WO2018117345A1 - 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도 - Google Patents

글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도 Download PDF

Info

Publication number
WO2018117345A1
WO2018117345A1 PCT/KR2017/004963 KR2017004963W WO2018117345A1 WO 2018117345 A1 WO2018117345 A1 WO 2018117345A1 KR 2017004963 W KR2017004963 W KR 2017004963W WO 2018117345 A1 WO2018117345 A1 WO 2018117345A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
gene
seq
thioredoxin
glutathione
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/004963
Other languages
English (en)
French (fr)
Inventor
노종렬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Original Assignee
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asan Foundation, University of Ulsan Foundation for Industry Cooperation filed Critical Asan Foundation
Publication of WO2018117345A1 publication Critical patent/WO2018117345A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06Tripeptides
    • A61K38/063Glutathione
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06Tripeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44Oxidoreductases (1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to a composition for the prevention or treatment of cancer comprising glutathione, thioredoxin and Nrf2 expression inhibitor or activity inhibitor as an active ingredient.
  • Head and neck cancer is a cancer that occurs in tissues such as the nasal cavity, pharynx, larynx, salivary glands, and thyroid gland, and the incidence of cancer worldwide accounts for about 5% of all malignancies.
  • cisplatin the most powerful anticancer agent currently used in clinical practice, is used for the treatment of head and neck cancer.
  • cisplatin is a very effective anticancer agent against various types of cancer, recent studies show that clinical problems are increasing due to its resistance. Therefore, various studies have recently been conducted to treat cancers that become cisplatin resistant using proteins and genes of cancer cells that induce resistance to cisplatin.
  • the increased amount of oxidative stress in cancer cells is due to an imbalance between the production and elimination of reactive oxygen species (Toyokuni S, Okamoto K, Yodoi J, Hiai H. FEBS Lett 358: 1-3, 1995). Sustained oxidative stress in cancer partially explains why cancer cells have different characteristics from those of normal cells susceptible to ROS damage (Trachootham D, Alexandre J, Huang P. Nat Rev Drug Discov). 8: 579-91, 2009). To process the oxidation-reduction state of imbalance, cancer cells corresponds to the free radical scavenging system, elevated high ROS amount (Diehn M et al, Nature 458 :. 780-3, 2009).
  • Intracellular antioxidant GSH has been reported to be synthesized by GCL (glutamate cysteine ligase) with GCLM (glutamate cysteine ligase modifier) and GCLC (glutamate cysteine ligase catalytic) subunits
  • GCL glutamate cysteine ligase
  • GCLM glutamate cysteine ligase modifier
  • GCLC glutamate cysteine ligase catalytic subunits
  • Nrf2 is a transcription factor that binds to the antioxidant responsive element (ARE) and plays an important role in regulating the homeostasis of redox within cells (Hayes JD, Dinkova-Kostova AT. Trends Biochem Sci 39: 199-218, 2014).
  • ARE antioxidant responsive element
  • cancer cells are known to compensate for stress caused by the amount of intracellular ROS by actively up-regulating various antioxidant pathways that contribute to tumor progression (DeNicola GM et al., Nature 475: 106-9, 2011; Diehn M et al. , Nature 458: 780-3, 2009; and Schafer ZT et al., Nature 461: 109-13, 2009).
  • An object of the present invention is a pharmaceutical for the prevention or treatment of cancer comprising glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) as an active ingredient. It is to provide a composition.
  • Another object of the present invention is the step of (a) treating the test substance to cancer cells; (b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed. It is to provide a screening method.
  • preventing or treating cancer comprising an activity inhibitor of a protein of at least one gene selected from the group consisting of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) It provides a pharmaceutical composition.
  • (ii) may be a pharmaceutical composition for the prevention or treatment of cancer comprising glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) inhibitory activity of the protein of the gene of the gene .
  • Nrf2 nuclear factor (erythroid-derived 2) -like 2) inhibitory activity of the protein of the gene of the gene .
  • glutathione Glutathione
  • Thioredoxin thioredoxin
  • Nrf2 nuclear factor (erythroid-derived 2) -like 2)
  • It may be a pharmaceutical composition for the prevention or treatment of cancer, including an inhibitor that simultaneously inhibits the expression of thioredoxin and Nrf2 gene and glutathione gene expression inhibitor.
  • it may be a pharmaceutical composition for the prevention or treatment of cancer, including an inhibitor that simultaneously inhibits expression of glutathione, thioredoxin and Nrf2 gene.
  • glutathione Glutathione
  • Thioredoxin thioredoxin
  • Nrf2 nuclear factor (erythroid-derived 2) -like 2)
  • It may be a pharmaceutical composition for preventing or treating cancer, including an inhibitor that simultaneously inhibits protein activity of thioredoxin and Nrf2 gene and a protein activity inhibitor of glutathione gene.
  • it may be a pharmaceutical composition for the prevention or treatment of cancer, including inhibitors that simultaneously inhibit the protein activity of glutathione, thioredoxin and Nrf2 gene.
  • the expression inhibitor is an antisense oligonucleotide, siRNA (small interfering RNA), shRNA (Short Hairpin RNA) complementary to the mRNA of the gene or genes that promote the expression of the gene
  • ribozyme ribozyme
  • siRNA that complementarily binds to the mRNA of the glutamate cysteine ligase modifier (GCLM) gene that promotes expression of the glutathione gene is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; Or a siRNA consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6, and complementarily binding to mRNA of the thioredoxin reductase 1 (TXNRD1) gene, which promotes expression of the thioredoxin gene, SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; Or consisting of the nucleotide sequence of SEQ ID NO: 11 and 12, siRNA that complementarily binds to the mRNA of the Nrf2 gene is SEQ ID NO: 13 and 14; SEQ ID NOs: 15 and 16; Or a siRNA consisting of the nucleotide sequences of SEQ ID NOs: 17 and 18, wherein the siRNA complementari
  • the activity inhibitor is a compound, peptides, peptide mimetics, substrate analogs, apps that specifically bind to at least one group consisting of glutathione, thioredoxin and Nrf2. It may be any one selected from the group consisting of a tamer and an antibody.
  • the compound specifically binding to glutathione is BSO (buthionine sulfoximine) or NOV-002 (glutathione disulfide mimetic), and the compound specifically binding to thioredoxin is oranopine (auranofin), nitrosourea, or curcumin, and the compound that specifically binds to Nrf2 is trigonelline, chrysin, apigenin, brusatol ), Ascorbic acid or as luteolin.
  • BSO buthionine sulfoximine
  • NOV-002 glutthione disulfide mimetic
  • the compound specifically binding to thioredoxin is oranopine (auranofin), nitrosourea, or curcumin
  • the compound that specifically binds to Nrf2 is trigonelline, chrysin, apigenin, brusatol ), Ascorbic acid or as luteolin.
  • the cancer may be cancer having cisplatin resistance.
  • the cancer is head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, scleroderma, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer , Thyroid cancer, parathyroid cancer, kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenomas may be selected from the group, but is not limited thereto.
  • the present invention comprises the steps of (a) treating the test substance to cancer cells; (b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed. It provides a screening method.
  • the cancer may be cancer having cisplatin resistance.
  • the cancer is head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, scleroderma, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer , Thyroid cancer, parathyroid cancer, kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenomas may be selected from the group, but is not limited thereto.
  • the present invention provides a method for preventing or preventing cancer comprising administering to a subject an inhibitor or activity inhibitor of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) Provide a method of treatment.
  • the method for preventing or treating cancer of the present invention comprises a therapeutically effective amount of the inhibitor or activity inhibitor of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) of the present invention.
  • Administering to the subject can be determined by the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, weight, general health, sex and diet, time of administration, It is desirable to apply differently depending on the route of administration and the rate of release of the composition, the duration of treatment, and the various factors and similar factors well known in the medical arts, including drugs used with or concurrent with the specific composition. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the above matters.
  • the subject is applicable to any mammal, and the mammal includes humans and primates, as well as domestic animals such as cattle, pigs, sheep, horses, dogs, and cats.
  • Expression inhibitors or activity inhibitors of glutathione, thioredoxin, and Nrf2 inhibit the growth of apoptosis resistant cancer cells and apoptosis By inducing it can be usefully used for the treatment of cancer.
  • FIG. 1 shows the results of apoptosis-inducing effects of cisplatin-sensitive and cisplatin-resistant HNC cells on GSH inhibitor BSO (buthionine sulfoximine) and Trx inhibitor oranopine.
  • A shows the apoptosis effect on oranopine according to the concentration
  • B shows the apoptosis effect by BSO according to the concentration
  • C shows the apoptosis effect by BSO and oranopine
  • D shows the apoptosis effect by BSO and oranopine in different types of HNC cell lines and SNU cell lines.
  • FIG. 2 shows the results of ROS (reactive oxygen species) induction and apoptosis effects in HNC cells against BSH (buthionine sulfoximine) and Trx inhibitor oranopine.
  • A is a result of comparing the survival rate of HNC cells after treatment with BOS, oranopine or BSO- oranopine
  • B is a result of observing HNC cells under a microscope
  • C is BOS, oranopine or The results of measurement of the amount of ROS in each group treated with BSO-oranopine and not treated with or without the antioxidant Trolox
  • D is the result of measuring the cell viability under the condition (C) (* P ⁇ 0.01; and ** P ⁇ 0.001).
  • FIG. 3 shows the suboptimal effect of apoptosis in resistant HNC cells by inhibition of GSH and Trx.
  • A GCLM or TXNRD1 It was a result of transducing the mRNA expression level of GSH or TrxR by transducing the siRNA of the gene, respectively
  • B is the analysis of the amount of GSH in the cell after introducing the siRNA of the gene
  • C is the siRNA of the gene Analysis of TrxR activity after introduction
  • D is GCLM And / or TXNRD1
  • the relative cell numbers were measured after treatment of BSO, oranopine, or BSO-oranopine in HN3 and HN3-cisR cells into which siRNAs were introduced.
  • E shows apoptosis by Annexin-V and PI staining. It is the result of analysis (* P ⁇ 0.05 in A to D; and * P ⁇ 0.01, ** P ⁇ 0.05, *** P ⁇ 0.01 in E).
  • Figure 4 shows the results for the induction of Nrf2-ARE activity by BSO and oranopine.
  • A is the result of confirming the protein expression levels of Nrf2, Keap1, NQO1 and HO-1 by Western blotting after treatment of HOS3 or HN3-cisR cells with BOS, oranopine or BSO-oranopine, and
  • B NFE2L2 And HMOX1 After transducing siRNAs for genes into HN3-cisR cells, it was confirmed whether mRNA of each gene was inhibited, and
  • C is NFE2L2.
  • siRNAs si GCLM , si TXNRD1 , respectively
  • si GCLM si GCLM , si TXNRD1 , respectively
  • NFE2L2 HMOX1 SiRNA for si siFE2L2
  • si HMOX1 si HMOX1
  • D is NFE2L2.
  • SiRNA (si NFE2L2 ) for the gene was transduced into HN3-cisR cells and then treated with BSO, oranopine, trolox or a combination thereof, and the results were shown for apoptosis effect through Annexin-V and PI staining (B , * P ⁇ 0.05 in C; and * P ⁇ 0.01 in D, ** P ⁇ 0.05, *** P ⁇ 0.05).
  • NFE2L2 And HMOX1 SiRNA for the gene was transduced into HN3-cisR cells and treated with BSO, oranopine or BSO-oranopine to measure cell viability, and
  • B shows BSO, oranopine or BSO- in HN3-cisR cells.
  • Cell counts were measured after further treatment of oranopine with trigonelin.
  • C shows the amount of ROS after treatment of trigonellin and / or Trolox with BSO, oranopine, or BSO-oranopine in HN3-cisR cells.
  • D is the result of measuring the apoptosis effect after Annexin V and PI staining (* P ⁇ 0.05, ** P ⁇ 0.01 in A; and * P ⁇ 0.05, ** in B to D) P ⁇ 0.01).
  • Figure 6 is a result showing the growth inhibitory effect after tumor transplantation by BSO, oranopine and trigonelin.
  • A is the result of measuring the volume of the tumor after treatment with BSO, oranopine, trigonelin or a combination thereof
  • B is the result of weighing the tumor
  • C is twice a week of each mouse Body weight is measured
  • D is the result of measuring TUNEL-positive killer cells (* P ⁇ 0.05, ** P ⁇ 0.01).
  • FIG. 7 shows that malignant tumor cells of resistance by blocking the GSH, Trx and Nrf2 antioxidant pathways can be targeted.
  • Figure 8 shows the results of confirming the protein expression amount for each gene after the introduction of siRNA for the GCLM , TXNRD1 and NFE2L2 gene in HN3-cisR cells.
  • Figure 9 shows the results confirmed by Western blotting the amount of Nrf2 expression in cisplatin-sensitive or resistant HNC cells.
