WO2018107228A1 - Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof - Google Patents

Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof Download PDF

Info

Publication number
WO2018107228A1
WO2018107228A1 PCT/AU2017/051385 AU2017051385W WO2018107228A1 WO 2018107228 A1 WO2018107228 A1 WO 2018107228A1 AU 2017051385 W AU2017051385 W AU 2017051385W WO 2018107228 A1 WO2018107228 A1 WO 2018107228A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
set forth
nucleic acid
sequence set
shmir
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2017/051385
Other languages
English (en)
French (fr)
Inventor
Vanessa STRINGS-UFOMBAH
David Suhy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Benitec Biopharma Pty Ltd
Original Assignee
Benitec Biopharma Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2019532105A priority Critical patent/JP7233149B2/ja
Priority to MX2019007110A priority patent/MX2019007110A/es
Priority to IL267353A priority patent/IL267353B2/en
Priority to RU2019121950A priority patent/RU2763319C2/ru
Priority to EP17882179.9A priority patent/EP3555294A4/en
Priority to US16/469,992 priority patent/US11142765B2/en
Priority to CN202410482087.4A priority patent/CN118421624A/zh
Priority to KR1020197019981A priority patent/KR102495222B1/ko
Priority to AU2017377661A priority patent/AU2017377661B2/en
Priority to CN201780086338.5A priority patent/CN110382698B/zh
Priority to IL304674A priority patent/IL304674B2/en
Priority to CA3047154A priority patent/CA3047154A1/en
Application filed by Benitec Biopharma Pty Ltd filed Critical Benitec Biopharma Pty Ltd
Priority to BR112019012312-1A priority patent/BR112019012312B1/pt
Priority to KR1020237003441A priority patent/KR102667867B1/ko
Publication of WO2018107228A1 publication Critical patent/WO2018107228A1/en
Anticipated expiration legal-status Critical
Priority to JP2023023159A priority patent/JP7431359B2/ja
Priority to AU2023222827A priority patent/AU2023222827B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/861Adenoviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/864Parvoviral vectors, e.g. parvovirus, densovirus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/867Retroviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell
    • C12N2330/51Specially adapted vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10041Use of virus, viral particle or viral elements as a vector
    • C12N2710/10043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/10041Use of virus, viral particle or viral elements as a vector
    • C12N2740/10043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • OPMD oculopharyngeal muscular dystrophy
  • RNA interference RNA interference
  • OPMD ociilopharyiigeal muscular dystrophy
  • OPMD is an autosomal dominant inherited, slow progressing, late-onset degenerative muscle disorder.
  • the disease is mainly characterised by progressive eyelid drooping (ptosis) and swallowing difficulties (dysphagia).
  • the pharyngeal and cricopharyngeal muscles are specific targets in OPMD.
  • Ptoxiaral limb weakness lends to follow at a later stage of disease progression.
  • the mutation that causes the disease is an abnormal expansion of a (GCN)n trinucleotide repeat in the coding region of the poly(A.) binding protein nuclear 1
  • PABPNl PABPNl gene. This expansion leads to an expanded polyalanine tract at the N -terminal of the PABPNl protein: 10 alanines are present in the normal protein, expanded to 1 1 to 18 alanines in the mutant form (expPABPNl).
  • the main pathological hallmark of the disease is nuclear aggregates of expPABPNl.
  • a misfolding of expanded PABPNl results in the accumulation of insoluble polymeric fibrillar aggregates inside nuclei of affected cells.:
  • PABPNl is an aggregation prone protein and mutant alanine-expanded PABPN l in OPMD has a higher aggregation rate than that of the wild type normal protein.
  • the nuclear aggregates in OPMD have a pathological function or a protective role as a consequence of a cellular defence mechanism,
  • Symptomatic surgical interventions can partly correct ptosis and improve swallowing in. moderate to severely affected individuals.
  • the cricopharyngeal myotomy is at present the only possible treatment available to improve swallowing in these patients.
  • the present disclosure is based, in part, on the recognition by the inventors that no therapeutic agents currently exist for the treatment of OPMD.
  • the present disclosure therefore provides RNAi reagents targeting regions of the PABPNl mRNA transcript which is causative of OPMD.
  • the inventors have shown that these RNAi reagents are effective for post-transcriptional suppression of PABPNl mRNA transcripts, including transcript variants which would otherwise be translated into the mutant PABPNl protein causative of OPMD i.e., those PABPNl proteins comprising an expanded polyalanine tract.
  • exemplary RNAi reagents of the disclosure inhibit or reduce expression of PABPNl protein in vitro.
  • the present disclosure provides reagents for expression of wild-type human PABPNl protein having a mRNA transcript which is not targeted by the RNAi reagents of the disclosure (hereinafter "PABPNl replacement reagents").
  • PABPNl replacement reagents The inventors have shown that when expressed in conjunction with the RNAi reagents of the disclosure, the PABPNl replacement reagents are capable of producing a PABPNl transcript which is resistant to the RNAi reagents and which is capable of being translated into functional PABPNl protein.
  • the present disclosure provides a nucleic acid comprising a DNA sequence which encodes a short hairpin micro-RNA (shmiR), said shmiR comprising: an effector sequence of at least 17 nucleotides in length;
  • pri-miRNA primary micro RNA
  • the effector sequence is substantially complementary to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13.
  • the effector sequence will be less than 30 nucleotides in length.
  • a suitable effector sequence may be in the range of 17-29 nucleotides in length.
  • the effector sequence will be 20 nucleotides in length. More preferably, the effector sequence will be 21 nucleotides in length and the effector complement sequence will be 20 nucleotides in length.
  • the effector sequence may comprise 4 base pair mismatches relative to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13 to which the effector sequence is substantially complementary.
  • the effector sequence comprises 3 base pair mismatches relative to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13 to which the effector sequence is substantially complementary.
  • the effector sequence comprises 2 base pair mismatches relative to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13 to which the effector sequence is substantially complementary.
  • the effector sequence comprises 1 base pair mismatch relative to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13 to which the effector sequence is substantially complementary.
  • the effector sequence is 100% complementary to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1- 13. Where mismatches are present, it is preferred that they are not located within the region corresponding to the seed region of the shmiR i.e., nucleotides 2-8 of the effector sequence.
  • shmiR2 comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 1 are described herein (hereinafter referred to as "shmiR2").
  • shmiR3 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 2 are described herein (hereinafter referred to as "shmiR3")- Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 3 are described herein (hereinafter referred to as "shmiR4"). Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 4 are described herein (hereinafter referred to as "shmiR5")-
  • shmiR6 comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 5 are described herein (hereinafter referred to as "shmiR6")-
  • shmiR7 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 6 are described herein (hereinafter referred to as "shmiR7").
  • shmiR9 comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 7 are described herein (hereinafter referred to as "shmiR9")-
  • shmiRl 1 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 8 are described herein (hereinafter referred to as "shmiRl 1").
  • shmiR13 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 9 are described herein (hereinafter referred to as "shmiR13")-
  • shmiR14 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 10 are described herein (hereinafter referred to as "shmiR14").
  • shmiR15 Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 11 are described herein (hereinafter referred to as "shmiR15”)- Exemplary shmiRs comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 12 are described herein (hereinafter referred to as "shmiR16”)-
  • shmiR17 comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 13 are described herein (hereinafter referred to as "shmiR17").
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR selected from the group consisting of: a shmiR comprising: (i) an effector sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 14 with the exception of 1, 2, 3 or 4 base mismatches, provided that the effector sequence is capable of forming a duplex with a sequence set forth in SEQ ID NO: 14; and (ii) an effector complement sequence comprising a sequence which is substantially complementary to the effector sequence (shmiR2); a shmiR comprising: (i) an effector sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 16 with the exception of 1, 2, 3 or 4 base mismatches, provided that the effector sequence is capable of forming a duplex with a sequence set forth in SEQ ID NO: 16; and (ii) an effector complement sequence comprising a sequence which is substantially complementary to the effector sequence (shmiR3); a shm
  • nucleic acid described herein may comprise a DNA sequence encoding a shmiR selected from the group consisting of:
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:15 and capable of forming a duplex therewith (shmiR2);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 17 and capable of forming a duplex therewith (shmiR3);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 19 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 19 and capable of forming a duplex therewith (shmiR4);
  • shmiR comprising an effector sequence set forth in SEQ ID NO:21 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:21 and capable of forming a duplex therewith (shmiR5);
  • shmiR comprising an effector sequence set forth in SEQ ID NO:23 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:23 and capable of forming a duplex therewith (shmiR6);
  • shmiR comprising an effector sequence set forth in SEQ ID NO:25 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:25 and capable of forming a duplex therewith (shmiR7);
  • shmiR comprising an effector sequence set forth in SEQ ID NO:27 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:27 and capable of forming a duplex therewith (shmiR9);
  • shmiRl l comprising an effector sequence set forth in SEQ ID NO:29 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:29 and capable of forming a duplex therewith (shmiRl l);
  • shmiR13 a shmiR comprising an effector sequence set forth in SEQ ID NO:31 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:31 and capable of forming a duplex therewith
  • shmiR14 a shmiR comprising an effector sequence set forth in SEQ ID NO:33 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:33 and capable of forming a duplex therewith
  • shmiR comprising an effector sequence set forth in SEQ ID NO:35 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:35 and capable of forming a duplex therewith (shmiR15);
  • shmiR comprising an effector sequence set forth in SEQ ID NO:37 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:37 and capable of forming a duplex therewith (shmiR16);
  • shmiR17 comprising an effector sequence set forth in SEQ ID NO:39 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:39 and capable of forming a duplex therewith (shmiR17).
  • the shmiR encoded by the nucleic acid described herein may comprise an effector complement sequence comprising 1, 2, 3 or 4 mismatches relative to the corresponding effector sequence, provided that the cognate effector and effector complement sequences are capable of forming a duplex region.
  • nucleic acid described herein may comprise a DNA sequence encoding a shmiR selected from the group consisting of:
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence set forth in SEQ ID NO: 14 (shmiR2);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 19 and an effector complement sequence set forth in SEQ ID NO: 18 (shmiR4);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 21 and an effector complement sequence set forth in SEQ ID NO: 20 (shmiR5);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 23 and an effector complement sequence set forth in SEQ ID NO: 22 (shmiR6);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 25 and an effector complement sequence set forth in SEQ ID NO: 24 (shmiR7);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 27 and an effector complement sequence set forth in SEQ ID NO: 26 (shmiR9); a shmiR comprising an effector sequence set forth in SEQ ID NO: 29 and an effector complement sequence set forth in SEQ ID NO: 28 (shmiRl l);
  • shmiR 13 a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 (shmiR 13);
  • shmiR 14 a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 (shmiR 14);
  • shmiR 15 a shmiR comprising an effector sequence set forth in SEQ ID NO: 35 and an effector complement sequence set forth in SEQ ID NO: 34 (shmiR 15);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 37 and an effector complement sequence set forth in SEQ ID NO: 36 (shmiR16);
  • shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the shmiR encoded by the nucleic acid of the disclosure may comprise, in a 5' to 3' direction:
  • the shmiR encoded by the nucleic acid of the disclosure may comprise, in a 5' to 3' direction:
  • Suitable loop sequences may be selected from those known in the art. However, an exemplary stemloop sequence is set forth in SEQ ID NO: 40.
  • Suitable primary micro RNA (pri-miRNA or pri-R) backbones for use in a nucleic acid of the disclosure may be selected from those known in the art.
  • the pri- miRNA backbone may be selected from a pri-miR-30a backbone, a pri-miR-155 backbone, a pri-miR-21 backbone and a pri-miR-136 backbone.
  • the pri-miRNA backbone is a pri-miR-30a backbone.
  • the 5' flanking sequence of the pri-miRNA backbone is set forth in SEQ ID NO: 41 and the 3' flanking sequence of the pri-miRNA backbone is set forth in SEQ ID NO: 42.
  • the nucleic acid described herein comprises a DNA sequence selected from the sequence set forth in any one of SEQ ID NOs: 56-68.
  • a shmiR encoded by the nucleic acid of the disclosure may comprise a sequence set forth in any one of SEQ ID NOs: 43-55.
  • nucleic acid in accordance with the present disclosure may be combined or used in conjunction with other therapeutic agents for treating OPMD e.g., such as other RNAi agents targeting RNA transcripts corresponding to a PABPNl protein which is causative of OPMD.
  • the present disclosure provides a nucleic acid comprising a DNA sequence encoding a shmiR as described herein in combination with one or more other RNAi agents for treating OPMD.
  • a plurality of nucleic acids are provided comprising:
  • a nucleic acid comprising a DNA sequence encoding a shmiR or short hairpin RNA (shRNA) comprising an effector sequence of at least 17 nucleotides in length and a effector complement sequence, wherein the effector sequence is substantially complementary to a RNA transcript corresponding to a PABPNl protein which is causative of oculopharyngeal muscular dystrophy (OPMD); wherein the shmiR encoded by the nucleic acid at (a) and the shmiR or shRNA encoded by the nucleic acid at (b) comprise different effector sequences.
  • shmiR or shRNA comprising a DNA sequence encoding a shmiR or short hairpin RNA (shRNA) comprising an effector sequence of at least 17 nucleotides in length and a effector complement sequence, wherein the effector sequence is substantially complementary to a RNA transcript corresponding to a PABPNl protein which is causative of oculopharyngeal muscular dystrophy
  • the effector sequence of the shmiR or shRNA at (b)(ii) is substantially complementary to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13.
  • the effector sequence of the shmiR or shRNA at (b)(ii) which is substantially complementary to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13 will be less than 30 nucleotides in length.
  • a suitable effector sequence of the shmiR or shRNA may be in the range of 17-29 nucleotides in length.
  • at least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR2 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR3 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR4 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR5 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR6 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR7 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR9 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiRl 1 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR13 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR14 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR15 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR16 as described herein.
  • At least one of the nucleic acids in the plurality comprises a DNA sequence encoding shmiR17 as described herein.
  • a plurality of nucleic acids in accordance with the present disclosure may comprise up to 10 nucleic acids, each encoding a shmiR as described herein i.e., shmiR2-7, shmiR9, shmiRl l, and shmiR 13- 17, such as two nucleic acids or three nucleic acids or four nucleic acids or five nucleic acids or six nucleic acids or seven nucleic acids or eight nucleic acids or nine nucleic acids or ten nucleic acids.
  • the plurality of nucleic acids comprises two nucleic acids of the disclosure, each encoding a shmiR as described herein.
  • the plurality of nucleic acids comprises three nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of nucleic acids comprises four nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of nucleic acids comprises five nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of nucleic acids comprises six nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of nucleic acids comprises seven nucleic acids of the disclosure, each encoding a shmiR as described herein.
  • the plurality of nucleic acids comprises eight nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of nucleic acids comprises nine nucleic acids of the disclosure, each encoding a shmiR as described herein. In one example, the plurality of RNAs comprises ten nucleic acids of the disclosure, each encoding a shmiR as described herein. In accordance with any of the examples described herein, one or more of the nucleic acids in the plurality may encode a shRNA as described herein.
  • the plurality of nucleic acids of the disclosure comprises at least two nucleic acids, each comprising a DNA sequence encoding a shmiR selected from the group consisting of shmiR2, shmiR3, shmiR5, shmiR9, shmiR 13, shmiR 14 and shmiR 17 as described herein.
  • One exemplary plurality of nucleic acids of the disclosure comprises one nucleic acid comprising a DNA sequence encoding shmiR 13 as described herein and another nucleic acid comprising a DNA sequence encoding shmiR17 as described herein.
  • Another exemplary plurality of nucleic acids of the disclosure comprises one nucleic acid comprising a DNA sequence encoding shmiR3 as described herein and another nucleic acid comprising a DNA sequence encoding shmiR14 as described herein.
  • two or more of the nucleic acids may form separate parts of the same polynucleotide.
  • two or more of the nucleic acids in the plurality form parts of different polynucleotides, respectively.
  • the or each nucleic acid in accordance with the present disclosure may comprise, or be in operable linkage with, one or more transcriptional terminator sequences.
  • the or each nucleic acid may comprise a transcriptional terminator sequence at the 3' terminus of the sequence encoding the shmiR.
  • Such sequences will depend on the choice of promoter and will be known to a person of skill in the art. However, suitable choices of promoter and transcriptional terminator sequences for use in accordance with a nucleic acid of the disclosure or plurality thereof are described herein.
  • the or each nucleic acid in accordance with the present disclosure may comprise, or be in operable linkage with, a transcription initiator sequence.
  • the or each nucleic acid may comprise a transcription initiator sequence at the 5' terminus of the sequence encoding the shmiR. Such sequences will be known to a person of skill in the art.
  • the or each nucleic acid in accordance with the present disclosure may comprise one or more restriction sites e.g., to facilitate cloning of the nucleic acid(s) into cloning or expression vectors.
  • the nucleic acids described herein may include a restriction site upstream and/or downstream of the sequence encoding a shmiR of the disclosure. Suitable restriction enzyme recognition sequences will be known to a person of skill in the art.
  • a nucleic acid in accordance with the present disclosure may also be provided in the form of, or be comprised in, a DNA- directed RNA interference (ddRNAi) construct which is capable of expressing one or more shmiRs which is/are encoded by the nucleic acid(s) of the present disclosure.
  • ddRNAi DNA- directed RNA interference
  • the ddRNAi construct comprises at least two nucleic acids of the disclosure, such that the ddRNAi construct encodes at least two shmiRs targeting a RNA transcript corresponding to a PABPN1 protein which is causative of OPMD, each of which is different to one another.
  • each of the at least two nucleic acids in the ddRNAi construct encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 1, 2, 4, 7, 9, 10 and 13.
  • a ddRNAi construct in accordance with this example encodes two shmiRs selected from shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14 and shmiR17 as described herein.
  • ddRNAi construct of the disclosure comprises at least two nucleic acids selected from the group consisting of:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence which is substantially complementary to SEQ ID NO: 15 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 14 (shmiR2);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to SEQ ID NO: 17 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 21 and an effector complement sequence which is substantially complementary to SEQ ID NO: 21 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 20 (shmiR5);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 27 and an effector complement sequence which is substantially complementary to SEQ ID NO: 27 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 26 (shmiR9);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to SEQ ID NO: 31 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 30 (shmiR 13);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to SEQ ID NO: 33 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 32 (shmiR 14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to SEQ ID NO: 39 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5);
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9);
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • each of the at least two nucleic acids in the ddRNAi construct encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 2, 9, 10 and 13.
  • a ddRNAi construct in accordance with this example encodes two shmiRs selected from shmiR3, shmiR 13, shmiR 14 and shmiR 17 as described herein.
  • ddRNAi construct of the disclosure comprises at least two nucleic acids selected from the group consisting of:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to SEQ ID NO: 17 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to SEQ ID NO: 31 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 30 (shmiR13);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to SEQ ID NO: 33 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 32 (shmiR14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to SEQ ID NO: 39 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO:
  • nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • One exemplary ddRNAi construct of the disclosure comprises:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • a ddRNAi construct in accordance with this example may comprise: (a) a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 64 (shmiR13); and
  • Another exemplary ddRNAi construct of the disclosure comprises:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 (shmiR14).
  • a ddRNAi construct in accordance with this example may comprise:
  • a ddRNAi construct as described herein comprises a single promoter which is operably-linked to the or each nucleic acid encoding a shmiR of the disclosure.
  • each nucleic acid encoding a shmiR of the disclosure is operably-linked to a separate promoter.
  • the promoter(s) is (are) positioned upstream of the respective nucleic acid(s) encoding the shmiR(s).
  • the promoters may be the same or different.
  • Exemplary promoters which may be employed are muscle-specific promoters, such as for example, Spc512 and CK8.
  • Other promoters which may be employed are RNA pol III promoters, such as for example, the U6 and HI promoters.
  • Exemplary U6 promoters are U6-1, U6-8 and U6-9 promoters.
  • a plurality of nucleic acids as described herein may also be provided in the form of, or be comprised in, a plurality of ddRNAi constructs, each capable of expressing one or more shmiRs which is/are encoded by the nucleic acid(s) of the present disclosure.
  • each nucleic acid in the plurality of nucleic acids may be provided in the form of, or be comprised in, a separate ddRNAi construct.
  • the plurality of ddRNAi constructs comprises at least two ddRNAi constructs, each comprising a nucleic acid of the plurality of nucleic acids described herein , such that collectively, the ddRNAi constructs encode at least two shmiRs targeting a RNA transcript corresponding to a PABPN1 protein which is causative of OPMD, each of which is different to one another.
  • each of the at least two ddRNAi constructs encodes a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 1, 2, 4, 7, 9, 10 and 13.
  • a plurality of ddRNAi constructs in accordance with this example collectively encode two shmiRs selected from shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14 and shmiR17 as described herein.
  • One example of a plurality of ddRNAi constructs of the disclosure comprises at least two ddRNAi constructs selected from the group consisting of:
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence which is substantially complementary to SEQ ID NO: 15 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 14 (shmiR2);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to SEQ ID NO: 17 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 21 and an effector complement sequence which is substantially complementary to SEQ ID NO: 21 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 20 (shmiR5);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 27 and an effector complement sequence which is substantially complementary to SEQ ID NO: 27 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 26 (shmiR9);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to SEQ ID NO: 31 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 30 (shmiR13);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to SEQ ID NO: 33 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 32 (shmiR14); and
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to SEQ ID NO: 39 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the plurality of ddRNAi constructs comprises at least ddRNAi constructs selected from the group consisting of:
  • ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 56 (shmiR2);
  • ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5);
  • ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14); and a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • each of the at least two ddRNAi constructs encodes a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 2, 9, 10 and 13.
  • a plurality of ddRNAi constructs in accordance with this example collectively encodes two shmiRs selected from shmiR3, shmiR13, shmiR14 and shmiR17 as described herein.
  • One example of a plurality of ddRNAi constructs of the disclosure comprises at least two ddRNAi constructs selected from the group consisting of:
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to SEQ ID NO: 17 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to SEQ ID NO: 31 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 30 (shmiR13);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to SEQ ID NO: 33 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 32 (shmiR14); and
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to SEQ ID NO: 39 and capable of forming a duplex therewith e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the at least two ddRNAi constructs is selected from the group consisting of: a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • One exemplary plurality of ddRNAi constructs of the disclosure comprises:
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 (shmiR13); and (b) a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 (shmiR 17).
  • a plurality of ddRNAi constructs in accordance with this example may comprise:
  • ddRNAi construct comprising a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • ddRNAi construct comprising a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • Another exemplary plurality of ddRNAi constructs of the disclosure comprises: (a) a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3); and
