CN115804829B - Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis - Google Patents

Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis Download PDF

Info

Publication number
CN115804829B
CN115804829B CN202211412053.5A CN202211412053A CN115804829B CN 115804829 B CN115804829 B CN 115804829B CN 202211412053 A CN202211412053 A CN 202211412053A CN 115804829 B CN115804829 B CN 115804829B
Authority
CN
China
Prior art keywords
sirna
pulmonary fibrosis
angiogenesis
seq
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202211412053.5A
Other languages
Chinese (zh)
Other versions
CN115804829A (en
Inventor
孟舒
宋志敏
张芸
王耀锋
陈静静
张廷虹
许梦珠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou National Laboratory
Original Assignee
Guangzhou National Laboratory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou National Laboratory filed Critical Guangzhou National Laboratory
Priority to CN202211412053.5A priority Critical patent/CN115804829B/en
Publication of CN115804829A publication Critical patent/CN115804829A/en
Application granted granted Critical
Publication of CN115804829B publication Critical patent/CN115804829B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The application discloses an application of an S-nitrosylated glutathione reductase inhibitor in improving pulmonary fibrosis angiogenesis. In a first aspect of the application there is provided the use of at least one of the following a1 to a3 for the preparation of a product for improving angiogenesis in pulmonary fibrosis: a1.s-nitrosylated glutathione; inhibitors of a2 s-nitrosylated glutathione reductase; a3. any one of a1 to a2 is a pharmaceutically acceptable salt. The application according to the embodiment of the application has at least the following beneficial effects: in the experimental process, the inhibition of S-nitrosylation can be used as a target point for improving angiogenesis of idiopathic pulmonary fibrosis, and the GSNOR inhibitor and/or exogenous GSNO can be provided for effectively increasing the blood vessel density in the lung tissue of a pulmonary fibrosis mouse model and promoting the angiogenesis; and also shows good vascularization ability to cells in vitro.