  • FIG. 11 shows the results of the next cell apoptosis effect by GSH and Trx inhibition.
  • A shows the apoptosis effect by Annexin V and PI staining after treatment with BSO, oranopine, Trolox or a combination thereof in HN9 and HN9-cisR cells
  • B HN9 transduced with si NFE2L2 After treatment with BSO, oranopine, Trolox, or a combination thereof in -cisR cells, apoptosis was shown by Annexin V and PI staining.
  • FIG 13 shows mice with tumors treated with control (A) and BSO- oranopine-trigonelline (B).
  • Figure 14 is the result of comparing the degree of tissue damage in the control and the treatment of BSO- oranopine-trigonelin.
  • Figure 15 shows the results of microscopic analysis of TUNEL-positive killing cells in the tumor section of the control group (A) and BSO- oranopine-trigonelin (B) treated group.
  • FIG. 16 shows the results of measuring the amount of GSH in cells in tumor tissues of mice treated with BSO, oranopine, trigonelin, or a combination thereof (** P ⁇ 0.01).
  • 17 is a result of apoptosis induction effect in lung cancer cells (H460 and H2009) and ovarian cancer cells (OVCAR3 and SKOV3) after treatment with BSO, oranopine or a combination thereof.
  • FIG. 18 shows the results of apoptosis induction effects in lung cancer cells (H2009) and ovarian cancer cells (OVCAR3) after treatment with BSO, oranopine, trigonelin, or a combination thereof (* P ⁇ 0.05 and ** P ⁇ 0.01) .
  • “Pharmaceutical composition” refers to a mixture or solution containing one or more therapeutic agents administered to a subject, eg, a mammal or a human, to prevent or treat a particular disease or condition in which the mammal suffers. .
  • the "pharmaceutical composition” according to the present invention is an expression capable of inhibiting one or more of each or simultaneously a crowd consisting of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) It may be an inhibitor or an activity inhibitor.
  • expression inhibitors of glutathione, thioredoxin, and Nrf2 may bind to or simultaneously complement each of the gene mRNAs or express the genes. It may be any one selected from the group consisting of antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), and ribozyme that complement or bind to each of the mRNAs of the gene promoting the It is not limited thereto.
  • siRNA refers to a short double-chain RNA capable of inducing RNA interference (RNAi) through cleavage of a specific mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit the expression of a target gene, it is provided by an efficient method of knocking down or by gene therapy.
  • RNAi RNA interference
  • antisense oligonucleotide encompasses a nucleic acid-based molecule having a complementary sequence to a target miRNA, in particular, a miRNA leader sequence, thereby forming a duplex with the miRNA.
  • a target miRNA in particular, a miRNA leader sequence
  • antisense oligonucleotide can be described herein as a "complementary nucleic acid-based inhibitor.”
  • the term "complementary" means that the antisense oligonucleotides are sufficiently complementary to selectively hybridize to a miR-BART1-3p target under certain hybridization or annealing conditions, preferably physiological conditions, and are substantially complementary. It has the meaning encompassing both substantially complementary and perfectly complementary, and preferably means completely complementary.
  • the inhibitors of glutathione, thioredoxin and Nrf2 are specific to glutathione, thioredoxin and Nrf2. It may be any one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies that bind to, but is not limited thereto.
  • prevention means any action that inhibits or delays the onset of cancer by administration of a pharmaceutical composition according to the present invention.
  • treatment means any action in which symptoms caused by cancer are improved or beneficially altered by administration of the pharmaceutical composition according to the present invention.
  • the pharmaceutical composition according to the invention may comprise a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carriers are conventionally used in the preparation, and include, but are not limited to, saline solution, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and the like. If necessary, other conventional additives such as antioxidants and buffers may be further included.
  • diluents, dispersants, surfactants, binders, lubricants and the like may be additionally added to formulate injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
  • Suitable pharmaceutically acceptable carriers and formulations may be preferably formulated according to each component using the methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.
  • the pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, inhalant, or external skin preparation.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally (eg, applied intravenously, subcutaneously, skin, nasal, airways) according to the desired method, and the dosage is determined by the condition and weight of the patient, Depending on the extent, drug form, route of administration, and time, it may be appropriately selected by those skilled in the art.
  • composition according to the invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level means the type, severity, and activity of the patient's disease. , Drug sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts.
  • the composition according to the present invention may be administered as a separate therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the term "combination administration” is defined to include administering a selected therapeutic agent to a single patient, and is intended to include therapeutic regimens in which the agents do not necessarily have to be administered in the same route of administration or simultaneously.
  • the effective amount of the composition according to the present invention may vary depending on the age, sex, and weight of the patient, and generally 0.001 to 150 mg, preferably 0.01 to 100 mg daily or every other day or 1 day per kg of body weight It can be administered in 1 to 3 divided doses.
  • the dosage may be increased or decreased depending on the route of administration, the severity of obesity, sex, weight, age, etc., and the above dosage does not limit the scope of the present invention in any way.
  • the term “subject” or “patient” includes an animal that may or may suffer from cancer or any disorder directly or indirectly involved in cancer.
  • subjects include mammals such as humans, dogs, cattle, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals.
  • the subject is a human, eg, a human suffering from, at risk of suffering from cancer, or potentially suffering from cancer.
  • the term “synergy” or “synergy” refers to (a) an inhibitor of glutathione, (b) an inhibitor of thioredoxin, and (c) a nuclear factor (Nrf2). This means that the effects of using an inhibitor of (erythroid-derived 2) -like 2) alone are greater than the sum of them.
  • this synergy provides greater efficacy at the same or lower doses.
  • the determination of the expression level can be measured at the level of transcription (nucleic acid) product using methods known in the art.
  • mRNA can be quantified using probes by hybridization methods (eg, Northern blot analysis).
  • the probe may be labeled with appropriate materials such as dyes, fluorescent materials, and isotopes, and the expression level or function may be detected as the detection intensity of the hybridized label.
  • the transcription products of the genes of the invention can be quantified using primers by amplification-based detection methods (eg RT-PCR).
  • the primer can be prepared based on the available sequence information of the gene.
  • the expression level measurement in the present invention can be measured at the translation (protein) product level.
  • Methods for measuring the amount of the protein include all immunoassay methods known in the art, such as immunoprecipitation, western blot, immunohistochemical analysis using an antibody that specifically recognizes the protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification of an antibody eg, chimeric antibody, scFv, Fab, F (ab ') 2, Fv, etc.
  • any fragment or modification of an antibody eg, chimeric antibody, scFv, Fab, F (ab ') 2, Fv, etc.
  • HNC head and neck cancer
  • HN3-cisR, HN4-cisR and HN9-cisR three cisplatin-resistant HNC cell lines, which were developed from HN3, HN4 and HN9, respectively, through continuous exposure to increased cisplatin concentrations.
  • IC50 (half-maximal inhibitory concentrations) values of cisplatin (Sigma-Aldrich, St. Louis, MO, USA) were determined by cell viability assay, 2.2-3.5 ⁇ M in parental cells, and 25.5 ⁇ in cisplatin-resistant HNC cells. 38.9 ⁇ .
  • MTT assay was performed with tetrazolium compound MTT (3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; Sigma-Aldrich) for 4 hours and in solubilization buffer for 2 hours. After loading, the absorbance was measured at 570 nm using a SpectraMax M2 microplate reader (Molecular Devices, Sunnyvale, Calif., USA).
  • Trypan blue exclusion was performed with 0.4% trypan blue staining and counted using a hemocytometer.
  • Apoptosis assays were performed by annexin V (Sigma-Aldrich) and PI (propidium iodide; Sigma-Aldrich) staining, flow cytometry and Cell Quest Pro software (BD Biosciences, Franklin Lakes, NJ). , USA) were used to count annexin V or PI positive cells. All assays were performed three times and three times.
  • the CI (combination index) of drug action was calculated using the Chou-Talalay method, and "CI ⁇ 1" was considered synergistic (Chou TC. Cancer Res 70: 440-6, 2010).
  • Glutathione glutathion : GSH
  • ROS reactive oxygen species
  • Trx thioredoxin
  • GSH levels in lysates of HNC cells were measured using a GSH colorimetric detection kit (BioVision Inc., Milpitas, CA, USA) after exposure to other drugs for 24 hours.
  • ROS production of cells in supernatants of differently treated HNC cell lysates for 24 hours was measured using DCF-DA (2 ', 7'-dichlorofluorescein diacetate; Enzo Life Sciences, Farmingdale, NY, USA). ROS amounts were analyzed with a FACSCalibur flow cytometer equipped with CellQuest Pro (BD Biosciences). Trx activity was measured using Trx activity fluorescent assay kit (Cayman Chemical, Ann Arbor, MI, USA) after treatment with HNC cells for 24 hours.
  • Cisplatin-resistant HN3 for silencing GCLM glutthione; gene that promotes GSH expression
  • TXNRD1 thioreodoxin reductase-1, TrxR1
  • NFE2L2 Nrf2
  • HMOX1 heme oxygenase 1; HO1
  • siRNA-induced gene inhibition was performed by reverse blotting and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) from 1-2 ⁇ g total RNA for each sample using Western blotting and the SuperScript® III RT-PCR system (Thermo Fisher Scientific). was performed.
  • RT-qPCR reverse transcription-quantitative polymerase chain reaction
  • GSH Forward Reverse GCLM
  • IDTDNA Integrated DNA Technologies, Coralville, IA, USA
  • Tumor size and weight of each mouse were measured twice a week and volume was calculated as (length ⁇ width 2 ) / 2. Mice were sacrificed on day 25 and tumors were isolated and analyzed by GSH measurement of cells. Arbitrary fluorescence units (AFUs) were compared to tumors treated differently.
  • AFUs Arbitrary fluorescence units
  • BSOs acted as a photosensitizer for oranopine-induced apoptosis, and inhibition of the GSH and Trx system may induce cancer cell death.
  • GSH is reported to be synthesized by glutamate cysteine ligase (GCL) with a glutamate cysteine ligase modifier (GCLM) and a glutamate cysteine ligase catalytic (GCLC) subunit
  • GCL glutamate cysteine ligase
  • GCLM glutamate cysteine ligase modifier
  • GCLC glutamate cysteine ligase catalytic subunit
  • TXNRD1 is the gene of Thioredoxin reductase 1. Inhibition of the GCLM and TXNRD1 genes was found to induce GSH depletion and Trx activity inhibition, respectively (FIGS. 3A, 3B, 3C and 8).
  • the double-blocking system of GSH and Trx was found to be synergistic in inducing the death of cisplatin-folk and cisplatin-resistant cells (FIGS. 3D and 3E).
  • some of the cisplatin-resistant HNC cells, such as HN3-cisR and HN9-cisR showed suboptimal effects, ie, some cell death was not inhibited (FIGS. 1C and 9).
  • Nrf2 nuclear factor (erythroid-derived 2) -like 2) and NQO1 (NAD (P) H quinone oxidoreductase 1) and HO-1 (Heme oxygenase 1). It was found to increase the expression of the containing antioxidant response element (ARE) pathway (FIG. 4A), and accordingly, siRNAs of the GCLM gene for inhibiting GSH synthesis and the siRNAs of TXNRD1 gene for suppressing Trx synthesis (si GCLM , respectively ) .
  • si TXNRD1 ) transduced HNC cells were used for the inhibition of NFE2L2 (Nrf2) or HMOX1 gene, or the pharmaceutical inhibition of Nrf2 by trigonelin.
  • Nrf2 silencing prevented time-dependent increase in Nrf2 induced by BSO and oranopine (FIG. 11).
  • BSOs act as photosensitizers for other drugs, showed biocompatibility in tissues in vivo , and inhibited the growth of cisplatin-resistant cancer cells by blocking GSH, Trx and Nrf2 systems. .
  • Example 6 Apoptosis effect in lung and ovarian cancer
  • the present inventors confirmed whether or not induction of apoptosis in lung cancer and ovarian cancer cells by combined treatment of BSO and oranopine.
  • Lung cancer cells H460 and H2009
  • ovarian cancer cells OVCAR3 and SKOV3
  • death of lung cancer and ovarian cancer cells occurred more significantly in the group treated with the combination of BSO and oranopine than when only BSO alone was treated (CI ⁇ 1.0; FIG. 17).
  • the present inventors performed experiments to determine whether the treatment of the BSH, oranopine and trigonelin induce apoptosis in order to determine the triple blocking effect of the GSH, Trx and Nrf2 system in lung cancer and ovarian cancer cells.
  • Trig 100 ⁇ M
  • BSO + Oranopine + Trigonelin Trigonelin
  • the survival rate was confirmed.
  • the combination of BSO and oranopine had an effect of inducing apoptosis, and the combination of BSO, oranopine and tri