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 (shmiR14).
  • a plurality of ddRNAi constructs in accordance with this example may comprise:
  • ddRNAi construct comprising a nucleic acid comprising or consisting of the sequence set forth in SEQ ID NO:57 (shmiR3);
  • a ddRNAi construct comprising a nucleic acid comprising or consisting of the sequence set forth in SEQ ID NO: 65 (shmiR 14).
  • Each ddRNAi construct in the plurality of ddRNAi constructs as described herein comprises a single promoter which is operably-linked to the or each nucleic acid encoding a shmiR comprised therein.
  • a ddRNAi construct in the plurality of ddRNAi constructs comprises more than one nucleic acid encoding a shmiR
  • each nucleic acid may be operably linked to the same promoter or be operably-linked to a separate promoter.
  • the promoter(s) is(are) positioned upstream of the respective nucleic acid(s) encoding the shmiR(s).
  • Exemplary promoters which may be employed are muscle-specific promoters, such as for example, Spc512 and CK8.
  • Other promoters which may be employed are RNA pol III promoters, such as for example, the U6 and HI promoters.
  • Exemplary U6 promoters are U6-1, U6-8 and U6-9 promoters.
  • the promoters comprised in the respective ddRNAi constructs of the plurality of ddRNAi constructs may be the same or different.
  • the present disclosure also provides a DNA construct comprising:
  • a PABPN1 construct comprising a DNA sequence encoding a functional PABPN1 protein having a mRNA transcript which is not targeted by the shmiR(s) encoded by the ddRNAi construct.
  • the DNA sequence encoding the functional PABPN1 protein is codon optimised such that its mRNA transcript is not targeted by the shmiRs of the ddRNAi construct.
  • functional PABPN1 protein is a wild- type human PABPN1 protein e.g., having a sequence set forth in SEQ ID NO: 74.
  • a codon optimised DNA sequence encoding the functional PABPN1 protein is set forth in SEQ ID NO: 73.
  • the DNA construct may comprise one or more promoters.
  • Exemplary promoters for use in the DNA constructs of the disclosure are muscle-specific promoter, such as for example, Spc512 and CK8.
  • the DNA construct comprises a promoter which is operably-linked to the PABPN1 construct and the ddRNAi construct, wherein the promoter is positioned upstream of the PABPN1 construct and the ddRNAi construct.
  • the DNA construct comprises, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., Spc512
  • a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct
  • a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR13 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR17 as described herein.
  • the DNA construct comprises:
  • a muscle-specific promoter e.g., Spc512
  • a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct;
  • a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR3 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR14 as described herein.
  • the PABPNl construct and the ddRNAi construct are each operably-linked to separate promoters within the DNA construct.
  • the promoter which is in operable linkage with the PABPNl construct will be operably linked to the DNA sequence encoding a functional PABPNl protein comprised therein.
  • the or each promoter which is in operable linkage with the ddRNAi construct will be operably-linked with one or more nucleic acids encoding a shmiR of the disclosure comprised in the ddRNAi construct.
  • Exemplary promoters for use in the DNA constructs of the disclosure are muscle- specific promoter, such as for example, Spc512 and CK8.
  • One DNA construct in accordance with this example comprises, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., CK8 promoter, positioned upstream of a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR 13 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR17 as described herein;
  • a muscle-specific promoter e.g., Spc512 promoter
  • PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct.
  • Another DNA construct in accordance with this example comprises, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., CK8 promoter, positioned upstream of a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR3 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR14 as described herein;
  • a muscle-specific promoter e.g., Spc512 promoter, positioned upstream of a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct.
  • An exemplary ddRNAi construct encoding shmiR13 and shmiR17 for inclusion in a DNA construct of the disclosure may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 31 e.g., an effector complement sequence set forth in
  • SEQ ID NO: 30 (shmiR13), and a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 39 e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the ddRNAi construct in accordance with this example of the DNA construct may comprise a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 64 (shmiR13), and a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • An exemplary ddRNAi construct encoding shmiR3 and shmiR 14 for inclusion in a DNA construct of the disclosure may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: ⁇ e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3), and a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 33 e.g., an effector complement sequence set forth in SEQ ID NO: 34 (shmiR14).
  • the ddRNAi construct in accordance with this example of the DNA construct may comprise a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 57 (shmiR3), and a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 65 (shmiR14).
  • the present disclosure also provides an expression vector, comprising a ddRNAi construct of the disclosure, or a plurality of ddRNAi constructs of the disclosure or a DNA construct of the disclosure.
  • the present disclosure also provides plurality of expression vectors each of which comprises a ddRNAi construct of the disclosure.
  • one or more of the plurality of expression vectors comprises a plurality of ddRNAi constructs as disclosed herein.
  • each expression vector in the plurality of expression vectors comprises a plurality of ddRNAi constructs as disclosed herein.
  • each expression vector in the plurality of expression vectors comprises a single ddRNAi construct as described herein.
  • the plurality of expression vectors may collectively express a plurality of shmiRs in accordance with the present disclosure.
  • the present disclosure also provides plurality of expression vectors comprising: (a) an expression vector comprising one or more ddRNAi constructs of the disclosure; and
  • an expression vector comprising a PABPN1 construct comprising a DNA sequence encoding a functional PABPN1 protein having a mRNA transcript which is not targeted by the shmiR(s) encoded by the ddRNAi construct.
  • the DNA sequence encoding the functional PABPN1 protein is codon optimised such that its mRNA transcript is not targeted by the shmiRs of the ddRNAi construct.
  • functional PABPN1 protein is a wild-type human PABPN1 protein e.g., having a sequence set forth in SEQ ID NO: 74.
  • a codon optimised DNA sequence encoding the functional PABPN1 protein is set forth in SEQ ID NO: 73.
  • the DNA sequence encoding the functional PABPN1 protein may be operably-linked to a promoter comprised within the PABPN1 construct and positioned upstream of the DNA sequence encoding the functional PABPN1 protein.
  • the expression vector comprising the PAPBN1 construct comprises a promoter upstream of the PABPN1 construct and in operable-linkage with the DNA sequence encoding the functional PABPN1 protein.
  • Exemplary promoters for use in the expression vector(s) of the disclosure are muscle-specific promoter, such as for example, Spc512 and CK8.
  • the or each expression vector is a plasmid or a minicircle.
  • the plasmid or minicircle or expression vector or ddRNAi construct is complexed with a cationic DNA binding polymer e.g., polyethylenimine.
  • a cationic DNA binding polymer e.g., polyethylenimine.
  • the or each expression vector is a viral vector.
  • the viral vector is selected from the group consisting of an adeno-associated viral (AAV) vector, a retroviral vector, an adenoviral vector (AdV) and a lenti viral (LV) vector.
  • AAV adeno-associated viral
  • AdV adenoviral vector
  • LV lenti viral
  • the present disclosure also provides a composition comprising a ddRNAi construct and/or a plurality of ddRNAi constructs and/or expression vector and/or a plurality of expression vectors as described herein.
  • the composition may also comprise one or more pharmaceutically acceptable carriers and/or diluents.
  • the present disclosure also provides a method of inhibiting expression of a PABPN1 protein which is causative of OPMD in a subject, said method comprising administering to the subject a nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vector, or a composition described herein.
  • the present disclosure also provides a method of treating OPMD in a subject suffering therefrom, the method comprising administering to the subject a nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vectors, or a composition described herein.
  • the method may comprise administering the plurality of expression vectors to the subject together, simultaneously or consecutively.
  • the present disclosure also provides a kit comprising:
  • agents for inhibiting expression of a PABPN1 protein which is causative of OPMD said agent(s) being selected from a nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vectors, or a composition described herein; and (b) an expression vector comprising a DNA sequence encoding a functional PABPN1 protein having a mRNA transcript which is not targeted by shmiRs expressed by the agent at (a).
  • the DNA sequence encoding the functional PABPN1 protein is codon optimised such that its mRNA transcript is not targeted by the shmiRs encoded by the agent at (a).
  • functional PABPN1 protein is a wild-type human PABPN1 protein e.g., having a sequence set forth in SEQ ID NO: 74.
  • the codon optimised DNA sequence encoding the functional PABPN1 protein is set forth in SEQ ID NO: 73.
  • the DNA sequence encoding the functional PABPN1 protein may be operably-linked to a promoter comprised within the expression vector at (b) and positioned upstream of the DNA sequence encoding the functional PABPN1 protein.
  • An exemplary promoter for use in the expression vector at (b) is a muscle-specific promoter, such as for example, a Spc512 or CK8 promoter.
  • the present disclosure also provides a kit comprising the plurality of expression vectors described herein packaged as separate components.
  • the present disclosure also provides a kit comprising a nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vectors, or a composition described herein, packaged with instruction for use in a method of the disclosure.
  • the kit as described herein is for use in treating OPMD according to a method described herein.
  • the present disclosure also provides use of a nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vectors, and/or a composition described herein in the preparation of a medicament, e.g., for treating OPMD in a subject and/or in a method disclosed herein.
  • the present disclosure also provides nucleic acid, a plurality of nucleic acids, a ddRNAi construct, a plurality of ddRNAi constructs, a DNA construct, an expression vector, a plurality of expression vectors, and/or a composition described herein for use in therapy.
  • the nucleic acid, the plurality of nucleic acids, the ddRNAi construct, the plurality of ddRNAi constructs, the DNA construct, the expression vector, the plurality of expression vectors and/or the composition may be for use in treating OPMD in a subject suffering therefrom or predisposed thereto and/or in a method disclosed herein.
  • Figure 1 illustrates the predicted secondary structure of a representative shmiR construct comprising a 5' flanking region, a siRNA sense strand; a stem/loop junction sequence, an siRNA anti-sense strand, and a 3' flanking region.
  • FIG. 2 illustrates the wtPABPNl inhibitory activity of shmiRs having antisense and sense sequences of shmiRs designated shmiR2-17 relative to the psilencer control in HEK293 cells.
  • This graph illustrates that all shmiRs except shmiRl 1 downregulated the level of luciferase expression from the wtPABPNl Luciferase reporter.
  • Figure 3 illustrates the optPABPNl inhibitory activity of shmiRs having antisense and sense sequences of shmiRs designated shmiR 2-17 relative to the psilencer control in
  • Figure 4(A) is a western blot showing levels of FLAG-tagged wtPABPNl protein relative to Hsp90 protein expressed in HEK293T cells transfected with plasmids encoding shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14, shmiR16 or shmiR17. This shows that all of the selected shmiRs knocked down the expression of wtPABPNl.
  • Figure 4(B) llustrates the percent inhibition of FLAG-tagged wtPABPNl protein in HEK293 cells relative to the psilencer control. This graph illustrates that all of the selected shmiRs knocked down the expression of wtPABPNl with percent inhibition > 90%, as determined by densiometric analysis of the western blot at Figure 4(A).
  • Figure 5(A) is a western blot showing levels of FLAG-tagged codon-optimised PABPN1 protein relative to Hsp90 protein expressed in HEK293T cells transfected with shmiRs plasmids encoding shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14, shmiR16 or shmiR17. This shows that none of the shmiRs resulted in inhibition of the expression product of the codon-optimised PABPNl construct.
  • Figure 5(B) illustrates the percent inhibition of FLAG-tagged codon-optimised PABPNl protein in HEK293 cells relative to the psilencer control. This graph illustrates that none of the shmiRs resulted in inhibition of the expression product of the codon-optimised PABPNl construct, as determined by densiometric analysis of the western blot at Figure 5(A).
  • Figure 6 illustrates the percent inhibition of endogenous wtPABPNl expression in HEK293T cells by shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14, shmiR16 or shmiR17, as determined by qPCR analysis.
  • This graph illustrates that the shmiRs downregulated the expression of wtPABPNl with percent inhibition ranging between 16.4% to 49.1% (mean 35.5%).
  • Figure 7 illustrates the percent inhibition of endogenous PABPNl expression in C2C12 cells in response to inhibition by shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14, shmiR16 or shmiR17, as determined by qPCR analysis.
  • the graph illustrates that all of the individual shmiRs, with the exception of shmiR 16 (percentage inhibition of -43%), downregulated the expression of PABPNl in C2C12 cells with a mean percentage inhibition of approximately 80% relative to the pSilencer control.
  • Figure 8 illustrates the percent inhibition of PABPNl expression in C2C12 cells by shmiRs shmiR13, shmiR17, shmiR3 and shmiR14 individually; shmiR13 in combination with shmiR17 (shmiR13/17); and shmiR3 in combination with shmiR14 (shmiR3/14), as determined by qPCR analysis.
  • Figure 9 illustrates the percent inhibition of PABPNl expression in ARPE-19 cells by shmiR13, shmiR17, shmiR3 and shmiR14 individually; shmiR13 in combination with shmiR17 (shmiR13/17); and shmiR3 in combination with shmiR14 (shmiR3/14), as determined by qPCR analysis.
  • the graph illustrates that the percent inhibition of PABPN1 expression increased 1.14 fold between 48 and 72 hours in ARPE-19 cells.
  • Figure 10(A) shows standard curves obtained by qPCR determining the total number of shmiRs expressed in C2C12 cells transfected with shmiR13, shmiR14 and shmiR17.
  • Figure 10(B) shows a non-linear standard curve obtained by qPCR determining the total number of shmiRs expressed in C2C12 cells transfected with shmiR3.
  • Figure 11 illustrates the levels of expression of shmiR3, shmiR13, shmiR14 and shmiR17 in C2C12 cells transduced with the shmiR vectors expressing said shmiRs.
  • Figure 12(A) is a schematic illustrating a construct for simultaneous gene silencing of endogenous PABPN1 and replacement with codon optimised PABPN1 generated by subcloning two shmiRs targeting wtPABPNl into the 3' untranslated region of the codon optimized PABPN1 transcript in the pAAV2 vector backbone.
  • Figure 12(B) is a schematic illustrating a construct for simultaneous gene silencing of endogenous PABPN1 and replacement with codon optimised PABPN1 generated by subcloning two shmiRs targeting wtPABPNl into the sequence upstream of the
  • Figure 13 shows in vivo fluorescence in mouse limb following injection with AAV9-eGFP.
  • Figure 14 is a schematic illustrating the SR-construct designed for simultaneous gene silencing of endogenous PABPN1 and replacement with codon optimised PABPN1 generated by subcloning two shmiRs targeting wtPABPNl (shmiR17 and shmiR13) into the 3' untranslated region of the codon optimized PABPN1 transcript in the pAAV2 vector backbone.
  • Figure 15 illustrates percent inhibition of PABPNl in A17 mice treated with the silence and replace construct (hereinafter the "SR-construct"), and shows that robust inhibition of PABPNl is acheived at both high and low doses.
  • Figure 16 illustrates the level of expression of codon-optimised PABPNl relative to wildtype PABPNl (including mutant form) in A17 mice treated with the SR-construct at high and low doses.
  • Figure 17 shows immunofluorescence histochemistry for PABPNl and laminin detection in sections of Tibialis anterior (TA) muscles from (i) A17 mice treated with saline, (ii) FvB mice treated with saline, (iii) A17 mice treated with the SR-construct at high and low doses.
  • the number of PABPNl positive intranuclear inclusions (INIs) is significantly reduced in muscles from mice treated with the SR-construct at both high and low doses.
  • Figure 18 illustrates the level of nuclei containing INIs (expressed as a percentage) in sections of Tibialis anterior (TA) muscles from (i) A17 mice treated with saline, (ii) FvB mice treated with saline, (iii) A17 mice treated with the SR-construct at high and low doses.
  • This graph illustrates that treatment with the SR-construct at both high and low doses reduces the amount of INIs to about 10% compared to saline injected A17 muscles.
  • FIG 19 shows weight of Tibialis anterior (TA) muscles excised from (i) A17 mice treated with saline, (ii) FvB mice treated with saline, (iii) A17 mice treated with the SR- construct at high and low doses.
  • This graph shows that treatment with the SR-construct at both high and low doses restored muscle weight to near wildtype levels of the FvB animals. All muscle measurement were taken on the day of sacfrice, at 14 or 20 weeks post-injection.
  • Figure 20 shows isometric maximal force of Tibialis anterior (TA) muscles excised from (i) A17 mice treated with saline, (ii) FvB mice treated with saline, (iii) A17 mice treated with the SR-construct at high and low doses.
  • This graph shows that treatment with the SR- construct at both high and low doses restored roughly 66% of the reduced strength difference noted in the A17 mice relative to FvB wildtype animals. All muscle measurement were taken on the day of sacrifice, at 14 or 20 weeks post-injection.
  • SEQ ID NO: 1 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 2.
  • SEQ ID NO: 2 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 3.
  • SEQ ID NO: 3 RNA sequence for region within mRNA transcript coiTesponding to
  • PABPN1 protein designated PABPN1 mRNA Region 4.
  • SEQ ID NO: 4 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 5.
  • SEQ ID NO: 5 RNA sequence for region within mRNA transcript corresponding to
  • PABP 1 protein designated PABP 1 mRNA Region 6.
  • SEQ ID NO: 6 RNA sequence for region within mRNA transcript coiTesponding to
  • PABPN1 protein designated PABPN1 mRNA Region 7.
  • SEQ ID NO: 7 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 9.
  • SEQ ID NO: 8 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 11.
  • SEQ ID NO: 9 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 13.
  • SEQ ID NO: 10 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 14.
  • SEQ ID NO: 11 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 15.
  • SEQ ID NO: 12 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 16.
  • SEQ ID NO: 13 RNA sequence for region within mRNA transcript corresponding to
  • PABPN1 protein designated PABPN1 mRNA Region 17.
  • SEQ ID NO: 14 RNA effector complement sequence for shmiR designated shmiR2.
  • SEQ ID NO: 15 RNA effector sequence for shmiR designated shmiR2.
  • SEQ ID NO: 16 RNA effector complement sequence for shmiR designated shmiR3.
  • SEQ ID NO: 17 RNA effector sequence for shmiR designated shmiR3.
  • SEQ ID NO: 18 RNA effector complement sequence for shmiR designated shmiR4.
  • SEQ ID NO: 19 RNA effector sequence for shmiR designated shmiR4.
  • SEQ ID NO: 20 RNA effector complement sequence for shmiR designated shmiR5.
  • SEQ ID NO: 21 RNA effector sequence for shmiR designated shmiR5.
  • SEQ ID NO: 22 RNA effector complement sequence for shmiR designated shmiR6.
  • SEQ ID NO: 23 RNA effector sequence for shmiR designated shmiR6.
  • SEQ ID NO: 24 RNA effector complement sequence for shmiR designated shmiR7.
  • SEQ ID NO: 25 RNA effector sequence for shmiR designated shmiR7.
  • SEQ ID NO: 26 RNA effector complement sequence for shmiR designated shmiR9.
  • SEQ ID NO: 27 RNA effector sequence for shmiR designated shmiR9.
  • SEQ ID NO: 28 RNA effector complement sequence for shmiR designated shmiRl l.
  • SEQ ID NO: 29 RNA effector sequence for shmiR designated shmiR 11.
  • SEQ ID NO: 30 RNA effector complement sequence for shmiR designated shmiR13.
  • SEQ ID NO: 31 RNA effector sequence for shmiR designated shmiR 13.
  • SEQ ID NO: 32 RNA effector complement sequence for shmiR designated shmiR 14.
  • SEQ ID NO: 33 RNA effector sequence for shmiR designated shmiR 14.
  • SEQ ID NO: 34 RNA effector complement sequence for shmiR designated shmiR15.
  • SEQ ID NO: 35 RNA effector sequence for shmiR designated shmiR 15.
  • SEQ ID NO: 36 RNA effector complement sequence for shmiR designated shmiR16.
  • SEQ ID NO: 37 RNA effector sequence for shmiR designated shmiR 16.
  • SEQ ID NO: 38 RNA effector complement sequence for shmiR designated shmiR17.
  • SEQ ID NO: 39 RNA effector sequence for shmiR designated shmiR 17.
  • SEQ ID NO: 40 RNA stem loop sequence for shmiRs
  • SEQ ID NO: 41 5' flanking sequence of the pri-miRNA backbone.
  • SEQ ID NO: 42 3' flanking sequence of the pri-miRNA backbone
  • SEQ ID NO: 43 RNA sequence for shmiR designated shmiR2.
  • SEQ ID NO: 44 RNA sequence for shmiR designated shmiR3.
  • SEQ ID NO: 45 RNA sequence for shmiR designated shmiR4.
  • SEQ ID NO: 46 RNA sequence for shmiR designated shmiR5.
  • SEQ ID NO: 47 RNA sequence for shmiR designated shmiR6.
  • SEQ ID NO: 48 RNA sequence for shmiR designated shmiR7.
  • SEQ ID NO: 49 RNA sequence for shmiR designated shmiR9.
  • SEQ ID NO: 50 RNA sequence for shmiR designated shmiR 11.
  • SEQ ID NO: 51 RNA sequence for shmiR designated shmiR13.
  • SEQ ID NO: 52 RNA sequence for shmiR designated shmiR 14.
  • SEQ ID NO: 53 RNA sequence for shmiR designated shmiR15.
  • SEQ ID NO: 54 RNA sequence for shmiR designated shmiR 16.
  • SEQ ID NO: 55 RNA sequence for shmiR designated shmiR 17.
  • SEQ ID NO: 56 DNA sequence coding for shmiR designated shmiR2.
  • SEQ ID NO: 57 DNA sequence coding for shmiR designated shmiR3.
  • SEQ ID NO: 58 DNA sequence coding for shmiR designated shmiR4.
  • SEQ ID NO: 59 DNA sequence coding for shmiR designated shmiR5.
  • SEQ ID NO: 60 DNA sequence coding for shmiR designated shmiR6.
  • SEQ ID NO: 61 DNA sequence coding for shmiR designated shmiR7.
  • SEQ ID NO: 62 DNA sequence coding for shmiR designated shmiR9.
  • SEQ ID NO: 63 DNA sequence coding for shmiR designated shmiRl l.
  • SEQ ID NO: 64 DNA sequence coding for shmiR designated shmiR13.
  • SEQ ID NO: 65 DNA sequence coding for shmiR designated shmiR 14.
  • SEQ ID NO: 66 DNA sequence coding for shmiR designated shmiR15.
  • SEQ ID NO: 67 DNA sequence coding for shmiR designated shmiR 16.
  • SEQ ID NO: 68 DNA sequence coding for shmiR designated shmiR 17.
  • SEQ ID NO: 69 DNA sequence for double construct version 1 coding for shmiR3 and shmiR 14 under control of the muscle specific CK8 promoter and codon optimized PABPN1 under control of Spc512
  • SEQ ID NO: 70 DNA sequence for double construct version 1 coding for shmiR 17 and shmiR 13 under control of the muscle specific CK8 promoter and codon optimized PABPN1 under control of Spc512
  • SEQ ID NO: 71 DNA sequence for double construct version 2 coding for coPABPNl and shmiRs designated shmiR3 and shmiR 14, under control of Spc512.
  • SEQ ID NO: 72 DNA sequence for double construct version 2 coding for coPABPNl and shmiRs designated shmiR17 and shmiR13 under control of Spc512.
  • SEQ ID NO: 73 DNA sequence for Human codon-optimized PABPN1 cDNA sequence.
  • SEQ ID NO: 74 Amino acid sequence for codon-optimised human PABPN1 protein.
  • SEQ ID NO: 75 Amino acid sequence for wildtype human PABPN1 protein with
  • SEQ ID NO: 77 DNA sequence for primer designated wtPABPNl-Fwd.
  • SEQ ID NO: 78 DNA sequence for primer designated wtPABPNl-Rev
  • SEQ ID NO: 79 DNA sequence for probe designated wtPABPNl -Probe
  • SEQ ID NO: 80 DNA sequence for primer designated optPABPNl-Fwd
  • SEQ ID NO: 82 DNA sequence for probe designated optPABPNl-Probe
  • SEQ ID NO: 84 DNA sequence for primer designated shmiR13-FWD
  • SEQ ID NO: 85 DNA sequence for primer designated shmiR14-FWD
  • RNA is meant a molecule comprising at least one ribonucleotide residue.
  • ribonucleotide is meant a nucleotide with a hydroxyl group at the 2' position of a ⁇ -D-ribo- furanose moiety.
  • the terms include double- stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in the RNA molecules of the instant disclosure can also comprise non-standard nucleotides, such as non- naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • RNA interference refers generally to RNA-dependent silencing of gene expression initiated by double stranded RNA (dsRNA) molecules in a cell's cytoplasm.
  • dsRNA double stranded RNA
  • the dsRNA molecule reduces or inhibits transcription products of a target nucleic acid sequence, thereby silencing the gene or reducing expression of that gene.
  • double stranded RNA or “dsRNA” refers to a RNA molecule having a duplex structure and comprising an effector sequence and an effector complement sequence which are of similar length to one another.
  • the effector sequence and the effector complement sequence can be in a single RNA strand or in separate RNA strands.
  • the "effector sequence” (often referred to as a “guide strand”) is substantially complementary to a target sequence, which in the present case, is a region of a PABPN1 mRNA transcript.
  • the "effector sequence” can also be referred to as the "antisense sequence”.
  • effector complement sequence will be of sufficient complementary to the effector sequence such that it can anneal to the effector sequence to form a duplex.
  • the effector complement sequence will be substantially homologous to a region of target sequence.
  • effector complement sequence can also be referred to as the "complement of the effector sequence” or the sense sequence.
  • duplex refers to regions in two complementary or substantially complementary nucleic acids (e.g., RNAs), or in two complementary or substantially complementary regions of a single-stranded nucleic acid (e.g., RNA), that form base pairs with one another, either by Watson-Crick base pairing or any other manner that allows for a stabilized duplex between the nucleotide sequences that are complementary or substantially complementary. It will be understood by the skilled person that within a duplex region, 100% complementarity is not required; substantial complementarity is allowable. Substantial complementarity includes may include 79% or greater complementarity.
  • a single mismatch in a duplex region consisting of 19 base pairs results in 94.7% complementarity, rendering the duplex region substantially complementary.
  • two mismatches in a duplex region consisting of 19 base pairs results in 89.5% complementarity, rendering the duplex region substantially complementary.
  • three mismatches in a duplex region consisting of 19 base pairs results in 84.2% complementarity, rendering the duplex region substantially complementary, and so on.
  • the dsRNA may be provided as a hairpin or stem loop structure, with a duplex region comprised of an effector sequence and effector complement sequence linked by at least 2 nucleotide sequence which is termed a stem loop.
  • a dsRNA When a dsRNA is provided as a hairpin or stem loop structure it can be referred to as a "hairpin RNA” or “short hairpin RNAi agent” or “shRNA”.
  • Other dsRNA molecules provided in, or which give rise to, a hairpin or stem loop structure include primary miRNA transcipts (pri-miRNA) and precursor microRNA (pre-miRNA).
  • Pre-miRNA shRNAs can be naturally produced from pri-miRNA by the action of the enzymes Drosha and Pasha which recognize and release regions of the primary miRNA transcript which form a stem-loop structure.
  • the pri-miRNA transcript can be engineered to replace the natural stem-loop structure with an artificial/recombinant stem-loop structure. That is, an artificial/recombinant stem-loop structure may be inserted or cloned into a pri-miRNA backbone sequence which lacks its natural stem-loop structure.
  • stemloop sequences engineered to be expressed as part of a pri-miRNA molecule Drosha and Pasha recognize and release the artificial shRNA.
  • dsRNA molecules produced using this approach are known as "shmiRNAs", “shmiRs” or "microRNA framework shRNAs”.
  • the term "complementary" with regard to a sequence refers to a complement of the sequence by Watson-Crick base pairing, whereby guanine (G) pairs with cytosine (C), and adenine (A) pairs with either uracil (U) or thymine (T).
  • a sequence may be complementary to the entire length of another sequence, or it may be complementary to a specified portion or length of another sequence.
  • U may be present in RNA
  • T may be present in DNA. Therefore, an A within either of a RNA or DNA sequence may pair with a U in a RNA sequence or T in a DNA sequence.
  • the term "substantially complementary” is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between nucleic acid sequences e.g., between the effector sequence and the effector complement sequence or between the effector sequence and the target sequence. It is understood that the sequence of a nucleic acid need not be 100% complementary to that of its target or complement.
  • the term encompasses a sequence complementary to another sequence with the exception of an overhang. In some cases, the sequence is complementary to the other sequence with the exception of 1-2 mismatches. In some cases, the sequences are complementary except for 1 mismatch. In some cases, the sequences are complementary except for 2 mismatches. In other cases, the sequences are complementary except for 3 mismatches. In yet other cases, the sequences are complementary except for 4 mismatches.
  • a nucleic acid that encodes, or codes for, a shRNA or shmiR of the disclosure will comprise a DNA sequence which serves as a template for transcription of the respective shRNA or shmiR.
  • DNA-directed RNAi construct refers to a nucleic acid comprising DNA sequence which, when transcribed produces a shRNA or shmiR molecule (preferably a shmiR) which elicits RNAi.
  • the ddRNAi construct may comprise a nucleic acid which is transcribed as a single RNA that is capable of self-annealing into a hairpin structure with a duplex region linked by a stem loop of at least 2 nucleotides i.e., shRNA or shmiR, or as a single RNA with multiple shRNAs or shmiRs, or as multiple RNA transcripts each capable of folding as a single shRNA or shmiR respectively.
  • the ddRNAi construct may be provided within a larger "DNA construct" comprising one or more additional DNA sequences.
  • the ddRNAi construct may be provided in a DNA construct comprising a further DNA sequence coding for functional PABPN1 protein which has been codon optimised such that its mRNA transcript is not targeted by shmiRs of the ddRNAi construct.
  • the ddRNAi construct and/or the DNA construct comprising same may be within an expression vector e.g., operably linked to a promoter.
  • operably-Iinked or “operable linkage” (or similar) means that a coding nucleic acid sequence is linked to, or in association with, a regulatory sequence, e.g., a promoter, in a manner which facilitates expression of the coding sequence.
  • a regulatory sequence e.g., a promoter
  • Regulatory sequences include promoters, enhancers, and other expression control elements that are art-recognized and are selected to direct expression of the coding sequence.
  • a “vector” will be understood to mean a vehicle for introducing a nucleic acid into a cell.
  • Vectors include, but are not limited to, plasmids, phagemids, viruses, bacteria, and vehicles derived from viral or bacterial sources.
  • a "plasmid” is a circular, double-stranded DN A molecule.
  • a useful type of vector for use in accordance with the present disclosure is a viral vector, wherein heterologous DN A sequences are inserted into a viral genome that can be modified to delete one or more viral genes or parts thereof.
  • Certain vectors are capable of autonomous replication in a host cell (e.g., vectors having an origin of replication that functions in the host ceil). Other vectors can be stably integrated into the genome of a host cell, and are thereby replicated along with the host genome.
  • the term "expression vector” will be understood to mean a vector capable of expressing a RNA molecule of the disclosure.
  • a “functional PABPNl protein” shall be understood to mean a PABPNl protein having the functional properties of a wild-type PABPNl protein e.g., an ability to control site of mRNA polyadenylation and/or intron splicing in a mammalian cell. Accordingly, a “functional PABPNl protein” will be understood to be a PABPNl protein which is not causative of OPMD when expressed or present in a subject. In one example, a reference herein to "functional PABPNl protein” is a reference to human wild-type PABPNl protein. The sequence of human wild-type PABPNl protein is set forth in NCBI RefSeq
  • a functional human PABPNl protein may have the functional properties in vivo of the human PABPNl protein set forth in NCBI RefSeq NP_004634.
  • treating refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. It follows that treatment of OPMD includes reducing or inhibiting expression of a PABPNl protein which is causative of OPMD in the subject and/or expressing in the subject a PABPNl protein having the normal length of polyalanine residues.
  • treatment of OPMD includes reducing or inhibiting expression of the PABPNl protein which is causative of OPMD in the subject and expressing in the subject a PABPNl protein having the normal length of polyalanine residues.
  • An individual is successfully "treated", for example, if one or more of the above treatment outcomes is achieved.
  • a “therapeutically effective amount” is at least the minimum concentration or amount required to effect a measurable improvement in the OPMD condition, such as a measurable improvement in in one or more symptoms of OPMD e.g., including but not limited to ptosis, dysphagia and muscle weakness in the subject.
  • a therapeutically effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same, to elicit a desired response in the individual and/or the ability of the expression vector to express functional PABPNl protein in the subject.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same, are outweighed by the therapeutically beneficial effects of the shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same, to inhibit, supress or reduce expression of PABPNl protein causative of OPMD considered alone or in combination with the therapeutically beneficial effects of the expression of functional PABPNl protein in the subject.
  • the "subject” or “patient” can be a human or non-human animal suffering from or genetically predisposed to OPMD i.e., possess a PABPNl gene variant which is causati e of OPMD.
  • the "non-human animal” may be a primate, livestock (e.g. sheep, horses, cattle, pigs, donkeys), companion animal (e.g. pets such as dogs and cats), laboratory test animal (e.g. mice, rabbits, rats, guinea pigs, drosophila, C.elegans, zebrafish), performance animal (e.g. racehorses, camels, greyhounds) or captive wild animal.
  • livestock e.g. sheep, horses, cattle, pigs, donkeys
  • companion animal e.g. pets such as dogs and cats
  • laboratory test animal e.g. mice, rabbits, rats, guinea pigs, drosophila, C.elegans, zebrafish
  • performance animal
  • reduced expression refers to the absence or an observable decrease in the level of protein and/or mRNA product from the target gene e.g., the PABPNl gene.
  • the decrease does not have to be absolute, but may be a partial decrease sufficient for there to a detectable or observable change as a result of the RNAi effected by the shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same of the disclosure.
  • the decrease can be measured by determining a decrease in the level of mRNA and/or protein product from a target nucleic acid relative to a cell lacking the shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same, and may be as little as 1 %, 5% or 10%, or may be absolute i.e., 100% inhibition.
  • the effects of the decrease may be determined by examination of the outward properties i.e., quantitative and/or qualitative phenotype of the cell or organism, and may also include detection of the presence or a change in the amount of nuclear aggregates of expPABPNl in the cell or organism following administration of a shmiR, nucleic acid encoding same, ddRNAi construct, DNA construct, expression vector, or composition comprising same, of the disclosure.
  • the present disclosure provides a nucleic acid comprising a DNA sequence which encodes a short hairpin micro-RNA (shmiR), said shmiR comprising: an effector sequence of at least 17 nucleotides in length;
  • pri-miRNA primary micro RNA
  • the effector sequence is substantially complementary to a region of corresponding length in an RNA transcript set forth in any one of SEQ ID NOs: 1-13.
  • the effector sequence will be less than 30 nucleotides in length.
  • a suitable effector sequence may be in the range of 17-29 nucleotides in length.
  • the effector sequence will be 21 nucleotides in length. More preferably, the effector sequence will be 21 nucleotides in length and the effector complement sequence will be 20 nucleotides in length.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12.
  • the shmiR comprises an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13 and contain 4 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13 and contain 3 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13 and contain 2 mismatch bases relative thereto.
  • the effector sequence may be substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13 and contain 1 mismatch base relative thereto.
  • the effector sequence may be 100% complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13.
  • the effector sequence of a shmiR of the disclosure is substantially complementary to a region of corresponding length in a PABPN1 miRNA transcript described herein and contains 1, 2, 3 or 4 mismatch base(s) relative thereto, it is preferred that the mismatch(es) are not located within the region corresponding to the seed region of the shmiR i.e., nucleotides 2-8 of the effector sequence.
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 15 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 15 may be the sequence set forth in SEQ ID NO: 14.
  • a shmiR in accordance with this example is hereinafter designated "shmiR2".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 17 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 17 may be the sequence set forth in SEQ ID NO: 16.
  • a shmiR in accordance with this example is hereinafter designated "shmiR3".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO: 19 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 19 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 19 may be the sequence set forth in SEQ ID NO: 18.
  • a shmiR in accordance with this example is hereinafter designated "shmiR4".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:21 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:21 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:21 may be the sequence set forth in SEQ ID NO: 20.
  • a shmiR in accordance with this example is hereinafter designated "shmiR5".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:23 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:23 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 23 may be the sequence set forth in SEQ ID NO: 22.
  • a shmiR in accordance with this example is hereinafter designated "shmiR6".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:25 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:25 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:25 may be the sequence set forth in SEQ ID NO:24.
  • a shmiR in accordance with this example is hereinafter designated "shmiR7".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:27 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:27 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:27 may be the sequence set forth in SEQ ID NO:26.
  • a shmiR in accordance with this example is hereinafter designated "shmiR9".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:29 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:29 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:29 may be the sequence set forth in SEQ ID NO:28.
  • a shmiR in accordance with this example is hereinafter designated "shmiRl 1".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:31 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:31 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:31 may be the sequence set forth in SEQ ID NO:30.
  • a shmiR in accordance with this example is hereinafter designated "shmiR13".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:33 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:33 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:33 may be the sequence set forth in SEQ ID NO:32.
  • a shmiR in accordance with this example is hereinafter designated "shmiR14".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:35 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:35 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:35 may be the sequence set forth in SEQ ID NO:34.
  • a shmiR in accordance with this example is hereinafter designated "shmiR15".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:37 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:37 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:37 may be the sequence set forth in SEQ ID NO:36.
  • a shmiR in accordance with this example is hereinafter designated "shmiR16".
  • the nucleic acid described herein may comprise a DNA sequence encoding a shmiR comprising: (i) an effector sequence which is substantially complementary to the sequence set forth in SEQ ID NO:38 with the exception of 1, 2, 3 or 4 base mismatches, provided that the effector sequence is capable of forming a duplex with a sequence set forth in SEQ ID NO: 38; and (ii) an effector complement sequence comprising a sequence which is substantially complementary to the effector sequence.
  • the shmiR encoded by the nucleic acid may comprise an effector sequence set forth in SEQ ID NO:39 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:39 and capable of forming a duplex therewith.
  • the effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO:39 may be the sequence set forth in SEQ ID NO:38.
  • a shmiR in accordance with this example is hereinafter designated "shmiR17".
  • the shmiR encoded by the nucleic acid of the disclosure may comprise, in a 5' to 3' direction:
  • the shmiR encoded by the nucleic acid of the disclosure may comprise, in a 5' to 3' direction:
  • Suitable loop sequences may be selected from those known in the art. However, an exemplary stemloop sequence is set forth in SEQ ID NO: 40.
  • Suitable primary micro RNA (pri-miRNA or pri-R) backbones for use in a nucleic acid of the disclosure may be selected from those known in the art.
  • the pri- miRNA backbone may be selected from a pri-miR-30a backbone, a pri-miR-155 backbone, a pri-miR-21 backbone and a pri-miR-136 backbone.
  • the pri-miRNA backbone is a pri-miR-30a backbone.
  • the nucleic acid encoding the shmiRs of the disclosure may comprise DNA sequence encoding the sequence set forth in SEQ ID NO: 41 and DNA sequence encoding the sequence set forth in SEQ ID NO: 42.
  • the nucleic acid described herein may comprise a DNA sequence selected from the sequence set forth in any one of SEQ ID NOs: 56-68.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 56 and encodes a shmiR (shmiR2) comprising or consisting of the sequence set forth in SEQ ID NO: 43.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 57 and encodes a shmiR (shmiR3) comprising or consisting of the sequence set forth in SEQ ID NO: 44.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 58 and encodes a shmiR (shmiR4) comprising or consisting of the sequence set forth in SEQ ID NO: 45.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 59 and encodes a shmiR (shmiR5) comprising or consisting of the sequence set forth in SEQ ID NO: 46.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 60 and encodes a shmiR (shmiR6) comprising or consisting of the sequence set forth in SEQ ID NO: 47.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 61 and encodes a shmiR (shmiR7) comprising or consisting of the sequence set forth in SEQ ID NO: 48.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 62 and encodes a shmiR (shmiR9) comprising or consisting of the sequence set forth in SEQ ID NO: 49.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 63 and encodes a shmiR (shmiRl 1) comprising or consisting of the sequence set forth in SEQ ID NO: 50.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 64 and encodes a shmiR (shmiR13) comprising or consisting of the sequence set forth in SEQ ID NO: 51.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 65 and encodes a shmiR (shmiR14) comprising or consisting of the sequence set forth in SEQ ID NO: 52.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 66 and encodes a shmiR (shmiR15) comprising or consisting of the sequence set forth in SEQ ID NO: 53.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 67 and encodes a shmiR (shmiR16) comprising or consisting of the sequence set forth in SEQ ID NO: 54.
  • the nucleic acid described herein comprises or consists of a DNA sequence set forth in SEQ ID NO: 68 and encodes a shmiR (shmiR17) comprising or consisting of the sequence set forth in SEQ ID NO: 55.
  • Exemplary nucleic acids of the disclosure encode a shmiR selected from shmiR2, shmiR3, shmiR5, shmiR9, shmiR13, shmiR14 and shmiR17 as described herein.
  • Nucleic acids of the disclosure encoding shmiRs selected from shmiR3, shmiR13, shmiR 14 and shmiR17 as described herein are particularly preferred.
  • nucleic acid in accordance with the present disclosure may be combined or used in conjunction with one or more other nucleic acids comprising a DNA sequence encoding a shRNA or shmiR comprising an effector sequence of at least 17 contiguous nucleotides which is substantially
  • nucleic acids comprising:
  • nucleic acid comprising a DNA sequence encoding a shmiR as described herein;
  • nucleic acid comprising a DNA sequence encoding a short hairpin RNA
  • shRNA comprising cognate effector and effector complement sequences of a shmiR as described herein; wherein the shmiR encoded by the nucleic acid at (a) and the shmiR or shRNA encoded by the nucleic acid at (b) comprise different effector sequences.
  • the plurality of nucleic acids of the disclosure may comprise two or more nucleic acids encoding shmiRs as described herein, such as two, or three, or four, or five, or six, or seven, or eight, or nine, or ten nucleic acids encoding shmiRs as described herein.
  • the plurality of nucleic acids of the disclosure comprises at least one nucleic acid encoding a shmiR as described herein and at least one nucleic acid comprising a DNA sequence encoding a shRNA comprising cognate effector and effector complement sequences of a shmiR as described herein.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR2 is hereinafter designated “shRNA2”.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR3 is hereinafter designated “shRNA3”.
  • shRNA4 a shRNA comprising the effector sequence and effector complement sequence of shmiR4.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR5 is hereinafter designated “shRNA5".
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR6 is hereinafter designated “shRNA6".
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR7 is hereinafter designated “shRNA7”.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR9 is hereinafter designated “shRNA9”.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiRl l is hereinafter designated “shRNAH”.
  • a shRNA comprising the effector sequence and effector complement sequence of shmiR 13 is hereinafter designated
  • shRNA13 a shRNA comprising the effector sequence and effector complement sequence of shmiR14 is hereinafter designated “shRNA14”.
  • shRNA15 a shRNA comprising the effector sequence and effector complement sequence of shmiR 15 is hereinafter designated “shRNA15”.
  • shRNA16 a shRNA comprising the effector sequence and effector complement sequence of shmiR 16 is hereinafter designated
  • shRNA16 a shRNA comprising the effector sequence and effector complement sequence of shmiR17 is hereinafter designated “shRNA17".
  • shRNA17 a shRNA comprising the effector sequence and effector complement sequence of shmiR17.
  • the shRNA may comprise a loop or stem loop sequence positioned between the cognate effector and the effector complement sequences. Suitable loop sequences may be selected from those known in the art.
  • a nucleic acid of the plurality described herein encoding a shRNA may comprise a DNA sequence encoding a stem loop positioned between the DNA sequences encoding the effector sequence and the effector complement sequence respectively.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR2, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR2 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 56 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 43, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 56 (shmiR2), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR3-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR3, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 57 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 44, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR4-shmiR7, shmiR9, shmiRl l or shmiR13- shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR4, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR4 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 58 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 45, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 58 (shmiR4), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR3, shmiR5-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR5, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR5 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 59 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 46, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR4, shmiR6-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR6, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPNl mRNA transcript.
  • Exemplary nucleic acids encoding shmiR6 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 60 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 47, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPNl mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 60 (shmiR6), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR5, shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR7, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPNl mRNA transcript.
  • Exemplary nucleic acids encoding shmiR7 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 61 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 48, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPNl mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 61 (shmiR7), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR6, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR9, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPNl mRNA transcript.
  • Exemplary nucleic acids encoding shmiR9 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 62 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 49, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 11, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiRl l are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 63 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 50, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 63 (shmiRl 1), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9 or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR13, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 64 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 51, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl 1 or shmiR14-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 14, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR14 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 65 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 52, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13, shmiR15- shmiR 17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR15, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR15 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 66 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 53, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 66 (shmiR15), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR14, or shmiR16-shmiR17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 16, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR16 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 67 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 54, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 67 (shmiR16), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR15, or shmiR 17 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids described herein comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 17, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • Exemplary nucleic acids encoding shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the plurality of nucleic acids described herein comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 68 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 55, and at least one other nucleic acid of the disclosure which encodes a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript.
  • the plurality of nucleic acids described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR 17), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR16 or the corresponding shRNA of any thereof.
  • the plurality of nucleic acids may comprise two or more nucleic acids encoding shmiRs or shRNAs as described herein, such as two, or three, or four, or five, or six, or seven, or eight, or nine, or ten nucleic acids encoding shmiRs as described herein, provided at that at least one of the nucleic acids encodes a shmiRs of the disclosure.
  • the plurality of nucleic acids comprises two nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises three nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises four nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • the plurality of nucleic acids comprises five nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises six nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises seven nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • the plurality of nucleic acids comprises eight nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises nine nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the plurality of nucleic acids comprises ten nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1 are described herein e.g., for shmiR2.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2 are described herein e.g., for shmiR3.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4 are described herein e.g., for shmiR5.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7 are described herein e.g., for shmiR9.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9 are described herein e.g., for shmiR13.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10 are described herein e.g., for shmiR14.
  • one of the nucleic acids comprises a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13.
  • Suitable nucleic acids encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13 are described herein e.g., for shmiR 17.
  • An exemplary plurality of nucleic acids of the disclosure comprises at least two nucleic acids, each comprising a DNA sequence encoding a shmiR of the disclosure, wherein each shmiR comprises a different effector sequence.
  • each of the at least two nucleic acids encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 1, 2, 4, 7, 9, 10 and 13.
  • Exemplary nucleic acids of the disclosure encoding shmiRs comprising effector sequences which are substantially complementary to regions of corresponding length in the RNA transcripts set forth in SEQ ID NO: 1, 2, 4, 7, 9, 10 and 13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the at least two nucleic acids are selected from the group consisting of:
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence set forth in SEQ ID NO: 14 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 56 (shmiR2);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 21 and an effector complement sequence set forth in SEQ ID NO: 20 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 27 and an effector complement sequence set forth in SEQ ID NO: 26 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • each of the at least two nucleic acids encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 2, 9, 10 and 13.
  • Exemplary nucleic acids of the disclosure encoding shmiRs comprising effector sequences which are substantially complementary to regions of corresponding length in the RNA transcripts set forth in SEQ ID NO: 2, 9, 10 and 13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the at least two nucleic acids are selected from the group consisting of:
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3); a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • the plurality of nucleic acids comprises a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 10, and a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 13.
  • the plurality of nucleic acids may comprise:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • An exemplary plurality of nucleic acids of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13) and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • the plurality of nucleic acids comprises a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 2, and a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 9.
  • the plurality of nucleic acids may comprise:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16, e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of the sequence set forth in SEQ ID NO: 65 (shmiR 14).
  • An exemplary plurality of nucleic acids of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13) and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68
  • two or more of the nucleic acids may form separate parts of the same polynucleotide.
  • two or more of the nucleic acids in the plurality form parts of different polynucleotides, respectively.
  • the plurality of nucleic acids described herein are provided as multiple components e.g., multiple compositions.
  • each of the nucleic acids of the plurality may be provided separately.
  • at least one of the nucleic acids may be provided separately and two or more of the plurality provided together.
  • the or each nucleic acid in accordance with the present disclosure may comprise, or be in operable linkage with, additional elements e.g., to facilitate transcription of the shmiR or shRNA.
  • additional elements e.g., to facilitate transcription of the shmiR or shRNA.
  • the or each nucleic acid may comprise a promoter operably linked to the sequence encoding a shmiR or shRNA described herein.
  • Other elements e.g., transcriptional terminators and initiators, are known in the art and/or described herein.
  • the or each nucleic acid in accordance with the present disclosure may comprise one or more restriction sites e.g., to facilitate cloning of the nucleic acid(s) into cloning or expression vectors.
  • the nucleic acids described herein may include a restriction site upstream and/or downstream of the sequence encoding a shmiR or shRNA of the disclosure. Suitable restriction enzyme recognition sequences will be known to a person of skill in the art.
  • the nucleic acid(s) of the disclosure may include a BamHl restriction site (GGATCC) at the 5' terminus i.e., upstream of the sequence encoding the shmiR or shRNA, and a EcoRl restriction site (GAATTC) at the 3' terminus i.e., downstream of the sequence encoding the shmiR or shRNA.
  • GGATCC BamHl restriction site
  • GAATTC EcoRl restriction site
  • the or each nucleic acid of the disclosure is provided in the form of, or is comprised in, a DNA-directed RNAi (ddRNAi) construct.
  • ddRNAi DNA-directed RNAi
  • the present disclosure provides a ddRNAi construct comprising a nucleic acid as described herein.
  • the present disclosure provides a ddRNAi construct comprising a plurality of nucleic acids described herein.
  • the present disclosure provides a plurality of ddRNAi constructs, each comprising a nucleic acid of the plurality of nucleic acids as described herein ⁇ i.e., such that all of the nucleic acids of the plurality are represented in the plurality of ddRNAi constructs).
  • Exemplary nucleic acids encoding shmiRs or shRNAs comprising effector sequences targeting a mRNA transcript of PABPN1 which is causative of OPMD are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid of the disclosure operably linked to a promoter.
  • each of the nucleic acids may be operably-linked to a promoter.
  • the nucleic acids in the ddRNAi construct may be operably linked to the same promoter.
  • the nucleic acids in the ddRNAi construct may be operably linked to different promoters.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR2.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 1.
  • Exemplary nucleic acids encoding shmiR2 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 56 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 43.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR3-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 56 (shmiR2), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR3-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR3-shmiR7, shmiR9, shmiRl 1 and shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR3.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 2.
  • Exemplary nucleic acids encoding shmiR3 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 57 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 44.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR4-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR4-shmiR7, shmiR9, shmiRl l or shmiR13- shmiR17 or the corresponding shRNA of any thereof.
  • shmiR2 Exemplary nucleic acids encoding shmiRs designated shmiR2, shmiR4-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR4.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 3.
  • Exemplary nucleic acids encoding shmiR4 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 58 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 45.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR3, shmiR5-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 58 (shmiR4), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2, shmiR3, shmiR5-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • shmiR2 Exemplary nucleic acids encoding shmiRs designated shmiR2, shmiR3, shmiR5-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR5.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 4.
  • Exemplary nucleic acids encoding shmiR5 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 59 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 46.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR4, shmiR6-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR4, shmiR6-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR4, shmiR6-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR6.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 5.
  • Exemplary nucleic acids encoding shmiR6 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 60 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 47.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of s shmiR2-shmiR5, shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 60 (shmiR6), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR5, shmiR7, shmiR9, shmiRl l or shmiR13- shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR5, shmiR7, shmiR9, shmiRl l or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR7.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 6.
  • Exemplary nucleic acids encoding shmiR7 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 61 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 48.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR6, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 61 (shmiR7), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR6, shmiR9, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR6, shmiR9, shmiRl l or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR9.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 7.
  • Exemplary nucleic acids encoding shmiR9 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 62 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 49.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiRl l or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiRl 1 or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • Exemplary nucleic acids encoding shmiRs designated shmiR2- shmiR7, shmiRl 1 or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiRl 1.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 8.
  • Exemplary nucleic acids encoding shmiRl l are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 63 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 50.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9 or shmiR13-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 63 (shmiRl 1), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9 or shmiR13-shmiR17 or the corresponding shRNA of any thereof.
  • Exemplary nucleic acids encoding shmiRs designated shmiR2- shmiR7, shmiR9 or shmiR13-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR13.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 9.
  • Exemplary nucleic acids encoding shmiR13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 64 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 51.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR14-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR14-shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR7, shmiR9, shmiRl l or shmiR14-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR14.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 10.
  • Exemplary nucleic acids encoding shmiR14 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 65 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 52.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13, shmiR15-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13, shmiR15- shmiR 17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13, shmiR15-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR15.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 11.
  • Exemplary nucleic acids encoding shmiR 15 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 66 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 53.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR14, or shmiR16-shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 66 (shmiR15), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR14, or shmiR16-shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR7, shmiR9, shmiRl 1 or shmiR13-shmiR14, or shmiR16-shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR16.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 12.
  • Exemplary nucleic acids encoding shmiRl 6 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 67 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 54.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR15, or shmiR17 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 67 (shmiR 16), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR15, or shmiR17 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13- shmiR15, or shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • a ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR17.
  • the ddRNAi construct may comprise a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR having an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript comprising or consisting of the sequence set forth in SEQ ID NO: 13.
  • Exemplary nucleic acids encoding shmiR17 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct comprises a nucleic acid which comprises or consists of a DNA sequence set forth in SEQ ID NO: 68 and which encodes a shmiR comprising or consisting of the sequence set forth in SEQ ID NO: 55.
  • the ddRNAi construct may comprise one or more further nucleic acids of the disclosure comprising a DNA sequence encoding a shmiR or shRNA targeting a region of a PABPN1 mRNA transcript, such as a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR16 or the corresponding shRNA of any thereof, as described herein.
  • the ddRNAi construct described herein may comprise (i) a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR 17), and (ii) a nucleic acid comprising or consisting of a DNA sequence encoding one of shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR16 or the corresponding shRNA of any thereof.
  • shmiRs designated shmiR2-shmiR7, shmiR9, shmiRl l or shmiR13-shmiR16 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • the ddRNAi construct may comprise two or more nucleic acids encoding shmiRs or shRNAs as described herein, such as two, or three, or four, or five, or six, or seven, or eight, or nine, or ten nucleic acids encoding shmiRs or shRNAs as described herein, provided that at least one of the nucleic acids encodes a shmiR as described herein.
  • the ddRNAi construct comprises two nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises three nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises four nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • the ddRNAi construct comprises five nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises six nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises seven nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • the ddRNAi construct comprises eight nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises nine nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein. In one example, the ddRNAi construct comprises ten nucleic acids encoding a shmiR or shRNA described herein, with the proviso that at least one of the nucleic acids encodes a shmiR as described herein.
  • An exemplary ddRNAi construct of the disclosure comprises at least two nucleic acids, each comprising a DNA sequence encoding a shmiR of the disclosure, wherein each shmiR comprises a different effector sequence.
  • each of the at least two nucleic acids in the ddRNAi construct encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 1, 2, 4, 7, 9, 10 and 13.
  • Exemplary nucleic acids of the disclosure encoding shmiRs comprising effector sequences which are substantially complementary to regions of corresponding length in the RNA transcripts set forth in SEQ ID NO: 1, 2, 4, 7, 9, 10 and 13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure describing ddRNAi constructs.
  • the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of:
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 15 and an effector complement sequence set forth in SEQ ID NO: 14 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 56 (shmiR2);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 21 and an effector complement sequence set forth in SEQ ID NO: 20 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 59 (shmiR5);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 27 and an effector complement sequence set forth in SEQ ID NO: 26 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 62 (shmiR9);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • each of the at least two nucleic acids in the ddRNAi construct encode a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in one of SEQ ID NOs: 2, 9,
  • RNA transcripts set forth in SEQ ID NO: 2, 9, 10 and 13 are described herein and shall be taken to apply mutatis mutandis to this example of the disclosure describing ddRNAi constructs.
  • the ddRNAi construct comprises at least two nucleic acids selected from the group consisting of: a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 (shmiR14); and
  • nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • the ddRNAi construct of the disclosure comprises a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 10, and a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 13.
  • the ddRNAi construct may comprise:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence set forth in SEQ ID NO: 30 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence set forth in SEQ ID NO: 38 e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • An exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13) and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • the ddRNAi construct comprises a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 2, and a nucleic acid encoding a shmiR comprising an effector sequence which is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 9.
  • the ddRNAi construct may comprise:
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence set forth in SEQ ID NO: 16, e.g., a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 (shmiR3);
  • a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence set forth in SEQ ID NO: 32 e.g., a nucleic acid comprising or consisting of the sequence set forth in SEQ ID NO: 65 (shmiR 14).
  • An exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 (shmiR13) and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • the or each nucleic acid comprised therein may be operably linked to a promoter.
  • the ddRNAi construct as described herein may comprise a single promoter which is operably-linked to the or each nucleic acid comprised therein e.g., to drive expression of one or more shmiRs and/or shRNAs from the ddRNAi construct.
  • each nucleic acid encoding a shmiR or shRNA of the disclosure comprised in the ddRNAi construct is operably-linked to a separate promoter.
  • the promoters can be the same or different.
  • the construct may comprise multiple copies of the same promoter with each copy operably linked to a different nucleic acid of the disclosure.
  • each promoter operably linked to a nucleic acid of the disclosure is different.
  • the two nucleic acids encoding the shmiRs are each operably linked to a different promoter.
  • the respective nucleic acids encoding the shmiR and shRNA are each operably linked to a different promoter.
  • the promoter is a constitutive promoter.
  • constitutive when made in reference to a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a specific stimulus (e.g., heat shock, chemicals, light, etc.).
  • constitutive promoters are capable of directing expression of a coding sequence in substantially any cell and any tissue.
  • the promoters used to transcribe shmiRs or shRNAs from the nucleic acid(s) of the disclosure include promoters for ubiquitin, CMV, ⁇ -actin, histone H4, EF-la or pgk genes controlled by RNA polymerase II, or promoter elements controlled by RNA polymerase I.
  • a Pol II promoter such as CMV, SV40, Ul, ⁇ -actin or a hybrid Pol II promoter is employed.
  • Other suitable Pol II promoters are known in the art and may be used in accordance with this example of the disclosure.
  • a Pol II promoter system may be preferred in a ddRNAi construct of the disclosure which expresses a pri-miRNA which, by the action of the enzymes Drosha and Pasha, is processed into one or more shmiRs.
  • a Pol II promoter system may also be preferred in a ddRNAi construct of the disclosure comprising sequence encoding a plurality of shRNAs or shmiRs under control of a single promoter.
  • a Pol II promoter system may also be preferred where tissue specificity is desired.
  • a promoter controlled by RNA polymerase III is used, such as a U6 promoter (U6-1, U6-8, U6-9), HI promoter, 7SL promoter, a human Y promoter (hYl, hY3, hY4 (see Maraia, et al, Nucleic Acids Res 22(15):3045-52(1994)) and hY5 (see Maraia, et al, Nucleic Acids Res 24(18):3552-59(1994)), a human MRP-7-2 promoter, an Adenovirus VA1 promoter, a human tRNA promoter, or a 5s ribosomal RNA promoter.
  • U6 promoter U6-1, U6-8, U6-9
  • HI promoter 7SL promoter
  • a human Y promoter hYl, hY3, hY4 (see Maraia, et al, Nucleic Acids Res 22(15):3045-52(
  • Suitable promoters for use in a ddRNAi construct of the disclosure are described in US Patent No. 8,008,468 and US Patent No. 8,129,510.
  • the promoter is a RNA pol III promoter.
  • the promoter is a U6 promoter (e.g., a U6-1, U6-8 or U6-9 promoter).
  • the promoter is a HI promoter.
  • each of the nucleic acids in the ddRNAi construct is operably linked to a U6 promoter e.g., a separate U6 promoter.
  • the promoter in a construct is a U6 promoter.
  • the promoter is a U6-1 promoter.
  • the promoter is a U6-8 promoter.
  • the promoter is a U6-9 promoter.
  • promoters of variable strength are employed.
  • use of two or more strong promoters may tax the cell, by, e.g., depleting the pool of available nucleotides or other cellular components needed for transcription.
  • use of several strong promoters may cause a toxic level of expression of RNAi agents e.g., shmiRs or shRNAs, in the cell.
  • RNAi agents e.g., shmiRs or shRNAs
  • one or more of the promoters in the multiple-promoter ddRNAi construct is weaker than other promoters in the construct, or all promoters in the construct may express the shmiRs or shRNAs at less than a maximum rate.
  • Promoters may also be modified using various molecular techniques, or otherwise, e.g., through modification of
  • PSE Proximal Sequence Element
  • Promoters useful in some examples of the present disclosure can be tissue-specific or cell-specific.
  • tissue specific refers to a promoter that is capable of directing selective transcription of a nucleic acid of interest to a specific type of tissue (e.g., tissue of the eye or muscle) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (e.g., liver).
  • cell- specific as applied to a promoter refers to a promoter which is capable of directing selective transcription of a nucleic acid of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue.
  • a muscle-specific promoter is used, such as Spc512 or CK8.
  • other muscle-specific promoters are known in the art and are contemplated for use in a ddRNAi construct of the disclosure.
  • a ddRNAi construct of the disclosure may additionally comprise one or more enhancers to increase expression of the shmiRs or shRNAs encoded by the nucleic acids described herein.
  • Enhancers appropriate for use in examples of the present disclosure include the Apo E HCR enhancer, a CMV enhancer (Xia et al, Nucleic Acids Res 31- 17(2003)), and other enhancers known to those skilled in the art. Suitable enhancers for use in a ddRNAi construct of the disclosure are described in US Patent No. 8,008,468.
  • a ddRNAi construct of the disclosure may comprise a transcriptional terminator linked to a nucleic acid encoding a shmiR or shRNA of the disclosure.
  • the terminators linked to each nucleic acid can be the same or different.
  • the terminator may be a contiguous stretch of 4 or more or 5 or more or 6 or more T residues.
  • the terminators can be different and are matched to the promoter from the gene from which the terminator is derived.
  • Such terminators include, but are not limited to, the SV40 poly A, the AdV VA1 gene, the 5S ribosomal RNA gene, and the terminators for human t-RNAs.
  • Other promoter and terminator combinations are known in the art and are contemplated for use in a ddRNAi construct of the disclosure.
  • promoters and terminators may be mixed and matched, as is commonly done with RNA pol II promoters and terminators.
  • the promoter and terminator combinations used for each nucleic acid in a ddRNAi construct comprising a plurality of nucleic acids is different to decrease the likelihood of DNA recombination events between components.
  • One exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR13 as described herein operably linked to a promoter, and a nucleic acid comprising or consisting of a DNA sequence encoding shmiR17 as described herein operably linked to a promoter.
  • an exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 operably linked to a promoter, and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 operably linked to a promoter.
  • each nucleic acid in the ddRNAi construct encoding a shmiR is operably linked to a separate promoter.
  • each nucleic acid in the ddRNAi construct encoding a shmiR is operably linked to the same promoter.
  • the or each promoter may be a U6 promoter e.g., a U6-1, U6-8 or U6-9 promoter.
  • the or each promoter may be a muscle specific promoter e.g., a Spc512 or CK8 promoter.
  • the ddRNAi construct comprises or consists of the DNA sequence set forth in SEQ ID NO: 72.
  • the ddRNAi construct comprises or consists of the DNA sequence set forth in SEQ ID NO: 70.
  • Another exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding shmiR3 as described herein operably linked to a promoter, and a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 14 as described herein operably linked to a promoter.
  • an exemplary ddRNAi construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 operably linked to a promoter, and a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 operably linked to a promoter.
  • each nucleic acid in the ddRNAi construct encoding a shmiR is operably linked to a separate promoter.
  • each nucleic acid in the ddRNAi construct encoding a shmiR is operably linked to the same promoter.
  • the or each promoter may be a U6 promoter e.g., a U6-1, U6-8 or U6-9 promoter.
  • the or each promoter may be a muscle specific promoter e.g., a Spc512 or CK8 promoter.
  • the ddRNAi construct comprises or consists of the DNA sequence set forth in SEQ ID NO: 71.
  • the ddRNAi construct comprises or consists of the DNA sequence set forth in SEQ ID NO: 69. Also provided is a plurality of ddRNAi constructs.
  • a plurality of nucleic acids as encoding shmiRs as described herein may be provided within a plurality of ddRNAi constructs, wherein each ddRNAi construct comprises one or more of the plurality of nucleic acids described herein. Combinations of nucleic acids encoding shmiR have been described and shall be taken to apply mutatis mutandis to this example of the disclosure.
  • each nucleic acid in the plurality of nucleic acids described herein is provided within its own ddRNAi construct.
  • each ddRNAi construct may also comprise one or more promoters operably linked to the nucleic acid(s) encoding the shmiR(s) comprised therein.
  • each ddRNAi construct comprises a single nucleic acid encoding a shmiR and a promoter operably linked thereto.
  • each nucleic acid in the one or more ddRNAi constructs is operably linked to a separate promoter.
  • the two or more nucleic acids are operably linked to the same promoter in the ddRNAi construct.
  • One exemplary plurality of ddRNAi constructs of the disclosure comprises a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding shmiR 13 as described herein operably linked to a promoter, and a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding shmiR17 as described herein operably linked to a promoter.
  • an exemplary plurality of ddRNAi constructs of the disclosure comprises a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 64 operably linked to a promoter, and a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 68 operably linked to a promoter.
  • the promoters are U6 promoters e.g., selected from a U6-1, U6- 8 or U6-9 promoter.
  • the promoters are muscle specific promoters e.g., Spc512 or CK8 promoters.
  • Another exemplary plurality of ddRNAi constructs of the disclosure comprises a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding shmiR3 as described herein operably linked to a promoter, and a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence encoding shmiR14 as described herein operably linked to a promoter.
  • an exemplary plurality of ddRNAi constructs of the disclosure comprises a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 57 operably linked to a promoter, and a ddRNAi construct comprising a nucleic acid comprising or consisting of a DNA sequence set forth in SEQ ID NO: 65 operably linked to a promoter.
  • the promoters are U6 promoters e.g., selected from a U6-1, U6- 8 or U6-9 promoter.
  • the promoters are muscle specific promoters e.g., Spc512 or CK8 promoters.
  • each ddRNAi construct can comprise one or more multiple cloning sites and/or unique restriction sites that are located strategically, such that the promoter, nucleic acid encoding the shmiR or shRNA and/or other regulator elements are easily removed or replaced.
  • the or each ddRNAi construct can be assembled from smaller oligonucleotide components using strategically located restriction sites and/or
  • the base vector for one approach according to the present disclosure comprises plasmids with a multilinker in which all sites are unique (though this is not an absolute requirement). Sequentially, each promoter is inserted between its designated unique sites resulting in a base cassette with one or more promoters, all of which can have variable orientation. Sequentially, again, annealed primer pairs are inserted into the unique sites downstream of each of the individual promoters, resulting in a single-, double- or multiple-expression cassette construct. The insert can be moved into e.g., an AdV backbone or an AAV backbone using two unique restriction enzyme sites (the same or different ones) that flank the single-, double- or multiple-expression cassette insert.
  • the construct comprises, for example, sequences necessary to package the ddRNAi construct into viral particles and/or sequences that allow integration of the ddRNAi construct into the target cell genome.
  • the or each viral construct additionally contains genes that allow for replication and propagation of virus, however such genes will be supplied in trans.
  • the or each viral construct cam contain genes or genetic sequences from the genome of any known organism incorporated in native form or modified.
  • a viral construct may comprise sequences useful for replication of the construct in bacteria.
  • the or each construct also may contain additional genetic elements.
  • additional genetic elements may include a reporter gene, such as one or more genes for a fluorescent marker protein such as GFP or RFP; an easily assayed enzyme such as beta-galactosidase, luciferase, beta-glucuronidase, chloramphenical acetyl transferase or secreted embryonic alkaline phosphatase; or proteins for which immunoassays are readily available such as hormones or cytokines.
  • genes that may find use in embodiments of the present disclosure include those coding for proteins which confer a selective growth advantage on cells such as adenosine deaminase, aminoglycodic phosphotransferase, dihydrofolate reductase, hygromycin-B -phosphotransferase, drug resistance, or those genes coding for proteins that provide a biosynthetic capability missing from an auxotroph.
  • a reporter gene is included along with the or each construct, an internal ribosomal entry site (IRES) sequence can be included.
  • the additional genetic elements are operably linked with and controlled by an independent promoter/enhancer.
  • a suitable origin of replication for propagation of the construct in bacteria may be employed. The sequence of the origin of replication generally is separated from the ddRNAi construct and other genetic sequences. Such origins of replication are known in the art and include the pUC, ColEl, 2-micron or SV40 origins of replication.
  • a ddRNAi construct of the disclosure is included within an expression vector.
  • the expression vector is a plasmid e.g., as is known in the art.
  • a suitable plasmid expression vector is a pAAV vector e.g., a self-complementary pAAV (pscAAV) plasmid vector or single-stranded pAAV (pssAAV) plasmid vector.
  • the plasmid may comprise one or more promoters (suitable examples of which are described) to drive expression of one or more shmiRs of the disclosure.
  • the expression vector is mini-circle DNA. Mini-circle DNA is described in U.S. Patent Publication No. 2004/0214329.
  • Mini-circle DNA are useful for persistently high levels of nucleic acid transcription.
  • the circular vectors are characterized by being devoid of expression-silencing bacterial sequences.
  • mini-circle vectors differ from bacterial plasmid vectors in that they lack an origin of replication, and lack drug selection markers commonly found in bacterial plasmids, e.g. ⁇ -lactamase, tet, and the like. Consequently, minicircle DNA becomes smaller in size, allowing more efficient delivery.
  • the expression vector is a viral vector.
  • a viral vector based on any appropriate virus may be used to deliver a ddRNAi of the disclosure.
  • hybrid viral systems may be of use.
  • the choice of viral delivery system will depend on various parameters, such as the tissue targeted for delivery, transduction efficiency of the system, pathogenicity, immunological and toxicity concerns, and the like.
  • Commonly used classes of viral systems used in gene therapy can be categorized into two groups according to whether their genomes integrate into host cellular chromatin (oncoretroviruses and lentiviruses) or persist in the cell nucleus predominantly as extrachromosomal episomes (adeno-associated virus, adenoviruses and herpesviruses).
  • a viral vector of the disclosure integrates into a host cell's chromatin.
  • a viral vector of the disclosure persists in a host cell's nucleus as an extrachomosomal episome.
  • a viral vector is an adenoviral (AdV) vector.
  • Adenoviruses are medium-sized double-stranded, non-enveloped DNA viruses with linear genomes that is between 26-48 Kbp. Adenoviruses gain entry to a target cell by receptor-mediated binding and internalization, penetrating the nucleus in both non-dividing and dividing cells.
  • Adenoviruses are heavily reliant on the host cell for survival and replication and are able to replicate in the nucleus of vertebrate cells using the host's replication machinery.
  • a viral vector is from the Parvoviridae family.
  • the Parvoviridae is a family of small single-stranded, non-enveloped DNA viruses with genomes approximately 5000 nucleotides long. Included among the family members is adeno-associated virus
  • a viral vector of the disclosure is an AAV.
  • AAV is a dependent parvovirus that generally requires co-infection with another virus (typically an adenovirus or herpesvirus) to initiate and sustain a productive infectious cycle.
  • another virus typically an adenovirus or herpesvirus
  • AAV is still competent to infect or transduce a target cell by receptor-mediated binding and internalization, penetrating the nucleus in both non-dividing and dividing cells.
  • progeny virus is not produced from AAV infection in the absence of helper virus, the extent of transduction is restricted only to the initial cells that are infected with the virus. It is this feature which makes AAV a desirable vector for the present disclosure.
  • AAV appears to lack human pathogenicity and toxicity (Kay, et at, Nature. 424: 251 (2003)). Since the genome normally encodes only two genes it is not surprising that, as a delivery vehicle, AAV is limited by a packaging capacity of 4.5 single stranded kilobases (kb). However, although this size restriction may limit the genes that can be delivered for replacement gene therapies, it does not adversely affect the packaging and expression of shorter sequences such as shmiRs and shRNAs.
  • Retroviruses comprise single- stranded RNA animal viruses that are characterized by two unique features. First, the genome of a retrovirus is diploid, consisting of two copies of the RNA. Second, this RNA is transcribed by the virion-associated enzyme reverse transcriptase into double- stranded DNA. This double-stranded DNA or provirus can then integrate into the host genome and be passed from parent cell to progeny cells as a stably-integrated component of the host genome.
  • a viral vector is a lentivirus.
  • Lentivirus vectors are often pseudotyped with vesicular somatitis virus glycoprotein (VSV-G), and have been derived from the human immunodeficiency virus (HIV); visan-maedi, which causes encephalitis (visna) or pneumonia in sheep; equine infectious anemia virus (EIAV), which causes autoimmune hemolytic anemia and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immune deficiency in cats; bovine immunodeficiency virus (BIV) which causes lymphadenopathy and lymphocytosis in cattle; and simian immunodeficiency virus (SIV), which causes immune deficiency and encephalopathy in non-human primates.
  • VSV-G vesicular somatitis virus glycoprotein
  • Vectors that are based on HIV generally retain ⁇ 5 of the parental genome, and ⁇ 25 of the genome is incorporated into packaging constructs, which minimizes the possibility of the generation of reverting replication-competent HIV.
  • Biosafety has been further increased by the development of self-inactivating vectors that contain deletions of the regulatory elements in the downstream long-terminal-repeat sequence, eliminating transcription of the packaging signal that is required for vector mobilization.
  • One of the main advantages to the use of lentiviral vectors is that gene transfer is persistent in most tissues or cell types, even following cell division of the transduced cell.
  • a lentiviral-based construct used to express shmiRs and/or shRNAs from the nucleic acids and ddRNAi constructs of the disclosure comprises sequences from the 5' and 3' long terminal repeats (LTRs) of a lentivirus.
  • the viral construct comprises an inactivated or self-inactivating 3' LTR from a lentivirus.
  • the 3' LTR may be made self- inactivating by any method known in the art.
  • the U3 element of the 3' LTR contains a deletion of its enhancer sequence, e.g., the TATA box, Spl and NF-kappa B sites.
  • the provirus that is integrated into the host genome will comprise an inactivated 5' LTR.
  • the LTR sequences may be LTR sequences from any lentivirus from any species.
  • the lentiviral-based construct also may incorporate sequences for MMLV or MSCV, RSV or mammalian genes.
  • the U3 sequence from the lentiviral 5' LTR may be replaced with a promoter sequence in the viral construct. This may increase the titer of virus recovered from the packaging cell line. An enhancer sequence may also be included.
  • viral or non-viral systems known to those skilled in the art may be used to deliver the ddRNAi or nucleic acid of the present invention to cells of interest, including but not limited to gene-deleted adenovirus-transposon vectors (see Yant, et ah, Nature Biotech. 20:999-1004 (2002)); systems derived from Sindbis virus or Semliki forest virus (see Perri, et al, J. Virol. 74(20): 9802-07 (2002)); systems derived from Newcastle disease virus or Sendai virus.
  • cell line useful as a cell culture model for OPMD is the HEK293T cell line (HEK293T, ATCC, Manassas, USA) which has been transfected with a vector expressing normal Ala lO-humanPABPNl -FLAG (AlalO) or mutant Ala.ll -humanPABPNl- FLAG (Alal7), the latter being hallmark of OPMD.
  • HEK293T HEK293T, ATCC, Manassas, USA
  • a vector expressing normal Ala lO-humanPABPNl -FLAG (AlalO) or mutant Ala.ll -humanPABPNl- FLAG (Alal7) the latter being hallmark of OPMD.
  • Further examples of cell lines useful as cell culture models for OPMD are the C2C12 mouse muscle cell and the ARPE-19 human retinal cells e.g., as described in Example 5
  • IM2 primary mouse myoblast
  • An exemplary IM2 derived cell line which stably expresses mutant ⁇ & ⁇ -humanPABPNl - FLAG (Ala 17) is the H2kB-D7e cell line.
  • the H2kB-D7e cell line is also described in Raz et al, (2011) American Journal of Pathology, 179(4): 1988-2000.
  • activity of a shmiR of the disclosure is determined by administering a nucleic acid encoding the shmiR, or a ddRNAi construct or expression vector comprising same, to the cell and subsequently measuring the level of expression of a RNA or protein encoded by the PABPNl gene.
  • intracellular PABPNl gene expression can be assayed by any one or more of RT-PCR, quantitative PCR, semiquantitative PCR, or in-situ hybridization under stringent conditions, using one or more probes or primers which are specific for PABPNl.
  • PABPNl mRNA or DNA can also be assayed either by PCR using one or more probes or primers which are specific for PABPNl or ELISA can be used to detect PABPNl protein.
  • Polynucleotides which may be used in RT-PCR, quantitative PCR or semi-quantitative PCR techniques for detecting PABPNl expression are known and commercially available (Thermo Fisher). However, polynucleotides useful for PCR-based detection methods can be designed based on sequence information available for PABPNl using method and/or software known in the art. In one example, the presence or absence of PABPNl mRNA may be detected using RT-PCR using standard methodologies known in the art. In one example, the presence or absence or relative amount of PABPNl polypeptide or protein may be detected using any one or more of Western blotting, ELISA, or other standard quantitative or semiquantitative techniques available in the art, or a combination of such techniques.
  • PABPN1 polypeptides may be detected with techniques which comprise antibody capture of PABPN1 polypeptides in combination with electrophoretic resolution of captured PABPN1 polypeptides, for example using the IsonosticTM Assay (Target
  • Antibodies are commercially available for PABPNlprotein.
  • a nucleic acid, ddRNAi construct or expression vector of the disclosure that reduces expression of a mRNA or protein encoded by PABPN1 or that reduces the presence of nuclear aggregates of PABPN1 protein, relative to a level of mRNA expression or protein encoded by PABPN1 or an amount of nuclear aggregates of PABPN1 protein in the absence of the RNA of the disclosure, is considered to be useful for therapeutic applications e.g., such as treating OPMD by reducing expression of endogenous PABPN1 and replacing some or all of the endogenous PABPN1 with a PABPN1 protein which is not causative of OPMD as described herein.
  • any of the foregoing animal models can be used to determine the efficacy of a shmiR or ddRNAi construct of the disclosure to knockdown, reduce or inhibit expression of a RNA or protein encoded by the PABPN1 gene.
  • the present disclosure provides an agent for replacement of functional PABPN1 protein e.g., to a cell or animal.
  • the functional PABPN1 protein will not be causative of OPMD, nor will it be encoded by a mRNA transcript which is targeted by the shmiR(s) or shRNA(s) of the disclosure.
  • the agent for replacement of functional PABPNl protein to a cell or animal is a nucleic acid e.g., such as DNA or cDNA, encoding the functional PABPNl protein.
  • the nucleic acid encoding the functional PABPNl protein may be codon optimised e.g., contain one or more degenerate or wobble bases relative to the wild type PABPNl nucleic acid but which encodes for identical amino acids, so that the corresponding mRNA sequence coding for the functional PABPNl protein is not recognised by the shmiR(s) or shRNA(s) of the disclosure.
  • a codon optimised nucleic acid encoding the functional PABPNl protein may comprise one or more degenerate or wobble bases relative to the wild type PABPNl nucleic acid within the region targeted by the shmiR(s) or shRNA(s) of the disclosure.
  • the one or more degenerate or wobble bases resides within a seed region of an effector sequence a shmiR or shRNA of the disclosure.
  • a nucleic acid encoding the functional PABPNl protein is codon optimised such that its corresponding mRNA sequence is not recognised by the shmiR(s) or shRNA(s) of the disclosure.
  • the functional PABPNl protein encoded by the codon optimised nucleic acid sequence comprises the amino acid sequence set forth in SEQ ID NO: 74 i.e., the amino acid sequence of the wild-type human PABPNl protein.
  • the agent for replacement of functional PABPNl protein is a nucleic acid comprising the sequence set forth in SEQ ID NO: 73.
  • the nucleic acid encoding the functional PABPNl protein may also comprise a Kozak sequence.
  • the codon-optimised nucleic acid encoding the functional PABPNl protein is operably-linked to a promoter suitable for expression of the functional PABPNl protein.
  • Promoters suitable for expression of the functional PABPNl protein in tissue or the eye or muscle may be particularly suitable.
  • One exemplary promoter suitable for use with the nucleic acid encoding the functional PABPNl protein is a Spc512 promoter.
  • Another exemplary promoter suitable for use with the nucleic acid encoding the functional PABPNl protein is a CK8 promoter.
  • any suitable promoter known in the art may be used.
  • other suitable promoters for use with the nucleic acid encoding the functional PABPNl protein are described in US 20110212529 Al.
  • promoters useful in some examples of the present disclosure can be tissue-specific or cell-specific.
  • a codon-optimised nucleic acid encoding the functional PABPNl protein of the disclosure may additionally comprise one or more enhancers to increase expression of the functional PABPNl protein and its corresponding mRNA transcript.
  • Enhancers appropriate for use in this example of the present disclosure will be known to those skilled in the art.
  • a nucleic acid encoding the functional PABPNl protein may be comprised within an expression vector.
  • Exemplary expression vectors have been described in the context of nucleic acid and ddRNAi constructs of the disclosure and shall be taken to apply mutatis mutandis to this example.
  • an agent for replacement of functional PABPNl protein to a cell or animal may be an expression vector comprising a codon-optimised nucleic acid encoding the functional PABPNl protein.
  • an expression vector of the disclosure may comprise the codon-optimised nucleic acid encoding the functional PABPNl protein and a promoter for expression therefor e.g., a SpC512 promoter or a CK8 promter.
  • the codon optimised nucleic acid encoding the functional PABPNl protein may also comprise a Kozak sequence.
  • the nucleic acid encoding the functional PABPNl protein as described herein may be comprised within a plasmid expression vector .
  • a plasmid expression vector Suitable plasmid expression vectors have been described herein and will be known in the art.
  • a suitable plasmid expression vector is a pAAV vector e.g., a pscAAV plasmid vector or pssAAV plasmid vector.
  • the expression vector is mini-circle DNA. Mini-circle DNA vectors have been described herein.
  • the expression vector is a viral vector.
  • a viral vector based on any appropriate virus may be used to deliver a codon optimised nucleic acid encoding the functional PABPNl protein of the disclosure.
  • hybrid viral systems may be of use. The choice of viral delivery system will depend on various parameters, such as the tissue targeted for delivery, transduction efficiency of the system, pathogenicity, immunological and toxicity concerns, and the like.
  • RNAs and ddRNAi constructs of the disclosure have been described in the context of the RNAs and ddRNAi constructs of the disclosure and shall be taken to apply mutatis mutandis to this example.
  • the viral vector is an AAV.
  • the viral vector is an AdV vector.
  • the viral vector is a lentivirus.
  • viral or non-viral systems known to those skilled in the art may be used to deliver the codon-optimised nucleic acid encoding functional PABPNl protein of the present disclosure to cells of interest, including but not limited to gene-deleted adenovirus- transposon vectors (see Yant, et al., Nature Biotech. 20:999-1004 (2002)); systems derived from Sindbis virus or Semliki forest virus (see Perri, et al, J. Virol. 74(20):9802-07 (2002)); systems derived from Newcastle disease virus or Sendai virus.
  • the codon-optimised nucleic acid encoding the functional PABPNl protein as described herein is provided with a nucleic acid, ddRNAi construct or expression vector of the disclosure
  • the codon-optimised nucleic acid encoding the functional PABPNl protein may be comprised within the same expression vector as the nucleic acid or ddRNAi construct.
  • the codon-optimised nucleic acid encoding the functional PABPNl protein and the nucleic acid or ddRNAi construct of the disclosure may be provided as a single DNA construct e.g., within an expression vector.
  • the codon-optimised nucleic acid encoding functional PABPNl protein and the nucleic acid or ddRNAi construct may be comprised within different expression vectors.
  • the respective expression vectors may be the same type of vector or be different types of vectors.
  • Exemplary cell culture models of OPMD have been described herein, including in the working examples e.g., Examples 4 and 5. Such cell culture models of OPMD may be used for assessing the ability of an agent of the disclosure to replace functional PABPNl protein in the presence of one or more nucleic acids encoding shmiRs of the disclosure targeting endogenous PABPNl.
  • PABPNl protein have also been described and apply mutatis mutandis to this example.
  • the presence or absence or relative amount of PABPNl protein may be detected using any one or more of Western blotting, ELISA, or other standard quantitative or semiquantitative techniques available in the art, or a combination of such techniques.
  • mutant and functional PABPNl proteins may be expressed with appropriate protein tags e.g., myc or flag tags, to facilitate differential detection of mutant and functional
  • PABPNl proteins using appropriate antibodies which are commercially available.
  • the mutant human PABPNl protein may be expressed with a FLAG tag.
  • the presence or absence or relative amount of both mutant and functional PABPNl protein may be detected independently in a cell following transfection or transduction of the cell with one or more nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure and an agent for replacing functional PABPNl protein of the disclosure (which may be provided separately or together as described herein).
  • the presence or absence or relative abundance of PABPNl polypeptide may be detected with techniques which comprise antibody capture of PABPNl polypeptides in combination with electrophoretic resolution of captured PABPNl polypeptides, for example using the IsonosticTM Assay (Target Discovery, Inc.). Antibodies are commercially available for PABPNl protein.
  • An agent of the disclosure that expresses a PABPNl protein which is not causative of
  • OPMD in a cell in the presence of the nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure (expressing one or more shmiR(s) of the disclosure) is considered to be useful for treating OPMD.
  • any of the foregoing animal models can be used to determine the efficacy of an agent of the disclosure to replace functional PABPNl protein in vivo in the presence of one or more nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure (expressing one or more shmiR(s) of the disclosure).
  • histological and morphological analyses may be used to determine the efficacy of an agent of the disclosure to replace functional PABPNl protein in vivo in the presence one or more nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure (expressing one or more shmiR(s) of the disclosure).
  • Further assays which may be used to determine efficacy of an agent of the disclosure to replace functional PABPNl protein in vivo are described in Trollet et ah, (2010) Human Molecular Genetics, 19(11): 2191-2207.
  • the present disclosure also provides a single DNA construct comprising the nucleic acid encoding the functional PABPNl protein as described herein and one or more ddRNAi construct(s) of the disclosure.
  • An exemplary DNA construct comprising a nucleic acid encoding the functional PABPNl protein and the ddRNAi construct of the disclosure is described in Example 7.
  • the DNA construct may comprise a single ddRNAi construct as described herein in combination with the nucleic acid encoding the functional PABPNl protein.
  • the DNA construct may comprise a plurality of ddRNAi constructs in combination with the nucleic acid encoding the functional PABPNl protein.
  • the DNA sequence encoding the functional PABPNl protein is codon optimised such that its mRNA transcript is not targeted by the shmiR(s) of the ddRNAi construct(s).
  • functional PABPNl protein is a wild-type human PABPNl protein e.g., having a sequence set forth in SEQ ID NO: 74.
  • codon optimised DNA sequence encoding the functional PABPNl protein may vary depending on the shmiR(s) encoded by the ddRNAi construct. That is, the specific codons within the PABPNl mRNA transcript to be modified may vary depending on the effector sequence(s) of shmiR(s) encoded by the ddRNAi construct.
  • a codon optimised DNA sequence encoding the functional PABPNl protein is set forth in SEQ ID NO: 73.
  • the DNA construct may also comprise one or more promoters e.g., to drive expression of the functional PABPNl protein and/or shmiRs encoded by the ddRNAi construct.
  • Promoters useful in some examples of the present disclosure can be tissue-specific or cell- specific.
  • Exemplary promoters for use in the DNA constructs of the disclosure are muscle-specific promoter, such as for example, Spc512 and CK8.
  • any suitable promoter known in the art is contemplated for use in the DNA construct described herein e.g., such as those described in US 20110212529 Al.
  • the DNA construct may be provided in the form of an expression vector or may be comprised within an expression vector. Suitable expression vectors have been described herein and will be known in the art.
  • the expression vector is a viral vector.
  • a viral vector based on any appropriate virus may be used to deliver the single DNA construct of the disclosure.
  • hybrid viral systems may be of use. The choice of viral delivery system will depend on various parameters, such as the tissue targeted for delivery, transduction efficiency of the system, pathogenicity, immunological and toxicity concerns, and the like.
  • a suitable plasmid expression vector is a pAAV vector e.g., a pscAAV plasmid vector or pssAAV plasmid vector.
  • a pAAV vector e.g., a pscAAV plasmid vector or pssAAV plasmid vector.
  • Other exemplary viral systems for delivery of genetic material to a cell or animal have been described in the context of the ddRNAi constructs of the disclosure and shall be taken to apply mutatis mutandis to this example.
  • the DNA construct is provided in the form of a pAAV expression vector comprising, in a 5' to 3' direction, a muscle-specific promoter e.g., a Spc512 promoter, a ddRNAi construct as described herein and a PABPNl construct described herein, e.g., wherein the ddRNAi construct is positioned in the 3' untranslated region (UTR) of nucleic acid encoding the functional PABPNl protein.
  • a DNA construct in accordance with this example is illustrated in Figure 12A.
  • An exemplary DNA construct in accordance with this example is a pAAV expression vector comprising, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., Spc512
  • a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct;
  • a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR17 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR13 as described herein.
  • the DNA construct may comprise or consist of the
  • Another exemplary DNA construct in accordance with this example is a pAAV expression vector comprising, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., Spc512
  • a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct;
  • a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR3 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR14 as described herein.
  • DNA construct may comprise or consist of the DNA sequence set forth in SEQ ID NO: 71.
  • the DNA construct is provided in the form of a pAAV expression vector comprising, in a 5' to 3' direction, a first muscle-specific promoter e.g., a CK8 promoter, a PABPNl construct as described herein, a second muscle-specific promoter e.g., a Spc512 promoter, and a ddRNAi construct as described herein, wherein the first and second muscle-specific promoters are in operable linkage with the PABPNl construct and the ddRNAi construct respectively.
  • a DNA construct in accordance with this example is illustrated in Figure 12B.
  • the promoter which is in operable linkage with the PABPNl construct will be operably linked to the DNA sequence encoding a functional PABPNl protein comprised therein, the promoter which is in operable linkage with the ddRNAi construct will be operably-linked with one or more nucleic acids encoding a shmiR of the disclosure.
  • a DNA construct in accordance with this example is illustrated in Figure 12A.
  • An exemplary DNA construct in accordance with this example is a pAAV expression vector comprising, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., CK8 promoter, positioned upstream of a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR17 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR13 as described herein;
  • a muscle-specific promoter e.g., Spc512 promoter, positioned upstream of a PABPNl construct as described herein comprising a DNA sequence encoding a functional
  • PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct.
  • the DNA construct may comprise or consist of the
  • Another exemplary DNA construct in accordance with this example is a pAAV expression vector comprising, in a 5' to 3' direction:
  • a muscle-specific promoter e.g., CK8 promoter, positioned upstream of a ddRNAi construct of the disclosure comprising a nucleic acid comprising a DNA sequence encoding shmiR3 as described herein and a nucleic acid comprising a DNA sequence encoding shmiR14 as described herein;
  • a muscle-specific promoter e.g., Spc512 promoter, positioned upstream of a PABPNl construct as described herein comprising a DNA sequence encoding a functional PABPNl protein having a mRNA transcript which is not targeted by the shmiRs encoded by the ddRNAi construct.
  • the DNA construct may comprise or consist of the
  • An exemplary ddRNAi construct encoding shmiR13 and shmiR17 for inclusion in a DNA construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 31 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 31 e.g., an effector complement sequence set forth in SEQ ID NO: 30 (shmiR13), and a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 39 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 39 e.g., an effector complement sequence set forth in SEQ ID NO: 38 (shmiR17).
  • the ddRNAi construct in accordance with this example of the DNA construct may comprise a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 64 (shmiR13), and a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 68 (shmiR17).
  • An exemplary ddRNAi construct encoding shmiR3 and shmiR14 for inclusion in a DNA construct of the disclosure comprises a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 17 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: ⁇ e.g., an effector complement sequence set forth in SEQ ID NO: 16 (shmiR3), and a nucleic acid comprising or consisting of a DNA sequence encoding a shmiR comprising an effector sequence set forth in SEQ ID NO: 33 and an effector complement sequence which is substantially complementary to the sequence set forth in SEQ ID NO: 33 e.g., an effector complement sequence set forth in SEQ ID NO: 34 (shmiR14).
  • the ddRNAi construct in accordance with this example of the DNA construct may comprise a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 57 (shmiR3), and a nucleic acid comprising or consisting of the DNA sequence set forth in SEQ ID NO: 65 (shmiR14).
  • a DNA construct in accordance with the present disclosure may include any ddRNAi construct described herein encoding one or more shmiRs.
  • ddRNAi constructs encoding shmiRs described in Examples 1 to 5 may be particularly suitable for inclusion in a DNA construct of the disclosure.
  • compositions and carriers are Compositions and carriers
  • the nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure is/are provided in a composition.
  • a nucleic acid encoding a functional PABPNl protein of the disclosure is provided in a composition.
  • the nucleic acid(s), ddRNAi construct(s) or expression vector(s) of the disclosure is/are provided in a composition together with a nucleic acid encoding a functional PABPNl protein of the disclosure.
  • the one or more nucleic acid(s) or ddRNAi construct(s) and the nucleic acid encoding a functional PABPN1 protein are provided in the same expression vector within a composition.
  • the expression vector may comprise a ddRNAi construct of the disclosure alone or in combination with a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure.
  • Reference herein to an expression vector and/or a composition comprising same will therefore be understood to encompass: (i) an expression vector comprising a ddRNAi construct of the disclosure, or a composition comprising same; (ii) an expression vector comprising both of a ddRNAi construct of the disclosure and a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure, or a composition comprising same; or (iii) an expression vector comprising a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure, or a composition comprising same.
  • composition of the disclosure may comprise (i) an expression vector comprising a ddRNAi construct of the disclosure, and (ii) an expression vector comprising a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure.
  • a composition of the disclosure may comprise a single expression vector comprising ddRNAi construct of the disclosure and a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure.
  • an expression vector comprising a ddRNAi construct of the disclosure may be provided in one composition and an expression vector comprising a codon-optimised nucleic acid encoding the functional PABPN1 protein of the disclosure may be provided within another composition e.g., which are packaged together.
  • composition of the disclosure may also comprise one or more pharmaceutically acceptable carriers or diluents.
  • the composition may comprise a carrier suitable for delivery of the nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure to muscle of a subject following administration thereto.
  • the carrier is a lipid-based carrier, cationic lipid, or liposome nucleic acid complex, a liposome, a micelle, a virosome, a lipid nanoparticle or a mixture thereof.
  • the carrier is a biodegradable polymer-based carrier, such that a cationic polymer-nucleic acid complex is formed.
  • the carrier may be a cationic polymer microparticle suitable for delivery of one or more nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure to muscle cells or tissue of the eye.
  • cationic polymers for delivery compositions to cells is known in the art, such as described in Judge et al. Nature 25: 457-462 (2005), the contents of which is incorporated herein by reference.
  • An exemplary cationic polymer-based carrier is a cationic DNA binding polymer, such as polyethylenimine.
  • cationic polymers suitable for complexing with, and delivery of nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure include poly(L-lysine) (PLL), ehitosan, PAMAM dendrimers, and poly(2- dimethylamino)ethyl methacrylate (pDMAEMA).
  • PLL poly(L-lysine)
  • ehitosan poly(2- dimethylamino)ethyl methacrylate
  • pDMAEMA poly(2- dimethylamino)ethyl methacrylate
  • Other polymers include poly beta - amino esters.
  • Such carrier formulations have been developed for various delivery routes including parenteral subcutaneous injection, intravenous injection and inhalation.
  • the carrier is a cyclodextrin-based carrier such as a cyclodextrin polymer-nucleic acid complex.
  • the carrier is a protein-based carrier such as a cationic peptide - nucleic acid complex.
  • the carrier is a lipid nanoparticle.
  • Exemplary nanoparticles are described, for example, in US7514099.
  • the nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure is/are formulated with a lipid nanoparticle composition comprising a cationic lipid/Cholesterol/PEG-C-DMA/DSPC ⁇ e.g., in a 40/48/2/10 ratio), a cationic lipid/Cholesterol/PEG-C-DMA/DSPC ⁇ e.g., in a 40/48/2/10 ratio), a cationic
  • lipid/Cholesterol/PEG-DMG/DSPC ⁇ e.g., in a 40/48/2/10 ratio
  • a cationic lipid/Cholesterol/PEG-DMG/DSPC ⁇ e.g., in a 40/48/2/10 ratio
  • a cationic lipid/Cholesterol/PEG-DMG/DSPC ⁇ e.g., in a 40/48/2/10 ratio
  • the cationic lipid is Octyl CL in DMA, DL in DMA, L-278, DLinKC2DMA, or MC3.
  • nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure is/are formulated with any of the cationic lipid formulations described in WO 2010/021865; WO 2010/080724; WO 2010/042877; WO 2010/105209 or WO
  • nucleic acid(s) or ddRNAi construct(s), or expression vector(s) of the disclosure is/are conjugated to or complexed with another compound, e.g., to facilitate delivery of the nucleic acid(s), ddRNAi construct(s), or expression vector(s).
  • conjugates are described in US 2008/0152661 and US
  • 2004/0162260 e.g., CDM-LBA, CDM-Pip-LBA, CDM-PEG, CDM-NAG, etc.
  • polyethylene glycol is covalently attached to a RNA or ddRNAi or expression vector of the disclosure.
  • the attached PEG can be any molecular weight, e.g., . from about 100 to about 50,000 daltons (Da).
  • the nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure is/are formulated with a carrier comprising surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes), such as is disclosed in for example, WO 96/10391; WO 96/10390; or WO 96/10392.
  • a carrier comprising surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes), such as is disclosed in for example, WO 96/10391; WO 96/10390; or WO 96/10392.
  • the nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure can also be formulated or complexed with polyethyleneimine or a derivative thereof, such as polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine (PEI-PEG- GAL) or polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosarnine (PEI-PEG- triGAL) derivatives.
  • polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine PEI-PEG- GAL
  • PEI-PEG- triGAL polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosarnine
  • nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure is/are complexed with membrane disruptive agents such as those described in U.S. Patent Application Publication No. 2001/0007666.
  • compositions will desirably include materials that increase the biological stability of the nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure and/or materials that increase the ability of the compositions to localise to and/or penetrate muscle cells selectively.
  • the therapeutic compositions of the disclosure may be administered in pharmaceutically acceptable carriers (e.g., physiological saline), which are selected on the basis of the mode and route of administration, and standard pharmaceutical practice.
  • pharmaceutically acceptable carriers e.g., physiological saline
  • One having ordinary skill in the art can readily formulate a pharmaceutical composition that comprises one or more nucleic acid(s), ddRNAi construct(s), or expression vector(s) of the disclosure. In some cases, an isotonic formulation is used.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • isotonic solutions such as phosphate buffered saline are preferred.
  • Stabilizers include gelatin and albumin.
  • a vasoconstriction agent is added to the formulation.
  • the compositions according to the present disclosure are provided sterile and pyrogen free. Suitable pharmaceutical carriers, as well as pharmaceutical necessities for use in pharmaceutical formulations, are described in Remington: The Science and Practice of Pharmacy (formerly Remington's Pharmaceutical Sciences), Mack Publishing Co., a standard reference text in this field, and in the USP/NF.
  • the volume, concentration, and formulation of the pharmaceutical composition, as well as the dosage regimen may be tailored specifically to maximize cellular delivery while minimizing toxicity such as an inflammatory response e.g, relatively large volumes (5, 10, 20, 50 ml or more) with corresponding low concentrations of active ingredients, as well as the inclusion of an anti-inflammatory compound such as a corticosteroid, may be utilized if desired.
  • an inflammatory response e.g, relatively large volumes (5, 10, 20, 50 ml or more) with corresponding low concentrations of active ingredients, as well as the inclusion of an anti-inflammatory compound such as a corticosteroid, may be utilized if desired.
  • compositions of the disclosure may be formulated for administration by any suitable route.
  • routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as transdermal or by inhalation or suppository.
  • routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as transdermal or by inhalation or suppository.
  • compositions of the disclosure are formulated for IM administration.
  • IM intravenous
  • IM intramuscular
  • oral intraperitoneal
  • intradermal intraarterial
  • subcutaneous injection intravenous
  • compositions of the disclosure is formulated for IM administration.
  • suitable sterile, non- pyrogenic vehicle e.g., buffered saline for injection
  • parenteral administration e.g., IM
  • intravenously including intravenous infusion
  • SC for intraperitoneal administration.
  • Some routes of administration such as IM, IV injection or infusion, may achieve effective delivery to muscle tissue and transfection of a ddRNAi constructs and/or codon-optimised nucleic acids encoding PABPNl of the disclosure, and expression of RNA and/or the codon- optimised nucleic acid therein.
  • nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition(s) comprising same as described herein be used for inhibiting expression of endogenous PABPNl protein, including a PABPNl protein which is causative of OPMD, in a subject.
  • nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition(s) comprising same as described herein may be used to treat OPMD in a subject suffering therefrom.
  • nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition(s) comprising same as described herein may be used to prevent the development or progression of one or more symptoms of OPMD in a subject suffering therefrom or predisposed thereto.
  • the expression vector and/or composition of the disclosure may comprise both a ddRNAi construct of the disclosure and a codon-optimised nucleic acid encoding functional PABPNl protein of the disclosure. Accordingly, administration of the expression vector or composition may be effective to (i) inhibit, reduce or knockdown expression of endogenous PABPNl, including the PABPNl protein comprising an expanded polyalanine tract which is causative of OPMD, and (ii) provide for expression of a functional PABPNl protein which is not targeted by shmiRs or shRNAs which inhibit, reduce or knockdown expression of endogenous PABPNl.
  • a composition of the disclosure may thus restore PABPNl protein function e.g.,. post-transcriptional processing of RNA, in a cell or animal to which it is administered.
  • treatment of OPMD may comprise administering separately to a subject (i) one or more agents for inhibiting expression of a PABPNl protein which is causative of OPMD, and (ii) an expression vector comprising a codon-optimised nucleic acid encoding functional PABPNl protein of the disclosure or composition comprising same.
  • the one or more agents for inhibiting expression of a PABPNl protein which is causative of OPMD may be a nucleic acid, a ddRNAi construct, an expression vector or composition comprising same as described herein or a plurality of any one or more thereof.
  • the subject may be administered components (i) and (ii) together, simultaneously or consecutively.
  • treatment of OPMD may comprise administering to a subject a codon- optimised nucleic acid encoding a functional PABPNl protein of the disclosure, wherein the subject has previously been administered one or more agents for inhibiting expression of a PABPNl protein which is causative of OPMD but which does not inhibit expression of the codon-optimised nucleic acid.
  • the subject may have been previously administered a nucleic acid, a ddRNAi construct, an expression vector or composition comprising same as described herein or a plurality of any one or more thereof.
  • routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as transdermal or by inhalation or suppository.
  • routes of administration include intravenous (IV), intramuscular (IM), oral, intraperitoneal, intradermal, intraarterial and subcutaneous injection.
  • IV intravenous
  • IM intramuscular
  • IV injection or infusion may achieve effective delivery to muscle tissue and transfection of a ddRNAi constructs and/or codon-optimised nucleic acids encoding PABPNl of the disclosure, and expression of shmiRs or shRNA and/or the codon-optimised nucleic acid therein.
  • nucleic acid a ddRNAi construct, an expression vector or composition comprising same as described herein, or a plurality of any one or more thereof, which would be required to treat a subject suffering from OPMD.
  • the therapeutically effective dose level for any particular patient will depend upon a variety of factors including: the composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of sequestration of the nucleic acid, a ddRNAi construct, an expression vector or composition comprising same as described herein, or a plurality of any one or more thereof, the duration of the treatment, together with other related factors well known in medicine.
  • Efficacy of a nucleic acid, a ddRNAi construct, an expression vector or composition comprising same of the disclosure to reduce or inhibit expression of the PABPNl protein causative of OPMD and to express functional PABPNl protein which is not causative of OPMD in an amount sufficient to restore PABPNl function may be determined by evaluating muscle contractile properties and/or swallowing difficulties in the subject treated. Methods for testing swallowing ability and muscle contractile properties are known in the art. For example, swallowing difficulties may be evaluated using videofluoroscopy, UGI endoscopy or oesophageal manometry and impedance testing. Other methods for assessing clinical features of OPMD are described in Riiegg et al,. (2005) Swiss Medical Weekly, 135:574-586.
  • the present disclosure also provides one or more nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition comprising same of the disclosure in the form of a kit.
  • the kit may comprise a container.
  • the kit typically contains one or more nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition comprising same of the disclosure with instructions for its, or their, administration.
  • the kit contains more than one nucleic acid, ddRNAi construct, expression vector or composition comprising same of the disclosure.
  • the kit comprises (i) a first kit component for reducing or inhibiting expression of a PABPNl protein causative of OPMD, comprising one or more nucleic acid(s), ddRNAi construct(s), expression vector(s) or composition comprising same of the disclosure, and (ii) an expression vector comprising a codon-optimised nucleic acid encoding the functional PABPNl protein of the disclosure or composition comprising same, as a second kit component.
  • the first and second kit components may be packaged together in a kit.
  • Sequences representing potential targets for design of siRNA constructs were identified from the PABPN1 mRNA sequence using publicly available siRNA design algorithms (including Ambion, Promega, Invitrogen, Origene and MWG): the selected sequences were conserved in humans, non-human primates, bovine and mice species.
  • Sequences encoding the candidate siRNAs were incorporated into a pre-miR30a scaffold in order to create a sequence encoding a short-hairpin microRNA (shmiR) comprising a 5' flanking region (SEQ ID NO: 41), a siRNA sense strand sequence (effector complement sequence), a stem/loop junction sequence (SEQ ID NO: 40), a siRNA anti-sense strand (effector sequence), and a 3' flanking region (SEQ ID NO:42).
  • the predicted secondary structure of a representative shmiR is shown in Figure 1.
  • the target regions of the PABPN1 mRNA transcript for the designed shmiRs are presented in Table 1 and corresponding shmiR effector sequences (antisense strand) are presented in Table 2.
  • PABPN1 transcripts dual-luciferase reporter assays were performed in HEK293 cells.
  • pGL3 Luciferase reporter vectors were constructed.
  • the Luciferase reporters were generated by inserting the complete coding sequence of either wild-type or codon-optimised PABPN1 (wtPABPNl or optPABPNl) into the pGL3-control vector (Promega, Madison, WI).
  • the inserts were subcloned into the 3' UTR of the luciferase reporter gene using Fsel and Xbal restriction enzyme sites.
  • the HEK293 cell line was purchased from ATCC (Manassas, VA). HEK293 cells were cultured in DMEM medium containing 10% fetal bovine serum, 2mM glutamine, penicillin (lOOU/mL), and streptomycin (100 ⁇ g/mL) at 37°C humid incubator with 5% C02. Briefly, the HEK293 cell were seeded at a density of 2xl0 4 cells per well into 96-well culture plate one day prior to transfection.
  • the PABPN1 shmiR-expressing constructs and their corresponding antisense or sense Luciferase reporter and Renilla control reporter constructs were co-transfected into HEK293 cells using Fugene 6 (Promega, Madison, WI) according to manufacturer's instructions. For each well of transfection, lOOng of one of the PABPN1 shmiRs, lOng of the corresponding Lucif erase reporter construct and lng of Renilla control reporter construct (served as transfection control) were co-transfected using 0.3uL of Fugene 6. 48 hour post- transfection, cell lysates were collected and analyzed using Dual Luciferase Reporter Assay System (Promega, Madison, WI).
  • the firefly/Renilla activity ratios were determined for each well, and the inhibition efficiency of shmiRs were calculated by normalizing to a non- targeting siRNA, pSilencer control (Thermo Fisher, USA). Percent inhibition of wtPABPNl or optPABPNl reporter constructs in HEK293 cells for the sense and antisense strands of each of the shmiRs relative to the psilencer control are illustrated in Figures 2 and 3.
  • shmiRl 1 As is evident in Figures 2 and 3, all except one of the exemplary shmiRs (shmiRl 1) designated in Table 2 downregulated the level of luciferase expressed from the wtPABPNl Luciferase reporter vector (Figure 2) but did not downregulate the expression from the coPABPBNl ( Figure 3) reporter.
  • shmiR-3, shmiR-4, shmiR-13, shmiR-14, shmiR-16, and shmiR-17 were shown to have potent inhibitory activity (defined as greater than 70% inhibition of luciferase activity relative to cells treated with an unrelated shRNA as a negative control) against the PABPN1 target mRNA sequences, while possessing weak activity (less than 35% inhibition) against their cognate reporters containing a target sequence recognised by the passenger strand.
  • potent inhibitory activity defined as greater than 70% inhibition of luciferase activity relative to cells treated with an unrelated shRNA as a negative control
  • weak activity less than 35% inhibition
  • shmiRs 2, 3, 5, 9, 13, 14, 16, and 17 were selected for further analysis.
  • the shmiR containing plasmids driven by the U6 promoter described in example 2 were used along with two additional expression plasmids.
  • One coding for a FLAG-tagged human wtPABPNl (wt-PABPNl-FLAG; SEQ ID NO: 75), and the other comprising a codon-optimised sequence coding for human PABPN1 with a FLAG tag (co-PABPNl-FLAG; SEQ ID NO: 76).
  • HEK293T Human embryonic kidney cells (HEK293T, ATCC, Manassas, USA) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 20mM HEPES, 2 mM glutamine, 10% foetal bovine serum (FBS), IX Penstrep.
  • DMEM Dulbecco's modified Eagle's medium
  • HEK293T cells were seeded at lxlO 6 cells/well and transfected the next day with one of the shmiR plasmids described above (300 ng/well), with or without plasmids expressing wild-type human PABPNl (wt-PABPNl-FLAG) (100 ng/well) (SEQ ID NO:75) or codon-optimized PABPNl (co-PABPNl-FLAG) (100 ng/well) (SEQ ID NO:76).
  • HEK293T cells were transfected with the pSilencer control plasmid expressing a non-targeting siRNA sequence (Thermo Fisher, USA). The HEK293T cells were incubated at 37°C in complete DMEM media for 72 hours, after which time the cells were harvested and cell lysates were analyzed by Western blot.
  • Cell lysates were prepared by incubating cells in RIPA buffer containing: NaCl 0.15M, 0.1% SDS, 50 mM Tris (pH8), 2 mM EDTA and 10% Triton-X-100 with protease inhibitor cocktail (Complete, Roche Diagnostics).
  • Proteins were separated on 4-12% Bis-Tris gel (Invitrogen) and transferred to the nitrocellulose membrane using the iBlot 2 dry blotting system (Life Technologies). Blots were blocked and probed with primary and secondary antibodies using the iBind Western System (Invitrogen). Primary antibodies (anti-flag (GenScript) and anti-Hsp90 (Sigma)) were used at 1 :500 dilution while secondary AP-conjugated antibodies (anti- mouse and anti-rabbit, Sigma) were used at 1 :6000 dilutions. Bands were detected using DDAO dye and visualized using a FLA-3000 scanner (Fuji).
  • HEK293T Human embryonic kidney cells (HEK293T, ATCC, Manassas, USA) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 20mM HEPES, 2 mM glutamine, 10% foetal bovine serum (FBS), IX Penstrep.
  • DMEM Dulbecco's modified Eagle's medium
  • HEK293T cells were seeded at lxlO 6 cells/well and transfected the next day with one of the shmiR plasmids described in Example 2 (300 ng/well).
  • HEK293T cells were transfected with the psilencer plasmid expressing a non-targeting siRNA sequence (Thermo Fisher, USA).
  • the HEK293T cells were incubated at 37°C in complete DMEM media for 72 hours, after which time the cells were harvested and RNA was extracted reverse transcribed and analyzed by qPCR. qPCR Analysis
  • qPCR analysis was performed on extracted RNA samples in order to quantify the level of inhibition of PABPNl at the mRNA level by the shmiRs described above.
  • TaqMan Primers and Probes were designed to specifically amplify wild-type PABPNl or codon optimized PABPNl. Primers were designed using GenScript TaqMan primer design tool (https://www.genscript.com/ssl-bin/app/primer)
  • each mRNA was normalized to GAPDH. Expression levels were calculated according to the total copies as determine by a standard curve and converted to percent inhibition relative to the pSilencer control.
  • Example 5 shmiR targeted gene silencing of PABPNl in C2C12 mouse muscle cells and ARPE-19 human retinal cells
  • C2C12 mouse muscle cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 20mM HEPES, 2 mM glutamine, 10% foetal bovine serum (FBS), IX Penstrep.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS foetal bovine serum
  • IX Penstrep IX Penstrep.
  • ARPE-19 human retinal cells were grown in Dulbecco's modified Eagle's
  • C2C12 cells were electroporated using the Neon Electroporation system (Pulse voltage: 1650, Pulse width: 10, Pulse number: 3). Both single shmiRs and combinations of two shmiRs described above (2 ⁇ g/well) were analyzed.
  • C2C12 cells were electroporated with the pSilencer plasmid expressing a non-targeting siRNA sequence (Thermo Fisher, USA).
  • the C2C12 cells were incubated at 37 °C in complete DMEM media for 24 hours, after which time 50ug/mL Hygromycin was added to slow the growth of non-transfected cells, followed by another addition of 100 ug/mL at 48 hours post electroporation. At 72 hours, the cells were harvested and total RNA was extracted for qPCR.
  • ARPE-19 cells were electroporated with the Neon electroporation system using the following conditions: Pulse voltage: 1350, Pulse width: 20, Pulse number: 2. Cells were treated as above for C2C12 cells except that 50ug/mL of Hygromycin was added at 24 hours with no further additions. ARPE-19 cells were harvested at both 48 and 72 hours for RNA extraction and qPCR analysis. qPCR Analysis
  • Reverse Transcriptase qPCR was performed as described for the HEK293 cells of Example 4 with the wtPABPNl primers and probes used to measure the expression of endogenous PABPN1 in response to inhibition by the shmiRs selected in Example 3. qPCR was performed in triplicate for shmiRs 3, 13, 14, 17 and in duplicate for shmiRs 2, 5, 9, 16 in the C2C12 cells. A single measurement was used at two time points (48 and 72 hours) for the ARPE-19 cells.
  • shmiRs 13/17 and shmiRs 3/14 were co-electroporated into the cells and expression of PABPNl was measured by qPCR as described above for the individual shmiRs.
  • Figure 8 demonstrates the effect these combinations of shmiRs had on the expression of PABPNl in C2C12 cells.
  • the shmiR 13/17 co-transfection resulted in a percent inhibition of PABPNl expression of 84.4% compared to 92.5% and 76.7% for individual shmiRs 13 and 17 respectively.
  • the shmiR 3/14 co-transfection resulted in 79.0% percent inhibition compared to 76.2% and 80.4% for individual shmiRs 3 and 14 respectively.
  • Example 6 Measurement of shmiR expression by qPCR In order to determine the total number of shmiRs expressed in C2C12 cells transfected with the best performing shmiRs as described above, a miScript assay was developed.
  • shmiR3-FWD 5' TTCATCTGCTTCTCTACCTCG -3' (SEQ ID NO: 83) shmiR13-FWD 5' AGGGGAATACCATGATGTCGC -3' (SEQ ID NO: 84) shmiR14-FWD 5' CTCATATTCATCTGCTTCTCT -3' (SEQ ID NO: 85) shmiR17-FWD 5' ATTCATCTGCTTCTCTACCTC -3' (SEQ ID NO: 86)
  • Reverse primers were provided in the Qiagen miScript SYBR green PCR kit. The following real-time PCR conditions were used: initial denaturation at 95°C for 15min followed by 40 cycles of 94°C for 15sec, 55°C for 30sec and 70°C for 30sec.
  • RNA copy numbers per cell were calculated based on the estimate of 10 ng total RNA in 333 C2C12 cells.
  • shmiR copies per cell were determined for each of shmiR3, shmiR13, shmiR14 and shmiR17 when expressed individually.
  • individual shRNA expression levels in C2C12 cells transduced with the shmiR vectors were estimated to be 51,663, 13,826, 11,576, and 14,791 copies per cell for shmiRs 3, 13, 14, and 17 respectively.
  • Example 7 Generation of vectors for simultaneous gene silencing of endogenous PABPNl and replacement with codon optimised PABPNl.
  • ssAAV2 single stranded adeno-associated virus type 2
  • the first construct, version 2 ( Figure 12A) is generated by subcloning two shmiRs targeting wtPABPNl into the 3' untranslated region of the optPABPNl transcript in the pAAV2 vector backbone. Expression of both optPABPNl and the two shmiRs in a single transcript is driven by the Muscle specific promoter Spc512.
  • the second construct, version 1, ( Figure 12B) is generated by subcloning two shmiRs targeting wtPABPNl into the sequence upstream of the optPABPNl transcript. In this construct, two transcripts are expressed, the first encoding the two shmiRs under control of the CK8 promoter and the second encoding optPABPNl under the Spc512 promoter.
  • HEK293T cells are cultured in cell factories in Dulbecco's modified Eagle's medium, supplemented with 10% FBS, and incubated at 37°C and 5% C0 2 .
  • the pAAV-shmiR viral plasmids as described in this example and a pAAVhelper and pAAVrepcap8 plasmid or pAAVhelper and pAAV repcap9 plasmid are complexed with Calcium Phosphate according to the manufacturer's instructions.
  • Triple-transfections are then performed with each of the pAAV-shmiR plasmids in combination with , pAAVhelper and pAAVrepcap8 or pAAVrepcap9 in the HEK293T cells.
  • the HEK293T cells are cultured for a period of 72 hours at 37°C and 5% CO2, after which time the cells are lysed and ssAAV shmiR- expressing particles for each of the viral plasmids are purified by iodixanol (Sigma- Aldrich) step-gradient ultracentrifugation followed by cesium chloride ultracentrifugation. The number of vector genomes was quantified by quantitative polymerase chain reaction (Q- PCR).
  • Q- PCR quantitative polymerase chain reaction
  • Adeno Associated Virus Serotype 9 (AAV9) capsid was selected for administration of the recombinant expression constructs via local intramuscular injection.
  • AAV9 Adeno Associated Virus Serotype 9
  • a number of different serotypes of AAV capsids including AAV8, AAVRh74, were tested.
  • Muscle transduction was assessed using a recombinant AAV9 construct that expressed the fluorescent protein GFP under the control of the Spc512 synthetic muscle promoter (AAV9-eGFP). Mice from both sexes were injected in each TA muscle with 50 ⁇ of the single stranded vector at a dose of 2el 1 total vector genomes. After twenty days, the mice were sacrificed and the injected limbs were examined by in vivo imaging.
  • PABPN1 A single stranded adeno-associated virus type 2 (ssAAV2) plasmid expressing shmiR17 and shmiR13 ⁇ e.g., as described in Tables 3 and 4) in combination with the optPABPNl sequence was created.
  • ssAAV2 single stranded adeno-associated virus type 2
  • SR-construct The silence and replace construct (hereinafter "SR-construct") was generated by subcloning DNA sequences encoding shmiR17 and shmiR13 (as described in Table 4) into the 3' untranslated region of the optPABPNl transcript in the pAAV2 vector backbone (pAAV-shmiR viral plasmid). Expression of both optPABPNl and the two shmiRs in a single transcript is driven by the muscle specific promoter Spc512.
  • Figure 14 A schematic of the SR- construct is provided in Figure 14.
  • HEK293T cells were cultured in cell factories in Dulbecco's modified Eagle's medium, supplemented with 10% FBS, and incubated at 37°C and 5% C0 2 .
  • the pAAV-shmiR viral plasmid and a pAAVhelper and pAAVrepcap8 plasmid or pAAVhelper and pAAV repcap9 or pAAV helper and pAAVRH74 plasmid were complexed with Calcium Phosphate according to the manufacturer's instructions.
  • Triple-transfections were then performed with the pAAV-shmiR plasmid in combination with the pAAVhelper and one of the following capsids; pAAVrepcap8, pAAVrepcap9 or pAAVRH74, in the HEK293T cells.
  • the HEK293T cells were then cultured for a period of 72 hours at 37°C and 5% C(3 ⁇ 4, after which time the cells were lysed and ssAAV shmiR-expressing particles were purified by iodixanol (Sigma- Aldrich) step-gradient ultracentrifugation followed by cesium chloride ultracentrifugation. The number of vector genomes was quantified by quantitative polymerase chain reaction (Q-PCR).
  • the SR-construct was administered individually, at a high and low dose, via intramuscular injection into the TA muscle of 10-12 week old A17 mice.
  • the low dose was set at lxlO 10 vector genomes per muscle.
  • the high dose was set at 6xl0 10 vector genomes per muscle.
  • Saline injected age-matched A17 mice served as the untreated group whilst FVB wildtype mice were also included as healthy comparators.
  • separate cohorts of mice were sacrificed at either 14 or 20 weeks post treatment to evaluate efficacy related to different time points. At sacrifice, the TA muscles were harvested and RNA and proteins extracted. qPCR analysis
  • RNA isolated from the TA muscles was evaluated by QPCR analysis.
  • the QPCR primers used were unable to discriminate between the wildtype PABPNl and the mutant PABPNl transcripts, but did not recognize or amplify sequences corresponding to the codon optimized PABPNl species.
  • Robust knockdown was observed with the SR-construct at both the high and low doses resulting in the reduction of PABPNl transcripts at 88.3% and 68.3% respectively (Figure 15). Additional analyses from these tissues demonstrated the presence of the shmiR transgenes in ratios consistent with the different levels of administered vectors.
  • the TA muscle cells from A17 mice weigh roughly 25% less than similar muscles from their FvB wildtype counterparts. At both doses tested, the SR-construct showed a significant restoration of muscle weight to near wild type levels of the FVB animals (Figure 19). Muscle strength

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/AU2017/051385 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof Ceased WO2018107228A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
MX2019007110A MX2019007110A (es) 2016-12-14 2017-12-14 Reactivos para el tratamiento de la distrofia muscular oculofaringea (opmd) y uso de estos.
IL267353A IL267353B2 (en) 2016-12-14 2017-12-14 Reagents for the treatment of (OCULOPHARYNGEAL MUSCULAR DYSTROPHY (OPMD) and their uses
RU2019121950A RU2763319C2 (ru) 2016-12-14 2017-12-14 Реагенты для лечения окулофарингеальной мышечной дистрофии (офмд) и их применение
EP17882179.9A EP3555294A4 (en) 2016-12-14 2017-12-14 REAGENTS FOR THE TREATMENT OF OCULOPHARYNGEAL MUSCLE DYSTROPHY (PDD) AND THEIR USE
US16/469,992 US11142765B2 (en) 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
CN202410482087.4A CN118421624A (zh) 2016-12-14 2017-12-14 用于治疗眼咽肌营养不良症(opmd)的试剂及其用途
KR1020197019981A KR102495222B1 (ko) 2016-12-14 2017-12-14 안구인두근위축증 (opmd)의 치료제 및 이의 사용
CN201780086338.5A CN110382698B (zh) 2016-12-14 2017-12-14 用于治疗眼咽肌营养不良症(opmd)的试剂及其用途
AU2017377661A AU2017377661B2 (en) 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof
JP2019532105A JP7233149B2 (ja) 2016-12-14 2017-12-14 眼咽頭型筋ジストロフィー(opmd)を治療するための試薬及びその使用
CA3047154A CA3047154A1 (en) 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof
IL304674A IL304674B2 (en) 2016-12-14 2017-12-14 Reagents for treating Oculopharyngeal Muscular Dystrophy (OPMD) and their uses
BR112019012312-1A BR112019012312B1 (pt) 2016-12-14 2017-12-14 Ácido nucleico que codifica micro-rna hairpin curto, construto de interferência de rna, construto de dna, vetorde expressão, combinação de vetores, composição, método in vitro de inibição da expressão de uma proteína pabpn1, kit eusos
KR1020237003441A KR102667867B1 (ko) 2016-12-14 2017-12-14 안구인두근위축증(opmd)의 치료제 및 이의 사용
JP2023023159A JP7431359B2 (ja) 2016-12-14 2023-02-17 眼咽頭型筋ジストロフィー(opmd)を治療するための試薬及びその使用
AU2023222827A AU2023222827B2 (en) 2016-12-14 2023-08-28 Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662434312P 2016-12-14 2016-12-14
US62/434,312 2016-12-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/469,992 A-371-Of-International US11142765B2 (en) 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
US17/463,923 Continuation US11932852B2 (en) 2016-12-14 2021-09-01 Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof

Publications (1)

Publication Number Publication Date
WO2018107228A1 true WO2018107228A1 (en) 2018-06-21

Family

ID=62557655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2017/051385 Ceased WO2018107228A1 (en) 2016-12-14 2017-12-14 Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof

Country Status (12)

Country Link
US (2) US11142765B2 (https=)
EP (1) EP3555294A4 (https=)
JP (2) JP7233149B2 (https=)
KR (2) KR102495222B1 (https=)
CN (2) CN110382698B (https=)
AU (2) AU2017377661B2 (https=)
CA (1) CA3047154A1 (https=)
IL (2) IL304674B2 (https=)
MX (2) MX2019007110A (https=)
RU (1) RU2763319C2 (https=)
WO (1) WO2018107228A1 (https=)
ZA (1) ZA202106827B (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020077412A1 (en) * 2018-10-17 2020-04-23 Benitec Biopharma Limited Methods for treating oculopharyngeal muscular dystrophy (opmd)
WO2020172720A1 (en) 2019-02-28 2020-09-03 Benitec Biopharma Limited Compositions and methods for treating oculopharyngeal muscular dystrophy (opmd)
US11142765B2 (en) 2016-12-14 2021-10-12 Benitec Ip Holdings, Inc. Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
US20220389423A1 (en) * 2019-12-23 2022-12-08 Versameb Ag Compositions and Methods for Simultaneously Modulating Expression of Genes
WO2026011009A1 (en) * 2024-07-02 2026-01-08 Kate Therapeutics, Inc. Compositions and methods for muscle disorders

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017177277A1 (en) * 2016-04-14 2017-10-19 Benitec Biopharma Limited Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL159756A0 (en) * 2001-07-12 2004-06-20 Univ Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
EP1783645A1 (en) * 2005-11-08 2007-05-09 Actigenics Methods for the identification of microRNA and their applications in research and human health
EP2275560A3 (en) * 2007-01-31 2012-01-25 BASF Plant Science GmbH Trangenic plants wherein the transgene is a memeber of the REMORIN gene family or a consensus sequence thereof having enhanced yield-related traits and a method for making the same
DK2164967T3 (en) * 2007-05-31 2015-10-19 Univ Iowa Res Found Reduction of off-target rna interferenstoksicitet
WO2010105372A1 (en) * 2009-03-20 2010-09-23 Protiva Biotherapeutics, Inc. Compositions and methods for silencing hepatitis c virus expression
EP2814514B1 (en) * 2012-02-16 2017-09-13 Atyr Pharma, Inc. Histidyl-trna synthetases for treating autoimmune and inflammatory diseases
WO2014077693A1 (en) * 2012-11-16 2014-05-22 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Means and methods for reducing an effect of aging in a mammalian cell
KR20150103280A (ko) * 2013-01-08 2015-09-09 베니텍 바이오파마 리미티드 연령-관련 황반 변성 치료
JP7233149B2 (ja) * 2016-12-14 2023-03-06 ベニテック アイピー ホールディングス インコーポレーテッド 眼咽頭型筋ジストロフィー(opmd)を治療するための試薬及びその使用

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017177277A1 (en) * 2016-04-14 2017-10-19 Benitec Biopharma Limited Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
ANVAR ET AL., AGING, vol. 5, no. 6, 2013, pages 412 - 426
ANVAR, S.Y. ET AL.: "A decline in PABPN1 induces progressive muscle weakness in Oculopharyngeal muscle dystrophy and in muscle again", AGING, vol. 5, no. 6, 1 June 2013 (2013-06-01), pages 412 - 426, XP055103909, Retrieved from the Internet <URL:http://www.sigmaaldrich.com/catalog/genes/PABPNl?lang=en&region=AU> [retrieved on 20170515] *
APPONI ET AL., HUMAN MOLECULAR GENETICS, vol. 19, no. 6, 2010, pages 1058 - 1065
APPONI, L.H. ET AL.: "Loss of nuclear poly(A)-binding protein 1 causes defects in myogenesis and mRNA biogenesis", HUMAN MOLECULAR GENETICS, vol. 19, no. 6, 15 March 2010 (2010-03-15), pages 1058 - 1065, XP055432462 *
BODEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 32, no. 3, 2004, pages 1154 - 1158
BODEN, D. ET AL.: "Enhanced gene silencing of HIV-1 specific siRNA using microRNA designed hairpins", NUCLEIC ACIDS RESEARCH, vol. 32, no. 3, 13 February 2004 (2004-02-13), pages 1154 - 1158, XP003005126, Retrieved from the Internet <URL:DOI:10.1093/nar/gkh278> *
DICKSON ET AL., MOLECULAR THERAPY, vol. 23, no. 1, 2016, pages 199
DICKSON, G. ET AL.: "Gene Therapy Rescues Disease Phenotype in the Oculopharyngeal Muscular Dystrophy Mouse Model", MOLECULAR THERAPY, vol. 24, no. 1, 1 May 2016 (2016-05-01), pages 199, XP055493106 *
FELLMANN ET AL., CELL REPORTS, vol. 5, 2013, pages 1704 - 1713
FELLMANN, C. ET AL.: "An optimized microRNA Backbone for Effective Single-Copy RNAi", CELL REPORTS, vol. 5, 2013, pages 1704 - 1713, XP055140183 *
FOWLER ET AL., NUCLEIC ACIDS RESEARCH, vol. 44, no. 5, 2016, pages e48
FOWLER, D.K. ET AL.: "Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi", NUCLEIC ACIDS RESEARCH, vol. 44, no. 5, 18 March 2016 (2016-03-18), pages e48, XP055480853, Retrieved from the Internet <URL:doi:10.1093/nar/gkv1246> *
KLEIN ET AL., JOURNAL OF NEUOMUSCULAR DISEASES, vol. 1, no. 1, 2014, pages 222
KLEIN, P. ET AL.: "Gene therapy strategy for oculopharyngeal muscular dystrophy (OPMD", JOURNAL OF NEUROMUSCULAR DISEASES, vol. 1, no. 1, 2014, pages 222, XP009515211 *
MALERBA ET AL., NATURE COMMUNICATIONS, vol. 8, 2017, pages 14848
MALERBA, A. ET AL.: "PABPN1 gene therapy for oculopharyngeal muscular dystrophy", NATURE COMMUNICATIONS, vol. 8, 31 March 2017 (2017-03-31), pages 14848, XP055467318, Retrieved from the Internet <URL:doi:10.1038/ncomms14848> *
RIAZ ET AL., PLOS GENETICS, vol. 12, no. 5, 2016, pages el006031

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11142765B2 (en) 2016-12-14 2021-10-12 Benitec Ip Holdings, Inc. Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
US11932852B2 (en) 2016-12-14 2024-03-19 Benitec IP Holdings Inc. Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
WO2020077412A1 (en) * 2018-10-17 2020-04-23 Benitec Biopharma Limited Methods for treating oculopharyngeal muscular dystrophy (opmd)
CN112867511A (zh) * 2018-10-17 2021-05-28 贝尼泰克生物制药有限公司 用于治疗眼咽肌营养不良(opmd)的方法
JP2022508835A (ja) * 2018-10-17 2022-01-19 ベニテック バイオファーマ リミテッド 眼咽頭筋ジストロフィー(opmd)を治療するための方法
WO2020172720A1 (en) 2019-02-28 2020-09-03 Benitec Biopharma Limited Compositions and methods for treating oculopharyngeal muscular dystrophy (opmd)
CN113631706A (zh) * 2019-02-28 2021-11-09 贝尼泰克知识产权控股股份有限公司 用于治疗眼咽肌营养不良(opmd)的组合物和方法
EP3931317A1 (en) 2019-02-28 2022-01-05 Benitec IP Holdings Inc. Compositions and methods for treating oculopharyngeal muscular dystrophy (opmd)
AU2020229886B2 (en) * 2019-02-28 2025-09-18 Benitec IP Holdings Inc. Compositions and methods for treating oculopharyngeal muscular dystrophy (OPMD)
US20220389423A1 (en) * 2019-12-23 2022-12-08 Versameb Ag Compositions and Methods for Simultaneously Modulating Expression of Genes
WO2026011009A1 (en) * 2024-07-02 2026-01-08 Kate Therapeutics, Inc. Compositions and methods for muscle disorders

Also Published As

Publication number Publication date
AU2017377661B2 (en) 2023-07-27
KR20230020586A (ko) 2023-02-10
CN110382698B (zh) 2024-05-10
CN110382698A (zh) 2019-10-25
IL304674A (en) 2023-09-01
IL267353A (en) 2019-08-29
RU2019121950A3 (https=) 2021-01-18
AU2017377661A1 (en) 2019-07-18
KR102495222B1 (ko) 2023-02-09
KR20190104151A (ko) 2019-09-06
JP7233149B2 (ja) 2023-03-06
US11142765B2 (en) 2021-10-12
ZA202106827B (en) 2022-07-27
CN118421624A (zh) 2024-08-02
US20190330629A1 (en) 2019-10-31
AU2023222827A1 (en) 2023-09-14
US20220056446A1 (en) 2022-02-24
CA3047154A1 (en) 2018-06-21
IL267353B1 (en) 2023-08-01
JP7431359B2 (ja) 2024-02-14
US11932852B2 (en) 2024-03-19
EP3555294A1 (en) 2019-10-23
IL304674B1 (en) 2024-07-01
JP2020503014A (ja) 2020-01-30
MX2024003643A (es) 2024-04-15
KR102667867B1 (ko) 2024-05-29
EP3555294A4 (en) 2020-08-26
BR112019012312A2 (pt) 2020-02-11
RU2019121950A (ru) 2021-01-18
JP2023062092A (ja) 2023-05-02
IL267353B2 (en) 2023-12-01
AU2023222827B2 (en) 2025-02-27
BR112019012312A8 (pt) 2023-02-28
IL304674B2 (en) 2024-11-01
MX2019007110A (es) 2019-12-05
RU2763319C2 (ru) 2021-12-28

Similar Documents

Publication Publication Date Title
US11932852B2 (en) Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
RU2755544C2 (ru) Реагенты для лечения окулофарингеальной мышечной дистрофии (OPMD) и их применение
US20220106594A1 (en) Methods for Treating Oculopharyngeal Muscular Dystrophy (OPMD)
BR112019012312B1 (pt) Ácido nucleico que codifica micro-rna hairpin curto, construto de interferência de rna, construto de dna, vetorde expressão, combinação de vetores, composição, método in vitro de inibição da expressão de uma proteína pabpn1, kit eusos
BR122025028670A2 (pt) Ácido nucleico que codifica micro-rna hairpin curto, construto de interferência de rna, construto de dna, vetor de expressão, combinação de vetores de expressão, composição, método in vitro de inibição da expressão de uma proteína pabpn1, kit e uso
BR112018071186B1 (pt) Composição farmacêutica e uso de um construto de rna de interferência direcionado à dna (ddrnai) e um ácido nucleico que codifica uma proteína pabpn1 funcional

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17882179

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3047154

Country of ref document: CA

Ref document number: 2019532105

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019012312

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20197019981

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017377661

Country of ref document: AU

Date of ref document: 20171214

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017882179

Country of ref document: EP

Effective date: 20190715

ENP Entry into the national phase

Ref document number: 112019012312

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190614