Description

Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis
Technical Field
The application relates to the technical field of pulmonary fibrosis, in particular to application of an S-nitrosylated glutathione reductase inhibitor in improving pulmonary fibrosis angiogenesis.
Background
Idiopathic pulmonary fibrosis (Idiopathic Pulmonary Fibrosis, IPF) is a chronic lethal disease characterized by progressive fibroblast proliferation, widely deposited extracellular matrix in lung tissue (Extracelluar Matrix, ECM), destruction of alveolar structures, and sustained decline in lung function, ultimately leading to respiratory failure and death. The pathogenesis of IPF is versatile and includes inflammatory response, angiogenesis and remodeling, oxidative stress, fibrinolytic disorders, matrix metalloproteinases, etc., which are not yet fully understood.
Wherein, angiogenesis refers to the formation of a new microvascular network in the human body mainly through angiogenesis, which is the process of proliferating vascular endothelial cells along the blood vessels, growing new capillaries from the existing vascular system, and is also an important physiological process in the growth, tissue injury, repair and healing processes. Angiogenesis plays an important role in the pathogenesis of cancer, diabetic retinopathy, rheumatoid arthritis, atherosclerosis, and other diseases. With the continuous and intensive research on pulmonary fibrosis, the role of angiogenesis and remodeling in the occurrence of pulmonary fibrosis is also increasingly emphasized, and is considered as one of the key links. In order to understand the process of vascular integrity and repair, it is necessary to determine factors associated with angiogenesis in IPF.
In the lungs under normal physiological conditions, angiogenesis and vascular inhibitors regulate vascular homeostasis through a balance of both. Although early studies have shown that IPF is associated with increased angiogenesis, recent studies have shown reduced angiogenesis in IPF fibroblast foci (Renzoni EA, et al, am J Respir Crit Care med 2003;167 (3): 438-43; cosgrove GP, et al, am J Respir Crit Care med 2004;170 (3): 242-51;) with up-regulation of expression levels of angiogenesis inhibitors (vascular endothelin) (Sumi M, et al, J Clin Lab al 2005;19 (4): 146-9.); in addition, it was found in studies with LTBP4 that it may cause alveolar septal defects by reducing angiogenesis, thereby affecting pulmonary fibrosis (boltmann-Mellin I, et al, am J Physiol Lung Cell Mol physiol.2017;313, L687-L698.); VEGF can also repair damage to lung tissue and reduce the formation of lung fibrosis by protecting endothelial cells, promoting angiogenesis, etc. (Derseh, et al, sci Rep.2009;9 (1): 19893); the above evidence supports the notion of pulmonary fibrosis with hypoangiogenesis. Therefore, angiogenesis may be an important target for pulmonary fibrosis, and it is necessary to develop products capable of improving angiogenesis to investigate therapeutic strategies for pulmonary fibrosis.
S-nitrosylated glutathione reductase (S-nitrosoglutathione reductase, GSNOR) is the intracellular S-nitrosylated Glutathione (GSNO) reductase, the most predominant S-nitrosylating enzyme. Protein S-nitrosylation, i.e., oxidative modification of cysteine by Nitric Oxide (NO), forms the protein S-nitrosothiols (SNO), which mediate the regulation of cellular function by NO. GSNOR plays an important role in regulating smooth muscle relaxation, immune function, inflammation, neuronal development, and carcinogenesis, but there is no report of the angiogenic relationship of GSNOR with pulmonary fibrosis.
Disclosure of Invention
The present application aims to solve at least one of the technical problems existing in the prior art. Therefore, the application provides an application of an S-nitrosylated glutathione reductase inhibitor in improving pulmonary fibrosis angiogenesis, and the GSNOR inhibitor can be used for effectively improving the pulmonary fibrosis angiogenesis.
In a first aspect of the application there is provided the use of at least one of the following a1 to a3 for the preparation of a product for improving angiogenesis in pulmonary fibrosis:
a1.s-nitrosylated glutathione;
inhibitors of a2 s-nitrosylated glutathione reductase;
a3. any one of a1 to a2 is a pharmaceutically acceptable salt.
The application according to the embodiment of the application has at least the following beneficial effects:
in the experimental process, the inhibition of S-nitrosylation can be used as a target point for improving angiogenesis of idiopathic pulmonary fibrosis, and the GSNOR inhibitor and/or exogenous GSNO can be provided for effectively increasing the blood vessel density in the lung tissue of a pulmonary fibrosis mouse model and promoting the angiogenesis; and also shows good vascularization ability to cells in vitro.
Wherein the inhibitor of S-nitrosylated glutathione reductase means a substance capable of inhibiting the expression of S-nitrosylated glutathione reductase and/or reducing the enzymatic activity of S-nitrosylated glutathione reductase.
In some embodiments of the application, the inhibitor is selected from any one of the following b1 to b 5:
b1. a substance for specifically editing the S-nitrosylated glutathione reductase gene;
b2. a substance that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase;
b3. a substance that specifically inhibits the expression level of S-nitrosylated glutathione reductase;
b4. a substance that specifically inhibits the activity of S-nitrosylated glutathione reductase;
b5. a vector comprising any one of b1 to b4.
The substance for specifically editing the S-nitrosylated glutathione reductase gene can be edited in such ways as knockout, replacement, homologous recombination and the like of the gene, so that the expression of the S-nitrosylated glutathione reductase is controlled. In some embodiments of the application, the substance that specifically edits the S-nitrosylated glutathione reductase gene is at least one of CRISPR/Cas, zinc finger ribonuclease ZFN, transcription activator-like effector nuclease TALEN, cre-LoxP recombinase.
Taking CRISPR/Cas as an example, the system generally comprises a CRISPR sequence and a CRISPR-associated nuclease, wherein the CRISPR sequence generally comprises a spacer sequence and a repeat sequence, and the CRISPR-associated nuclease is selected from at least one of Cas (e.g., cas1, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9, cas10, cas12 a-i, cas13 a-d, cas14 a-c), csa (Csa 1-5), csb (Csb 1-3), csc (Csc 1-2), cse (Cse 1-2), csf (Csf 1-4), csm (Csm 1-6), csn, csx (Csx 1-20), csy (Csy 1-3), cmr (Cmr 1-6).
