CN115804829A

CN115804829A - Application of S-nitrosylation glutathione reductase inhibitor in improvement of pulmonary fibrosis angiogenesis

Info

Publication number: CN115804829A
Application number: CN202211412053.5A
Authority: CN
Inventors: 孟舒; 宋志敏; 张芸; 王耀锋; 陈静静; 张廷虹; 许梦珠
Original assignee: Guangzhou National Laboratory
Current assignee: Guangzhou National Laboratory
Priority date: 2022-11-11
Filing date: 2022-11-11
Publication date: 2023-03-17
Anticipated expiration: 2042-11-11
Also published as: CN115804829B

Abstract

The application discloses application of an S-nitrosylated glutathione reductase inhibitor in improvement of pulmonary fibrosis angiogenesis. In a first aspect of the application, the application provides the application of at least one of the following substances a1 to a3 in preparing the product for improving the angiogenesis of pulmonary fibrosis: a1. S-nitrosylated glutathione; an inhibitor of s-nitrosylated glutathione reductase; a3.A1 to a2. According to the application of the embodiment of the application, at least the following beneficial effects are achieved: in the experimental process, the inhibition of the de-S-nitrosylation can be used as a target for improving the angiogenesis of the idiopathic pulmonary fibrosis, and the blood vessel density in the lung tissue of a pulmonary fibrosis mouse model can be effectively increased and the angiogenesis is promoted by providing a GSNOR inhibitor and/or exogenous GSNO; and simultaneously shows good hemangiogenic capability for cells in vitro.

Description

Application of S-nitrosylation glutathione reductase inhibitor in improvement of pulmonary fibrosis angiogenesis

Technical Field

The application relates to the technical field of pulmonary fibrosis, in particular to application of an S-nitrosylation glutathione reductase inhibitor in improvement of pulmonary fibrosis angiogenesis.

Background

Idiopathic Pulmonary Fibrosis (IPF) is a chronic fatal disease characterized by progressive fibroblast proliferation, extensive deposition of extracellular Matrix (ECM) in lung tissue, destruction of alveolar structures, and sustained decline in lung function, ultimately leading to respiratory failure and death. The pathogenesis of IPF is multifaceted, including inflammatory responses, angiogenesis and remodeling, oxidative stress, fibrinolysis disorders, matrix metalloproteinases, and the like, and is not yet fully understood.

Among them, angiogenesis refers to the formation of a new microvascular network, which is mainly achieved by angiogenesis in the human body, and is actually a process in which vascular endothelial cells arranged along blood vessels proliferate to grow new capillaries from the existing vascular system, and is also an important physiological process in the processes of growth, tissue damage, repair and healing. Angiogenesis plays an important role in the pathogenesis of cancer, diabetic retinopathy, rheumatoid arthritis, atherosclerosis and other diseases. With the continuous and deep research on pulmonary fibrosis, the role of angiogenesis and remodeling in pulmonary fibrosis is increasingly emphasized, and is considered as a key link. In order to understand the integrity of blood vessels and the process of repair, it is necessary to determine factors in IPF that are related to angiogenesis.

In the lung under normal physiological conditions, angiogenesis and angiostatic factors regulate vascular homeostasis through a balance of both. Although earlier studies indicate that IPF is associated with increased angiogenesis, recent studies have shown a reduction in angiogenesis in IPF fibroblasts (Renzoni EA, et al, am J Respir Crit Care med.2003;167 (3): 438-43.; cosgrove GP, et al, am J Respir Crit Care med.2004;170 (3): 242-51.), with an upregulation of the expression level of angiogenesis inhibitors (vascular endothelin) (Sumi M, et al, J Clin Lab anal.2005;19 (4): 146-9.); in addition, in studies with LTBP4, it was found that it may affect pulmonary fibrosis by reducing angiogenesis leading to alveolar septal defects (Bultmann-Mellin I, et al, am J Physiol Lung Cell Mol physiol.2017;313, L687-L698.); VEGF, in turn, can repair damage to lung tissue and reduce the formation of pulmonary fibrosis by protecting endothelial cells, promoting angiogenesis, etc. (Derseh, et al., sci Rep.2009;9 (1): 19893); the above evidence supports the view that pulmonary fibrosis is hypoangiogenesis. Therefore, angiogenesis may be an important target of pulmonary fibrosis, and there is a need to develop products capable of improving angiogenesis so as to explore the treatment strategy of pulmonary fibrosis.