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물에 관한 것으로서, 구체적으로 시스플라틴에 저항성을 가진 암에 대하여 상기 유전자의 발현을 억제하거나 단백질의 발현 또는 활성을 억제시킴으로써 시스플라틴-저항성의 암의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

[규칙 제26조에 의한 보정 04.07.2017] 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도
본 발명은 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물에 관한 것이다.
두경부암(Head and neck cancer)은 비강, 인두, 후두, 침샘, 갑상선 등의 조직에서 발생하는 암으로써, 세계적으로 발생 빈도가 전 악성종양의 약 5% 정도를 차지하고 있다. 세계적으로 두경부암의 발생빈도는 점차로 증가하고 있으며, 이러한 두경부암의 치료를 위해서 현재 임상에서 사용되고 있는 항암제 중 가장 강력한 항암제인 시스플라틴이 사용되고 있다. 그러나, 시스플라틴이 다양한 종류의 암에 대하여 매우 효과적인 항암제이긴 하지만 최근 연구에 의하면 그 내성으로 인해 임상적인 문제가 증가하고 있다. 따라서, 최근에는 시스플라틴에 대한 내성을 유도하는 암세포의 단백질 및 유전자를 이용하여 시스플라틴에 내성을 갖게된 암을 치료하려는 연구가 다양하게 진행되고 있다.
암세포에서 산화적 스트레스의 증가된 양은 ROS(reactive oxygen species)의 생산 및 제거 사이의 불균형에 의한 것이다(Toyokuni S, Okamoto K, Yodoi J, Hiai H. FEBS Lett 358: 1-3, 1995). 암에서 지속적인 산화적 스트레스는 부분적으로 암세포가 ROS에 의한 손상에 쉬운 정상세포와 다른 특성을 가진 이유를 설명하고 있다(Trachootham D, Alexandre J, Huang P. Nat Rev Drug Discov 8: 579-91, 2009). 불균형의 산화환원 상태를 처리하기 위하여, 암세포는 높은 ROS 양을 상승된 자유라디칼 소기 시스템으로 대응한다(Diehn M et al., Nature 458: 780-3, 2009). 암세포에서의 산화환원 변화 및 증가된 항산화 방어 기작은 암세포에 방사선 및 화학요법의 치료에 무감각하게 한다는 보고가 있다(Hanahan D, Weinberg RA. Cell 144: 646-74, 2011). 증가된 ROS 양은 종양의 공격적인 표현형 및 좋지 않은 치료 결과로 연결된다(Kumar B, Koul S, Khandrika L, Meacham RB, Koul HK. Cancer Res 68: 1777-85, 2008). 따라서, 암세포에서 ROS 생성을 더욱 강화하거나 항산화 방어의 약화에 의한 산화환원 조절은 정상세포를 남기고 암세포를 선택적으로 제거하기 위한 유망한 전략이 될 수 있다(Schumacker PT. Cancer Cell 10: 175-6, 2006).
세포 내 항산화제인 GSH는 GCLM(glutamate cysteine ligase modifier) 및 GCLC(glutamate cysteine ligase catalytic) 서브유닛을 가지는 GCL(glutamate cysteine ligase)에 의해 합성된다고 보고되어 있고(Liu Y, Hyde AS, Simpson MA, Barycki JJ. Adv Cancer Res 122: 69-101, 2014), Trx 시스템은 티오레독신 환원효소(thioredoxin reductase)의 존재 하에 세포내 산화환원상태가 감소된 상태로 유지하는데 필수적이라고 보고되었다(Mahmood DF, Abderrazak A, El Hadri K, Simmet T, Rouis M. Antioxid Redox Signal 19: 1266-303, 2013). Nrf2는 ARE(antioxidant responsive element)에 결합하는 전사인자로서 세포 내의 산화환원의 항상성을 조절하는데 중요한 역할을 한다(Hayes JD, Dinkova-Kostova AT. Trends Biochem Sci 39: 199-218, 2014). 그런데, 암세포는 종양 진행에 기여하는 다양한 항산화 경로를 활발히 상향 조절함으로써 세포 내 ROS 양에 의한 스트레스를 보완하는 것으로 알려져 있다(DeNicola GM et al., Nature 475: 106-9, 2011; Diehn M et al., Nature 458: 780-3, 2009; 및 Schafer ZT et al., Nature 461: 109-13, 2009).
본 발명의 목적은 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 (a) 암세포에 시험물질을 처리하는 단계; (b) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 mRNA 발현량 또는 단백질의 발현량이 억제되는 것을 확인하는 단계를 포함하는 암 치료제의 스크리닝 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은
(i) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)로 이루어진 군으로부터 선택된 하나 이상의 유전자의 발현 억제제; 또는
(ii) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)로 이루어진 군으로부터 선택된 하나 이상의 유전자의 단백질의 활성 억제제를 포함하는 암의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 일 실시예로서,
(i) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 유전자 발현 억제제; 또는
(ii) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 유전자의 단백질의 활성 억제제를 포함하는 암의 예방 또는 치료용 약학 조성물일 수 있다.
본 발명의 일 실시예로서, 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 유전자 발현을 각각 억제하는 억제제의 조합일 수 있다.
본 발명의 일 실시예로서,
1)글루타치온 및 티오레독신 유전자의 발현을 동시에 억제하는 억제제 및 Nrf2 유전자 발현 억제제;
2)글루타치온 및 Nrf2 유전자의 발현을 동시에 억제하는 억제제 및 티오레독신 유전자 발현 억제제; 또는
3)티오레독신 및 Nrf2 유전자의 발현을 동시에 억제하는 억제제 및 글루타치온 유전자 발현 억제제를 포함하는 암의 예방 또는 치료용 약학적 조성물일 수 있다.
또한, 본 발명의 일실시예로서, 글루타치온, 티오레독신 및 Nrf2 유전자의 발현을 동시에 억제하는 억제제를 포함하는 암의 예방 또는 치료용 약학적 조성물일 수 있다.
본 발명의 일 실시예로서,
본 발명의 일 실시예로서, 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)유전자의 단백질 활성을 각각 억제하는 억제제의 조합일 수 있다.
1)글루타치온 및 티오레독신 유전자의 단백질 활성을 동시에 억제하는 억제제 및 Nrf2 유전자의 단백질 활성 억제제;
2)글루타치온 및 Nrf2 유전자의 단백질 활성을 동시에 억제하는 억제제 및 티오레독신 유전자의 단백질의 활성 억제제; 또는
3)티오레독신 및 Nrf2 유전자의 단백질 활성을 동시에 억제하는 억제제 및 글루타치온 유전자의 단백질 활성 억제제를 포함하는 암의 예방 또는 치료용 약학적 조성물일 수 있다.
또한, 본 발명의 일실시예로서, 글루타치온, 티오레독신 및 Nrf2 유전자의 단백질 활성을 동시에 억제하는 억제제를 포함하는 암의 예방 또는 치료용 약학적 조성물일 수 있다.
본 발명의 일 실시예에 있어서, 상기 발현 억제제는 상기 유전자 또는 상기 유전자의 발현을 촉진하는 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA((small interfering RNA), shRNA(Short Hairpin RNA) 및 리보자임(ribozyme)으로 이루어진 그룹에서 선택되는 어느 하나인 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 글루타치온 유전자의 발현을 촉진하는 GCLM(glutamate cysteine ligase modifier) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 1 및 2; 서열번호 3 및 4; 또는 서열번호 5 및 6의 염기서열로 이루어진 것이고, 상기 티오레독신 유전자의 발현을 촉진하는 TXNRD1(thioredoxin reductase 1) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 7 및 8; 서열번호 9 및 10; 또는 서열번호 11 및 12의 염기서열로 이루어진 것이며, 상기 Nrf2 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 13 및 14; 서열번호 15 및 16; 또는 서열번호 17 및 18의 염기서열로 이루어진 것이고, 상기 Nrf2 유전자의 발현을 촉진하는 HO1(heme oxygenase 1) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 19 및 20; 서열번호 21 및 22; 또는 서열번호 23 및 24의 염기서열로 이루어진 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 활성 억제제는 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2로 구성된 군중 1종 이상에 특이적으로 결합하는 화합물, 펩타이드, 펩타이드모방체, 기질유사체, 앱타머 및 항체로 이루어진 그룹에서 선택되는 어느 하나인 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 글루타치온에 특이적으로 결합하는 화합물은 BSO(buthionine sulfoximine) 또는 NOV-002(glutathione disulfide mimetic)인 것이고, 상기 티오레독신에 특이적으로 결합하는 화합물은 오라노핀(auranofin), 니트로소 요소(nitrosourea) 또는 커큐민(curcumin)인 것이며, 상기 Nrf2에 특이적으로 결합하는 화합물은 트리고넬린(trigonelline), 크리신(chrysin), 아피제닌(apigenin), 브루사톨(brusatol), 아스코르브산(ascorbic acid) 또는 루테올린(luteolin)인 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 암은 시스플라틴에 저항성을 가지는 암인 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 암은 두경부암, 폐암, 위암, 간암, 대장암, 소장암, 췌장암, 뇌암, 뼈암, 흑색종, 유방암, 경화성선증, 난소암, 자궁암, 자궁경부암, 식도암, 갑상선암, 부갑상선암, 신장암, 육종, 전립선암, 요도암, 방광암, 혈액암, 림프종, 건선 또는 섬유선종으로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 (a) 암세포에 시험물질을 처리하는 단계; (b) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 mRNA 발현량 또는 단백질의 발현량이 억제되는 것을 확인하는 단계를 포함하는 암 치료제의 스크리닝 방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 암은 시스플라틴에 저항성을 가지는 암인 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 암은 두경부암, 폐암, 위암, 간암, 대장암, 소장암, 췌장암, 뇌암, 뼈암, 흑색종, 유방암, 경화성선증, 난소암, 자궁암, 자궁경부암, 식도암, 갑상선암, 부갑상선암, 신장암, 육종, 전립선암, 요도암, 방광암, 혈액암, 림프종, 건선 또는 섬유선종으로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 발현 억제제 또는 활성 억제제를 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공한다.
본 발명의 암의 예방 또는 치료 방법은 본 발명의 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 발현 억제제 또는 활성 억제제를 치료적 유효량으로 개체에 투여하는 것을 포함한다. 특정 개체에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 개체의 연령, 체중, 일반건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
상기 개체는 임의의 포유동물에 적용가능하며, 상기 포유동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
본 발명에 따른 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 발현 억제제 또는 활성 억제제는 시스플라틴에 저항성을 가진 암세포의 성장을 억제하고 세포사멸을 유도함으로써 암의 치료에 유용하게 사용될 수 있다.
도 1은 GSH 억제제인 BSO(buthionine sulfoximine) 및 Trx 억제제인 오라노핀에 대한 시스플라틴-민감성 및 시스플라틴-저항성 HNC 세포의 사멸 유도 효과에 관한 결과이다. (A)는 농도에 따른 오라노핀에 대한 세포사멸 효과를 나타낸 것이고, (B)는 농도에 따른 BSO에 의한 세포사멸 효과를 나타낸 것이며, (C)는 BSO 및 오라노핀에 의한 세포사멸 효과를 나타낸 것이고, (D)는 다른 종류의 HNC 세포주 및 SNU 세포주에서의 BSO 및 오라노핀에 의한 세포사멸 효과를 나타낸 것이다.
도 2는 GSH 억제제인 BSO(buthionine sulfoximine) 및 Trx 억제제인 오라노핀에 대한 HNC 세포에서의 ROS(reactive oxygen species) 유도 및 세포사멸 효과에 대한 결과이다. (A)는 BOS, 오라노핀 또는 BSO-오라노핀을 처리한 후 HNC 세포의 생존율을 비교한 결과이고, (B)는 HNC 세포를 현미경으로 관찰한 결과이며, (C)는 BOS, 오라노핀 또는 BSO-오라노핀을 처리하고, 항산화제인 Trolox의 처리 또는 처리하지 않은 각 군에서 ROS의 양을 측정한 결과이고, (D)는 상기 (C)의 조건에서의 세포생존율을 측정한 결과이다 (* P < 0.01; 및 ** P < 0.001).
도 3은 GSH 및 Trx의 억제에 의하여 저항성의 HNC 세포에서의 세포사멸의 차선 효과를 나타내는 결과이다. (A)는 GCLM 또는 TXNRD1 유전자의 siRNA를 형질도입하여 각각 GSH 또는 TrxR의 mRNA 발현량을 확인한 결과이고, (B)는 상기 유전자의 siRNA를 도입시킨 후 세포 내 GSH 양을 분석한 것이며, (C)는 상기 유전자의 siRNA를 도입시킨 후 TrxR 활성을 분석한 것이고, (D)는 GCLM 및/또는 TXNRD1 유전자의 siRNA를 도입한 HN3 및 HN3-cisR 세포에 BSO, 오라노핀 또는 BSO-오라노핀을 처리한 후 상대적인 세포 수를 측정한 결과이고, (E)는 아넥신-V 및 PI 염색에 의하여 세포사멸을 분석한 결과이다(A 내지 D에서 * P < 0.05; 및 E에서 * P < 0.01, ** P < 0.05, *** P < 0.01).
도 4는 BSO 및 오라노핀에 의한 Nrf2-ARE 활성 유도에 대한 결과를 나타낸 것이다. (A)는 HN3 및 HN3-cisR 세포에 BOS, 오라노핀 또는 BSO-오라노핀을 처리한 후 Nrf2, Keap1, NQO1 및 HO-1의 단백질 발현량을 웨스턴 블럿팅으로 확인한 결과이고, (B)는 NFE2L2 HMOX1 유전자에 대한 siRNA를 HN3-cisR 세포에 형질도입시킨 후 각 유전자의 mRNA가 억제되는지를 확인한 결과이고, (C)는 NFE2L2 및/또는 HMOX1 유전자에 대한 siRNA(각각 siGCLM, siTXNRD1 )를 HN3-cisR 세포에 형질도입시킨 후 NFE2L2, HMOX1 에 대한 siRNA(각각 siNFE2L2 , siHMOX1) 또는 트리고넬린을 처리한 후 세포생존율을 측정한 결과이며, (D)는 NFE2L2 유전자에 대한 siRNA(siNFE2L2)를 HN3-cisR 세포에 형질도입시킨 후 BSO, 오라노핀, trolox 또는 이의 조합을 처리하고 아넥신-V 및 PI 염색을 통해 세포사멸 효과에 대한 결과를 나타낸 것이다(B, C에서 * P < 0.05; 및 D에서 * P < 0.01, ** P < 0.05, *** P < 0.05).
도 5는 Nrf2 억제에 의한 BSO 및 오라노핀의 암세포사멸에 대한 향상 효과를 나타낸 결과이다. (A)는 NFE2L2 HMOX1 유전자에 대한 siRNA를 HN3-cisR 세포에 형질도입시킨 후 BSO, 오라노핀 또는 BSO-오라노핀을 처리하여 세포생존율을 측정한 결과이고, (B)는 HN3-cisR 세포에서 BSO, 오라노핀 또는 BSO-오라노핀에 트리고넬린을 추가 처리한 후 세포수를 측정한 결과이며, (C)는 HN3-cisR 세포에서 BSO, 오라노핀 또는 BSO-오라노핀에 트리고넬린 및/또는 Trolox를 처리한 후 ROS 양을 측정한 결과이고, (D)는 아넥신 V 및 PI 염색 후 세포사멸 효과를 측정한 결과이다(A에서 * P < 0.05, ** P < 0.01; 및 B 내지 D에서 * P < 0.05, ** P < 0.01).
도 6은 BSO, 오라노핀 및 트리고넬린에 의한 종양 이식 후 성장 억제 효과를 나타낸 결과이다. (A)는 BSO, 오라노핀, 트리고넬린 또는 이들의 조합을 처리한 후 종양의 부피를 측정한 결과이고, (B)는 종양의 무게를 측정한 결과이며, (C)는 일주일 두번 각 마우스의 몸무게를 측정한 결과이고, (D)는 TUNEL-양성 사멸세포를 측정한 결과이다(* P < 0.05, ** P < 0.01).
도 7은 GSH, Trx 및 Nrf2 항산화 경로의 차단에 의한 저항성의 악성 종양세포를 타겟팅할 수 있다는 것을 표시한 것이다.
도 8은 HN3-cisR 세포에서 GCLM, TXNRD1NFE2L2 유전자에 대한 siRNA를 도입시킨 후 각 유전자에 대한 단백질 발현량을 확인한 결과이다.
도 9는 시스플라틴-민감성 또는 저항성 HNC 세포에서 Nrf2 발현량을 웨스턴 블럿팅으로 확인한 결과이다.
도 10은 siNFE2L2으로 형질도입된 HN3-cisR 세포에서 Nrf2 및 HO-1의 단백질 발현량을 웨스턴 블럿팅으로 확인한 결과이다.
도 11은 GSH 및 Trx 억제에 의한 차선의 세포사멸 효과를 나타낸 결과이다. (A)는 HN9 및 HN9-cisR 세포에서 BSO, 오라노핀, Trolox 또는 이의 조합을 처리한 후 아넥신 V 및 PI 염색에 의한 세포사멸 효과를 나타낸 것이고, (B)는 siNFE2L2으로 형질도입된 HN9-cisR 세포에서 BSO, 오라노핀, Trolox 또는 이의 조합을 처리한 후 아넥신 V 및 PI 염색에 의한 세포사멸 효과를 나타낸 것이다.
도 12는 정상 구강 각질세포(keratinocytes: A) 및 섬유아세포(fibroblast: B)에 BSO, 오라노핀 및 트리고넬린을 노출시킨 후 세포생존율을 측정한 결과이다.
도 13은 대조군(A)과 BSO-오라노핀-트리고넬린(B)을 처리한 종양을 가진 마우스를 나타낸 것이다.
도 14는 대조군과 BSO-오라노핀-트리고넬린의 처리에서 조직 손상 정도를 비교한 결과이다.
도 15는 대조군(A)과 BSO-오라노핀-트리고넬린(B)을 처리한 군의 종양 섹션에서 TUNEL-양성 사멸 세포를 현미경으로 분석한 결과이다.
도 16은 BSO, 오라노핀, 트리고넬린 또는 이의 조합으로 처리된 마우스의 종양 조직에서 세포 내 GSH 양을 측정한 결과이다(** P <0.01).
도 17은 BSO, 오라노핀 또는 이의 조합을 처리한 후 폐암세포(H460 및 H2009) 및 난소암세포(OVCAR3 및 SKOV3)에서의 세포사멸 유도 효과에 관한 결과이다.
도 18은 BSO, 오라노핀, 트리고넬린 또는 이의 조합을 처리한 후 폐암세포(H2009) 및 난소암세포(OVCAR3)에서의 세포사멸 유도 효과에 관한 결과이다(* P <0.05 및 ** P <0.01).
본 발명에 따른 "약학 조성물"은 포유동물이 걸린 특정한 질환 또는 병태를 예방 또는 치료하기 위해, 대상체, 예를 들어, 포유동물 또는 인간에게 투여되는 하나 이상의 치료제를 함유하는 혼합물 또는 용액을 지칭하는 것이다.
본 발명에 따른 "약학 조성물"은 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)로 구성된 군중 어느 하나 이상을 각각 또는 동시에 억제할 수 있는 발현 억제제 또는 활성 억제제일 수 있다.
본 발명에서, 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 발현 억제제는 상기 유전자 mRNA 각각에 또는 동시에 상보적으로 결합하거나 상기 유전자의 발현을 촉진하는 유전자의 mRNA 각각에 또는 동시에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA((small interfering RNA), shRNA(Short Hairpin RNA) 및 리보자임(ribozyme)으로 이루어진 그룹에서 선택되는 어느 하나인 것일 수 있고, 이에 제한되는 것은 아니다.
본 발명의 용어, "siRNA"는 특정 mRNA의 절단(cleavage)을 통하여 RNAi(RNA interference) 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미한다. 타겟 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다. siRNA는 타겟 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knock-down) 방법, 또는 유전자치료(gene therapy)의 방법으로 제공된다.
본 발명의 용어, "안티센스 올리고뉴클레오타이드"는 타겟으로 하는 miRNA, 특히, miRNA의 선도서열에 대한 상보적인 서열을 가지고 있어 miRNA와 이합체(duplex)를 형성할 수 있는 핵산-기반 분자를 포괄한다. 따라서, 본 명세서에서 용어 "안티센스 올리고뉴클레오타이드"는 "상보적 핵산-기반 억제제"로 기재될 수 있다.
본 발명의 용어, "상보적"은 소정의 혼성화 또는 어닐링 조건, 바람직하게는 생리학적 조건 하에서 안티센스 올리고뉴클레오타이드가 miR-BART1-3p 타겟에 선택적으로 혼성화 할 정도로 충분히 상보적인 것을 의미하며, 실질적으로 상보적(substantially complementary) 및 완전히 상보적 (perfectly complementary)인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 상보적인 것을 의미한다.
본 발명에서, 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 활성 억제제는 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2에 특이적으로 결합하는 화합물, 펩타이드, 펩타이드모방체, 기질유사체, 앱타머 및 항체로 이루어진 그룹에서 선택되는 어느 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어, "예방"이란 본 발명에 따른 약학적 조성물의 투여에 의해 암을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명의 용어, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 암에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에 따른 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 제제시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제, 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제, 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌 (Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학 조성물은 제형에 특별한 제한은 없으나 주사제, 흡입제, 피부 외용제 등으로 제제화할 수 있다.
본 발명의 약학 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 피부, 비강, 기도에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명에 따른 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 따른 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 용어, "조합 투여"는 단일 환자에게 선택된 치료제를 투여하는 것을 포함하는 것으로 정의되며, 작용제가 반드시 동일한 투여 경로 또는 동시에 투여되어야 할 필요는 없는 치료 요법을 포함시키고자 하는 것이다.
구체적으로, 본 발명에 따른 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 용어, "대상체" 또는 "환자"는 암, 또는 직접 또는 간접적으로 암에 관여하는 임의의 장애를 앓을 수 있거나 앓고 있는 동물을 포함한다. 대상체의 예는 포유동물, 예를 들어 인간, 개, 소, 말, 돼지, 양, 염소, 고양이, 마우스, 토끼, 래트, 및 트랜스제닉 비-인간 동물을 포함한다. 바람직한 실시양태에서, 대상체는 인간, 예를 들어 암을 앓고 있거나, 암을 앓을 위험이 있거나, 잠재적으로 암을 앓을 가능성이 있는 인간이다.
본 발명의 용어, "시너지 효과" 또는 "시너지 작용"은 본 발명에 포함되는 (a) 글루타치온(Glutathione)의 억제제, (b) 티오레독신(Thioredoxin)의 억제제, 및 (c) Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 억제제를 단독으로 사용하여 생기는 효과들을 합한 것보다 더 크다는 것을 의미한다. 유리하게는, 이러한 시너지 작용은 동일 또는 낮은 투여량으로 보다 큰 효능을 제공한다.
또한, 본 발명의 "암 치료제 스크리닝 방법"은
(a) 암세포에 시험물질을 처리하는 단계;
(b)글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 mRNA 발현량 또는 단백질의 발현량이 억제되는 것을 확인하는 단계를 포함하는데, 상기 발현수준이 시험물질을 처리하지 않은 대조군에 비해 감소하는 경우, 암치료제로 결정할 수 있다.
상기 발현수준의 측정은 당업계에 알려진 방법을 사용하여 전사(핵산) 산물 수준에서 측정될 슈 있다. 예를 들면, mRNA는 혼성화 방법 (예를 들면, 노던 블랏 분석(Northern hybridization))에 의한 프로브(probe)을 사용하여 정량될 수 있다.
상기 프로브는 염료, 형광물질 및 동위원소 등의 적절한 물질로 표지될 수 있고, 발현수준 또는 기능은 상기 혼성화된 표지의 검출세기로서 검출될 수 있다.
또한, 본 발명의 유전자의 전사산물은 증폭 기반의 검출 방법(예를 들면, RT-PCR)에 의한 프라이머를 사용하여 정량될 수 있다. 상기 프라이머는 상기 유전자의 이용가능한 서열 정보를 바탕으로 제조될 수 있다.
또한, 본 발명에서 발현 수준 측정은 번역(단백질) 산물 수준에서 측정될 수 있다. 상기 단백질의 양의 측정 방법은 상기 단백질을 특이적으로 인식하는 항체를 사용하는 면역침전, 웨스턴 블롯, 면역조직화학 분석 등의 당업계에 알려진 모든 면역분석 방법을 포함한다. 상기 항체는 단일클론 또는 다중 클론일 수 있다. 또한, 표적 단백질에 대한 결합능력을 보유하는 한 항체의 임의의 단편 또는 변형(예를 들면, 키메릭 항체, scFv, Fab, F(ab')2, Fv, 등) 등이 모두 사용될 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 재료 및 방법
1.1. 세포주
HNC(head and neck cancer) 세포주(Acta Otolaryngol (Stockh) 1997; 117: 775-784)는 아산병원 두경부암연구소에서 제공받아 HN2 내지 HN10로 확립시켰고, SNU 세포주는 Korea Cell Line Bank (Seoul, Republic of Korea)에서 구입하였으며, STR(short tandem repeat)-기반의 DNA 핑거프린팅 및 Multiplex PCR로 증명하였다. 세포는 10% FBS(fetal bovine serum)이 포함된 MEM(Eagle's minimum essential medium) 또는 RPMI 1640(Roswell Park Memorial Institute medium) 배지를 사용하여 5% CO2, 37℃ 배양기에서 배양하였다. 정상 구강 각질세포(normal oral keratinocytes)는 구강 수술이 진행된 환자로부터 획득되었고, in vitro 어세이에 사용하였다. 또한, 세 가지 시스플라틴-저항성의 HNC 세포주(HN3-cisR, HN4-cisR 및 HN9-cisR)를 사용하였고, 상기 세 가지 세포주는 증가된 시스플라틴 농도에 계속적인 노출을 통해 각각 HN3, HN4 및 HN9으로부터 개발된 것이다(Nakamura M et al., Oncol Rep 14: 1281-6, 2005). 시스플라틴(Sigma-Aldrich, St. Louis, MO, USA)의 IC50(half-maximal inhibitory concentrations) 값은 세포생존율 어세이를 통해 결정하였으며, 모세포에서는 2.2~3.5 μM이고, 시스플라틴-저항성 HNC 세포는 25.5~38.9 μM으로 나타났다.
1.2. 세포생존율 어세이
BSO(buthionine sulfoximine; Sigma-Aldrich), 오라노핀(auranofin; Sigma-Aldrich) 또는 트리고넬린(trigonelline; Sigma-Aldrich)에 노출시킨 후의 세포생존율은 MTT 및 trypan blue exclusion으로 측정하였다. MTT 어세이는 4시간 동안 tetrazolium compound MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide; Sigma-Aldrich)로 수행하였고, 2시간 동안 solubilization buffer에 넣은 후, SpectraMax M2 microplate reader (Molecular Devices, Sunnyvale, CA, USA)를 사용하여 570 nm에서 흡광도를 측정하였다. trypan blue exclusion은 0.4% trypan blue staining으로 수행하였고, hemocytometer를 사용하여 카운팅하였다. 세포사멸 어세이는 아넥신 V(annexin V; Sigma-Aldrich) 및 PI(propidium iodide; Sigma-Aldrich) 염색으로 수행하였고, 유세포분석기(flow cytometry) 및 Cell Quest Pro software (BD Biosciences, Franklin Lakes, NJ, USA)를 사용하여 아넥신 V 또는 PI 양성세포를 카운팅하였다. 모든 어세이는 3회 3번 반복하여 수행하였다. 약물 작용의 CI(combination index)는 Chou-Talalay method을 사용하여 계산하였고, "CI < 1" 은 시너지 작용으로 간주하였다(Chou TC. Cancer Res 70: 440-6, 2010).
1.3. 글루타치온 ( glutathion : GSH ) 합성, ROS (reactive oxygen species) 생산 및 Trx(thioredoxin: 티오레독신) 활성 측정
HNC 세포의 용해물에서의 GSH 양은 24시간 동안 다른 약물에 노출시킨 후 GSH colorimetric detection kit (BioVision Inc., Milpitas, CA, USA)을 사용하여 측정하였다. 24시간 동안 다르게 처리된 HNC 세포 용해물의 상층액에서의 세포의 ROS 생성은 DCF-DA(2',7'-dichlorofluorescein diacetate; Enzo Life Sciences, Farmingdale, NY, USA)를 사용하여 측정하였다. ROS 양은 FACSCalibur flow cytometer equipped with CellQuest Pro (BD Biosciences)으로 분석하였다. Trx 활성은 HNC 세포에 24시간 동안 다른 약물을 처리한 후 Trx activity fluorescent assay kit (Cayman Chemical, Ann Arbor, MI, USA)를 사용하여 측정하였다.
1.4. siRNA 형질도입
GCLM(glutathione; GSH의 발현을 촉진하는 유전자), TXNRD1(thioreodoxin reductase-1, TrxR1), NFE2L2(Nrf2) 및 HMOX1(heme oxygenase 1; HO1) 유전자를 억제(silencing)하기 위하여, 시스플라틴-저항성의 HN3-cisR 세포 및 HN9-cisR 세포를 접종하고, 상기 세포는 24시간 뒤 인간 유전자를 타겟하는 10 nmol/L의 siRNA(small interfering RNA) 또는 scrambled control siRNA (Integrated DNA Technologies, Coralville, IA, USA)로 형질도입하였다. siRNA-유도의 유전자 억제는 웨스턴 블럿팅 및 SuperScript® III RT-PCR system (Thermo Fisher Scientific)을 사용하여 각 샘플에 대한 1~2μg의 총 RNA로부터 RT-qPCR(reverse transcription-quantitative polymerase chain reaction)을 수행하였다.
siRNA 종류 회사 번호 Forward Reverse
GCLM(GSH) IDTDNA 1 5'-GCAAUAGAGCUAGGAAUUAAGAATC-3' (서열번호 1) 5'-GAUUCUUAAUUCCUAGCUCUAUUGCCC-3' (서열번호 2)
2 5'-ACCAAAUAGUAACCAAGUUAAUCTT-3' (서열번호 3) 5'- AAGAUUAACUUGGUUACUAUUUGGUUU-3'(서열번호 4)
3 5'-CUAAACAAUUUGACAUACAGCUGT-3' (서열번호 5) 5'-ACAGCUGUAUGUCAAAUUGUUUAGCAA-3' (서열번호 6)
TXNRD1 (TrxR1) IDTDNA 1 5'-GGUGAUAAACUUGUAGUAGUUGACT -3' (서열번호 7) 5'- AGUCAACUACUACAAGUUUAUCACCUG-3' (서열번호 8)
2 5'-AGCCACCAUUAAUGAAUUAGUCUAA-3' (서열번호 9) 5'-UUAGACUAAUUCAUUAAUGGUGGCUUC -3' (서열번호 10)
3 5'-CAGAGUGUGAAGUCAAAUGCAUGCC-3' (서열번호 11) 5'-GGCAUGCAUUUGACUUCACACUCUGAA -3' (서열번호 12)
NFE2L2(Nrf2) IDTDNA 1 5'-GUUACAACUAGAUGAAGAGACAGGT-3' (서열번호 13) 5'-ACCUGUCUCUUCAUCUAGUUGUAACUG-3' (서열번호 14)
2 5'-GCAAGAUUUAGAUCAUUUGAAAGAT-3' (서열번호 15) 5'- AUCUUUCAAAUGAUCUAAAUCUUGCUC -3' (서열번호 16)
3 5'- UCAACGAAAUGAUGUCCAAAGAGCA -3' (서열번호 17) 5'- UGCUCUUUGGACAUCAUUUCGUUGAAG -3' (서열번호 18)
HO1 IDTDNA 1 5'- AACAUUGUCUGAUAGUAGCUUGAAA -3' (서열번호 19) 5'- UUUCAAGCUACUAUCAGACAAUGUUGU -3' (서열번호 20)
2 5'- UAAACAACAUUGUCUGAUAGUAGCT -3' (서열번호 21) 5'- AGCUACUAUCAGACAAUGUUGUUUAUU -3' (서열번호 22)
3 5'- GGUCCUUACACUCAGCUUUCUGGTG -3' (서열번호 23) 5'- CACCAGAAAGCUGAGUGUAAGGACCCA -3' (서열번호 24)
* IDTDNA = Integrated DNA Technologies, Coralville, IA, USA
1.5. 웨스턴 블럿팅
세포는 70% confluence로 배양하였으며, 표시된 약물 또는 조건화된 배지로 처리하였다. 세포는 RIPA(radioimmunoprecipitation assay) lysis buffer (Thermo Fisher Scientific)를 사용하여 4℃에서 용해하였다. 총 50μg의 단백질이 10 ~ 20% 젤의 SDS-PAGE에서 확인하였고, 니트로셀룰로오스 또는 PVDF(polyvinylidene difluoride) 막으로 옮겼으며, 1차 및 2차 항체로 표지하였다. 1차 항체는 다음과 같다: Nrf2, Keap1, NQO1 및 HO-1 (Abcam, Cambridge, UK). β-actin (Sigma-Aldrich)은 대조군으로 사용하였다. 모든 항체는 1:500 내지 1:5000 에서 희석하였다.
1.6. In vivo 마우스 이종이식(xenograft) 모델
모든 동물 연구 과정은 본 기관의 실험동물운영위원회(Institutional Animal Care and Use Committee)의 승인에 따라 수행하였다. 6주령의 athymic BALB/c 수컷 누드마우스(nu/nu)는 중앙실험동물(주) (Seoul, Republic of Korea)에서 구입하엿다. HN3-cisR 세포는 누드마우스의 옆쪽에 피하주사로 주입하였다. 종양이식으로부터 총 결절이 확인된 날부터, 마우스는 6개의 다른 처리군으로 나누었다: 비히클(vehicle); BSO(450 mg/kg로 매일 복강내 주사); 오라노핀(2 mg/kg로 매일 복강내 주사); 트리고넬린(50 mg/kg로 매일 경구투여); BSO 및 오라노핀 auranofin; 또는 BSO, 오라노핀 및 트리고넬린의 조합 (n = 10 each). 각 마우스의 종양 크기와 몸무게는 1주일에 두번 측정하였고, 부피는 (길이 × 넓이2)/2 로 계산되었다. 마우스는 25일에 희생하였고, 종양을 분리하고 세포의 GSH 측정에 의해 분석하였다. AFU(arbitrary fluorescence units)는 다르게 처리된 종양과 비교하였다. 종양에서 사멸된 세포는 in situ TUNEL(terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling) 어세이를 사용하여 분석하였다. Two-tailed Mann-Whitney U 테스트는 처리군 사이의 통계적 차이를 비교하는데 사용하였다.
실시예 2. BSO 및 오라노핀의 시너지 작용에 의한 HNC 세포사멸 유도 효과
티오레독신에 특이적으로 결합하는 화합물 중 하나인 오라노핀을 시스플라틴-민감성 또는 시스플라틴-저항성 HNC 세포에 처리하면, 농도-의존적으로 시스플라틴-민감성 및 시스플라틴-저항성 HNC 세포의 생존을 감소시킨다는 결과를 확인하였다(도 1A), 반면, 글루타치온에 특이적으로 결합하는 화합물 중 하나인 BSO(50 mM 까지)를 세포에 처리한 경우에는 높은 농도에도 불구하고 대조군의 50% 이상까지 세포생존율 억제를 유도하지 못했다(도 1B).
그러나, 낮은 농도의 BSO(5~25 μM)와 오라노핀(0.1~0.5 μM)은 시너지 작용으로 HNC 세포의 효과적인 사멸을 유도할 수 있음을 확인하였다(CI <1.0; 도 1C 및 1D). BSO와 오라노핀의 조합은 처리 후 1일째부터 세포수가 유의적으로 감소된 반면, 낮은 농도에서 이들의 단독처리는 세포수가 감소되지 않았다(도 2A 및 2B).
그런데, BSO 또는 BSO-오라노핀의 조합은 세포의 ROS 축적을 유도한다는 것을 확인하였고, 이것은 항산화제인 trolox((6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid)의 선처리를 하는 경우 없어졌다(도 2C). 또한, trolox를 처리한 경우 BSO 및 오라노핀에 의한 세포성장의 억제를 막을 수 있음을 알 수 있었다(CI <1.0; 도 2D).
따라서, BSO는 오라노핀-유도의 세포사멸에 대한 감광제로서 역할을 한 것을 볼 수 있고, GSH 및 Trx 시스템의 억제는 암세포의 사멸을 유도할 수 있음을 확인하였다.
실시예 3. GSH 및 Trx 이원 차단 시스템에 의한 HNC 세포사멸 유도 효과
GSH는 GCLM(glutamate cysteine ligase modifier) 및 GCLC(glutamate cysteine ligase catalytic) 서브유닛을 가지는 GCL(glutamate cysteine ligase)에 의해 합성된다고 보고되어 있으며(Liu Y, Hyde AS, Simpson MA, Barycki JJ. Adv Cancer Res 122: 69-101, 2014), TXNRD1는 티오레독신 환원효소 1(Thioredoxin reductase 1)의 유전자이다. GCLM 및 TXNRD1 유전자의 억제는 각각 GSH 고갈 및 Trx 활성 억제를 유도할 수 있음을 확인하였다(도 3A, 3B, 3C 및 도 8).
유전적 또는 약학적으로 GSH 및 Trx 의 이중차단 시스템은 시너지 작용으로 시스플라틴-민간성 및 시스플라틴-저항성 세포의 사멸을 유도할 수 있음을 확인하였다(도 3D 및 3E). 그러나, HN3-cisR 및 HN9-cisR과 같은 시스플라틴-저항성 HNC 세포의 일부에서는 차선(suboptimal)의 효과를 보였고, 즉, 일부 세포사멸이 억제되지 않음을 확인하였다(도 1C 및 도 9).
따라서, GSH 및 Trx 시스템의 억제는 일부 시스플라틴-저항성 암세포의 사멸을 현저하게 유도하지 않음을 알 수 있었다.
실시예 4. GSH 및 Trx 시스템의 억제에 의한 Nrf2-ARE 경로의 활성 효과
본 발명자들은 오라노핀 또는 BSO-오라노핀의 조합 처리가 Nrf2(nuclear factor (erythroid-derived 2)-like 2)와 NQO1(NAD(P)H quinone oxidoreductase 1) 및 HO-1(Heme oxygenase 1)을 포함하는 ARE(antioxidant response element) 경로의 발현을 증가시킴을 발견하였고(도 4A), 이에 따라, GSH의 합성을 억제하기 위한 GCLM 유전자 및 Trx 합성을 억제하기 위한 TXNRD1 유전자의 siRNA(각각 siGCLM, siTXNRD1)가 형질도입된 HNC 세포를 사용하여, NFE2L2(Nrf2) 또는 HMOX1 유전자의 억제, 또는 트리고넬린에 의한 Nrf2의 약학적 억제 실험을 진행하였다.
그 결과, siGCLM 및/또는 siTXNRD1에 의해 형질도입된 HNC 세포의 세포 생존율은 대조군에 비하여 감소됨을 확인하였다(도 4B 및 4C). Nrf2 및/또는 HO-1의 유전적 억제는 시스플라틴-저항성의 HN3-cisR 및 HN9-cisR 세포에서 BSO 및 오라노핀에 의한 시너지 작용의 세포사멸을 향상시켰다(도 4D 및 5A). 트리고넬린에 의한 Nrf2 의 약학적 억제는 트리고넬린을 처리하지 않거나 항산화제 Trolox의 선처리에 비해 세포성장 억제, ROS 축적 및 BSO 및 오라노핀에 의한 세포사멸을 더욱 유도하였다(도 5B, 5C 및 5D). 증가된 Nrf2 양은 시스플라틴-민감성의 HNC 세포에 비해 시스플라틴-저항성의 HNC 세포에서 발견되었다(도 10). Nrf2 억제(silencing)은 시간-의존적으로 BSO 및 오라노핀에 의해 유도된 Nrf2 증가를 막았다(도 11).
그러나, 세 가지 조합은 정상 세포의 성장을 유의적으로 억제하는 것은 아님을 확인하였다(도 12).
따라서, GSH, Trx 및 Nrf2의 억제는 정상 세포의 성장의 억제에는 영향을 주지 않으면서, 암세포, 특히 시스플라틴-저항성의 암세포에 효과적으로 세포사멸을 유도함을 알 수 있었다.
실시예 5. GSH , Trx Nrf2 시스템의 차단에 의한 in vivo HNC 성장 억제 효과
BSO 및 오라노핀에 의한 GSH 및 Trx 시스템의 약학적 이중 차단은 in vivo 성장에서 HNC 세포를 유의적으로 억제하였고, 이는 트리고넬린의 추가에 의하여 강화되었음을 확인하였다(도 6A, 6B 및 도 13). BSO, 오라노핀 또는 트리고넬린 단독 또는 이들의 조합은 종양-이식된 마우스의 몸무게 또는 주요 장기의 다른 합병증에서 유의적 변화를 일으키지 않았고(도 6C 및 도 14), BSO 및 오라노핀 또는 트리고넬린이 조합된 처리는 이식된 종양에서 유의적으로 세포사멸이 증가됨을 확인하였다(도 6D 및 도 15). 세포의 GSH 양은 BSO, BSO-오라노핀 또는 BSO-오라노핀-트리고넬린을 처리한 마우스의 종양에서 유의적으로 감소하였다(도 16).
따라서, BSO는 다른 약물에 대한 감광제로서 역할을 하며, in vivo 조직에서 생적합성을 보였고, GSH, Trx 및 Nrf2 시스템의 차단에 의하여 시스플라틴-저항성의 암세포의 성장을 억제하는 효과가 있음을 알 수 있었다.
실시예 6. 폐암 및 난소암에서의 세포사멸 효과
본 발명자들은 폐암 및 난소암 세포에서 GSH 및 Trx 시스템의 약학적 이중 차단 효과를 알아보기 위하여, BSO 및 오라노핀의 조합된 처리에 의하여 폐암 및 난소암 세포에서 세포사멸을 유도하는지 여부를 확인하는 실험을 수행하였다. 폐암세포(H460 및 H2009) 및 난소암세포(OVCAR3 및 SKOV3)에 BSO, 오라노핀 또는 이들의 조합을 72시간 동안 처리한 후 세포생존율을 확인하였다. 그 결과, BSO만을 단독으로 처리한 경우보다 BSO 및 오라노핀의 조합으로 처리된 군에서 폐암 및 난소암 세포의 사멸이 현저하게 일어났음을 확인하였다(CI <1.0; 도 17).
또한, 본 발명자들은 폐암 및 난소암 세포에서 GSH, Trx 및 Nrf2 시스템의 삼중 차단 효과를 알아보기 위하여, BSO, 오라노핀 및 트리고넬린을 처리하여 세포사멸을 유도하는지 여부를 확인하는 실험을 수행하였다. H2009 폐암세포와 OVCAR 난소암세포에 BSO, 오라노핀, BSO+오라노핀, 트리고넬린(Trig, 100 μM), BSO+트리고넬린, 오라노핀+트리고넬린, BSO+오라노핀+트리고넬린을 처리한 후 72시간 동안 세포생존율을 확인하였다. 그 결과, BSO 및 오라노핀의 조합의 경우 세포사멸을 유도하는 효과가 있었고, BSO, 오라노핀 및 트리고넬린의 조합의 경우에는 더욱 현저하게 세포사멸을 유도하는 효과가 있음을 확인하였다.
따라서, GSH, Trx 및 Nrf2을 모두 차단하는 경우 폐암 및 난소암세포의 성장을 억제하는 효과가 있음을 확인하였다.