Substances that specifically inhibit the mRNA level of S-nitrosylated glutathione reductase may inhibit the expression of S-nitrosylated glutathione reductase by controlling the silencing of the gene of S-nitrosylated glutathione reductase. In some embodiments of the application, the substance that specifically inhibits mRNA levels of S-nitrosylated glutathione reductase is selected from at least one of antisense nucleic acid sequences, siRNA, shRNA, dsRNA, miRNA. The materials can be obtained by knowing the gene sequence of the S-nitrosylated glutathione reductase, and then the materials can be designed by self by the existing software or can be designed by a related company.
In some embodiments of the application, the substance that specifically inhibits mRNA levels of S-nitrosylated glutathione reductase is an siRNA, the siRNA being selected from at least one of siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR 3;
wherein, the sense strand of siRNA GSNOR1 comprises a nucleotide sequence shown as SEQ ID No. 1:
AAUUCAGUCAUGAACCUGUUUUCTG (DNA from post 2nt TG) (SEQ ID No. 1); or (b)
The antisense strand of siRNA GSNOR1 comprises the nucleotide sequence shown as SEQ ID No. 2:
CAGAAAACAGGUUCAUGACUGAAUUAU (SEQ ID No. 2); or (b)
The sense strand of siRNA GSNOR2 comprises the nucleotide sequence shown as SEQ ID No. 3:
GUGUCUGAAUAUAUGUCCAAAAAGA (post 2nt GA is DNA) (SEQ ID No. 3); or (b)
The antisense strand of siRNA GSNOR2 comprises the nucleotide sequence shown as SEQ ID No. 4:
UCUUUUUGGACAUAUAUUCAGACACCA (SEQ ID No. 4); or (b)
The sense strand of siRNA GSNOR3 comprises the nucleotide sequence shown as SEQ ID No. 5:
UCCUUUGAAUGUAUUGGUAAUGUGA (post 2nt GA is DNA) (SEQ ID No. 5); or (b)
The antisense strand of siRNA GSNOR3 comprises the nucleotide sequence shown as SEQ ID No. 6:
UCACAUUACCAAUACAUUCAAAGGAAU(SEQ ID No.6)。
in some embodiments of the application, the sense strand of siRNA GSNOR1 is shown as SEQ ID No. 1; or (b)
The antisense strand of the siRNA GSNOR1 is shown as SEQ ID No. 2; or (b)
The sense strand of the siRNA GSNOR2 is shown as SEQ ID No. 3; or (b)
The antisense strand of the siRNA GSNOR2 is shown as SEQ ID No. 4; or (b)
The sense strand of the siRNA GSNOR3 is shown as SEQ ID No. 5; or (b)
The antisense strand of siRNA GSNOR3 is shown as SEQ ID No. 6.
In some embodiments of the application, the substance that specifically inhibits the activity of S-nitrosylated glutathione reductase may be an optional small molecule compound inhibitor, such as GSNOR small molecule inhibitors developed by N30 company (N30 Pharmaceuticals), such as any of the N6 series, N7 series, N9 series; GSNOR small molecule inhibitors developed by SAJE corporation (SAJE Pharma), such as any of SPL-334, SPL-850, and the like.
In some embodiments of the application, the substance that specifically inhibits the activity of S-nitrosylated glutathione reductase is at least one of N6022 (N30 Pharmaceuticals), N6547 (N30 Pharmaceuticals), N6338 (N30 Pharmaceuticals), N91115 (N30 Pharmaceuticals), N91138 (N30 Pharmaceuticals), SPL-334 (SAJE Pharmaceuticals).
Wherein, the structural formula of partial small molecule inhibitor is exemplified as follows:
the structural formula of N6022 is:
the structural formula of N91115 is:
SPL-334 has the structural formula:
in some embodiments of the present application, the amount of the substance that specifically inhibits S-nitrosylated glutathione reductase activity administered is 0.05 to 10mg/kg. For example, 0.05mg/kg, 0.1mg/kg, 0.2mg/kg, 0.5mg/kg, 1mg/kg, 1.5mg/kg, 2mg/kg, 2.5mg/kg, 3mg/kg, 3.5mg/kg, 4mg/kg, 4.5mg/kg, 5mg/kg, 5.5mg/kg, 6mg/kg, 6.5mg/kg, 7mg/kg, 7.5mg/kg, 8mg/kg, 8.5mg/kg, 9mg/kg, 9.5mg/kg, 10mg/kg may be used.
In some specific embodiments, the substance that specifically inhibits S-nitrosylated glutathione reductase activity is administered in an amount of 0.08 to 10mg/kg, 0.1 to 10mg/kg, 0.2 to 10mg/kg, 0.5 to 10mg/kg, 1 to 10mg/kg, 2 to 10mg/kg, 5 to 10mg/kg, 0.1 to 8mg/kg, 0.1 to 5mg/kg, 1 to 8mg/kg, 1 to 5mg/kg, 1 to 3mg/kg.
In some embodiments, the substance that specifically inhibits S-nitrosylated glutathione reductase activity is present in an angiogenesis product that ameliorates pulmonary fibrosis in an amount of 1 to 1000mg. For example, 1mg, 2mg, 2.5mg, 5mg, 10mg, 20mg, 25mg, 30mg, 40mg, 50mg, 60mg, 70mg, 80mg, 90mg, 100mg, 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, 900mg, 1000mg may be used.
In some specific embodiments, the substance that specifically inhibits S-nitrosylated glutathione reductase activity is present in an angiogenesis product that ameliorates pulmonary fibrosis in an amount of 2 to 1000mg, 2.5 to 1000mg, 5 to 1000mg, 10 to 1000mg, 20 to 1000mg, 50 to 1000mg, 100 to 1000mg, 200 to 1000mg, 500 to 1000mg, 1 to 800mg, 1 to 500mg, 1 to 200mg, 1 to 100mg, 20 to 500mg.
In some embodiments of the application, the support is any one of an inorganic support, an organic support, an inorganic-organic composite support. Wherein, the inorganic carrier comprises at least one of carbon nano tube, carbon dot, graphene, nano silicon dioxide or other inorganic nano carriers; the organic carrier comprises at least one of cholesterol, liposome, adenovirus carrier, adeno-associated virus carrier, slow virus carrier, retrovirus carrier and the like; the organic-inorganic composite carrier comprises at least one of metal-organic frameworks MOFs (such as ZIF, uiO, PCN, MIL), covalent organic frameworks COFs (such as Py-Azine, tpPa-1, TPB-DMTP, tpOMe-Pa1, dhaTth, LZU 1) and the like. In addition, the carrier may further be or further include at least one of colloidal dispersion systems, other macromolecular complexes, nanocapsules, microspheres, beads, oil-in-water emulsions, micelles, mixed micelles, solvents, dispersants, and the like.
In some embodiments of the application, the lung fibrosis is idiopathic pulmonary fibrosis.
In some embodiments of the application, the pulmonary fibrosis is bleomycin-induced pulmonary fibrosis.
In some embodiments of the application, the product is a medicament selected from at least one of a tablet, capsule, pill, suppository, aerosol, oral liquid, granule, powder, injection, lotion, tincture, film.
In some embodiments of the application, there is also provided the use of at least one of a1 to a3 for the preparation of a product for the treatment of pulmonary fibrosis. The above substances can improve pulmonary fibrosis angiogenesis.
In some embodiments of the application, there is also provided the use of at least one of a1 to a3 for the preparation of a product for promoting angiogenesis.