S-nitrosylated glutathione reductase (GSNOR) is the reductase of intracellular S-nitrosylated Glutathione (GSNO), the most predominant de-S-nitrosylating enzyme. Protein S-nitrosylation, the oxidative modification of cysteine by Nitric Oxide (NO), forms protein S-nitrosothiol (SNO), mediates the regulation of NO on cell function. GSNOR plays an important role in regulating smooth muscle relaxation, immune function, inflammation, neuronal development, and carcinogenesis, but there is no report on the angiogenic relationship of GSNOR with pulmonary fibrosis.

Disclosure of Invention

The present application is directed to solving at least one of the problems in the prior art. Therefore, the application provides the application of the S-nitrosylation glutathione reductase inhibitor in improving pulmonary fibrosis angiogenesis, and the GSNOR inhibitor can be used for effectively improving pulmonary fibrosis angiogenesis.

In a first aspect of the application, the application provides the application of at least one of the following substances a1 to a3 in preparing the product for improving the angiogenesis of pulmonary fibrosis:

a1. S-nitrosylated glutathione;

an inhibitor of s-nitrosylated glutathione reductase;

a3. Any one of a1 to a2 is a pharmaceutically acceptable salt.

According to the application of the embodiment of the application, at least the following beneficial effects are achieved:

in the experimental process, the inhibition of the de-S-nitrosylation can be used as a target for improving the angiogenesis of the idiopathic pulmonary fibrosis, and the blood vessel density in the lung tissue of a pulmonary fibrosis mouse model can be effectively increased and the angiogenesis is promoted by providing a GSNOR inhibitor and/or exogenous GSNO; and simultaneously shows good hemangioblast capacity for cells in vitro.

Wherein the inhibitor of S-nitrosylated glutathione reductase is a substance that inhibits the expression of S-nitrosylated glutathione reductase and/or reduces the enzymatic activity of S-nitrosylated glutathione reductase.

In some embodiments of the present application, the inhibitor is selected from any one of the following b1 to b 5:

b1. a substance that specifically edits an S-nitrosylated glutathione reductase gene;

b2. a substance that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase;

b3. a substance that specifically inhibits the expression level of S-nitrosylated glutathione reductase;

b4. a substance which specifically inhibits the activity of S-nitrosylated glutathione reductase;

b5. a carrier comprising any one of b1 to b4.

Substances for specifically editing the S-nitrosylated glutathione reductase gene can be edited by knocking out, replacing, homologous recombination and the like of the gene, so that the expression of the S-nitrosylated glutathione reductase is controlled. In some embodiments of the application, the agent that specifically edits the S-nitrosylated glutathione reductase gene is at least one of CRISPR/Cas, zinc finger ribonuclease ZFN, transcription activator-like effector nuclease TALEN, cre-LoxP recombinase.

Taking CRISPR/Cas as an example, the system usually comprises a CRISPR sequence and a CRISPR-associated nuclease, wherein the CRISPR sequence generally comprises a spacer sequence and a repeat sequence, and the CRISPR-associated nuclease is selected from at least one of Cas (such as Cas1, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9, cas10, cas12a to i, cas13a to d, cas14a to c), csa (Csa 1 to 5), csb (Csb 1 to 3), csc (Csc 1 to 2), cse (Cse 1 to 2), csf (Csf 1 to 4), csm (Csm 1 to 6), csn, csx (Csx 1 to 20), csy (Csy 1 to 3) and Cmr (Cmr 1 to 6).

A substance that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase can inhibit the expression of S-nitrosylated glutathione reductase by controlling the silencing of the gene of S-nitrosylated glutathione reductase. In some embodiments of the present application, the agent that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase is selected from at least one of the group consisting of an antisense nucleic acid sequence, siRNA, shRNA, dsRNA, miRNA. The above-mentioned substances can be obtained by knowing the sequence of the S-nitrosylated glutathione reductase gene and then designing them by itself or handing them to a related company by means of existing software.