Claims (10)

  1. (i) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)로 이루어진 군으로부터 선택된 하나 이상의 유전자의 발현 억제제; 또는
    (ii) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)로 이루어진 군으로부터 선택된 하나 이상의 유전자의 단백질의 활성 억제제를 포함하는 암의 예방 또는 치료용 약학 조성물.
  2. 제 1 항에 있어서,
    상기 발현 억제제는 상기 유전자 또는 상기 유전자의 발현을 촉진하는 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA((small interfering RNA), shRNA(Short Hairpin RNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 어느 하나의 발현억제제인 것을 특징으로 하는 조성물.
  3. 제 2 항에 있어서,
    상기 글루타치온 유전자의 발현을 촉진하는 GCLM(glutamate cysteine ligase modifier) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 1 및 2; 서열번호 3 및 4; 또는 서열번호 5 및 6의 염기서열로 이루어진 것이고,
    상기 티오레독신 유전자의 발현을 촉진하는 TXNRD1(thioredoxin reductase 1) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 7 및 8; 서열번호 9 및 10; 또는 서열번호 11 및 12의 염기서열로 이루어진 것이며,
    상기 Nrf2 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 13 및 14; 서열번호 15 및 16; 또는 서열번호 17 및 18의 염기서열로 이루어진 것이고,
    상기 Nrf2 유전자의 발현을 촉진하는 HO1(heme oxygenase 1) 유전자의 mRNA에 상보적으로 결합하는 siRNA는 서열번호 19 및 20; 서열번호 21 및 22; 또는 서열번호 23 및 24의 염기서열로 이루어진 것을 특징으로 하는 조성물.
  4. 제 1 항에 있어서,
    상기 활성 억제제는 상기 유전자의 단백질에 특이적으로 결합하는 화합물, 펩타이드, 펩타이드모방체, 기질유사체, 앱타머 및 항체로 이루어진 그룹에서 선택되는 어느 하나인 것을 특징으로 하는 조성물.
  5. 제 4 항에 있어서,
    상기 글루타치온 유전자의 단백질에 특이적으로 결합하는 화합물은 BSO(buthionine sulfoximine) 또는 NOV-002(glutathione disulfide mimetic)이고,
    상기 티오레독신 유전자의 단백질에 특이적으로 화합물은 오라노핀(auranofin), 니트로소 요소(nitrosourea) 또는 커큐민(curcumin)이며,
    상기 Nrf2에 유전자의 단백질에 특이적으로 결합하는 화합물은 트리고넬린(trigonelline), 크리신(chrysin), 아피제닌(apigenin), 브루사톨(brusatol), 아스코르브산(ascorbic acid) 또는 루테올린(luteolin)인 것을 특징으로 하는 조성물.
  6. 제 1 항에 있어서,
    상기 암은 시스플라틴에 저항성을 가지는 암인 것을 특징으로 하는 조성물.
  7. 제 6 항에 있어서,
    상기 암은 두경부암, 폐암, 위암, 간암, 대장암, 소장암, 췌장암, 뇌암, 뼈암, 흑색종, 유방암, 경화성선증, 난소암, 자궁암, 자궁경부암, 식도암, 갑상선암, 부갑상선암, 신장암, 육종, 전립선암, 요도암, 방광암, 혈액암, 림프종, 건선 또는 섬유선종으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 조성물.
  8. (a) 암세포에 시험물질을 처리하는 단계;
    (b) 글루타치온(Glutathione), 티오레독신(Thioredoxin) 및 Nrf2(nuclear factor (erythroid-derived 2)-like 2)의 mRNA 발현량 또는 단백질의 발현량이 억제되는 것을 확인하는 단계를 포함하는 암 치료제의 스크리닝 방법.
  9. 제 8 항에 있어서,
    상기 암은 시스플라틴에 저항성을 가지는 암인 것을 특징으로 하는 방법.
  10. 제 9 항에 있어서,
    상기 암은 두경부암, 폐암, 위암, 간암, 대장암, 소장암, 췌장암, 뇌암, 뼈암, 흑색종, 유방암, 경화성선증, 난소암, 자궁암, 자궁경부암, 식도암, 갑상선암, 부갑상선암, 신장암, 육종, 전립선암, 요도암, 방광암, 혈액암, 림프종, 건선 또는 섬유선종으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 방법.
PCT/KR2017/004963 2016-12-20 2017-05-12 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도 Ceased WO2018117345A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160174698A KR101908029B1 (ko) 2016-12-20 2016-12-20 Glutathione, Thioredoxin, Nrf2 항산화계 병합억제를 통한 선택적 암세포사멸 유도
KR10-2016-0174698 2016-12-20

Publications (1)

Publication Number Publication Date
WO2018117345A1 true WO2018117345A1 (ko) 2018-06-28

Family

ID=62626762

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/004963 Ceased WO2018117345A1 (ko) 2016-12-20 2017-05-12 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도

Country Status (2)

Country Link
KR (1) KR101908029B1 (ko)
WO (1) WO2018117345A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110438126A (zh) * 2019-06-18 2019-11-12 武汉市农业科学院 一种抑制Nrf2基因表达的siRNA序列及其反应体系
JPWO2021014812A1 (ko) * 2019-07-24 2021-01-28
WO2023051088A1 (zh) * 2021-10-01 2023-04-06 浙江中医药大学 二氢丹参酮Ⅰ在制备Nrf2抑制剂中的应用

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024054073A1 (ko) * 2022-09-07 2024-03-14 재단법인 아산사회복지재단 선행화학요법 내성의 고형암 환자 진단용 바이오마커 및 이를 이용한 선행화학요법 내성 진단을 위한 정보제공방법
CN115804829B (zh) * 2022-11-11 2023-12-12 广州国家实验室 S-亚硝基化谷胱甘肽还原酶抑制剂在改善肺纤维化血管新生中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100255117A1 (en) * 2007-04-06 2010-10-07 The Johns Hopkins University Methods and compositions for the treatment of cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100255117A1 (en) * 2007-04-06 2010-10-07 The Johns Hopkins University Methods and compositions for the treatment of cancer

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BENHAR: "Dual targeting of the thioredoxin and glutathione systems in cancer and HIV", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 126, no. 5, 2 May 2016 (2016-05-02), pages 1630 - 1639, XP055605777, ISSN: 0021-9738, DOI: 10.1172/JCI85339 *
LV ET AL.: "Inhibition of heme oxygenase-1 enhances the chemosensitivity of laryngeal squamous cell cancer Hep-2 cells to cisplatin", APOPTOSIS, vol. 21, no. 4, 22 January 2016 (2016-01-22), pages 489 - 501, XP035635732, ISSN: 1360-8185, DOI: 10.1007/s10495-016-1216-7 *
NO ET AL.: "Targeting Nrf2 signaling to combat chemoresistance", JOURNAL OF CANCER PREVENTION, vol. 19, no. 2, 30 June 2014 (2014-06-30), pages 111 - 117, XP055605769, ISSN: 2288-3649, DOI: 10.15430/JCP.2014.19.2.111 *
ROH: "Targeting of the glutathione, thioredoxin, and Nrf2 antioxidant systems in head and neck cancer", ANTIOXIDANTS & REDOX SIGNALING, vol. 27, no. 2, 14 November 2016 (2016-11-14), pages 106 - 114, XP055605790, ISSN: 1523-0864, DOI: 10.1089/ars.2016.6841 *
SAMATIWAT: "Repression of Nrf2 enhances antitumor effect of 5-fluorouracil and gemcitabine on cholangiocarcinoma cells", NAUNYN-SCHMIEDEBERG'S ARCHIVES OF PHARMACOLOGY, vol. 388, no. 6, 24 February 2015 (2015-02-24) - June 2015 (2015-06-01), pages 601 - 612, XP055605786, ISSN: 0028-1298, DOI: 10.1007/s00210-015-1101-x *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110438126A (zh) * 2019-06-18 2019-11-12 武汉市农业科学院 一种抑制Nrf2基因表达的siRNA序列及其反应体系
JPWO2021014812A1 (ko) * 2019-07-24 2021-01-28
WO2021014812A1 (ja) * 2019-07-24 2021-01-28 国立大学法人東海国立大学機構 線維芽細胞性又は筋線維芽細胞性腫瘍・疾患の治療
WO2023051088A1 (zh) * 2021-10-01 2023-04-06 浙江中医药大学 二氢丹参酮Ⅰ在制备Nrf2抑制剂中的应用

Also Published As

Publication number Publication date
KR101908029B1 (ko) 2018-10-15
KR20180071722A (ko) 2018-06-28

Similar Documents

Publication Publication Date Title
Wen et al. Cuproptosis enhances docetaxel chemosensitivity by inhibiting autophagy via the DLAT/mTOR pathway in prostate cancer
WO2018117345A1 (ko) 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도
US20250073225A1 (en) Bifunctional compositions for the treatment of cancer
Guo et al. Emodin potentiates the antitumor effects of gemcitabine in PANC-1 pancreatic cancer xenograft model in vivo via inhibition of inhibitors of apoptosis
US20250099453A1 (en) Use of neuronal nitric oxide synthase inhibitors for immunotherapy in melanoma patients
US20230090446A1 (en) Antisense oligonucleotide targeting linc00518 for treating melanoma
WO2020080861A1 (ko) Syt11 억제제를 유효성분으로 포함하는 위암 치료용 조성물
US20150190484A1 (en) Methods for reducing cellular senescence mediated by dna damaging agents
US20220347125A1 (en) Antitumor agent and compounding agent
US20220047546A1 (en) Combination cancer therapies
US20230414749A1 (en) Use of immune checkpoint inhibitors in combination with anti-aging drugs in preparation of tumor treatment products
WO2014025837A1 (en) Methods for treatment and prevention of tauopathies by inhibiting endothelin receptors
KR101859641B1 (ko) 아르테미신 유도체 및 Nrf2 억제제를 포함하는 항암용 조성물
WO2023068820A1 (ko) 암 치료 또는 예방용 조성물
WO2011087343A2 (ko) Hpv 감염과 관련된 암의 치료용 조성물
CN115944740A (zh) 靶向hif-1/cbs在三阴性乳腺癌中的应用
KR20230022002A (ko) miR-16-5p 및 소마토스타틴 유사체를 포함하는 종양 예방 또는 치료용 약학적 조성물
WO2022008464A1 (en) Combination of antineoplastic antibiotics and bcl-2 inhibitors for the treatment of npm-1-driven acute myeloid leukemia (aml)
US20180230466A1 (en) Methods for treating tumors
WO2023075123A1 (ko) miRNA를 포함하는 대장암의 치료 및 전이 억제용 약학적 조성물 및 이의 용도
WO2023075122A1 (ko) 대장암의 치료 및 전이 억제용 약학적 조성물 및 이의 용도
CN114306320A (zh) 一种下调衰老相关分泌表型的抗衰老植物多酚类药物及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17884313

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17884313

Country of ref document: EP

Kind code of ref document: A1