In a second aspect of the present application, there is also provided a composition comprising a first substance and a second substance, wherein the first substance is selected from at least one of S-nitrosylated glutathione or an inhibitor of S-nitrosylated glutathione reductase; the second substance is at least one selected from other medicines for treating pulmonary fibrosis and other medicines for improving angiogenesis of pulmonary fibrosis.
In some embodiments of the application, the other drug for treating pulmonary fibrosis is selected from pirfenidone, nidnib, methylprednisolone, prednisone, methotrexate, cyclophosphamide, bosentan, macitentan, sildenafil, N-acetylcysteine, proton pump inhibitors, histamine 2 receptor antagonists, other may also include anti-Connective Tissue Growth Factor (CTGF) antibodies, lysophosphatidic acid (LPA) inhibitors, N-pentaprotein (penetratin) -2, JAK-STAT signaling pathway inhibitors, phosphodiesterase 4 (PDE 4) inhibitors, TAS-115 (multiple cytokine receptor TKI), ifenesone, integrin (intel aVb 6) antagonists, histone deacetylase inhibitors, and the like.
In view of the above, the application provides an action target for removing S-nitrosylation, and can improve pulmonary fibrosis, in particular promote angiogenesis in idiopathic pulmonary fibrosis through a GSNOR small molecule inhibitor, exogenous GSNO, GSNOR small interference RNA (siRNA GSNOR) and the like.
Additional aspects and advantages of the application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the application.
Drawings
Fig. 1 is a flow chart and experimental results of the efficacy study of GSNOR inhibitor N6022 in example 1 of the present application on idiopathic pulmonary fibrosis. Wherein A is a schematic diagram of drug administration in a modeling process; b is the white blood cell count in the alveolar lavage fluid of the different groups,: p <0.05; * **: p <0.001; c is the results of HE staining and Masson staining of lung tissue of mice in the control group and the 30mg/kg group, the scale of HE staining and Masson staining in the first and second columns is 500 μm, and the scale of Masson staining magnification in the third column is 50 μm.
Fig. 2 is an experimental result of the efficacy study of GSNOR inhibitor N6022 in example 2 of the present application for improving idiopathic pulmonary fibrosis angiogenesis. Wherein A is the result of HE staining of lung tissue sections of model mice on days 0 and 21, and the scale is 50 μm; b is the endothelial cell specific staining results of model mice on day 0 and day 21, scale 100 μm; c is the endothelial cell specific staining result of the lung tissue sections of the control model mice and 30mg/kg mice on day 14, scale 100 μm.
Figure 3 is a graph showing the results of the efficacy study of GSNOR small interference RNA (siRNA GSNOR) on angiogenesis in vitro in example 3 of the present application. Wherein a is the relative expression amount of GSNOR mRNA of the control group and the experimental group detected by RT-PCR: p <0.0001; b is the level of GSNOR protein and internal reference beta-actin of the control group and experimental group detected by Western Blot (WB); c is a photograph of the ability of the control group and the experimental group to form a tube under matrigel culture conditions in the angiogenesis experiment, and the scale is 200 μm.
FIG. 4 is a graph showing the results of studies of efficacy of GSNOR inhibitors and exogenous GSNO on angiogenesis in vivo in example 4 of the application. Among them, from left to right are photographs of HE staining results of Matrigel blank, matrigel plug sections with addition of 6mM GSNO and 0.4mM SPL-334, respectively, on a scale of 100 μm.
Detailed Description
The conception and the technical effects produced by the present application will be clearly and completely described in conjunction with the embodiments below to fully understand the objects, features and effects of the present application. It is apparent that the described embodiments are only some embodiments of the present application, but not all embodiments, and that other embodiments obtained by those skilled in the art without inventive effort are within the scope of the present application based on the embodiments of the present application.
The following detailed description of embodiments of the application is exemplary and is provided merely to illustrate the application and is not to be construed as limiting the application.
In the description of the present application, the meaning of a number is one or more, the meaning of a number is two or more, and greater than, less than, exceeding, etc. are understood to exclude the present number, and the meaning of a number is understood to include the present number. The description of the first and second is for the purpose of distinguishing between technical features only and should not be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of the technical features indicated.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing embodiments of the application only and is not intended to be limiting of the application.
In the description of the present application, the descriptions of the terms "one embodiment," "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
The following description is made with reference to specific examples.
Example 1: efficacy study of GSNOR inhibitor N6022 on idiopathic pulmonary fibrosis
1. Animal model building
SPF-class 10 week old male C57BL/6J mice were randomly divided into 4 groups: normal group; control group (idiopathic pulmonary fibrosis model+pbs); 1mg/kg group (idiopathic pulmonary fibrosis model+1mg/kg N6022); 30mg/kg group (idiopathic pulmonary fibrosis model +30mg/kg N6022). Referring to a of fig. 1, the model of idiopathic pulmonary fibrosis is modeled as follows: the mice are anesthetized, the air outlet pipe is exposed by blunt separation, bleomycin (5U/kg) is injected into the air pipe for one time, and the mice are returned to the cage after natural awakening. N6022 was administered intraperitoneally once 24 hours prior to bleomycin stimulation. Significant pulmonary fibrosis characteristics have been demonstrated from day 14 to day 21 after bleomycin stimulation.
2. Collecting alveolar lavage fluid and cell counts
The bleomycin is sacrificed on day 14 after administration and the tracheal cannula is perfused with an appropriate amount of PBS buffer to prepare alveolar lavage fluid (BAL). After centrifugation at 1000g for 5min at 4℃the pellet (sediment) was washed twice and resuspended in 50. Mu.L PBS buffer, and the white blood cells were counted by a hemocytometer.
3. Morphological observation of lung tissue