In some embodiments of the present application, the agent that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase is siRNA selected from at least one of siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR 3;

wherein, the sense strand of the siRNA GSNOR1 comprises a nucleotide sequence shown as SEQ ID No. 1:

AAUUCAGUGCAUGAACCUGUUCTG (the last 2nt TG is DNA) (SEQ ID No. 1); or

The antisense strand of the siRNA GSNOR1 comprises a nucleotide sequence shown as SEQ ID No. 2:

CAGAAAACAGGUUCAUGAUGACUGAAUUAU (SEQ ID No. 2); or

The sense strand of the siRNA GSNOR2 comprises the nucleotide sequence shown as SEQ ID No. 3:

GUGUGUCUGAAUAUAUAUGUCCAAAAAGA (the last 2nt GA is DNA) (SEQ ID No. 3); or

The antisense strand of the siRNA GSNOR2 comprises the nucleotide sequence shown in SEQ ID No. 4:

UCUUUGGACAUAUUCAGACCA (SEQ ID No. 4); or

The sense strand of the siRNA GSNOR3 comprises a nucleotide sequence shown as SEQ ID No. 5:

UCCUUUGAAUGUAUGUAUGA (the later 2nt GA is DNA) (SEQ ID No. 5); or

The antisense strand of the siRNA GSNOR3 comprises the nucleotide sequence shown in SEQ ID No. 6:

UCACAUUACCAAUACAUUCAAAGGAAU(SEQ ID No.6)。

in some embodiments of the present application, the sense strand of the siRNA GSNOR1 is as set forth in SEQ ID No. 1; or

The antisense strand of the siRNA GSNOR1 is shown in SEQ ID No. 2; or

The sense strand of the siRNA GSNOR2 is shown as SEQ ID No. 3; or

The antisense strand of the siRNA GSNOR2 is shown in SEQ ID No. 4; or

The sense strand of the siRNA GSNOR3 is shown as SEQ ID No. 5; or

The antisense strand of siRNA GSNOR3 is shown in SEQ ID No. 6.

In some embodiments of the present application, the substance that specifically inhibits the activity of S-nitrosylated glutathione reductase can be an optional small molecule compound inhibitor, such as a GSNOR small molecule inhibitor developed by the N30 company (N30 Pharmaceuticals), such as any of the N6 series, N7 series, N9 series; GSNOR small molecule inhibitors developed by SAJE corporation (SAJE Pharma), such as any one of SPL-334, SPL-850, etc.

In some embodiments of the present application, the substance that specifically inhibits the activity of S-nitrosylated glutathione reductase is at least one of N6022 (N30 Pharmaceuticals), N6547 (N30 Pharmaceuticals), N6338 (N30 Pharmaceuticals), N91115 (N30 Pharmaceuticals), N91138 (N30 Pharmaceuticals), SPL-334 (SAJE Pharmaceuticals).

Wherein, the structural formula of part of the small molecule inhibitor is illustrated as follows:

the structural formula of N6022 is:

the structural formula of N91115 is:

the structural formula of SPL-334 is:

in some embodiments of the present application, the agent that specifically inhibits S-nitrosylated glutathione reductase activity is administered in an amount of 0.05 to 10mg/kg. For example, it may be 0.05mg/kg, 0.1mg/kg, 0.2mg/kg, 0.5mg/kg, 1mg/kg, 1.5mg/kg, 2mg/kg, 2.5mg/kg, 3mg/kg, 3.5mg/kg, 4mg/kg, 4.5mg/kg, 5mg/kg, 5.5mg/kg, 6mg/kg, 6.5mg/kg, 7mg/kg, 7.5mg/kg, 8mg/kg, 8.5mg/kg, 9mg/kg, 9.5mg/kg, 10mg/kg.

In some specific embodiments, the amount of the substance that specifically inhibits S-nitrosylated glutathione reductase activity is 0.08 to 10mg/kg, 0.1 to 10mg/kg, 0.2 to 10mg/kg, 0.5 to 10mg/kg, 1 to 10mg/kg, 2 to 10mg/kg, 5 to 10mg/kg, 0.1 to 8mg/kg, 0.1 to 5mg/kg, 1 to 8mg/kg, 1 to 5mg/kg, 1 to 3mg/kg.

In some specific embodiments, the agent that specifically inhibits S-nitrosylated glutathione reductase activity is present in the vascular neo-products for the improvement of pulmonary fibrosis in an amount of 1 to 1000mg. Examples of the amount of the surfactant include 1mg, 2mg, 2.5mg, 5mg, 10mg, 20mg, 25mg, 30mg, 40mg, 50mg, 60mg, 70mg, 80mg, 90mg, 100mg, 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, 900mg and 1000mg.

In some specific embodiments, the amount of the substance that specifically inhibits S-nitrosylated glutathione reductase activity in the angiogenesis product for improving pulmonary fibrosis is 2 to 1000mg, 2.5 to 1000mg, 5 to 1000mg, 10 to 1000mg, 20 to 1000mg, 50 to 1000mg, 100 to 1000mg, 200 to 1000mg, 500 to 1000mg, 1 to 800mg, 1 to 500mg, 1 to 200mg, 1 to 100mg, 20 to 500mg.

In some embodiments of the present application, the support is any one of an inorganic support, an organic support, an inorganic-organic composite support. Wherein, the inorganic carrier includes but is not limited to at least one of carbon nano tube, carbon dot, graphene, nano silicon dioxide or other inorganic nano carriers; organic vectors include, but are not limited to, at least one of cholesterol, liposomes, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, retroviral vectors, and the like; the organic-inorganic composite carrier includes, but is not limited to, at least one of metal organic frameworks MOFs (such as ZIF, uiO, PCN, MIL), covalent organic frameworks COFs (such as Py-Azine, tpPa-1, TPB-DMTP, tpOMe-Pa1, dhatph, LZU 1) and the like. In addition, the carrier may further comprise or comprise at least one of colloid dispersion system, other macromolecule compound, nanocapsule, microsphere, bead, oil-in-water emulsion, micelle, mixed micelle, solvent, dispersant, etc.

In some embodiments of the present application, the pulmonary fibrosis is idiopathic pulmonary fibrosis.

In some embodiments of the present application, the pulmonary fibrosis is bleomycin-induced pulmonary fibrosis.

In some embodiments of the present application, the product is a medicament selected from at least one of a tablet, a capsule, a pill, a suppository, an aerosol, an oral liquid, a granule, a powder, an injection, a lotion, a tincture, and a film.

In some embodiments of the present application, there is also provided the use of at least one of substances a1 to a3 in the preparation of a product for the treatment of pulmonary fibrosis. The above substances can improve angiogenesis of pulmonary fibrosis.

In some embodiments of the application, the application of at least one substance from a1 to a3 in preparing products for promoting angiogenesis is also provided.

In a second aspect of the present application, there is also provided a composition comprising a first substance and a second substance, wherein the first substance is selected from at least one of S-nitrosylated glutathione or an inhibitor of S-nitrosylated glutathione reductase; the second substance is at least one selected from the group consisting of other drugs for treating pulmonary fibrosis, and other drugs for improving angiogenesis of pulmonary fibrosis.

In some embodiments of the present application, the additional agent for treating pulmonary fibrosis is selected from pirfenidone, nintedanib, methylprednisolone, prednisone, methotrexate, cyclophosphamide, bosentan, macitentan, sildenafil, N-acetylcysteine, proton pump inhibitors, histamine 2 receptor antagonists, others may also include anti-Connective Tissue Growth Factor (CTGF) antibodies, lysophosphatidic acid (LPA) inhibitors, pentraxin (penetratin) -2, JAK-STAT signaling pathway inhibitors, phosphodiesterase 4 (PDE 4) inhibitors, TAS-115 (various cytokine receptors TKI), imatinib, integrin (integrina vb 6) antagonists, histone deacetylase inhibitors, and the like.

In summary, the present application provides an action target for de-S-nitrosylation, which can improve pulmonary fibrosis, especially promote angiogenesis in idiopathic pulmonary fibrosis, through GSNOR small molecule inhibitor, exogenous GSNO and GSNOR small interfering RNA (siRNA GSNOR), etc.

Additional aspects and advantages of the present application will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the present application.

Drawings

Fig. 1 is an experimental procedure and experimental results of the efficacy study of the GSNOR inhibitor N6022 on idiopathic pulmonary fibrosis in example 1 of the present application. Wherein, A is a schematic diagram of administration in a modeling process; b is the white blood cell count in different groups of alveolar lavage fluid: p <0.05; * **: p <0.001; c is the results of HE staining and Masson staining of lung tissue in control and 30mg/kg mice, the scale of HE staining and Masson staining in the first and second columns is 500 μm, and the scale of the third column is 50 μm in the magnified view of Masson staining.

Fig. 2 is the experimental result of the study of the efficacy of GSNOR inhibitor N6022 on improving angiogenesis of idiopathic pulmonary fibrosis in example 2 of the present application. Wherein A is the lung tissue section HE staining result of the model mouse on the 0 th day and the 21 st day, and the scale is 50 μm; b is the endothelial cell specific staining result of the model mouse on day 0 and day 21, and the scale is 100 μm; c is the result of endothelial cell-specific staining of lung tissue sections on day 14 of control group model mice and 30mg/kg group mice, and the scale is 100 μm.

FIG. 3 is the results of in vitro angiogenesis efficacy studies of GSNOR small interfering RNA (siRNA GSNOR) in example 3 of the present application. Wherein a is the relative expression amount of GSNOR mRNA of the control group and experimental group detected by RT-PCR: p <0.0001; b is the levels of GSNOR protein and internal reference beta-actin detected by Western Blot (WB) in the control group and the experimental group; c is a photograph of tube forming ability of the control group and the experimental group in the blood vessel formation experiment under the matrigel culture condition, and the scale is 200 μm.

Fig. 4 is the results of the study of the efficacy of GSNOR inhibitors and exogenous GSNO on angiogenesis in vivo in example 4 of the present application. From left to right, HE staining results of Matrigel blank, 6mM GSNO added, and 0.4mM SPL-334 added sections of Matrigel plug were shown in 100 μm scale.

Detailed Description

The conception and the resulting technical effects of the present application will be clearly and completely described in conjunction with the embodiments below, so that the objects, features and effects of the present application can be fully understood. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all embodiments, and other embodiments obtained by those skilled in the art without inventive efforts based on the embodiments of the present application belong to the protection scope of the present application.

The following detailed description of embodiments of the present application is provided for the purpose of illustration only and is not intended to be construed as a limitation of the application.

In the description of the present application, the meaning of a plurality is one or more, the meaning of a plurality is two or more, and the above, below, exceeding, etc. are understood as excluding the present number, and the above, below, within, etc. are understood as including the present number. If the first and second are described for the purpose of distinguishing technical features, they are not to be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of the technical features indicated.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing embodiments of the present application only and is not intended to be limiting of the application.

In the description of the present application, reference to the description of "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples", etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The following description is given with reference to specific examples.

Example 1: efficacy study of GSNOR inhibitor N6022 on idiopathic pulmonary fibrosis

1. Establishment of animal model

SPF grade 10 week old male C57BL/6J mice were randomly divided into 4 groups: a normal group; control group (idiopathic pulmonary fibrosis model + PBS); 1mg/kg group (idiopathic pulmonary fibrosis model +1mg/kg N6022); the 30mg/kg group (idiopathic pulmonary fibrosis model +30mg/kg N6022). Referring to a of fig. 1, the modeling approach of the idiopathic pulmonary fibrosis model is as follows: the mice are anesthetized, the air outlet pipe is exposed through blunt separation, bleomycin (5U/kg) is injected into the air pipe at one time, and the mice are returned to the cage after naturally reviving. N6022 was administered intraperitoneally 24 hours prior to bleomycin challenge. Significant pulmonary fibrosis characteristics have occurred 14-21 days after bleomycin challenge.

2. Collection of alveolar lavage fluid and cell counts

On day 14 after bleomycin administration, alveolar lavage fluid (BAL) was prepared by perfusing the trachea cannula with the appropriate amount of PBS buffer. After centrifugation at 1000g for 5min at 4 ℃, the cell pellet (pellet) was washed twice and resuspended in 50 μ L PBS buffer, from which the leukocytes were counted by a hemocytometer.

3. Morphological observation of lung tissue

The left lung tissues of each group of mice are fixed in neutral formaldehyde with 10% volume fraction for 24h, embedded in paraffin and sliced (the thickness is about 5 mu m), and then HE staining (hematoxylin staining for 2-5 min, and eosin staining for 1 min) and Masson staining (Masson complex staining solution staining for 5 min) are respectively carried out, and the pathological changes of the mouse tissues are observed under a microscope.

4. Results of the experiment

The alveolar lavage fluid leukocyte count results are shown in fig. 1B, and the difference between the number of leukocytes in BAL of the control group model mice and the number of leukocytes in BAL of the normal group model mice has statistical significance, indicating that the control group modeling was successful. Meanwhile, the difference between the number of leukocytes in BAL of the 30mg/kg group mice and the number of leukocytes in the control group was also statistically significant, indicating that 30mg/kg of GSNOR inhibitor N6022 significantly reduced the number of leukocytes in BAL at 14 days, whereas 1mg/kg of GSNOR inhibitor N6022 exhibited a tendency to reduce the number of leukocytes in BAL at 14 days. The above results demonstrate that inhibitors of GSNOR are effective in inhibiting the number of inflammatory cells in fibrotic lung tissue.

HE and Masson staining results as shown in C of fig. 1, at day 14, lung tissues of control group model mice exhibited a large amount of inflammatory cell infiltration and collagen fiber deposition, whereas the diseased lung tissue areas were significantly reduced, the collagen fiber distribution was decreased, and the fibrotic areas were significantly reduced after the 30mg/kg group had been previously treated with N6022, compared to the control group. The above results indicate that inhibition of GSNOR can inhibit the progression of pulmonary fibrosis.

Example 2: efficacy study of GSNOR inhibitor N6022 on improvement of angiogenesis of idiopathic pulmonary fibrosis

Referring to the procedure of example 1, a pulmonary fibrosis mouse model was established using bleomycin in the same manner, and HE staining and endothelial cell specific staining (CD 31) were performed on lung tissue sections of the mice on day 0 and day 21, respectively.

The results are shown in a and B of fig. 2, from which it can be seen that the vascular density in lung tissue of mice was significantly reduced at day 21 compared to day 0.

In addition, endothelial cell-specific staining (CD 31) was performed on day 14 for the mice of the control group and the 30mg/kg group in example 1, and as a result, as shown in C of FIG. 2, it can be seen from the graph that the blood vessel density in the lung tissue of the bleomycin-induced pulmonary fibrosis mice was significantly increased after the drug treatment with the GSNOR inhibitor N6022 of 30mg/kg in advance to the modeled day 14.

Example 3: efficacy of GSNOR Small interfering RNA (siRNA GSNOR) on in vitro angiogenesis

The siRNA GSNOR mix (siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR 3) was transfected into Human Umbilical Vein Endothelial Cells (HUVEC) using Lipofectamine RNAiMAX Reagent transfection Reagent following the transfection protocol of its instructions, knocking down GSNOR (ADH 5) expression.

The sequences of siRNA GSNOR1, siRNA GSNOR2 and siRNA GSNOR3 are as follows:

wherein, the sense strand has 25 bases, the first 23nt is RNA, the second 2nt is DNA overhang, and the antisense strand has 27 bases and is whole-strand RNA.

siRNA GSNOR1：

Sense strand sequence (5 '-3'): AAUUCAGUGCAUGAACCUGUUUCTG (SEQ ID No. 1);

antisense strand sequence (5 '-3'): CAGAAAACAGGUUCAUUGACUGAAUUAAU (SEQ ID No. 2);

siRNA GSNOR2：

sense strand sequence (5 '-3'): GUGUGUCUGAAUAUAUAUGUCCAAAAAGA (SEQ ID No. 3);

antisense strand sequence (5 '-3'): UCUUUGGACAUAUUCAGACCA (SEQ ID No. 4);

siRNA GSNOR3：

sense strand sequence (5 '-3'): UCCUUUGAAUGUAUGUAUGUGA (SEQ ID No. 5);

antisense strand sequence (5 '-3'): UCACAUACAUUUCAAUCAAAGGAAUU (SEQ ID No. 6).

The results of detecting the mRNA level of GSNOR and the protein level of GSNOR in the cells by RT-PCR and WB respectively are shown in A and B of FIG. 3, and it can be seen from the figure that the three siRNA GSNOR successfully knockdown the mRNA and protein levels of GSNOR in HUVEC cells, indicating that the three siRNA achieve the down-regulation of GSNOR.

The HUVEC transfected with siRNA GSNOR mix and the non-transfected HUVEC are taken as an experimental group and a control group respectively to carry out an angiogenesis experiment, and the steps are as follows:

the day before the experiment Matrigel was placed in an ice box overnight at 4 ℃ in a refrigerator and allowed to slowly melt overnight. After the Matrigel is frozen and thawed, subpackaging the Matrigel into 96-well plates by using a precooling gun head on ice, and placing the 96-well plates into an incubator for standing for 30-60 min until the Matrigel is solidified.

HUVEC of the experimental group and the control group are digested and resuspended to a density of 2X 10 ⁵ The cells were suspended at a concentration of 50. Mu.l/well in a 96-well plate, and then cultured in a cell culture chamber for 14 hours under a conventional microscope to take photographs.

The results are shown in fig. 3C, and it can be seen from the figure that after GSNOR is down-regulated in the experimental group, the tube forming ability of HUVEC cells in matrigel culture for 14 hours is significantly higher than that of the control group, indicating that these GSNOR sirnas have good angiogenesis promoting effect.

Example 4: efficacy study of GSNOR inhibitor and exogenous GSNO on in vivo angiogenesis

A400 ml volume of VEGF 200ng/ml mixture of 300. Mu.L Matrigel and PBS was injected subcutaneously into the abdomen of NOD-SCID mice, and after 5 days, the mice were sacrificed, and the coagulated Matrigel plugs were removed, fixed, embedded, sectioned, and HE-stained. The Matrigel is divided into three groups according to whether other components are added to the Matrigel according to the composition: control group (blank control), GSNO group (adding GSNO 6 mM), SPL-334 group (adding GSNOR small molecule inhibitor SPL-3340.4 mM). As shown in FIG. 4, the GSNOR inhibitor SPL-334 or exogenous GSNO can effectively enhance the matrigel thrombus vascularization ability in NOD-SCID mice, so that inhibition of protein de-S-nitrosylation (inhibition of GSNOR and exogenous supply of GSNO) can significantly promote angiogenesis.

The present application has been described in detail with reference to the embodiments, but the present application is not limited to the embodiments described above, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present application. Furthermore, the embodiments and features of the embodiments of the present application may be combined with each other without conflict.

Claims

1. The application of at least one substance in a 1-a 3 in preparing a product for improving angiogenesis of pulmonary fibrosis:

a1. S-nitrosylated glutathione;

an inhibitor of s-nitrosylated glutathione reductase;

a3. Any one of a1 to a2 is a pharmaceutically acceptable salt.

2. The use according to claim 1, wherein the inhibitor is selected from any one of the following b1 to b 5:

b4. a substance that specifically inhibits the activity of S-nitrosylated glutathione reductase;

b5. a carrier comprising any one of b1 to b4.

3. Use according to claim 2, wherein the substance specifically editing the S-nitrosylated glutathione reductase gene is at least one of CRISPR/Cas, ZFN, TALEN, cre-LoxP.

4. The use according to claim 2, wherein the substance that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase is selected from at least one of the group consisting of an antisense nucleic acid sequence, siRNA, shRNA, dsRNA, miRNA.

5. The use according to claim 4, wherein the substance that specifically inhibits the mRNA level of S-nitrosylated glutathione reductase is siRNA selected from at least one of siRNA GSNOR1, siRNA GSNOR2, siRNA GSNOR 3;

wherein, the sense strand of the siRNA GSNOR1 comprises a nucleotide sequence shown as SEQ ID No. 1; or

The antisense strand of the siRNA GSNOR1 comprises a nucleotide sequence shown as SEQ ID No. 2; or

The sense strand of the siRNA GSNOR2 comprises a nucleotide sequence shown as SEQ ID No. 3; or

The antisense strand of siRNA GSNOR2 comprises a nucleotide sequence shown as SEQ ID No. 4; or

The sense strand of the siRNA GSNOR3 comprises a nucleotide sequence shown as SEQ ID No. 5; or

The antisense strand of the siRNA GSNOR3 comprises the nucleotide sequence shown in SEQ ID No. 6.

6. The use according to claim 2, wherein the substance that specifically inhibits the activity of S-nitrosylated glutathione reductase is at least one of N6022, N6547, N6338, N91115, N91138, SPL-334.

7. The use according to claim 6, wherein the substance which specifically inhibits the activity of S-nitrosylated glutathione reductase is administered in an amount of 0.05 to 10mg/kg.

8. The use according to claim 2, wherein the support is any one of an inorganic support, an organic support, and an inorganic-organic composite support.

9. The use according to any one of claims 1 to 8, wherein the pulmonary fibrosis is idiopathic pulmonary fibrosis.

10. The use according to any one of claims 1 to 8, wherein the product is a medicament selected from at least one of tablets, capsules, pills, suppositories, aerosols, oral liquid preparations, granules, powders, injections, lotions, tinctures, and films.