WO2018117345A1 - Selective induction of cancer apoptosis through combined inhibition of glutathione, thioredoxin, and nrf2 antioxidant - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cancer, wherein the composition comprises an expression inhibitor or an activity inhibitor of glutathione, thioredoxin, and Nrf2 as an active ingredient. In particular, with respect to cancer having resistance to cisplatin, the composition suppresses the expression of the gene or suppresses the expression or activity of protein, and thus can be usefully used to prevent or treat cisplatin-resistant cancer.

Description

[Correction by Rule 26 04.07.2017] Induction of selective cancer cell death through anti-inhibition of glutathione, thioredoxin and NR2 antioxidant system

The present invention relates to a composition for the prevention or treatment of cancer comprising glutathione, thioredoxin and Nrf2 expression inhibitor or activity inhibitor as an active ingredient.

Head and neck cancer is a cancer that occurs in tissues such as the nasal cavity, pharynx, larynx, salivary glands, and thyroid gland, and the incidence of cancer worldwide accounts for about 5% of all malignancies. The incidence of head and neck cancer is increasing gradually throughout the world, and cisplatin, the most powerful anticancer agent currently used in clinical practice, is used for the treatment of head and neck cancer. However, although cisplatin is a very effective anticancer agent against various types of cancer, recent studies show that clinical problems are increasing due to its resistance. Therefore, various studies have recently been conducted to treat cancers that become cisplatin resistant using proteins and genes of cancer cells that induce resistance to cisplatin.

The increased amount of oxidative stress in cancer cells is due to an imbalance between the production and elimination of reactive oxygen species (Toyokuni S, Okamoto K, Yodoi J, Hiai H. FEBS Lett 358: 1-3, 1995). Sustained oxidative stress in cancer partially explains why cancer cells have different characteristics from those of normal cells susceptible to ROS damage (Trachootham D, Alexandre J, Huang P. Nat Rev Drug Discov). 8: 579-91, 2009). To process the oxidation-reduction state of imbalance, cancer cells corresponds to the free radical scavenging system, elevated high ROS amount (Diehn M et al, Nature 458 :. 780-3, 2009). Redox changes and increased antioxidant defense mechanisms in cancer cells have been reported to make cancer cells insensitive to the treatment of radiation and chemotherapy (Hanahan D, Weinberg RA. Cell 144: 646-74, 2011). Increased ROS amounts lead to aggressive phenotypes of tumors and poor treatment results (Kumar B, Koul S, Khandrika L, Meacham RB, Koul HK. Cancer Res 68: 1777-85, 2008). Thus, redox regulation by further enhancing ROS production or weakening antioxidant defenses in cancer cells may be a promising strategy to selectively remove cancer cells leaving normal cells (Schumacker PT. Cancer Cell 10: 175-6, 2006). ).

Intracellular antioxidant GSH has been reported to be synthesized by GCL (glutamate cysteine ligase) with GCLM (glutamate cysteine ligase modifier) and GCLC (glutamate cysteine ligase catalytic) subunits (Liu Y, Hyde AS, Simpson MA, Barycki JJ Adv Cancer Res 122: 69-101, 2014), the Trx system has been reported to be essential for maintaining a reduced state of intracellular redox in the presence of thioredoxin reductase (Mahmood DF, Abderrazak A). , El Hadri K, Simmet T, Rouis M. Antioxid Redox Signal 19: 1266-303, 2013). Nrf2 is a transcription factor that binds to the antioxidant responsive element (ARE) and plays an important role in regulating the homeostasis of redox within cells (Hayes JD, Dinkova-Kostova AT. Trends Biochem Sci 39: 199-218, 2014). However, cancer cells are known to compensate for stress caused by the amount of intracellular ROS by actively up-regulating various antioxidant pathways that contribute to tumor progression (DeNicola GM et al., Nature 475: 106-9, 2011; Diehn M et al. , Nature 458: 780-3, 2009; and Schafer ZT et al., Nature 461: 109-13, 2009).

An object of the present invention is a pharmaceutical for the prevention or treatment of cancer comprising glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) as an active ingredient. It is to provide a composition.

Another object of the present invention is the step of (a) treating the test substance to cancer cells; (b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed. It is to provide a screening method.

In order to achieve the above object, the present invention

(i) inhibitors of expression of one or more genes selected from the group consisting of glutathione, thioredoxin and nuclear factor (erythroid-derived 2) -like 2); or

(ii) preventing or treating cancer comprising an activity inhibitor of a protein of at least one gene selected from the group consisting of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) It provides a pharmaceutical composition.

In one embodiment of the present invention,

(i) inhibitors of gene expression of glutathione, thioredoxin and nuclear factor (erythroid-derived 2) -like 2); or

(ii) may be a pharmaceutical composition for the prevention or treatment of cancer comprising glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) inhibitory activity of the protein of the gene of the gene .

In one embodiment of the present invention, glutathione (Glutathione), thioredoxin (Thioredoxin) and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) may be a combination of inhibitors that respectively inhibit the gene expression.

In one embodiment of the present invention,

1) inhibitors that simultaneously inhibit expression of glutathione and thioredoxin genes, and Nrf2 gene expression inhibitors;

2) inhibitors and thioredoxin gene expression inhibitors which simultaneously inhibit expression of glutathione and Nrf2 genes; or

3) It may be a pharmaceutical composition for the prevention or treatment of cancer, including an inhibitor that simultaneously inhibits the expression of thioredoxin and Nrf2 gene and glutathione gene expression inhibitor.

In addition, as an embodiment of the present invention, it may be a pharmaceutical composition for the prevention or treatment of cancer, including an inhibitor that simultaneously inhibits expression of glutathione, thioredoxin and Nrf2 gene.

In one embodiment of the present invention,

In one embodiment of the present invention, glutathione (Glutathione), thioredoxin (Thioredoxin) and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) may be a combination of inhibitors that respectively inhibit the protein activity of the gene.

1) an inhibitor that simultaneously inhibits protein activity of glutathione and thioredoxin genes, and an inhibitor of protein activity of the Nrf2 gene;

2) inhibitors that simultaneously inhibit protein activity of glutathione and Nrf2 genes and inhibitors of protein activity of thioredoxin genes; or

3) It may be a pharmaceutical composition for preventing or treating cancer, including an inhibitor that simultaneously inhibits protein activity of thioredoxin and Nrf2 gene and a protein activity inhibitor of glutathione gene.

In addition, as an embodiment of the present invention, it may be a pharmaceutical composition for the prevention or treatment of cancer, including inhibitors that simultaneously inhibit the protein activity of glutathione, thioredoxin and Nrf2 gene.

In one embodiment of the invention, the expression inhibitor is an antisense oligonucleotide, siRNA (small interfering RNA), shRNA (Short Hairpin RNA) complementary to the mRNA of the gene or genes that promote the expression of the gene And ribozyme (ribozyme) may be any one selected from the group consisting of.

In one embodiment of the present invention, siRNA that complementarily binds to the mRNA of the glutamate cysteine ligase modifier (GCLM) gene that promotes expression of the glutathione gene is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; Or a siRNA consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6, and complementarily binding to mRNA of the thioredoxin reductase 1 (TXNRD1) gene, which promotes expression of the thioredoxin gene, SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; Or consisting of the nucleotide sequence of SEQ ID NO: 11 and 12, siRNA that complementarily binds to the mRNA of the Nrf2 gene is SEQ ID NO: 13 and 14; SEQ ID NOs: 15 and 16; Or a siRNA consisting of the nucleotide sequences of SEQ ID NOs: 17 and 18, wherein the siRNA complementarily binds to the mRNA of the heme oxygenase 1 gene, which promotes expression of the Nrf2 gene, SEQ ID NOs: 19 and 20; SEQ ID NOs: 21 and 22; Or may consist of the nucleotide sequences of SEQ ID NOs: 23 and 24.

In one embodiment of the present invention, the activity inhibitor is a compound, peptides, peptide mimetics, substrate analogs, apps that specifically bind to at least one group consisting of glutathione, thioredoxin and Nrf2. It may be any one selected from the group consisting of a tamer and an antibody.

In one embodiment of the present invention, the compound specifically binding to glutathione is BSO (buthionine sulfoximine) or NOV-002 (glutathione disulfide mimetic), and the compound specifically binding to thioredoxin is oranopine (auranofin), nitrosourea, or curcumin, and the compound that specifically binds to Nrf2 is trigonelline, chrysin, apigenin, brusatol ), Ascorbic acid or as luteolin.

In one embodiment of the present invention, the cancer may be cancer having cisplatin resistance.

In one embodiment of the present invention, the cancer is head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, scleroderma, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer , Thyroid cancer, parathyroid cancer, kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenomas may be selected from the group, but is not limited thereto.

In addition, the present invention comprises the steps of (a) treating the test substance to cancer cells; (b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed. It provides a screening method.

In one embodiment of the present invention, the cancer may be cancer having cisplatin resistance.

In one embodiment of the present invention, the cancer is head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, scleroderma, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer , Thyroid cancer, parathyroid cancer, kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenomas may be selected from the group, but is not limited thereto.

In addition, the present invention provides a method for preventing or preventing cancer comprising administering to a subject an inhibitor or activity inhibitor of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) Provide a method of treatment.

The method for preventing or treating cancer of the present invention comprises a therapeutically effective amount of the inhibitor or activity inhibitor of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) of the present invention. Administering to the subject. The specific therapeutically effective amount for a particular individual can be determined by the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, weight, general health, sex and diet, time of administration, It is desirable to apply differently depending on the route of administration and the rate of release of the composition, the duration of treatment, and the various factors and similar factors well known in the medical arts, including drugs used with or concurrent with the specific composition. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the above matters.

The subject is applicable to any mammal, and the mammal includes humans and primates, as well as domestic animals such as cattle, pigs, sheep, horses, dogs, and cats.

Expression inhibitors or activity inhibitors of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) according to the present invention inhibit the growth of apoptosis resistant cancer cells and apoptosis By inducing it can be usefully used for the treatment of cancer.

FIG. 1 shows the results of apoptosis-inducing effects of cisplatin-sensitive and cisplatin-resistant HNC cells on GSH inhibitor BSO (buthionine sulfoximine) and Trx inhibitor oranopine. (A) shows the apoptosis effect on oranopine according to the concentration, (B) shows the apoptosis effect by BSO according to the concentration, (C) shows the apoptosis effect by BSO and oranopine (D) shows the apoptosis effect by BSO and oranopine in different types of HNC cell lines and SNU cell lines.

FIG. 2 shows the results of ROS (reactive oxygen species) induction and apoptosis effects in HNC cells against BSH (buthionine sulfoximine) and Trx inhibitor oranopine. (A) is a result of comparing the survival rate of HNC cells after treatment with BOS, oranopine or BSO- oranopine, (B) is a result of observing HNC cells under a microscope, (C) is BOS, oranopine or The results of measurement of the amount of ROS in each group treated with BSO-oranopine and not treated with or without the antioxidant Trolox, (D) is the result of measuring the cell viability under the condition (C) (* P <0.01; and ** P <0.001).

3 shows the suboptimal effect of apoptosis in resistant HNC cells by inhibition of GSH and Trx. (A) GCLM or TXNRD1 It was a result of transducing the mRNA expression level of GSH or TrxR by transducing the siRNA of the gene, respectively, (B) is the analysis of the amount of GSH in the cell after introducing the siRNA of the gene, (C) is the siRNA of the gene Analysis of TrxR activity after introduction, (D) is GCLM And / or TXNRD1 The relative cell numbers were measured after treatment of BSO, oranopine, or BSO-oranopine in HN3 and HN3-cisR cells into which siRNAs were introduced. (E) shows apoptosis by Annexin-V and PI staining. It is the result of analysis (* P <0.05 in A to D; and * P <0.01, ** P <0.05, *** P <0.01 in E).

Figure 4 shows the results for the induction of Nrf2-ARE activity by BSO and oranopine. (A) is the result of confirming the protein expression levels of Nrf2, Keap1, NQO1 and HO-1 by Western blotting after treatment of HOS3 or HN3-cisR cells with BOS, oranopine or BSO-oranopine, and (B) NFE2L2 And HMOX1 After transducing siRNAs for genes into HN3-cisR cells, it was confirmed whether mRNA of each gene was inhibited, and (C) is NFE2L2. And / or transduce siRNAs (si GCLM , si TXNRD1 , respectively ) for HMOX1 gene into HN3-cisR cells, followed by NFE2L2 , HMOX1 SiRNA for si siFE2L2 , si HMOX1 , respectively Or after treatment with trigonelin, cell viability is measured, and (D) is NFE2L2. SiRNA (si NFE2L2 ) for the gene was transduced into HN3-cisR cells and then treated with BSO, oranopine, trolox or a combination thereof, and the results were shown for apoptosis effect through Annexin-V and PI staining (B , * P <0.05 in C; and * P <0.01 in D, ** P <0.05, *** P <0.05).

5 is a result showing the improvement effect on cancer cell death of BSO and oranopine by Nrf2 inhibition. (A) NFE2L2 And HMOX1 SiRNA for the gene was transduced into HN3-cisR cells and treated with BSO, oranopine or BSO-oranopine to measure cell viability, and (B) shows BSO, oranopine or BSO- in HN3-cisR cells. Cell counts were measured after further treatment of oranopine with trigonelin. (C) shows the amount of ROS after treatment of trigonellin and / or Trolox with BSO, oranopine, or BSO-oranopine in HN3-cisR cells. (D) is the result of measuring the apoptosis effect after Annexin V and PI staining (* P <0.05, ** P <0.01 in A; and * P <0.05, ** in B to D) P <0.01).

Figure 6 is a result showing the growth inhibitory effect after tumor transplantation by BSO, oranopine and trigonelin. (A) is the result of measuring the volume of the tumor after treatment with BSO, oranopine, trigonelin or a combination thereof, (B) is the result of weighing the tumor, (C) is twice a week of each mouse Body weight is measured and (D) is the result of measuring TUNEL-positive killer cells (* P <0.05, ** P <0.01).

FIG. 7 shows that malignant tumor cells of resistance by blocking the GSH, Trx and Nrf2 antioxidant pathways can be targeted.

Figure 8 shows the results of confirming the protein expression amount for each gene after the introduction of siRNA for the GCLM , TXNRD1 and NFE2L2 gene in HN3-cisR cells.

Figure 9 shows the results confirmed by Western blotting the amount of Nrf2 expression in cisplatin-sensitive or resistant HNC cells.

10 shows the results of Western blotting of protein expression levels of Nrf2 and HO-1 in HN3-cisR cells transduced with si NFE2L2 .

11 shows the results of the next cell apoptosis effect by GSH and Trx inhibition. (A) shows the apoptosis effect by Annexin V and PI staining after treatment with BSO, oranopine, Trolox or a combination thereof in HN9 and HN9-cisR cells, (B) HN9 transduced with si NFE2L2 After treatment with BSO, oranopine, Trolox, or a combination thereof in -cisR cells, apoptosis was shown by Annexin V and PI staining.

12 is a result of measuring the cell viability after exposure to normal oral keratinocytes (A) and fibroblasts (fibroblast: B), BSO, oranopine and trigonelin.

Figure 13 shows mice with tumors treated with control (A) and BSO- oranopine-trigonelline (B).

Figure 14 is the result of comparing the degree of tissue damage in the control and the treatment of BSO- oranopine-trigonelin.

Figure 15 shows the results of microscopic analysis of TUNEL-positive killing cells in the tumor section of the control group (A) and BSO- oranopine-trigonelin (B) treated group.

FIG. 16 shows the results of measuring the amount of GSH in cells in tumor tissues of mice treated with BSO, oranopine, trigonelin, or a combination thereof (** P <0.01).

17 is a result of apoptosis induction effect in lung cancer cells (H460 and H2009) and ovarian cancer cells (OVCAR3 and SKOV3) after treatment with BSO, oranopine or a combination thereof.

FIG. 18 shows the results of apoptosis induction effects in lung cancer cells (H2009) and ovarian cancer cells (OVCAR3) after treatment with BSO, oranopine, trigonelin, or a combination thereof (* P <0.05 and ** P <0.01) .

"Pharmaceutical composition" according to the present invention refers to a mixture or solution containing one or more therapeutic agents administered to a subject, eg, a mammal or a human, to prevent or treat a particular disease or condition in which the mammal suffers. .

The "pharmaceutical composition" according to the present invention is an expression capable of inhibiting one or more of each or simultaneously a crowd consisting of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) It may be an inhibitor or an activity inhibitor.

In the present invention, expression inhibitors of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) may bind to or simultaneously complement each of the gene mRNAs or express the genes. It may be any one selected from the group consisting of antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), and ribozyme that complement or bind to each of the mRNAs of the gene promoting the It is not limited thereto.

As used herein, the term "siRNA" refers to a short double-chain RNA capable of inducing RNA interference (RNAi) through cleavage of a specific mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit the expression of a target gene, it is provided by an efficient method of knocking down or by gene therapy.

As used herein, the term "antisense oligonucleotide" encompasses a nucleic acid-based molecule having a complementary sequence to a target miRNA, in particular, a miRNA leader sequence, thereby forming a duplex with the miRNA. Thus, the term "antisense oligonucleotide" can be described herein as a "complementary nucleic acid-based inhibitor."

As used herein, the term "complementary" means that the antisense oligonucleotides are sufficiently complementary to selectively hybridize to a miR-BART1-3p target under certain hybridization or annealing conditions, preferably physiological conditions, and are substantially complementary. It has the meaning encompassing both substantially complementary and perfectly complementary, and preferably means completely complementary.

In the present invention, the inhibitors of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) are specific to glutathione, thioredoxin and Nrf2. It may be any one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies that bind to, but is not limited thereto.

As used herein, the term "prevention" means any action that inhibits or delays the onset of cancer by administration of a pharmaceutical composition according to the present invention.

As used herein, the term "treatment" means any action in which symptoms caused by cancer are improved or beneficially altered by administration of the pharmaceutical composition according to the present invention.

The pharmaceutical composition according to the invention may comprise a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers are conventionally used in the preparation, and include, but are not limited to, saline solution, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and the like. If necessary, other conventional additives such as antioxidants and buffers may be further included. In addition, diluents, dispersants, surfactants, binders, lubricants and the like may be additionally added to formulate injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Suitable pharmaceutically acceptable carriers and formulations may be preferably formulated according to each component using the methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, inhalant, or external skin preparation.

The pharmaceutical composition of the present invention can be administered orally or parenterally (eg, applied intravenously, subcutaneously, skin, nasal, airways) according to the desired method, and the dosage is determined by the condition and weight of the patient, Depending on the extent, drug form, route of administration, and time, it may be appropriately selected by those skilled in the art.

The composition according to the invention is administered in a pharmaceutically effective amount. In the present invention, “pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level means the type, severity, and activity of the patient's disease. , Drug sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts. The composition according to the present invention may be administered as a separate therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.

As used herein, the term "combination administration" is defined to include administering a selected therapeutic agent to a single patient, and is intended to include therapeutic regimens in which the agents do not necessarily have to be administered in the same route of administration or simultaneously.

Specifically, the effective amount of the composition according to the present invention may vary depending on the age, sex, and weight of the patient, and generally 0.001 to 150 mg, preferably 0.01 to 100 mg daily or every other day or 1 day per kg of body weight It can be administered in 1 to 3 divided doses. However, the dosage may be increased or decreased depending on the route of administration, the severity of obesity, sex, weight, age, etc., and the above dosage does not limit the scope of the present invention in any way.

As used herein, the term “subject” or “patient” includes an animal that may or may suffer from cancer or any disorder directly or indirectly involved in cancer. Examples of subjects include mammals such as humans, dogs, cattle, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In a preferred embodiment, the subject is a human, eg, a human suffering from, at risk of suffering from cancer, or potentially suffering from cancer.

As used herein, the term "synergy" or "synergy" refers to (a) an inhibitor of glutathione, (b) an inhibitor of thioredoxin, and (c) a nuclear factor (Nrf2). This means that the effects of using an inhibitor of (erythroid-derived 2) -like 2) alone are greater than the sum of them. Advantageously, this synergy provides greater efficacy at the same or lower doses.

In addition, the "cancer drug screening method" of the present invention

(a) treating the test substance with cancer cells;

(b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed, the expression If the level is reduced compared to a control that has not been treated with the test substance, it can be determined as a cancer treatment.

The determination of the expression level can be measured at the level of transcription (nucleic acid) product using methods known in the art. For example, mRNA can be quantified using probes by hybridization methods (eg, Northern blot analysis).

The probe may be labeled with appropriate materials such as dyes, fluorescent materials, and isotopes, and the expression level or function may be detected as the detection intensity of the hybridized label.

In addition, the transcription products of the genes of the invention can be quantified using primers by amplification-based detection methods (eg RT-PCR). The primer can be prepared based on the available sequence information of the gene.

In addition, the expression level measurement in the present invention can be measured at the translation (protein) product level. Methods for measuring the amount of the protein include all immunoassay methods known in the art, such as immunoprecipitation, western blot, immunohistochemical analysis using an antibody that specifically recognizes the protein. The antibody may be monoclonal or polyclonal. In addition, any fragment or modification of an antibody (eg, chimeric antibody, scFv, Fab, F (ab ') 2, Fv, etc.) can be used as long as it retains the ability to bind to the target protein.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited to these examples.

Example 1. Materials and Methods

1.1. Cell line

The head and neck cancer (HNC) cell line (Acta Otolaryngol (Stockh) 1997; 117: 775-784) was provided by Asan Medical Center for Head and Neck Cancer and established as HN2 to HN10. Korea) and was verified by STR (short tandem repeat) -based DNA fingerprinting and Multiplex PCR. Cells were cultured in 5% CO ₂ , 37 ° C. incubator using Eagle's minimum essential medium (MEM) or Roswell Park Memorial Institute medium (RPMI 1640) containing 10% fetal bovine serum (FBS). Normal oral keratinocytes were obtained from patients undergoing oral surgery and used for in vitro assays. In addition, three cisplatin-resistant HNC cell lines (HN3-cisR, HN4-cisR and HN9-cisR) were used, which were developed from HN3, HN4 and HN9, respectively, through continuous exposure to increased cisplatin concentrations. (Nakamura M et al., Oncol Rep 14: 1281-6, 2005). IC50 (half-maximal inhibitory concentrations) values of cisplatin (Sigma-Aldrich, St. Louis, MO, USA) were determined by cell viability assay, 2.2-3.5 μM in parental cells, and 25.5 ~ in cisplatin-resistant HNC cells. 38.9 μΜ.

1.2. Cell Viability Assay

Cell viability after exposure to BSO (buthionine sulfoximine; Sigma-Aldrich), orranoffin (auranofin; Sigma-Aldrich) or trigonelline (Sigma-Aldrich) was measured by MTT and trypan blue exclusion. MTT assay was performed with tetrazolium compound MTT (3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; Sigma-Aldrich) for 4 hours and in solubilization buffer for 2 hours. After loading, the absorbance was measured at 570 nm using a SpectraMax M2 microplate reader (Molecular Devices, Sunnyvale, Calif., USA). Trypan blue exclusion was performed with 0.4% trypan blue staining and counted using a hemocytometer. Apoptosis assays were performed by annexin V (Sigma-Aldrich) and PI (propidium iodide; Sigma-Aldrich) staining, flow cytometry and Cell Quest Pro software (BD Biosciences, Franklin Lakes, NJ). , USA) were used to count annexin V or PI positive cells. All assays were performed three times and three times. The CI (combination index) of drug action was calculated using the Chou-Talalay method, and "CI <1" was considered synergistic (Chou TC. Cancer Res 70: 440-6, 2010).

1.3. Glutathione ( glutathion : GSH ) synthesis, ROS production of reactive oxygen species and measurement of Trx (thioredoxin) activity

GSH levels in lysates of HNC cells were measured using a GSH colorimetric detection kit (BioVision Inc., Milpitas, CA, USA) after exposure to other drugs for 24 hours. ROS production of cells in supernatants of differently treated HNC cell lysates for 24 hours was measured using DCF-DA (2 ', 7'-dichlorofluorescein diacetate; Enzo Life Sciences, Farmingdale, NY, USA). ROS amounts were analyzed with a FACSCalibur flow cytometer equipped with CellQuest Pro (BD Biosciences). Trx activity was measured using Trx activity fluorescent assay kit (Cayman Chemical, Ann Arbor, MI, USA) after treatment with HNC cells for 24 hours.

1.4. siRNA transduction

Cisplatin-resistant HN3 for silencing GCLM (glutathione; gene that promotes GSH expression), TXNRD1 (thioreodoxin reductase-1, TrxR1), NFE2L2 (Nrf2) and HMOX1 (heme oxygenase 1; HO1) genes -cisR cells and HN9-cisR cells were inoculated, and the cells were after 24 hours with 10 nmol / L of small interfering RNA (SIRNA) or scrambled control siRNA (Integrated DNA Technologies, Coralville, IA, USA) targeting human genes. Transduction was carried out. siRNA-induced gene inhibition was performed by reverse blotting and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) from 1-2 μg total RNA for each sample using Western blotting and the SuperScript® III RT-PCR system (Thermo Fisher Scientific). Was performed.

siRNA types	company	number	Forward	Reverse
GCLM (GSH)	IDTDNA	One	5'-GCAAUAGAGCUAGGAAUUAAGAATC-3 '(SEQ ID NO: 1)	5'-GAUUCUUAAUUCCUAGCUCUAUUGCCC-3 '(SEQ ID NO: 2)
		2	5'-ACCAAAUAGUAACCAAGUUAAUCTT-3 '(SEQ ID NO: 3)	5'- AAGAUUAACUUGGUUACUAUUUGGUUU-3 '(SEQ ID NO: 4)
		3	5'-CUAAACAAUUUGACAUACAGCUGT-3 '(SEQ ID NO: 5)	5'-ACAGCUGUAUGUCAAAUUGUUUAGCAA-3 '(SEQ ID NO: 6)
TXNRD1 (TrxR1)	IDTDNA	One	5'-GGUGAUAAACUUGUAGUAGUUGACT -3 '(SEQ ID NO: 7)	5'- AGUCAACUACUACAAGUUUAUCACCUG-3 '(SEQ ID NO: 8)
		2	5'-AGCCACCAUUAAUGAAUUAGUCUAA-3 '(SEQ ID NO: 9)	5'-UUAGACUAAUUCAUUAAUGGUGGCUUC -3 '(SEQ ID NO: 10)
		3	5'-CAGAGUGUGAAGUCAAAUGCAUGCC-3 '(SEQ ID NO: 11)	5'-GGCAUGCAUUUGACUUCACACUCUGAA -3 '(SEQ ID NO: 12)
NFE2L2 (Nrf2)	IDTDNA	One	5'-GUUACAACUAGAUGAAGAGACAGGT-3 '(SEQ ID NO: 13)	5'-ACCUGUCUCUUCAUCUAGUUGUAACUG-3 '(SEQ ID NO: 14)
		2	5'-GCAAGAUUUAGAUCAUUUGAAAGAT-3 '(SEQ ID NO: 15)	5'- AUCUUUCAAAUGAUCUAAAUCUUGCUC -3 '(SEQ ID NO: 16)
		3	5'- UCAACGAAAUGAUGUCCAAAGAGCA-3 '(SEQ ID NO: 17)	5'- UGCUCUUUGGACAUCAUUUCGUUGAAG -3 '(SEQ ID NO: 18)
HO1	IDTDNA	One	5'- AACAUUGUCUGAUAGUAGCUUGAAA -3 '(SEQ ID NO: 19)	5'- UUUCAAGCUACUAUCAGACAAUGUUGU -3 '(SEQ ID NO: 20)
		2	5'- UAAACAACAUUGUCUGAUAGUAGCT -3 '(SEQ ID NO: 21)	5'- AGCUACUAUCAGACAAUGUUGUUUAUU -3 '(SEQ ID NO: 22)
		3	5'- GGUCCUUACACUCAGCUUUCUGGTG -3 '(SEQ ID NO: 23)	5'- CACCAGAAAGCUGAGUGUAAGGACCCA -3 '(SEQ ID NO: 24)

* IDTDNA = Integrated DNA Technologies, Coralville, IA, USA

1.5. Western blotting

Cells were incubated in 70% confluence and treated with the indicated drug or conditioned medium. Cells were lysed at 4 ° C. using a radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific). A total of 50 μg of protein was identified on SDS-PAGE of 10-20% gels and transferred to nitrocellulose or polyvinylidene difluoride (PVDF) membranes and labeled with primary and secondary antibodies. Primary antibodies are as follows: Nrf2, Keap1, NQO1 and HO-1 (Abcam, Cambridge, UK). β-actin (Sigma-Aldrich) was used as a control. All antibodies were diluted from 1: 500 to 1: 5000.

1.6. In vivo  Mouse xenograft model

All animal research procedures were performed with the approval of the Institutional Animal Care and Use Committee. Six-week old athymic BALB / c male nude mice (nu / nu) were purchased from Central Experimental Animal (Seoul, Republic of Korea). HN3-cisR cells were injected subcutaneously into the side of nude mice. From the day when total nodules were identified from tumor transplantation, mice were divided into six different treatment groups: vehicle; BSO (intraperitoneal injection at 450 mg / kg daily); Oranopine (intraperitoneal injection at 2 mg / kg daily); Trigonelin (oral daily at 50 mg / kg); BSO and oranopine auranofin; Or a combination of BSO, oranopine and trigonelin (n = 10 each). Tumor size and weight of each mouse were measured twice a week and volume was calculated as (length × width ² ) / 2. Mice were sacrificed on day 25 and tumors were isolated and analyzed by GSH measurement of cells. Arbitrary fluorescence units (AFUs) were compared to tumors treated differently. Cells killed in tumors were analyzed using an in situ TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling) assay. Two-tailed Mann-Whitney U test was used to compare statistical differences between treatment groups.

Example 2 Induction Effect of HNC Apoptosis by Synergy of BSO and Oranopine

Treatment of oranopine, one of the compounds specifically binding to thioredoxin, to cisplatin-sensitive or cisplatin-resistant HNC cells resulted in a concentration-dependent decrease in the survival of cisplatin-sensitive and cisplatin-resistant HNC cells. On the other hand, treatment with BSO (up to 50 mM), one of the compounds specifically binding to glutathione, did not induce inhibition of cell viability up to 50% or more of the control group despite the high concentration. (FIG. 1B).

However, low concentrations of BSO (5-25 μM) and oranopine (0.1-0.5 μM) were found to synergistically induce effective killing of HNC cells (CI <1.0; FIGS. 1C and 1D). Combination of BSO and oranopine significantly decreased cell number from day 1 after treatment, whereas their treatment at low concentrations did not reduce cell number (FIGS. 2A and 2B).

However, it was confirmed that the combination of BSO or BSO-oranopine induces ROS accumulation in cells, which was pretreated with the antioxidant trolox ((6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid). In addition, it was found that treatment with trolox prevented the inhibition of cell growth by BSO and oranopine (CI <1.0; FIG. 2D).

Therefore, it was confirmed that BSOs acted as a photosensitizer for oranopine-induced apoptosis, and inhibition of the GSH and Trx system may induce cancer cell death.

Example 3 Induction Effect of HNC Apoptosis by GSH and Trx Binary Block System

GSH is reported to be synthesized by glutamate cysteine ligase (GCL) with a glutamate cysteine ligase modifier (GCLM) and a glutamate cysteine ligase catalytic (GCLC) subunit (Liu Y, Hyde AS, Simpson MA, Barycki JJ. Adv Cancer Res 122: 69-101, 2014), TXNRD1 is the gene of Thioredoxin reductase 1. Inhibition of the GCLM and TXNRD1 genes was found to induce GSH depletion and Trx activity inhibition, respectively (FIGS. 3A, 3B, 3C and 8).

Genetically or pharmacologically, the double-blocking system of GSH and Trx was found to be synergistic in inducing the death of cisplatin-folk and cisplatin-resistant cells (FIGS. 3D and 3E). However, some of the cisplatin-resistant HNC cells, such as HN3-cisR and HN9-cisR, showed suboptimal effects, ie, some cell death was not inhibited (FIGS. 1C and 9).

Thus, it was found that inhibition of the GSH and Trx systems did not significantly induce the death of some cisplatin-resistant cancer cells.

Example 4 Activity Effect of Nrf2-ARE Pathway by Inhibition of GSH and Trx System

The present inventors have found that the combination treatment of oranopine or BSO-orranopine is performed by the use of Nrf2 (nuclear factor (erythroid-derived 2) -like 2) and NQO1 (NAD (P) H quinone oxidoreductase 1) and HO-1 (Heme oxygenase 1). It was found to increase the expression of the containing antioxidant response element (ARE) pathway (FIG. 4A), and accordingly, siRNAs of the GCLM gene for inhibiting GSH synthesis and the siRNAs of TXNRD1 gene for suppressing Trx synthesis (si GCLM , respectively ) . si TXNRD1 ) transduced HNC cells were used for the inhibition of NFE2L2 (Nrf2) or HMOX1 gene, or the pharmaceutical inhibition of Nrf2 by trigonelin.

As a result, it was confirmed that the cell viability of HNC cells transduced with si GCLM and / or si TXNRD1 was reduced compared to the control group (FIGS. 4B and 4C). Genetic inhibition of Nrf2 and / or HO-1 enhanced apoptosis of synergistic action by BSO and oranopine in cisplatin-resistant HN3-cisR and HN9-cisR cells (FIGS. 4D and 5A). Pharmaceutical inhibition of Nrf2 by trigonelin induced no cell growth inhibition, ROS accumulation and apoptosis by BSO and oranopine compared to trigonelin treatment or pretreatment with the antioxidant Trolox (FIGS. 5B, 5C and 5D). . Increased Nrf2 amounts were found in cisplatin-resistant HNC cells compared to cisplatin-sensitive HNC cells (FIG. 10). Nrf2 silencing prevented time-dependent increase in Nrf2 induced by BSO and oranopine (FIG. 11).

However, the three combinations did not significantly inhibit the growth of normal cells (Fig. 12).

Therefore, it was found that inhibition of GSH, Trx and Nrf2 effectively induced apoptosis in cancer cells, especially cisplatin-resistant cancer cells, without affecting the inhibition of normal cell growth.

Example  5. GSH , Trx  And Nrf2  By blocking the system in vivo HNC  Growth inhibitory effect

Pharmaceutical double blocking of the GSH and Trx systems by BSO and oranopine significantly inhibited HNC cells in in vivo growth, confirming that it was enhanced by the addition of trigonelin (FIG. 6A, 6B and FIG. 13). BSO, oranopine, or trigonelin alone or in combination thereof did not result in significant changes in the weight of tumor-grafted mice or other complications of major organs (FIGS. 6C and 14) and combinations of BSO and oranopine or trigonelin The treatment was confirmed to significantly increase apoptosis in the transplanted tumors (FIGS. 6D and 15). GSH amounts of cells were significantly reduced in tumors of mice treated with BSO, BSO-oranopine or BSO-oranopine-trigonelin (FIG. 16).

Therefore, BSOs act as photosensitizers for other drugs, showed biocompatibility in tissues in vivo , and inhibited the growth of cisplatin-resistant cancer cells by blocking GSH, Trx and Nrf2 systems. .

Example  6. Apoptosis effect in lung and ovarian cancer

In order to examine the pharmaceutical double blocking effect of the GSH and Trx system in lung cancer and ovarian cancer cells, the present inventors confirmed whether or not induction of apoptosis in lung cancer and ovarian cancer cells by combined treatment of BSO and oranopine. Was performed. Lung cancer cells (H460 and H2009) and ovarian cancer cells (OVCAR3 and SKOV3) after treatment with BSO, oranopine or a combination thereof for 72 hours to determine the cell viability. As a result, it was confirmed that death of lung cancer and ovarian cancer cells occurred more significantly in the group treated with the combination of BSO and oranopine than when only BSO alone was treated (CI <1.0; FIG. 17).

In addition, the present inventors performed experiments to determine whether the treatment of the BSH, oranopine and trigonelin induce apoptosis in order to determine the triple blocking effect of the GSH, Trx and Nrf2 system in lung cancer and ovarian cancer cells. H2009 Lung and OVCAR Ovarian Cancer Cells Treated with BSO, Oranopine, BSO + Oranopine, Trigonelin (Trig, 100 μM), BSO + Trigonelin, Oranopine + Trigonelin, BSO + Oranopine + Trigonelin The survival rate was confirmed. As a result, it was confirmed that the combination of BSO and oranopine had an effect of inducing apoptosis, and the combination of BSO, oranopine and trigonelin was more remarkably effective in inducing cell death.

Therefore, blocking all of GSH, Trx and Nrf2 was confirmed to have the effect of inhibiting the growth of lung cancer and ovarian cancer cells.

Claims (10)

1. (i) inhibitors of expression of one or more genes selected from the group consisting of glutathione, thioredoxin and nuclear factor (erythroid-derived 2) -like 2); or

   (ii) preventing or treating cancer comprising an activity inhibitor of a protein of at least one gene selected from the group consisting of glutathione, thioredoxin and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) Pharmaceutical composition for.
2. The method of claim 1,

   The expression inhibitor is a group consisting of an antisense oligonucleotide, siRNA (small interfering RNA), shRNA (Short Hairpin RNA) and ribozyme complementary to the mRNA of the gene or genes that promote the expression of the gene. The composition of any one of the expression inhibitors selected from.
3. The method of claim 2,

   SiRNA complementarily binding to the mRNA of the glutamate cysteine ligase modifier (GCLM) gene for promoting expression of the glutathione gene is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; Or consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6,

   SiRNA that complementarily binds to mRNA of the thioredoxin reductase 1 (TXNRD1) gene, which promotes expression of the thioredoxin gene, includes SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; Or consisting of the nucleotide sequences of SEQ ID NOs: 11 and 12,

   SiRNA complementarily binding to the mRNA of the Nrf2 gene is SEQ ID NO: 13 and 14; SEQ ID NOs: 15 and 16; Or consisting of the nucleotide sequences of SEQ ID NOs: 17 and 18,

   SiRNAs that complementarily bind to mRNA of the heme oxygenase 1 (HO1) gene that promotes expression of the Nrf2 gene include SEQ ID NOs: 19 and 20; SEQ ID NOs: 21 and 22; Or a nucleotide sequence of SEQ ID NOs: 23 and 24.
4. The method of claim 1,

   The activity inhibitor is a composition, characterized in that any one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies specifically binding to the protein of the gene.
5. The method of claim 4, wherein

   Compounds that specifically bind to the protein of the glutathione gene are BSO (buthionine sulfoximine) or NOV-002 (glutathione disulfide mimetic),

   The compound specific to the protein of the thioredoxin gene is orranopine (auranofin), nitrosourea (curcumin),

   Compounds that specifically bind to the protein of the Nrf2 gene are trigonelline (trigonelline), chrysin (chrysin), apigenin (apigenin), brusatol (brusatol), ascorbic acid (lutecoric acid) or luteolin (luteolin) The composition characterized in that the.
6. The method of claim 1,

   The cancer is a composition, characterized in that the cancer having resistance to cisplatin.
7. The method of claim 6,

   The cancer includes head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, sclerosis, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer, thyroid cancer, parathyroid cancer, kidney cancer, A composition characterized in that it is selected from the group consisting of sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenoma.
8. (a) treating the test substance with cancer cells;

   (b) confirming that the expression levels of glutathione, thioredoxin, and Nrf2 (nuclear factor (erythroid-derived 2) -like 2) mRNA expression levels or proteins are suppressed. Screening method.
9. The method of claim 8,

   And said cancer is cancer resistant to cisplatin.
10. The method of claim 9,

    The cancer includes head and neck cancer, lung cancer, stomach cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, sclerosis, ovarian cancer, uterine cancer, cervical cancer, esophageal cancer, thyroid cancer, parathyroid cancer, kidney cancer, And is selected from the group consisting of sarcoma, prostate cancer, urethral cancer, bladder cancer, hematologic cancer, lymphoma, psoriasis or fibroadenoma.

Images