Left lung tissues of each group of mice were fixed in 10% volume fraction neutral formaldehyde for 24 hours, paraffin-embedded, sectioned (thickness about 5 μm), and HE stained (hematoxylin stained for 2-5 min, eosin stained for 1 min) and Masson stained (Masson complex staining solution stained for 5 min) respectively, and pathological changes of the mouse tissues were observed under a microscope.
4. Experimental results
The results of alveolar lavage fluid leukocyte counts are shown in FIG. 1B, and the difference between the number of leukocytes in BAL of the control group model mice and the number of leukocytes in BAL of the normal group mice has statistical significance, which indicates that the control group modeling is successful. At the same time, the difference between the white blood cell number in BAL of 30mg/kg mice and the white blood cell number in control group has statistical significance, which shows that the GSNOR inhibitor N6022 of 30mg/kg significantly reduces the white blood cell number in BAL at 14 days, and the GSNOR inhibitor N6022 of 1mg/kg has shown a trend of reducing the white blood cell number in BAL at 14 days. The above results demonstrate that inhibitors of GSNOR are effective in inhibiting the number of inflammatory cells in fibrotic lung tissue.
The results of HE and Masson staining are shown in fig. 1C, and on day 14, lung tissue of control model mice showed a large amount of inflammatory cell infiltration and collagen fiber deposition, whereas lung tissue lesion-like areas were significantly reduced, collagen fiber distribution was reduced, and fibrotic areas were significantly reduced after pretreatment of 30mg/kg group with N6022, compared to control group. The above results indicate that inhibition of GSNOR can inhibit the progression of pulmonary fibrosis.
Example 2: efficacy study of GSNOR inhibitor N6022 for improving idiopathic pulmonary fibrosis angiogenesis
Referring to the procedure in example 1, a lung fibrosis mouse model was established using bleomycin in the same manner, and lung tissue sections of mice were subjected to HE staining and endothelial cell specific staining (CD 31) on day 0 and day 21, respectively.
The results are shown in fig. 2a and B, from which it can be seen that the blood vessel density in the lung tissue of the mice was significantly reduced on day 21 compared to day 0.
Furthermore, endothelial cell specific staining (CD 31) was performed on day 14 on mice of the control group and 30mg/kg group of example 1, and the results are shown in FIG. 2C, from which it can be seen that the vascular density in the lung tissue of bleomycin-induced pulmonary fibrosis mice was significantly increased by day 14 of modeling after drug treatment with 30mg/kg of GSNOR inhibitor N6022 in advance.
Example 3: efficacy study of GSNOR small interference RNA (siRNA GSNOR) on angiogenesis in vitro
siRNA GSNOR mix (siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR 3) was transfected into Human Umbilical Vein Endothelial Cells (HUVECs) using Lipofectamine RNAiMAX Reagent transfection reagents according to the transfection protocol described therein, knockdown GSNOR (ADH 5) expression.
The sequences of siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR3 are as follows:
wherein, the 25 bases of the sense strand, the first 23nt is RNA, the second 2nt is DNA overhang, and the 27 bases of the antisense strand are full-strand RNA.
siRNA GSNOR1：
Sense strand sequence (5 '-3'): AAUUCAGUCAUGAACCUGUUUUCTG (SEQ ID No. 1);
antisense strand sequence (5 '-3'): CAGAAAACAGGUUCAUGACUGAAUUAU (SEQ ID No. 2);
siRNA GSNOR2：
sense strand sequence (5 '-3'): GUGUCUGAAUAUAUGUCCAAAAAGA (SEQ ID No. 3);
antisense strand sequence (5 '-3'): UCUUUUUGGACAUAUAUUCAGACACCA (SEQ ID No. 4);
siRNA GSNOR3：
sense strand sequence (5 '-3'): UCCUUUGAAUGUAUUGGUAAUGUGA (SEQ ID No. 5);
antisense strand sequence (5 '-3'): UCACAUUACCAAUACAUUCAAAGGAAU (SEQ ID No. 6).
The results of the detection of GSNOR mRNA content and GSNOR protein content by RT-PCR and WB, respectively, are shown in FIG. 3A and B, and it can be seen from the graph that the three siRNA GSNOR knockdown GSNOR mRNA and protein levels in HUVEC cells successfully, which indicates that the GSNOR is down-regulated by the three siRNAs.
The following steps were taken for the vascularization experiments using the transfected HUVEC and the untransfected HUVEC of siRNA GSNOR mix as the experimental group and the control group, respectively:
matrigel was placed in an ice box overnight at 4 ℃ on the day before the experiment and allowed to slowly melt overnight. After the Matrigel is frozen and thawed, subpackaging the Matrigel into 96-well plates by using a precooling gun head on ice, and placing the Matrigel into an incubator for standing for 30-60 min until the Matrigel is solidified.
HUVECs of the above experimental group and control group were digested and resuspended to a density of 2×10 5 Mu.l of each well of a 96-well plate was added to each cell suspension per ml, followed by observation and photographing under a conventional culture 14-hour mirror in a cell culture incubator.
As shown in fig. 3C, it can be seen from the graph that the capacity of the HUVEC cells to form tubes after GSNOR down-regulation in the experimental group is significantly higher than that of the control group after the culture of matrigel for 14 hours, indicating that these GSNOR sirnas have good angiogenesis promoting effect.
Example 4: efficacy study of GSNOR inhibitors and exogenous GSNO on angiogenesis in vivo
mu.L Matrigel and PBS were mixed into 400ml (200 ng/ml VEGF; 60U/ml heparin) and subcutaneously injected into the abdomen of NOD-SCID mice, after 5 days the mice were sacrificed, the Matrigel plugs that had coagulated were removed, fixed, embedded, sectioned, and HE stained. Among them, matrigel is classified into three groups according to whether or not other ingredients are further added to its composition: control (blank), GSNO (with addition of GSNO 6 mM), SPL-334 (with addition of GSNOR small molecule inhibitor SPL-3340.4 mM). As shown in FIG. 4, the GSNOR inhibitor SPL-334 or exogenous GSNO can effectively enhance the matrigel thrombus vascularization ability of NOD-SCID mice, thus inhibiting protein S-nitrosylation (inhibiting GSNOR and exogenous GSNO supply) can remarkably promote blood vessel regeneration.
The present application has been described in detail with reference to the embodiments, but the present application is not limited to the embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, embodiments of the application and features of the embodiments may be combined with each other without conflict.

Claims (4)

1. Use of at least one of the following a 1-a 3 for the preparation of a product for improving angiogenesis of idiopathic pulmonary fibrosis:
a1.s-nitrosylated glutathione;
an inhibitor of s-nitrosylated glutathione reductase, the inhibitor comprising at least one of siRNA, a small molecule inhibitor;
a3. any one of a1 to a2 is a pharmaceutically acceptable salt;
the siRNA is at least one selected from siRNA GSNOR1, siRNA GSNOR2 and siRNA GSNOR 3;
wherein, the nucleotide sequence of the sense strand of the siRNA GSNOR1 is shown as SEQ ID No. 1; or (b)
The nucleotide sequence of the antisense strand of the siRNA GSNOR1 is shown as SEQ ID No. 2; or (b)
The nucleotide sequence of the sense strand of the siRNA GSNOR2 is shown as SEQ ID No. 3; or (b)
The nucleotide sequence of the antisense strand of the siRNA GSNOR2 is shown as SEQ ID No. 4; or (b)
The nucleotide sequence of the sense strand of the siRNA GSNOR3 is shown as SEQ ID No. 5; or (b)
The nucleotide sequence of the antisense strand of the siRNA GSNOR3 is shown as SEQ ID No. 6;
the small molecule inhibitor for specifically inhibiting the S-nitrosylated glutathione reductase is at least one of N6022 and SPL-334.
2. The use according to claim 1, wherein the small molecule inhibitor specifically inhibiting S-nitrosylated glutathione reductase is administered in an amount of 0.05 to 10mg/kg.
3. The use according to claim 1, wherein the inhibitor further comprises a carrier, the carrier being any one of an inorganic carrier, an organic carrier, an inorganic-organic composite carrier.
4. The use according to any one of claims 1 to 3, wherein the product is a medicament selected from at least one of tablets, capsules, pills, suppositories, aerosols, oral liquid preparations, granules, powders, injections, lotions, tinctures, films.
CN202211412053.5A 2022-11-11 2022-11-11 Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis Active CN115804829B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211412053.5A CN115804829B (en) 2022-11-11 2022-11-11 Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211412053.5A CN115804829B (en) 2022-11-11 2022-11-11 Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis

Publications (2)

Publication Number Publication Date
CN115804829A CN115804829A (en) 2023-03-17
CN115804829B true CN115804829B (en) 2023-12-12

Family

ID=85483434

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211412053.5A Active CN115804829B (en) 2022-11-11 2022-11-11 Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis

Country Status (1)

Country Link
CN (1) CN115804829B (en)

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2605707A1 (en) * 1996-12-31 1998-07-09 Antioxidant Pharmaceuticals Corporation Pharmaceutical preparations of glutathione and methods of administration thereof
CA2528155A1 (en) * 2003-06-04 2005-01-06 Duke University Compositions and methods for modulating s-nitrosoglutathione reductase
TW200825100A (en) * 2006-12-04 2008-06-16 Chi-Tsai Lin Protein and nucleic acid for glutathione-dependent formaldehyde dehydrogenase (GFD), alcohol dehydrogenase and S-nitrosoglutathione reductase from Antrodia camphorata, manufacturing method and uses therefor
EP2019318A1 (en) * 2007-07-27 2009-01-28 Erasmus University Medical Center Rotterdam Protein markers for cardiovascular events
CN101897948A (en) * 2010-07-16 2010-12-01 浙江大学 Application of S-nitroso glutathione
CN101991832A (en) * 2010-10-30 2011-03-30 支开叶 Medicament for treating idiopathic pulmonary fibrosis and preparation method thereof
CN103194466A (en) * 2013-04-24 2013-07-10 昆明理工大学 Lilium regale glutathione S-transferase gene LrGSTU5 and application thereof
JP2013143917A (en) * 2012-01-13 2013-07-25 Mie Univ Preventive or therapeutic agent for fibrosis
US9198909B1 (en) * 2007-12-13 2015-12-01 Indiana University Research And Technology Corporation Materials and methods for inhibiting mamalian S-nitrosoglutathione reductase
KR20180071722A (en) * 2016-12-20 2018-06-28 울산대학교 산학협력단 Inducing apoptosis of cancer cells selectively by targeting of glutathione, thioreodoxin, Nrf2 antioxidant systems
WO2018130702A1 (en) * 2017-01-16 2018-07-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Improved multi tyrosine kinase inhibitor therapy
WO2018191418A1 (en) * 2017-04-11 2018-10-18 Saje Pharma, Llc Carbazole compounds and methods of use thereof
CN109069501A (en) * 2016-03-18 2018-12-21 H4奥芬制药 H4 agonist molecule is used to treat the purposes of idiopathic pulmonary fibrosis
CN109943622A (en) * 2019-03-07 2019-06-28 南京医科大学 The medical usage of nitrosoglutathione reductase
EP3620164A1 (en) * 2018-09-05 2020-03-11 Genoscience Pharma SAS Substituted 2,4 diamino-quinoline as new medicament for fibrosis, autophagy and cathepsins b (ctsb), l (ctsl) and d (ctsd) related diseases
CN111303264A (en) * 2020-03-01 2020-06-19 沈阳药科大学 Anti-inflammatory analgesic active peptide GSN and RRD, and preparation and application thereof
CN111529524A (en) * 2020-04-24 2020-08-14 南京医科大学 Application of N6022 in prevention and treatment of aortic dissection and aortic aneurysm
WO2021217028A1 (en) * 2020-04-23 2021-10-28 University Hospitals - Cleveland Medical Center Compositions and methods for in vivo lung and blood sno repletion
CN114099536A (en) * 2021-11-19 2022-03-01 河南师范大学 Application of agent for down-regulating Czib gene expression in preparation of drugs for treating or improving pulmonary fibrosis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140023696A1 (en) * 2012-07-20 2014-01-23 Frederick Timothy Guilford Treatment for idiopathic pulmonary fibrosis
US20220193181A1 (en) * 2020-12-21 2022-06-23 Musc Foundation For Research Development S-nitrosoglutathione (gsno) and gsno reducatase inhibitors for use in therapy

Patent Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2605707A1 (en) * 1996-12-31 1998-07-09 Antioxidant Pharmaceuticals Corporation Pharmaceutical preparations of glutathione and methods of administration thereof
CA2528155A1 (en) * 2003-06-04 2005-01-06 Duke University Compositions and methods for modulating s-nitrosoglutathione reductase
TW200825100A (en) * 2006-12-04 2008-06-16 Chi-Tsai Lin Protein and nucleic acid for glutathione-dependent formaldehyde dehydrogenase (GFD), alcohol dehydrogenase and S-nitrosoglutathione reductase from Antrodia camphorata, manufacturing method and uses therefor
EP2019318A1 (en) * 2007-07-27 2009-01-28 Erasmus University Medical Center Rotterdam Protein markers for cardiovascular events
US9198909B1 (en) * 2007-12-13 2015-12-01 Indiana University Research And Technology Corporation Materials and methods for inhibiting mamalian S-nitrosoglutathione reductase
CN101897948A (en) * 2010-07-16 2010-12-01 浙江大学 Application of S-nitroso glutathione
CN101991832A (en) * 2010-10-30 2011-03-30 支开叶 Medicament for treating idiopathic pulmonary fibrosis and preparation method thereof
JP2013143917A (en) * 2012-01-13 2013-07-25 Mie Univ Preventive or therapeutic agent for fibrosis
CN103194466A (en) * 2013-04-24 2013-07-10 昆明理工大学 Lilium regale glutathione S-transferase gene LrGSTU5 and application thereof
CN109069501A (en) * 2016-03-18 2018-12-21 H4奥芬制药 H4 agonist molecule is used to treat the purposes of idiopathic pulmonary fibrosis
KR20180071722A (en) * 2016-12-20 2018-06-28 울산대학교 산학협력단 Inducing apoptosis of cancer cells selectively by targeting of glutathione, thioreodoxin, Nrf2 antioxidant systems
WO2018130702A1 (en) * 2017-01-16 2018-07-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Improved multi tyrosine kinase inhibitor therapy
WO2018191418A1 (en) * 2017-04-11 2018-10-18 Saje Pharma, Llc Carbazole compounds and methods of use thereof
CN110753683A (en) * 2017-04-11 2020-02-04 赛吉制药有限责任公司 Carbazole compounds and methods of use thereof
EP3620164A1 (en) * 2018-09-05 2020-03-11 Genoscience Pharma SAS Substituted 2,4 diamino-quinoline as new medicament for fibrosis, autophagy and cathepsins b (ctsb), l (ctsl) and d (ctsd) related diseases
CN109943622A (en) * 2019-03-07 2019-06-28 南京医科大学 The medical usage of nitrosoglutathione reductase
CN111303264A (en) * 2020-03-01 2020-06-19 沈阳药科大学 Anti-inflammatory analgesic active peptide GSN and RRD, and preparation and application thereof
WO2021217028A1 (en) * 2020-04-23 2021-10-28 University Hospitals - Cleveland Medical Center Compositions and methods for in vivo lung and blood sno repletion
CN111529524A (en) * 2020-04-24 2020-08-14 南京医科大学 Application of N6022 in prevention and treatment of aortic dissection and aortic aneurysm
CN114099536A (en) * 2021-11-19 2022-03-01 河南师范大学 Application of agent for down-regulating Czib gene expression in preparation of drugs for treating or improving pulmonary fibrosis

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Pharmacological In Vivo Inhibition of S-Nitrosoglutathione Reductase Attenuates Bleomycin-Induced Inflammation and Fibrosis;Irina G. Luzina等;《J Pharmacol Exp Ther》;13-22 *
The Role of S-nitrosoglutathione Reductase (GSNOR) in Human Disease and Therapy;Scott D. Barnett等;《Biochem Mol Biol》;340–354 *
Understanding the role of S-nitrosylation/nitrosative stress in inflammation and the role of cellular denitrosylases in inflammation modulation: Implications in health and diseases;Ajanta Chatterji等;《Free Radical Biology and Medicine》;604-621 *

Also Published As

Publication number Publication date
CN115804829A (en) 2023-03-17

Similar Documents

Publication Publication Date Title
Lan et al. Cordycepin ameliorates nonalcoholic steatohepatitis by activation of the AMP‐activated protein kinase signaling pathway
Chen et al. An agonist of the protective factor SIRT1 improves functional recovery and promotes neuronal survival by attenuating inflammation after spinal cord injury
Andreeff et al. Hexamethylene bisacetamide in myelodysplastic syndrome and acute myelogenous leukemia: a phase II clinical trial with a differentiation-inducing agent
US20210317529A9 (en) Compositions and methods for xi chromosome reactivation
Chen et al. Anti-fibrotic effects via regulation of transcription factor Sp1 on hepatic stellate cells
Tepes et al. Stable gastric pentadecapeptide BPC 157 therapy for primary abdominal compartment syndrome in rats
JP6389172B2 (en) Use of antithrombin in extracorporeal membrane oxygenator
Xie et al. Yes‐associated protein regulates the hepatoprotective effect of vitamin D receptor activation through promoting adaptive bile duct remodeling in cholestatic mice
CN115804829B (en) Use of S-nitrosylated glutathione reductase inhibitors for improving pulmonary fibrosis angiogenesis
US20230002770A1 (en) Il-34 antisense agents and methods of using same
US20210113654A1 (en) Methods and Compositions to Alleviate Vascular Permeability
US11793889B2 (en) Methods for selective kinase inhibition by endogenously produced antagonists of one or more kinases
WO2018214860A1 (en) Method and pharmaceutical composition for treating aplastic anemia
US20240226214A1 (en) Methods for treating inflammatory and fibrotic diseases and disorders
CN113209284B (en) Application of urinary trypsin inhibitor in preparation of medicine for treating hemophagocytic syndrome
CA2588369C (en) Methods of treatment and prevention of metabolic bone diseases and disorders
WO2023143479A1 (en) Small rna and use thereof in treatment of hyperlipidemia
US20240093197A1 (en) Il-34 antisense agents and methods of using same
WO2019237184A1 (en) Modulators of dna methylation and use thereof in medicine
CN110448568B (en) Application of auranofin in preparation of medicine for treating hereditary hemochromatosis
CN115300516A (en) Medicinal composition for treating rheumatoid arthritis and application thereof
KR20170005539A (en) Pharmaceutical composition for treating renal disease including dipyridamole as active ingredient
US20220135982A1 (en) Compositions for suppressing trim28 and uses thereof
CN118599000A (en) Application of LRP5 as targeting molecule in treatment of diabetic nephropathy
CN111067892A (en) Application of artesunate in treatment of primary sclerosing cholangitis model mouse

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant