WO2018098117A1 - SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - Google Patents

SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF Download PDF

Info

Publication number
WO2018098117A1
WO2018098117A1 PCT/US2017/062701 US2017062701W WO2018098117A1 WO 2018098117 A1 WO2018098117 A1 WO 2018098117A1 US 2017062701 W US2017062701 W US 2017062701W WO 2018098117 A1 WO2018098117 A1 WO 2018098117A1
Authority
WO
WIPO (PCT)
Prior art keywords
dsrna
antisense strand
nucleotides
nucleotide
strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/062701
Other languages
English (en)
French (fr)
Other versions
WO2018098117A8 (en
Inventor
Mark K. SCHLEGAL
Maja JANAS
Vasant R. Jadhav
Donald Foster
Muthiah Manoharan
Kallanthottathil G. Rajeev
Alexander V. KEL'IN
Klaus CHARISSE
Jayaprakash K. NAIR
Martin A. Maier
Shigeo Matsuda
Muthusamy Jayaraman
Alfica Sehgal
Christopher Brown
Kevin FITZGERRALD
Stuart Milstein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alnylam Pharmaceuticals Inc
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201780074650.2A priority Critical patent/CN110114463B/zh
Priority to CR20190294A priority patent/CR20190294A/es
Priority to JP2019547592A priority patent/JP7348067B2/ja
Priority to EP17822812.8A priority patent/EP3545093A1/en
Priority to MX2019005898A priority patent/MX2019005898A/es
Priority to RU2019119242A priority patent/RU2761667C2/ru
Priority to CA3044562A priority patent/CA3044562A1/en
Priority to BR112019010342-2A priority patent/BR112019010342A2/pt
Priority to KR1020197018069A priority patent/KR20190082317A/ko
Priority to AU2017363604A priority patent/AU2017363604A1/en
Priority to MYPI2019002873A priority patent/MY199978A/en
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Publication of WO2018098117A1 publication Critical patent/WO2018098117A1/en
Priority to PH12019550076A priority patent/PH12019550076A1/en
Priority to IL266746A priority patent/IL266746A/en
Priority to US16/420,263 priority patent/US10995336B2/en
Anticipated expiration legal-status Critical
Priority to CONC2019/0005992A priority patent/CO2019005992A2/es
Priority to US17/194,431 priority patent/US11725207B2/en
Publication of WO2018098117A8 publication Critical patent/WO2018098117A8/en
Priority to US18/644,183 priority patent/US20250043279A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate

Definitions

  • Serpinal encodes alpha- 1- antitrypsin which predominantly complexes with and inhibits the activity of neutrophil elastase produced by hepatocytes, mononuclear monocytes, alveolar macrophages, enterocytes, and myeloid cells.
  • Subjects having variations in one or both copies of the Serpinal gene may suffer from alpha- 1 -antitrypsin deficiency and are at risk of developing pulmonary emphysema and/or chronic liver disease due to greater than normal elastase activity in the lungs and liver.
  • the deficiency in alpha- 1 -antitrypsin is a deficiency of wild-type, functional alpha- 1 -antitrypsin.
  • a subject having a variation in one or both copies of the Serpinal gene is carrying a null allele.
  • a subject having a variation in one or both copies of the Serpinal gene is carrying a deficient allele.
  • a subject having a deficient allele of Serpinal such as the PIZ allele, may be producing misfolded proteins which cannot be properly transported from the site of synthesis to the site of action within the body.
  • Such subjects are typically at risk of developing lung and/or liver disease.
  • Subjects having a Serpinal null allele such as the PINULL( Granite Falls) are typically only at risk of developing lung disease.
  • Liver disease resulting from alpha- 1 antitrypsin deficiency is the result of variant forms of alpha- 1-antitypsin produced in liver cells which misfold and are, thus, not readily transported out of the cells. This leads to a buildup of misfolded protein in the liver cells and can cause one or more diseases or disorders of the liver including, but not limited to, chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • liver disease arising from alpha- 1 -antitrypsin deficiency
  • injurious agents e.g. , alcohol and NSAIDs
  • replacement alpha- 1 -antitrypsin therapy is available, such treatment has no impact liver disease in these subjects and, although liver transplantation may be effective, it is a difficult, expensive and risky procedure and liver organs are not readily available.
  • Serpinal-associated diseases such as a chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • compositions comprising agents, e.g., RNAi agents, e.g. , double stranded iRNA agents, targeting Serpinal . Also disclosed are methods using the compositions of the invention for inhibiting Serpinal expression and for treating Serpinal associated diseases, e.g. , chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • agents e.g., RNAi agents, e.g. , double stranded iRNA agents
  • Serpinal associated diseases e.g. , chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • the present invention is based, at least in part on the discovery of effective nucleotide or chemical motifs for dsRNA agents targeting Serpinal which are advantageous for inhibition of target gene expression, while having reduced off-target gene silencing effects, as well as compositions comprising such agents suitable for therapeutic use. More specifically, it has been discovered inter alia that dsRNA agents targeting Serpinal where the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA agent has a melting temperature in the range of from about 40°C to about 80°C can be more effective in mediating RNA interference than a parent dsRNA agent lacking the destabilizing modification.
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, wherein the antisense strand has sufficient complementarity to the target sequence to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an asialoglycoprotein receptor (ASGPR) ligand, and wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.
  • dsRNA double stranded RNA
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein said antisense strand comprises at least one thermally destabilizing modification of the double stranded region within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an asialoglycoprotein receptor (ASGPR) ligand, and wherein each of the sense strand and the anti strand and
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded region, said antisense strand comprising a region of complementarity to an mRNA encoding
  • dsRNA double stranded RNA
  • the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein said antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an asialoglycoprotein receptor (ASGPR) ligand, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.
  • ASGPR asialoglycoprotein receptor
  • the dsRNA agent comprises at least four nucleotides comprising a 2'-fluoro modification.
  • the dsRNA agent has the following characteristics: a) the thermally destabilizing modification is located in position 4-8 of the 5' region of the antisense strand; b) and each of the sense and antisense strands independently comprise at least two nucleotides comprising a 2'-fluoro modification; and c) an ASGPR ligand attached to either end of the sense strand.
  • the antisense strand has at least two of the following characteristics: a) the thermally destabilizing modification is located in position 4 to 8 of the antisense strand; b) at least two nucleotides comprise a 2' -fluoro modification; c) a phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 (counting from the 5' end); d) a length of 18 to 35 nucleotides.
  • the sense strand has at least one of the following characteristics: a) the ASGPR ligand attached to either end of the sense strand; b) at least two nucleotides comprise a 2' -fluoro modification; c) the sense strand and the antisense strand form a double stranded region spanning at least 19 nucleotide positions and wherein the thermally destabilizing modification is located within said double stranded region.
  • the thermally destabilizing modification is selected from the group consisting of
  • B is nucleobase
  • the destabilizing modification is located in position 7 of the antisense strand.
  • the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the ASGPR ligand is:
  • the dsRNA agent is conjugated to the ligand as shown following schematic
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, wherein the antisense strand has sufficient complementarity to a target sequence to mediate RNA interference, wherein the antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length, and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.
  • dsRNA double stranded RNA
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein the antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length, and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.
  • dsRNA has
  • the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, said antisense strand comprising a region of complementarity to an mRNA encoding Serpinal, wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein the antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length, and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.
  • dsRNA double stranded RNA
  • the dsRNA agent has a melting temperature of from about 55°C to about 67°C. In another embodiment, the dsRNA agent has a melting temperature of from about 60°C to about 67°C.
  • the dsRNA agent further comprises an asialoglycoprotein receptor (ASGPR) ligand.
  • ASGPR asialoglycoprotein receptor
  • the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the ASGPR ligand is:
  • the dsRNA agent is conjugated to the ligand as shown following schematic
  • the dsRNA agent further has at least one of the following characteristics: (i) the antisense strand comprises 2, 3, 4, 5 or 6 nucleotides comprising a 2'- fluoro modifications (ii) the antisense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 nucleotides comprising a 2' -fluoro modification; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four nucleotides comprising a 2' -fluoro modification; (vii) the dsRNA comprises a double stranded region region of 12-40 nucleotide pairs in length; and (viii) a blunt end at 5 'end of the antisense strand.
  • each strand of the dsRNA agent may have 15-30 nucleotides, 19-30 nucleotides; or the sense strand may have 21 nucleotides, and the antisense strand may have 23 nucleotides.
  • the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from nucleotides 1440- 1480 of SEQ ID NO 1 or nucleotides 1441- 1479 of SEQ ID NO 1 or nucleotides 1442- 1478 of SEQ ID NO 1 or nucleotides 1443- 1477 of SEQ ID NO 1 or nucleotides 1444- 1476 of SEQ ID NO 1 or nucleotides 1445- 1475 of SEQ ID NO 1 or nucleotides 1446- 1474 of SEQ ID NO 1 or nucleotides 1447- 1473 of SEQ ID NO 1 or nucleotides 1448- 1473 of SEQ ID NO 1 or nucleotides 1448- 1472 of SEQ ID NO 1 or nucleotides 1448- 1471 of SEQ ID NO 1 or nucleotides 1448- 1470 of SEQ ID NO 1 or nucleotides 1447
  • the region of complemntarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5' - UUUUGUUCAAUCAUUAAGAAGAC - 3' (SEQ ID NO: 419).
  • the sense strand comprises the nucleotide sequence 5' - CUUCUUAAUGAUUGAACAAAA - 3' (SEQ ID NO: 417) and the antisense strand comprises the nucleotide sequence 5' - UUUUGUUCAAUCAUUAAGAAGAC - 3' (SEQ ID NO: 419).
  • the sense strand comprises the nucleotide sequence
  • the present invention provides a double stranded RNA (dsRNA) molecule that inhibits expression of a serine peptidase inhibitor, clade A, member 1
  • dsRNA double stranded RNA
  • (Serpinal) gene comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5' - csusucuuAfaUfGfAfuugaacaaaaL96 - 3' (SEQ ID NO: 35) and the antisense strand comprises the nucleotide sequence 5' - usUfsuugu(Tgn)caaucaUfuAfagaagsasc - 3' (SEQ ID NO: 34), wherein a, g, c, and u are 2'-0-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are 2'-fluoro A, G, C and U, respectively; s is a phosphorothioate linkage; (Tgn) is a thymidine-glycol nucleic acid (GNA) S-Isome
  • the invention provides a dsRNA agent that inhibits expression of a serine peptidase inhibitor, clade a, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target Serpinal sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA further has at least one (e.g. , one, two, three, four, five, six seven, eight or all nine) of the following characteristics: (i) a melting temperature (T m ) of from about 40°C to about 80°C; (ii) the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (iii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iv) the sense strand is conjugated with a ligand; (v) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (vi) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vii) the dsRNA comprises at least four 2'-fluoro modifications; (viii) the dsRNA comprises a duplex region of 12
  • the invention provides a a dsRNA agent that inhibits expression of a serine peptidase inhibitor, clade a, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target Serpinal sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA further has at least one (e.g. , one, two, three, four, five, six seven, eight or all nine) of the following characteristics: (i) a melting temperature (T m ) of from about 40°C to about 80°C; (ii) the antisense comprises 6, 7, 8, 9, 10, 11 or 12 2'-OMe modifications; (iii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iv) the sense strand is conjugated with a ligand; (v) the sense strand comprises 6, 7, 8, 9, 10, 11 or 12 2'-OMe modifications; (vi) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vii) the dsRNA comprises at least 1, 2, 3, 4 or 5 2'-deoxy modification(s); (viii) the ds
  • the dsRNA has a melting temperature with a lower end of the range from about 40°C, 45°C, 50°C, 55°C, 60°C or 65°C, and upper end of the arranger from about 70°C, 75°C or 80°C.
  • the dsRNA has a melting temperature in the range from about 55°C to about 70°C.
  • the dsRNA has a melting temperature in the range from about 57°C to about 67°C.
  • the dsRNA has a melting temperature in the range from about 60°C to about 67°C.
  • the dsRNA has a melting temperature in the range from about 62°C to about 66°C.
  • dsRNA agents having a melting temperature of at least 60°C are more effective in vivo and in vitro.
  • the dsRNA has a melting temperature of at least 60°C.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target Serpinal sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA has a melting temperature (T m ) of from about 40°C to about 80°C, and the dsRNA optionally further has at least one (e.g. , one, two, three, four, five, six, seven or all eight) of the following
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2 '-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) a blunt end at 5'end of the antisense strand.
  • the dsRNA agent has a duplex region of 12-40 nucleotide pairs in length, wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e. , at position 2-9 of the 5 '-end of the antisense strand, counting from the 5 '-end), and the dsRNA has a T m of from about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications; and vii) a blunt end at 5'end of the antisense strand.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e.
  • the dsRNA has a melting temperature of about 40°C to about 80°C (e.g. , 40°C, 50°C, 60°C, 70°C or 80°C).
  • the thermally destabilizing modification of the duplex is at position 5, 6, 7, or 8 of the antisense strand, counting from 5'-end of the antisense strand.
  • the thermally destabilizing modification of the duplex is at position 6 of the antisense strand, counting from 5'-end of the antisense strand.
  • the thermally destabilizing modification of the duplex is at position 7 of the antisense strand, counting from 5 '-end of the antisense strand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the antisense strand further comprises one or both of the following characteristics:
  • the sense strand comprises one, two or three of the following characteristics:
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5 '-end, and a ligand is conjugated with the sense strand, and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5 '-end, a ligand is conjugated with the sense strand, and the dsRNA comprises at least four 2'-fluoro modifications.
  • a Serpinal target sequence e.g., nucleotides 1440- 1480 of SEQ ID NO: l
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, said sense strand comprises a ligand, and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the ligand is an ASGPR ligand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4-8, counting from the 5'-end, wherein said sense strand comprises a ligand, wherein each of the sense and antisense strands comprise at least two 2'-fluoro modifications, and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the ligand is an ASGPR ligand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the antisense further comprises at least two of the following characteristics: (i) the thermally destabilizing modification of the duplex is located in position 4 to 8 of the antisense strand; (ii) at least two 2'-fluoro modifications; (iii)
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and the sense strand has at least one of the following characteristics: (i) the ligand is attached to either end of the sense strand; (ii) sense strand comprises at least two 2'- fluoro modifications; and (iii) the sense strand and the antisense
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of:
  • B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4-8, counting from the 5'-end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2'-fluoro modifications, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the thermally destabilizing
  • modification of the duplex is selected from the group consisting of:
  • B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5'-end of the antisense strand, wherein said sense strand comprises a ligand, and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5'-end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2'-fluoro modifications, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the thermally destabilizing
  • modification of the duplex is selected from the group consisting of:
  • B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the ligand comprises one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • a Serpinal target sequence e.g., nucleotides 1440-1480 of SEQ ID NO: l
  • the antisense strand
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the ligand is an ASGPR ligand of structure:
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2'-fluoro
  • the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5'-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2'-fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 3, 4, 5 or 6 2'-fluoro modifications, comprises 2, 3 or 4 phosphorothioate intemucleotide linkages; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2'-fluoro
  • the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises
  • the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g. , one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5'-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2'-fluoro
  • the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises
  • dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2'-fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5'-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications;
  • the dsRNA comprises a duplex region of 18, 19, 21, 22, 23, 24 or 24 nucleotide pairs in length; and
  • the dsRNA comprises a blunt end at 5 '-end of the sense strand.
  • sense strand is 19, 20 or 21 or 22 nucleotides in length and the antisense
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2' -fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, between nucleotide positions 22 and 23, between nucleotide positions 1 and 2, between nucleotide positions 2 and 3; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • one end of the dsRNA is a blunt end and the other end has an overhang
  • the antisense strand contains at least one thermally destabilizing nucleotide
  • the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand)
  • the dsRNA has a melting temperature of about 40°C to about 80°C
  • the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2 '-fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length.
  • the overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5 '-end of the antisense strand. In some particular embodiments, the overhang is 2, 3 or 4-nucleotides in length.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally
  • the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications, and optionally the 2 nucleotide overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5 '-end of the antisense strand. In some embodiments, the overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5 '-end of the antisense strand.
  • the dsRNA agent of the invention may also have two blunt ends, at both ends of the dsRNA duplex.
  • the dsRNA has a blunt end at both ends of the duplex, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications; and
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length and has a blunt end at both ends of the duplex, wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and
  • the dsRNA comprises at least four 2' -fluoro modifications.
  • the dsRNA agent of the invention comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e.
  • the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optinally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications; and
  • the dsRNA comprises a blunt end at 5 '-end of the antisense strand.
  • the 2 nt overhang is at the 3 '-end of the antisense.
  • the dsRNA agent of the invention comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10- 30 consecutive nucleotides which are unpaired with sense strand,
  • the dsRNA has a melting temperature of about 40°C to about 80°C.
  • the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14- 17 of the 5'-end of the sense strand, and wherein the dsRNA optinally further has at least one (e.g. , one, two, three, four, five, six or all seven) of the following
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2'-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length.
  • the dsRNA agent of the invention comprises a sense and antisense strands, wherein said dsRNA agent comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5'end, wherein the 3' end of said sense strand and the 5' end of said antisense strand form a blunt end and said antisense strand is 1-4 nucleotides longer at its 3' end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a
  • the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g. , one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2' -fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications
  • the antisense strand comprises phosphorothioate
  • the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 3 or 4 phosphorothioate intemucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the antisense strand comprises phosphorothioate
  • the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages;
  • the dsRNA comprises at least four 2'- fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the sense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications;
  • the sense strand comprises 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'-fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3
  • the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e.
  • the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g. , one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (iv) the sense strand comprises 3 or 4 phosphorothioate
  • the dsRNA comprises at least four 2'-fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the invention provides a dsRNA agent capable of inhibiting the expression of a Serpinal target sequence, e.g., nucleotides 1440- 1480 of SEQ ID NO: l, comprising a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA further has at least one (e.g. , one, two, three, four, five, six seven or all eight) of the following characteristics:
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide
  • the dsRNA comprises at least four 2'-fluoro modifications
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length
  • the thermally destabilizing modification of the duplex is at position 7 of the antisense strand, counting frm 5 '-end of the antisense strand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the target sequence to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e. , at position 2-9 of the 5 '-end of the antisense strand, counting from the 5 '-end), and the antisense strand further comprises one or both of the following characteristics:
  • the sense strand comprises one, two or three of the following characteristics:
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5 '-end, and a ligand is conjugated with the sense strand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5 '-end, a ligand is conjugated with the sense strand, and the dsRNA comprises at least four 2'-fluoro modifications.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand.
  • the ligand is an ASGPR ligand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4-8, counting from the 5 '-end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2' -fluoro modifications.
  • the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference
  • said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4-8, counting from the 5 '-end
  • the ligand is an ASGPR ligand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, and wherein the antisense further comprises at least two of the following characteristics: (i) the thermally destabilizing modification of the duplex is located in position 4 to 8 of the antisense strand; (ii) at least two 2'-fluoro modifications; (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, and the sense strand has at least one of the following characteristics: (i) the ligand is attached to either end of the sense strand; (ii) sense strand comprises at least two 2' -fluoro modifications; and (iii) the sense strand and the antisense strand show sufficient complementarity to form a double stranded region spanning at least 19 nu
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of:
  • B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4-8, counting from the 5 '-end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2'-fluoro modifications, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of:
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5'-end of the antisense strand, and wherein said sense strand comprises a ligand.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5'- end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2' -fluoro modifications, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of:
  • B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2' -fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the ligand comprsies one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440-1480 of SEQ ID NO: l, to mediate RNA interference, wherein the dsRNA comprises at least four 2'-fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5'-end, and wherein said sense strand comprises a ligand, wherein the ligand is an ASGPR ligand of structure:
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2'-fluoro
  • the dsRNA optionally further has at least one (e.g. , one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the dsRNA optionally further has at least one (e.g. , one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2'-fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 3, 4, 5 or 6 2'-fluoro modifications, comprises 2, 3 or 4 phosphorothioate intemucleotide linkages; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5'-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2' -fluoro
  • the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises
  • the dsRNA optionally further has at least one (e.g. , one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21,
  • the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2' -fluoro
  • the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises
  • the dsRNA optionally further has at least one (e.g. , one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12- 25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21,
  • the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2' -fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12- 25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e.
  • the sense strand is conjugated with a ligand, comprises 2'-fluoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5'-end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 2'-fluoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, between nucleotide positions 22 and 23, between nucleotide positions 1 and 2, between nucleotide positions 2 and 3; and wherein the dsRNA optionally further has at least one (e.g.
  • the dsRNA comprises a duplex region of 12-25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3 '-end of the antisense strand.
  • the dsRNA agents of the present invention comprise:
  • an ASGPR ligand attached to the 3 '-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents of the present invention comprise:
  • an ASGPR ligand attached to the 3 '-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents have a two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
  • the dsRNA agents of the present invention comprise:
  • an ASGPR ligand attached to the 3 '-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents have a two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
  • the dsRNA agents of the present invention comprise:
  • an ASGPR ligand attached to the 3 '-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents have a two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
  • the dsRNA agents of the present invention comprise:
  • an ASGPR ligand attached to the 3 ' -end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents have a two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
  • the dsRNA agents of the present invention comprising an antisense strand having:
  • the dsRNA agents of the present invention comprise:
  • the dsRNA agents of the present invention comprise: (a) a sense strand having:
  • an ASGPR ligand attached to the 3 '-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • the dsRNA agents have a two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
  • the dsRNA agent further comprises at least one ASGPR ligand.
  • the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivale
  • the ASGPR ligand is attached to the 3' end of the sense strand.
  • the region of a Serpinal mRNA targeted by any of the dsRNA agents described herein may be nucleotides 1440-1480 of SEQ ID NO: l ; or nucleotides 1441- 1479 of SEQ ID NO: l
  • nucleotides 1442- 1478 of SEQ ID NO 1 or nucleotides 1443- 1477 of SEQ ID NO 1 ; or nucleotides 1443- 1477 of SEQ ID NO 1
  • nucleotides 1444- 1476 of SEQ ID NO 1 or nucleotides 1445- 1475 of SEQ ID NO 1; or nucleotides 1445- 1475 of SEQ ID NO 1
  • nucleotides 1446- 1474 of SEQ ID NO 1 or nucleotides 1447- 1473 of SEQ ID NO 1; or nucleotides 1447- 1473 of SEQ ID NO 1
  • nucleotides 1448- 1473 of SEQ ID NO 1 or nucleotides 1448- 1472 of SEQ ID NO 1 ; or nucleotides 1448- 1472 of SEQ ID NO 1
  • nucleotides 1448- 1471 of SEQ ID NO 1 or nucleotides 1448- 1470 of SEQ ID NO 1
  • nucleotides 1447- 1469 of SEQ ID NO 1 or nucleotides 1446- 1478 of SEQ ID NO 1
  • nucleotides 1449- 1471 of SEQ ID NO 1 or nucleotides 1450- 1472 of SEQ ID NO 1
  • nucleotides 1440- 1475 of SEQ ID NO 1 or nucleotides 1440- 1475 of SEQ ID NO 1 ; or nucleotides 1445- 1480 of SEQ ID NO 1
  • the present invention also provides vetors, cells, and pharmaceutical compositions comprising the dsRNA agents of the inevtion.
  • compositions of the invention may be an unbuffered solution, e.g., saline or water; or a buffered solution, e.g., a buffered solution c omprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof, or phosphate buffered saline (PBS).
  • a buffered solution e.g., a buffered solution c omprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof, or phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the present invention provides a method of inhibiting Serpinal expression in a cell.
  • the method includes contacting the cell with any of the foregoing dsRNA agents or pharmaceutical composition of the invention, thereby inhibiting expression of the Serpinal gene in the cell.
  • the cell is in a subject, such as a human subject.
  • the Serpinal expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.
  • the present invention provides a method of treating a subject having a Serpinal associated disease.
  • the method includes administering to the subject a
  • the subject is a human.
  • the Serpinal associated disease is a liver disorder.
  • the liver disorder is selected from the group consisting of chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • the present invention provides a method of inhibiting development of hepatocellular carcinoma in a subject having a Serpinal deficiency variant.
  • the method includes administering to the subject a therapeutically effective amount of any of the foregoing dsRNA agents or pharmaceutical composition of the invention, thereby inhibiting development of hepatocellular carcinoma in the subject.
  • the present invention provides a method of reducing the accumulation of misfolded Serpinal in the liver of a subject having a Serpinal deficiency variant.
  • the method includes administering to the subject a therapeutically effective amount of any of the foregoing dsRNA agents or pharmaceutical composition of the invention, thereby reducing the accumulation of misfolded Serpinal in the liver of the subject.
  • the dsRNA agent may administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg; or a dose of about 10 mg/kg to about 30 mg/kg.
  • the dsRNA agent may administered to the subject subcutaneously; or intravenously.
  • the dsRNA agent may administered to the subject in two or more doses.
  • Figure 1A schematically depicts the modified sense and antisense strand nucleotide sequences of AD-61444; AD-75994; and AD-75995.
  • Figure 1A discloses SEQ ID NOs: 36- 37, 36, 38, 36 and 39, respectively, in order of appearance.
  • Figure IB is a graph depicting the in vivo effect of administration of the indicated dsRNA agents on the level of expression of AAT (Serpina). The level of expression of AAT shown is relative to the pre-bleed level of expression of AAT.
  • Figure 1C schematically depicts the modified sense and antisenes strand nucleotide sequences of AD-61444; AD-77404; and AD-77412.
  • Figure 1C discloses SEQ ID NOs: 36- 37, 36-37, 36 and 39, respectively, in order of appearance.
  • Figure ID is a graph depicting the in vivo effect of administration of the indicated dsRNA agents on the level of expression of AAT (Serpina).
  • Figure 2A is a graph depicting the off-target effect of AD-61444 in Hep3B cells tranfected with 10 nM of the dsRNA agent 16 hours after treatment.
  • Figure 2B is a graph depicting the off-target effect of AD-77412 in Hep3B cells tranfected with 10 nM of the dsRNA agent 16 hours after treatment.
  • Figure 3A is a graph depicting the efficacy and durability of AAT silencing in nonhuman primates (NHP) administered a single 0.3 mg/kg dose of the indicated agents.
  • the level of expression of AAT shown is relative to the pre-bleed level of expression of AAT determined at days -7 and -1 pre-dose.
  • Figure 3B is a graph depicting the durability of AAT silencing in nonhuman primates administered a single 1 mg/kg dose of the indicated agents.
  • the level of expression of AAT shown is relative to the pre-bleed level of expression of AAT determined at days -7 and -1 pre-dose.
  • Figure 3C is a graph depicting the durability of AAT silencing in nonhuman primates administered a single 3 mg/kg dose of the indicated agents.
  • the level of expression of AAT shown is relative to the pre-bleed level of expression of AAT determined at days -7 and -1 pre-dose.
  • Figure 3D is a graph depicting the durability of AAT silencing in nonhuman primates administered a single 10 mg/kg dose of the indicated agents.
  • the level of expression of AAT shown is relative to the pre-bleed level of expression of AAT determined at days -7 and -1 pre-dose.
  • compositions comprising agents, e.g., RNAi agents, e.g., double stranded iRNA agents, targeting Serpinal. Also disclosed are methods using the compositions of the invention for inhibiting Serpinal expression and for treating Serpinal associated diseases, such as liver disorders, e.g., chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • agents e.g., RNAi agents, e.g., double stranded iRNA agents
  • methods using the compositions of the invention for inhibiting Serpinal expression and for treating Serpinal associated diseases, such as liver disorders, e.g., chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • the present invention is based, at least in part on the discovery of effective nucleotide or chemical motifs for dsRNA agents targeting Serpinal which are advantageous for inhibition of target gene expression, while having reduced off-target gene silencing effects, as well as compositions comprising such agents suitable for therapeutic use. More specifically, it has been discovered inter alia that dsRNA agents targeting Serpinal where the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e.
  • the dsRNA agent has a melting temperature in the range of from about 40°C to about 80°C can be more effective in mediating RNA interference than a parent dsRNA agent lacking the destabilizing modification.
  • an element means one element or more than one element, e.g. , a plurality of elements.
  • Serpinal refers to the serpin peptidase inhibitor, clade A, member 1 gene or protein. Serpinal is also known as alpha- 1 -antitrypsin, a- 1 -antitrypsin, AAT, protease inhibitor 1, PI, PI1, anti-elastase, and antitrypsin.
  • Serpinal includes human Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession Nos. GI: 189163524 (SEQ ID NO: l), GI: 189163525 (SEQ ID NO:2), GI: 189163526 (SEQ ID NO:3), GI: 189163527 (SEQ ID NO:4), GI: 189163529 (SEQ ID NO:5), GI: 189163531 (SEQ ID NO:6), GI: 189163533 (SEQ ID NO:7), GI: 189163535 (SEQ ID NO:8), GI: 189163537 (SEQ ID NO:9),
  • GI: 189163539 (SEQ ID NO: 10), and/or GI: 189163541 (SEQ ID NO: 11); rhesus Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession Nos. GL402766667 (SEQ ID NO: 12), GL297298519 (SEQ ID NO: 13), and/or GI: 297298520 (SEQ ID NO: 14); mouse Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GL357588423 and/or
  • GL357588426 and rat, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GL77020249. Additional examples of Serpinal mRNA sequences are readily available using, e.g. , GenBank and OMUVI.
  • M alleles of Serpinal have been identified and the "M” alleles are considered the wild-type or "normal” allele (e.g., "PIM1-ALA213” (also known as PI, MIA), "PIM1- VAL213” (also known as PI, MIV), "PIM2", “PIM3”, and PIM4"). Additional variants may be found in, for example, the A(l)ATVar database (see, e.g., Zaimidou, S., et al. (2009) Hum Mutat. 230(3):308- 13 and www.goldenhelix.org/AlATVar).
  • Serpinal deficiency allele refers to a variant allele that produces proteins which do not fold properly and may aggregate intracellularly and are, thus, not properly transported from the site of synthesis in the liver to the site of action within the body.
  • Exemplary Serpinal deficiency alleles include, the "Z allele”, the "S allele”, the
  • Z allele refers to a variant allele of Serpinal in which the amino acid at position 342 of the protein is changed from a glutamine to a lysine as a result of the relevant codon being changed from GAG to AAG.
  • a subject homozygous for a Z allele can be referred to as "PIZZ.”
  • Z-AAT mutations account for 95% of Serpinal deficiency patients and are estimated to be present in 100,000 Americans and about 3 million individuals worldwide. The Z allele reaches polymorphic frequencies in Caucasians and is rare or absent in Asians and blacks.
  • the homozygous ZZ phenotype is associated with a high risk of both emphysema and liver disease.
  • Z-AAT protein does not fold correctly in the endoplasmic reticulum, leading to loop-sheet polymers which aggregate and reduce secretion, elicitation of the unfolded protein response, apoptosis, endoplasmic reticulum overload response, autophagy, mitochondrial stress, and altered hepatocyte function.
  • PIM(Malton) and M(Malton)-AAT refer to a variant allele of Serpinal in which one of the adjacent phenylalanine residues at position 51 or 52 of the mature protein is deleted. Deletion of this one amino acid shortens one strand of the beta- sheet, B6, preventing normal processing and secretion in the liver which is associated with hepatocyte inclusions and impaired secretion of the protein from the liver.
  • PIS refers to a variant allele of Serpinal in which a glutamic acid at position 264 is substituted with valine. Although the majority of this variant protein is degraded intracellularly, there is a high frequency of the PIS allele in the Caucasian population and, thus, compound heterozygotes with a Z or null allele are frequent.
  • target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a Serpinal gene, including mRNA that is a product of RNA processing of a primary transcription product.
  • strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
  • G,” “C,” “A” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively.
  • T and “dT” are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g. , deoxyribothymine, 2'-deoxythymidine or thymidine.
  • ribonucleotide or “nucleotide” or “deoxyribonucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety.
  • guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
  • a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil.
  • nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine.
  • Polynucleotides also referred to as “oligonucleotides,” are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the polynucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide. Polynucleotides may be either RNA or DNA and are, for example less than about 100, 200, 300, or about 400 nucleotides in length.
  • RNAi agent refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway.
  • RISC RNA-induced silencing complex
  • iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi).
  • RNAi RNA interference
  • the iRNA modulates, e.g., inhibits, the expression of Serpinal in a cell, e.g., a cell within a subject, such as a
  • RNAi refers to the ability to silence, in a sequence specific manner, a target RNA. While not wishing to be bound by theory, it is believed that silencing uses the RNAi machinery or process and a guide RNA, e.g., an siRNA agent of 21 to 23 nucleotides.
  • an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., a Serpinal target mRNA sequence, to direct the cleavage of the target RNA.
  • a target RNA sequence e.g., a Serpinal target mRNA sequence
  • Dicer Type III endonuclease
  • Dicer a ribonuclease- III- like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363).
  • the siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309).
  • RISC RNA-induced silencing complex
  • the invention Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188).
  • sssiRNA single stranded RNA
  • the term "siRNA” is also used herein to refer to an RNAi as described above.
  • the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA.
  • Single- stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA.
  • the single- stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U.S. Patent No.
  • any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et ah , (2012) Cell 150;:883-894.
  • an "iRNA” for use in the compositions and methods of the invention is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double- stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”.
  • dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having "sense” and “antisense” orientations with respect to a target RNA, i.e., an Serpinal gene.
  • a double-stranded RNA triggers the degradation of a target RNA, e.g. , an mRNA, through a post-transcriptional gene- silencing mechanism referred to herein as RNA interference or RNAi.
  • each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide.
  • an "RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides.
  • modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleobase.
  • modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases.
  • the modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such
  • RNAi agent for the purposes of this specification and claims.
  • the duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g. , about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30,
  • the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3 '-end of one strand and the 5 '-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a "hairpin loop."
  • a hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
  • RNA molecules where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected.
  • the connecting structure is referred to as a "linker.”
  • the RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex.
  • an RNAi may comprise one or more nucleotide overhangs.
  • an RNAi agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a Serpinal target mRNA sequence, to direct the cleavage of the target RNA.
  • a target RNA sequence e.g., a Serpinal target mRNA sequence
  • long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485).
  • Dicer a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363).
  • the siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al. , (2001) Cell 107:309).
  • RISC RNA-induced silencing complex
  • one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188).
  • nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA.
  • a dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a
  • the overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.
  • the antisense strand of a dsRNA has a 1- 10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end and/or the 5'-end.
  • the sense strand of a dsRNA has a 1- 10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end and/or the 5'-end.
  • one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
  • the overhang on the sense strand or the antisense strand, or both can include extended lengths longer than 10 nucleotides, e.g. , 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length.
  • an extended overhang is on the sense strand of the duplex.
  • an extended overhang is present on the 3 'end of the sense strand of the duplex.
  • an extended overhang is present on the 5 'end of the sense strand of the duplex.
  • an extended overhang is on the antisense strand of the duplex.
  • an extended overhang is present on the 3 'end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5'end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate.
  • dsRNA dsRNA that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e. , no nucleotide overhang.
  • One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended.
  • a "blunt ended" dsRNA is a dsRNA that is blunt at both ends, i.e. , no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.
  • antisense strand or "guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a Serpinal mRNA.
  • region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a Serpinal nucleotide sequence, as defined herein.
  • the mismatches can be in the internal or terminal regions of the molecule.
  • the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5'- and/or 3'-terminus of the iRNA.
  • sense strand or “passenger strand” as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
  • cleavage region refers to a region that is located immediately adjacent to the cleavage site.
  • the cleavage site is the site on the target at which cleavage occurs.
  • the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.
  • the term "complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50oC or 70oC for 12- 16 hours followed by washing.
  • Other conditions such as physiologically relevant conditions as may be encountered inside an organism, can apply. For example, a
  • complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi.
  • the skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
  • Sequences can be "fully complementary” with respect to each when there is base- pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second nucleotide sequence over the entire length of the first and second nucleotide sequences.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.
  • “Complementary” sequences may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.
  • non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.
  • a polynucleotide that is "substantially complementary to at least part of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g. , an mRNA encoding Serpinal) including a 5' UTR, an open reading frame (ORF), or a 3' UTR.
  • mRNA messenger RNA
  • polynucleotide is complementary to at least a part of a Serpinal mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding Serpinal .
  • a dsRNA agent of the invention is "sufficiently
  • the dsRNA agent of the invention is "exactly complementary" or fully complementary to a target RNA, e.g. , the target RNA and the dsRNA duplex agent anneal, for example to form a hybrid made exclusively of Watson-Crick base pairs in the region of exact complementarity.
  • a "sufficiently complementary" target RNA can include an internal region (e.g. , of at least 10 nucleotides) that is exactly complementary to a target RNA.
  • the dsRNA agent of the invention specifically discriminates a single- nucleotide difference.
  • the dsRNA agent only mediates RNAi if exact complementary is found in the region (e.g. , within 7 nucleotides of) the single-nucleotide difference.
  • BNA' refers to bridged nucleic acid, and is often referred as constrained or inaccessible RNA.
  • BNA can contain a 5-, 6- membered, or even a 7-membered bridged structure with a "fixed" Cs'-endo sugar puckering.
  • the bridge is typically incorporated at the 2'-, 4'-position of the ribose to afford a 2', 4'-BNA nucleotide (e.g. , LNA, or ENA).
  • BNA nucleotides include the following nucleosides:
  • LNA locked nucleic acid
  • LNA is a modified RNA nucleotide.
  • the ribose moiety of an LNA nucleotide is modified with an extra bridge ⁇ e.g. , a methylene bridge or an ethylene bridge) connecting the 2' hydroxyl to the 4' carbon of the same ribose sugar.
  • the bridge can "lock" the ribose in the 3'-endo North) conformation:
  • ⁇ ' refers to ethylene-bridged nucleic acid, and is often referred as constrained or inaccessible RNA.
  • inhibitor as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.
  • the phrase "inhibiting expression of a Serpinal,” as used herein, includes inhibition of expression of any Serpinal gene (such as, e.g. , a mouse Serpinal gene, a rat Serpinal gene, a monkey Serpinal gene, or a human Serpinal gene) as well as variants, ⁇ e.g., naturally occurring variants), or mutants of a Serpinal gene.
  • the Serpinal gene may be a wild- type Serpinal gene, a variant Serpinal gene, a mutant Serpinal gene, or a transgenic
  • Serpinal gene in the context of a genetically manipulated cell, group of cells, or organism.
  • “Inhibiting expression of a Serpinal gene” includes any level of inhibition of a Serpinal gene, e.g. , at least partial suppression of the expression of a Serpinal gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
  • the expression of a Serpinal gene may be assessed based on the level of any variable associated with Serpinal gene expression, e.g., Serpinal mRNA level, Serpinal protein level, or serum AAT levels. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level.
  • the control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
  • contacting a cell with a double stranded RNAi agent includes contacting a cell by any possible means.
  • Contacting a cell with a double stranded RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent.
  • the contacting may be done directly or indirectly.
  • the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
  • Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent.
  • Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, the bloodstream or the subcutaneous space, such that the agent will
  • the RNAi agent may contain and/or be coupled to a ligand, e.g., a GalNAc3 ligand, that directs the RNAi agent to a site of interest, e.g., the liver.
  • a ligand e.g., a GalNAc3 ligand
  • a site of interest e.g., the liver.
  • Combinations of in vitro and in vivo methods of contacting are also possible.
  • a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
  • a “patient” or “subject,” as used herein, is intended to include either a human or non- human animal, preferably a mammal, e.g., a monkey. Most preferably, the subject or patient is a human.
  • a "Serpinal associated disease,” as used herein, is intended to include any disease, disorder, or condition associated with the Serpinal gene or protein. Such a disease may be caused, for example, by misfolding of a Serpinal protein, intracellular accumulation of Serpinal protein (e.g., misfolded Serpinal protein), excess production of the Serpinal protein, by Serpinal gene variants, Serpinal gene mutations, by abnormal cleavage of the Serpinal protein, by abnormal interactions between Serpinal and other proteins or other endogenous or exogenous substances.
  • a Serpinal associated disease may be a liver disease and/or a lung disease.
  • a "liver disease" includes a disease, disorder, or condition affecting the liver and/or its function.
  • a liver disorder can be the result of accumulation of Serpinal protein in the liver and/or liver cells.
  • liver disorders include liver disorders resulting from, viral infections, parasitic infections, genetic predisposition, autoimmune diseases, exposure to radiation, exposure to hepatotoxic compounds, mechanical injuries, various environmental toxins, alcohol, acetaminophen, a combination of alcohol and acetaminophen, inhalation anesthetics, niacin, chemotherapeutics, antibiotics, analgesics, antiemetics and the herbal supplement kava, and combinations thereof.
  • a liver disorder associated with Serpinal deficiency may occur more often in subjects with one or more copies of certain alleles (e.g. , the PIZ, PiM(Malton), and/or PIS alleles).
  • certain alleles e.g. , the PIZ, PiM(Malton), and/or PIS alleles.
  • hepatocytes The cellular responses to these misfolded proteins can include the unfolded protein response (UPR), endoplasmic reticulum- associated degradation (ERAD), apoptosis, ER overload response, autophagy, mitochondrial stress and altered hepatocyte function.
  • the injuries to the hepatocytes can lead to symptoms such as, but not limited to, inflammation, cholestasis, fibrosis, cirrhosis, prolonged obstructive jaundice, increased transaminases, portal hypertension and/or hepatocellular carcinoma.
  • the highly variable clinical course of this disease is suggestive of modifiers or "second hits" as contributors to developing symptoms or progressing in severity.
  • subjects with a PIZ allele can be more sensitive to Hepatitis C infections or alcohol abuse and more likely to develop a liver disorder if exposed to such factors.
  • cystic fibrosis subjects carrying the PIZ allele are at greater risk of developing severe liver disease with portal hypertension.
  • a deficiency of Serpinal can also cause or contribute to the development of early onset emphysema, necrotizing panniculitis, bronchiectasis, and/or prolonged neonatal jaundice.
  • Some patients having or at risk of having a deficiency of alpha- 1 -antitrypsin are identified by screening when they have family members affected by an alpha- 1- antitrypsin deficiency.
  • Exemplary liver disorders include, but are not limited to, liver inflammation, chronic liver disease, cirrhosis, liver fibrosis, hepatocellular carcinoma, liver necrosis, steatosis, cholestatis and/or reduction and/or loss of hepatocyte function.
  • Chronic liver damage is a pathological condition associated with chronic liver damage that includes extensive fibrosis and regenerative nodules in the liver.
  • liver function refers to one or more of the many physiological functions performed by the liver. Such functions include, but are not limited to, regulating blood sugar levels, endocrine regulation, enzyme systems, interconversion of metabolites (e.g. , ketone bodies, sterols and steroids and amino acids); manufacturing blood proteins such as fibrinogen, serum albumin, and cholinesterase, erythropoietic function, detoxification, bile formation, and vitamin storage.
  • Several tests to examine liver function are known in the art, including, for example, measuring alanine amino transferase (ALT), alkaline phosphatase, bilirubin, prothrombin, and albumin.
  • Therapeutically effective amount is intended to include the amount of an RNAi agent that, when administered to a patient for treating a Serpinal-associated disease, is sufficient to effect treatment of the disease (e.g. , by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease).
  • the "therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by Serpinal expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
  • “Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet experience or display symptoms of an Serpinal-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease.
  • the “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
  • a “therapeutically-effective amount” or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
  • RNAi gents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
  • sample includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
  • biological fluids include blood, serum and serosal fluids, plasma, urine, lymph, cerebrospinal fluid, ocular fluids, saliva, and the like.
  • Tissue samples may include samples from tissues, organs or localized regions.
  • samples may be derived from particular organs, parts of organs, or fluids or cells within those organs.
  • samples may be derived from the liver (e.g. , whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g. , hepatocytes).
  • liver e.g. , whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g. , hepatocytes.
  • a "sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a subject” refers to liver tissue (or subcomponents thereof) derived from the subject.
  • RNAi agents which inhibit the expression of a Serpinal gene in a cell, such as a cell within a subject, e.g. , a mammal, such as a human having a Serpinal associated disease, e.g. , a liver disease, e.g. , chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • a cell within a subject e.g. , a mammal, such as a human having a Serpinal associated disease, e.g. , a liver disease, e.g. , chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • a liver disease e.g. , chronic liver disease, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.
  • the invention provides double stranded RNAi agents with chemical modifications capable of inhibiting the expression of a target gene (i.e. , a Serpinal gene) in vivo.
  • a target gene i.e. , a Serpinal gene
  • substantially all of the nucleotides of an iRNA of the invention are modified.
  • all of the nucleotides of an iRNA of the invention are modified.
  • iRNAs of the invention in which "substantially all of the nucleotides are modified" are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
  • the RNAi agent comprises a sense strand and an antisense strand.
  • Each strand of the RNAi agent may range from 12-30 nucleotides in length.
  • each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 19-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17- 19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • RNAi agent a duplex double stranded RNA
  • the duplex region of an RNAi agent may be 12-30 nucleotide pairs in length.
  • the duplex region can be between 14- 30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
  • the RNAi agent may contain one or more overhang regions and/or capping groups at the 3'-end, 5'-end, or both ends of one or both strands.
  • the overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2'- sugar modified, such as, 2-F, 2'-0-methyl, thymidine (T), 2 -0-methoxyethyl-5- methyluridine (Teo), 2 -0-methoxyethyladenosine (Aeo), 2 -0-methoxyethyl-5- methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • RNAi agent may be phosphorylated.
  • the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
  • the overhang is present at the 3 '-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3'- overhang is present in the antisense strand. In one embodiment, this 3 '-overhang is present in the sense strand.
  • the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
  • the single-stranded overhang may be located at the 3 '-terminal end of the sense strand or, alternatively, at the 3 '-terminal end of the antisense strand.
  • the RNAi may also have a blunt end, located at the 5 '-end of the antisense strand (or the 3 '-end of the sense strand) or vice versa.
  • the antisense strand of the RNAi has a nucleotide overhang at the 3 '-end, and the 5 '-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5 '-end of the antisense strand and 3 '-end overhang of the antisense strand favor the guide strand loading into RISC process.
  • nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.
  • Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3 '-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g. , at the 2'-position or 4'-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3 '-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abas
  • RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • a modified iRNA will have a phosphorus atom in its internucleoside backbone.
  • Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e. , the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • a peptide nucleic acid PNA
  • PNA compounds the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331 ; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
  • RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular— CH 2 — NH— CH 2 -, ⁇ CH 2 ⁇ N(CH 3 ) ⁇ 0 ⁇ CH 2 ⁇ [known as a methylene (methylimino) or MMI backbone], -- CH 2 -0-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 - and -N(CH 3 )-CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as— O— P— O— CH 2 — ] of the above-referenced U.S.
  • Patent No. 5,489,677 and the amide backbones of the above- referenced U.S. Patent No. 5,602,240.
  • the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Patent No. 5,034,506.
  • Modified RNAs can also contain one or more substituted sugar moieties.
  • the iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to Cio alkyl or C 2 to Cio alkenyl and alkynyl.
  • Exemplary suitable modifications include 0[(CH 2 ) n O] m CH 3 ,
  • n OCH 3 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n ONH 2 , and 0(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
  • dsRNAs include one of the following at the 2' position: Ci to Cio lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O- alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties.
  • the modification includes a 2'-methoxyethoxy (2'-0— CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486- 504) i.e., an alkoxy-alkoxy group.
  • Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0-CH 2 -0-CH 2 -N(CH 2 ) 2 .
  • modifications include 2'-methoxy (2'-OCH 3 ), 2'-aminopropoxy (2'- OCH 2 CH 2 CH 2 NH 2 ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.
  • An iRNA of the invention can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5- bromo, 5-trifluoromethyl and other 5-sub
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley- VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention.
  • These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276- 278) and are exemplary base substitutions, even more particularly when combined with 2'-0- methoxyethyl sugar modifications.
  • An iRNA of the invention can also be modified to include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al, (2003) Nucleic Acids Research 31(12):3185-3193).
  • An iRNA of the invention can also be modified to include one or more bicyclic sugar moities.
  • a "bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms.
  • A"bicyclic nucleoside" (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system.
  • the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.
  • an agent of the invention may include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons.
  • an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'- CH2-0-2' bridge.
  • This structure effectively "locks" the ribose in the 3'-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3):833-843;
  • bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to 4'-(CH2)— 0-2' (LNA); 4'-(CH2)— S-2'; 4'- (CH2)2— 0-2' (ENA); 4'-CH(CH3)— 0-2' (also referred to as "constrained ethyl” or "cEt") and 4'-CH(CH20CH3)— 0-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'- C(CH3)(CH3)— 0-2' (and analogs thereof; see e.g., US Patent No.
  • stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D- ribofuranose (see WO 99/14226).
  • An iRNA of the invention can also be modified to include one or more constrained ethyl nucleotides.
  • a "constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge.
  • a constrained ethyl nucleotide is in the S conformation referred to herein as "S-cEt.”
  • An iRNA of the invention may also include one or more "conformationally restricted nucleotides" ("CRN").
  • CRN are nucleotide analogs with a linker connecting the C2'and C4' carbons of ribose or the C3 and -C5' carbons of ribose .
  • CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA.
  • the linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
  • an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides.
  • UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue.
  • UNA also encompasses monomer with bonds between Cl'-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the CI' and C4' carbons).
  • the C2'-C3' bond i.e. the covalent carbon-carbon bond between the C2' and C3' carbons
  • the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).
  • RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
  • an iRNA of the invention include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent.
  • Suitable phosphate mimics are disclosed in, for example US Patent
  • the dsRNA agents were able to retain gene silencing activity similar to the parent dsRNA while having reduced off-target gene silencing. Further, the number of off-target genes that are down-regulated or up-regulated is also reduced by dsRNA agents comprising these thermally destabilizing modifications when compared to the parent dsRNA.
  • the invention provides a double stranded RNAi (dsRNA) agent capable of inhibiting expression of a Serpinal target gene.
  • dsRNA double stranded RNAi
  • the dsRNA agents of the invention show high on-target gene silencing while reducing or minimizing off- target gene silencing and/or toxicity.
  • the dsRNA agents of the invention can be substituted for the dsRNA agents and can be used for in RNA interference based gene silencing techniques, including, but not limited to, in vitro or in vivo applications.
  • the dsRNA agent comprises a sense strand (also referred to as passenger strand) and an antisense strand (also referred to as guide strand).
  • a sense strand also referred to as passenger strand
  • an antisense strand also referred to as guide strand.
  • Each strand of the dsRNA agent can range from 12-40 nucleotides in length.
  • each strand can be between 14-40 nucleotides in length, 17-37 nucleotides in length, 25-37 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • the sense and antisense strands can be equal length or unequal length.
  • the antisense strand is of length 18 to 35 nucleotides. In some embodimens, the antisense strand is 21-25, 19-25, 19-21 or 21-23 nucleotides in length. In some particular embodiments, the antisense strand is 23 nucleotides in length. Similar to the antisense strand, the sense strand can be, in some embodiments, 18-35 nucloeitdes in length. In some embodimens, the sense strand is 21-25, 19-25, 19-21 or 21-23 nucleotides in length. In some particular embodiments, the antisense strand is 21 nucleotides in length.
  • the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'-fluoro modifications;
  • the dsRNA comprises a duplex region of 18, 19, 21, 22, 23, 24 or 24 nucleotide pairs in length; and
  • the dsRNA comprises a blunt end at 5'-end of the sense strand.
  • sense strand is 19, 20 or 21 or 22 nucleotides in length and the antisense
  • the sense strand and antisense strand typically form a duplex dsRNA.
  • the duplex region of a dsRNA agent may be 12-40 nucleotide pairs in length.
  • the duplex region can be between 14-40 nucleotide pairs in length, 17-30 nucleotide pairs in length, 25- 35 nucleotides in length, 27-35 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17- 19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotide pairs in length.
  • the dsRNA agent of the invention has a duplex region of 12-40 nucleotides pairs in length, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'- fluoro modifications; and (vii) the dsRNA comprises a blunt end at 5 '-end of the antisense strand.
  • the duplex region is 18, 19, 20, 21, 22 or 23 nucleotides pairs in length. In a particular embodiment, the duplex region is 21 nucleotide pairs in length.
  • the dsRNA agent of the invention comprises one or more overhang regions and/or capping groups of dsRNA agent at the 3 '-end, or 5 '-end or both ends of a strand.
  • the overhang can be 1- 10 nucleotides in length, 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.
  • the first and second strands can also be joined, e.g. , by additional bases to form a hairpin, or by other non-base linkers.
  • the nucleotides in the overhang region of the dsRNA agent of the invention can each independently be a modified or unmodified nucleotide including, but not limited to 2'-sugar modified, such as, 2-F 2'-Omethyl, thymidine (T), 2'-0- methoxyethyl-5-methyluridine (Teo), 2'-0-methoxyethyladenosine (Aeo), 2'-0- methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.
  • the 5'- or 3 '- overhangs at the sense strand, antisense strand or both strands of the dsRNA agent of the invention may be phosphorylated.
  • the overhang region contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
  • the overhang is present at the 3 '-end of the sense strand, antisense strand or both strands. In some embodiments, this 3 '-overhang is present in the antisense strand. In some embodiments, this 3 '-overhang is present in the sense strand.
  • the dsRNA agent of the invention may comprise only a single overhang, which can strengthen the interference activity of the dsRNA, without affecting its overall stability.
  • the single-stranded overhang is located at the 3'-terminal end of the sense strand or, alternatively, at the 3 '-terminal end of the antisense strand.
  • the dsRNA may also have a blunt end, located at the 5 '-end of the antisense strand (or the 3 '-end of the sense strand) or vice versa.
  • the antisense strand of the dsRNA has a nucleotide overhang at the 3'- end, and the 5 '-end is blunt.
  • the asymmetric blunt end at the 5'- end of the antisense strand and 3 '-end overhang of the antisense strand favor the guide strand loading into RISC process.
  • the single overhang comprises at least two, three, four, five, six, seven, eight, nine, or ten nucleotides in length.
  • the dsRNA has a 2 nucleotide overhang on the 3 '-end of the antisense strand and a blunt end at the 5 '-end of the antisense strand.
  • one end of the dsRNA is a blunt end and the other end has an overhang
  • the antisense strand contains at least one thermally destabilizing nucleotide
  • the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand)
  • the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'-fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length.
  • the overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5'-end of the antisense strand. In some particular embodiments, the overhang is 2, 3 or 4- nucleotides in length.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally
  • the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications, and optionally the 2 nucleotide overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5 '-end of the antisense strand. In some embodiments, the overhang is on the 3 '-end of the antisense strand and the blunt end is at the 5 '-end of the antisense strand.
  • the dsRNA agent of the invention may also have two blunt ends, at both ends of the dsRNA duplex.
  • the dsRNA has a blunt end at both ends of the duplex, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. , at position 2-9 of the 5'-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2 '-fluoro modifications; and
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length.
  • the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length and has a blunt end at both ends of the duplex, wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications.
  • the antisense strand comprises at least one (e.g. , one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand.
  • thermally destabilizing modification of the duplex is located in positions 2-9, or preferably positions 4- 8, from the 5'-end of the antisense strand.
  • the thermally destabilizing modification of the duplex is located at position 6, 7 or 8 from the 5 '-end of the antisense strand.
  • the thermally destabilizing modification of the duplex is located at position 7 from the 5'-end of the antisense strand.
  • thermally destabilizing modification(s) includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) (preferably a Tm with one, two, three or four degrees lower than the Tm of the dsRNA without having such modification(s).
  • Tm overall melting temperature
  • the thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2'-deoxy modification or acyclic nucleotide, e.g. , unlocked nucleic acids (UNA) or glycol nucleic acid (GNA).
  • UUA unlocked nucleic acids
  • GAA glycol nucleic acid
  • R H, Me, Et or OMe
  • R' H, Me, Et or OMe
  • R" H, Me, Et or OMe
  • B is a modified or unmodified nucleobase.
  • Exemplified sugar modifications include, but are not limited to the following:
  • O-alkyl R H, OH, O-alkyl ucleic acid v r CH 3l CH 2 CH 3 , O-alkyl, NH 2l NHMe, NMe 2 J R O , CH 3 , CH 2 CH 3 , O-alkyl, NH 2 , NHMe, NMe 2 j j
  • R H, OH, O-alkyl
  • R'" H, OH, CH 3 , CH 2 CH 3 , O-alkyl, NH 2 , NHMe, NMe 2
  • R" H, OH, CH 3 , CH 2 CH 3 , O-alkyl, NH 2 , NHMe, NMe 2
  • B is a modified or unmodified nucleobase.
  • B is a modified or unmodified nucleobase.
  • acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g. , C l '-C2' , C2'-C3' , C3'- C4' , C4'-04' , or CI '-04') is absent and/or at least one of ribose carbons or oxygen (e.g. , CI ' , C2' , C3' , C4' or 04') are independently or in combination absent from the nucleotide.
  • UNA refers to unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar” residue.
  • UNA also encompasses monomers with bonds between Cl'-C4' being removed (i.e. the covalent carbon-oxygen-carbon bond between the CI' and C4' carbons).
  • the C2'-C3' bond i.e.
  • the acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings.
  • the acyclic nucleotide can be linked via 2' -5' or 3 '-5' linkage.
  • the term 'GNA' refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its "backbone" in that is composed of repeating glycerol units linked by phosphodiester bonds:
  • the thermally destabilizing modification of the duplex can be mismatches (i.e. , noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex.
  • exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof.
  • Other mismatch base pairings known in the art are also amenable to the present invention.
  • a mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, i.e.
  • the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides.
  • the dsRNA agent contains at least one nucleobase in the mismatch pairing that is a 2'-deoxy nucleobase; e.g. , the 2'-deoxy nucleobase is in the sense strand.
  • the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired W-C H-bonding to complementary base on the target mRNA, such as:
  • the thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.
  • the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand.
  • nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010/0011895, which is herein incorporated by reference in its entirety.
  • Exemplary nucleobase modifications are:
  • the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more a-nucleotide complementary to the base on the target mRNA, suach as:
  • R is H, OH, OCH 3 , F, NH 2 , NHMe, NMe 2 or O-alkyl
  • Exemplary phosphate modifications known to decrease the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages are:
  • the alkyl for the R group can be a Ci-C 6 alkyl.
  • Specific alkyls for the R group include, but are not lmited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.
  • the dsRNA can also comprise one or more stabilizing modifications.
  • the dsRNA can comprise at least two (e.g. , two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
  • the stabilizing modifications all can be present in one strand.
  • both the sense and the antisense strands comprise at least two stabilizing modifications.
  • the stabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the stabilizing
  • each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern.
  • the alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.
  • the antisense strand comprises at least two (e.g. , two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
  • a stabilizing modification in the antisense strand can be present at any positions.
  • the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14 and 16 from the 5'-end.
  • the antisense comprises stabilizing modifications at positions 2, 6, 14 and 16 from the 5'-end.
  • the antisense comprises stabilizing modifications at positions 2, 14 and 16 from the 5'-end.
  • the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification.
  • the stabilizing modification can be the nucleotide at the 5 '-end or the 3 '-end of the destabilizing
  • the antisense strand comprises a stabilizing modification at each of the 5 '-end and the 3 '-end of the destabilizing modification, i.e. , positions -1 and +1 from the position of the destabilizing modification.
  • the antisense strand comprises at least two stabilizing modifications at the 3 '-end of the destabilizing modification, i.e. , at positions +1 and +2 from the position of the destabilizing modification.
  • the sense strand comprises at least two (e.g. , two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
  • a stabilizing modification in the sense strand can be present at any positions.
  • the sense strand comprises stabilizing modifications at positions 7, 10 and 11 from the 5 '-end.
  • the sense strand comprises stabilizing modifications at positions 7, 9, 10 and 11 from the 5'-end.
  • the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12 and 15 of the antisense strand, counting from the 5'-end of the antisense strand.
  • the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, 13 and 15 of the antisense strand, counting from the 5 '-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four stabilizing modifications.
  • the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.
  • thermally stabilizing modifications include, but are not limited to 2' -fluoro modifications.
  • the dsRNA of the invention comprises at least four (e.g. , four, five, six, seven, eight, nine, ten or more) 2'-fluoro nucleotides.
  • the 2'- fluoro nucleotides all can be present in one strand.
  • both the sense and the antisense strands comprise at least two 2' -fluoro nucleotides. The 2' -fluoro modification can occur on any nucleotide of the sense strand or antisense strand.
  • the 2'- fluoro modification can occur on every nucleotide on the sense strand and/or antisense strand; each 2' -fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2' -fluoro
  • the alternating pattern of the 2' -fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2' -fluoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2' -fluoro modifications on the antisense strand.
  • the antisense strand comprises at least two (e.g. , two, three, four, five, six, seven, eight, nine, ten or more) 2 '-fluoro nucleotides.
  • a 2' -fluoro modification in the antisense strand can be present at any positions.
  • the antisense comprises 2'-fluoro nucleotides at positions 2, 6, 8, 9, 14 and 16 from the 5 '-end.
  • the antisense comprises 2' -fluoro nucleotides at positions 2, 6, 14 and 16 from the 5'-end.
  • the antisense comprises 2'-fluoro nucleotides at positions 2, 14 and 16 from the 5'-end.
  • the antisense strand comprises at least one 2' -fluoro nucleotide adjacent to the destabilizing modification.
  • the 2'-fluoro nucleotide can be the nucleotide at the 5 '-end or the 3 '-end of the destabilizing modification, i.e. , at position - 1 or +1 from the position of the destabilizing modification.
  • the antisense strand comprises a 2' -fluoro nucleotide at each of the 5 '-end and the 3 '-end of the
  • the antisense strand comprises at least two 2' -fluoro nucleotide at the 3 '-end of the destabilizing modification, i.e. , at positions +1 and +2 from the position of the destabilizing modification.
  • the sense strand comprises at least two (e.g. , two, three, four, five, six, seven, eight, nine, ten or more) 2'-fluoro nucleotides.
  • a 2'- fluoro modification in the sense strand can be present at any positions.
  • the antisense comprises 2' -fluoro nucleotides at positions 7, 10 and 11 from the 5'-end. In some other embodiments, the sense strand comprises 2'-fluoro nucleotides at positions 7, 9, 10 and 11 from the 5'-end. In some embodiments, the sense strand comprises 2'-fluoro nucleotides at positions opposite or complimentary to positions 11, 12 and 15 of the antisense strand, counting from the 5 '-end of the antisense strand. In some other
  • the sense strand comprises 2' -fluoro nucleotides at positions opposite or complimentary to positions 11, 12, 13 and 15 of the antisense strand, counting from the 5'- end of the antisense strand.
  • the sense strand comprises a block of two, three or four 2' -fluoro nucleotides.
  • the sense strand does not comprise a 2' -fluoro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.
  • the dsRNA agent of the invention comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'-fluoro modifications; and
  • the dsRNA comprises a blunt end at 5'-end of the antisense strand.
  • the 2 nt overhang is at the 3 '-end of the antisense.
  • the dsRNA agent of the invention comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10- 30 consecutive nucleotides which are unpaired with sense strand,
  • the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14- 17 of the 5'-end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages;
  • the dsRNA comprises at least four 2'-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length.
  • the dsRNA agent of the invention comprises a sense and antisense strands, wherein said dsRNA agent comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5'end, wherein the 3' end of said sense strand and the 5' end of said antisense strand form a blunt end and said antisense strand is 1-4 nucleotides longer at its 3' end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA agent is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2'-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.
  • every nucleotide in the sense strand and antisense strand of the dsRNA agent may be modified.
  • Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g. , of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with "dephospho" linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
  • nucleic acids are polymers of subunits
  • many of the modifications occur at a position which is repeated within a nucleic acid, e.g. , a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
  • the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not.
  • a modification may only occur at a 3' or 5' terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
  • a modification may occur in a double strand region, a single strand region, or in both.
  • a modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA.
  • a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g. , at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
  • the 5' end or ends can be phosphorylated.
  • each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'- O-methyl, 2'-0-allyl, 2'-C- allyl, 2'-deoxy, or 2'-fluoro.
  • the strands can contain more than one modification.
  • each residue of the sense strand and antisense strand is independently modified with 2' -O-methyl or 2'-fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.
  • the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2'-0- methyl or 2'-deoxy.
  • each residue of the sense strand and antisense strand is independently modified with 2'-0-methyl nucleotide, 2'-deoxy nucleotide, 2'- deoxyfluoro nucleotide, 2'-0-N-methylacetamido (2'-0-NMA) nucleotide, a 2'-0- dimethylaminoethoxyethyl (2'-0-DMAEOE) nucleotide, 2'-0-aminopropyl (2'-0-AP) nucleotide, or 2'-ara-F nucleotide.
  • these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.
  • the dsRNA agent of the invention comprises modifications of an alternating pattern, particular in the B l, B2, B3, ⁇ , B2', B3', B4' regions.
  • alternating motif or "alternative pattern” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand.
  • the alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern.
  • the alternating motif can be "AB AB AB AB AB AB AB ... ,” "AABB AABB AABB ... ,” ' ' A AB A AB A AB A AB ... ,” ' ' A A AB A AB A AB A AB A ... ,” ' ' A A AB A AB A A AB A A AB A AB ,” ' ' A A AB A AB A A AB A A AB A
  • the type of modifications contained in the alternating motif may be the same or different.
  • the alternating pattern i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as "ABABAB ".
  • the dsRNA agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted.
  • the shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa.
  • the sense strand when paired with the antisense strand in the dsRNA duplex the alternating motif in the sense strand may start with "ABABAB" from 5 '-3' of the strand and the alternating motif in the antisense strand may start with "BAB ABA" from 3'-5'of the strand within the duplex region.
  • the alternating motif in the sense strand may start with "AABBAABB” from 5 '-3' of the strand and the alternating motif in the antisense strand may start with
  • the dsRNA agent of the invention may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.
  • the phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand.
  • the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both internucleotide linkage modifications in an alternating pattern.
  • the alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
  • the dsRNA agent comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.
  • the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.
  • Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region.
  • the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • these terminal three nucleotides may be at the 3 '-end of the antisense strand.
  • the sense strand of the dsRNA agent comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of two phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of three phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of four phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of five phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphate intemucleotide linkages, wherein one of the
  • phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of six phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2,
  • the antisense strand of the dsRNA agent comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3,
  • phosphate internucleotide linkages wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the antisense strand of the dsRNA agent comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3 or 4 phosphate internucleotide linkages, wherein one of the phosphorothioate or
  • methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
  • the dsRNA agent of the invention further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1- 10 of the termini position(s) of the sense and/or antisense strand.
  • one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1- 10 of the termini position(s) of the sense and/or antisense strand.
  • at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate or
  • methylphosphonate internucleotide linkage at one end or both ends of the sense and/or antisense strand.
  • the dsRNA agent of the invention further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1- 10 of the internal region of the duplex of each of the sense and/or antisense strand.
  • at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate methylphosphonate intemucleotide linkage at position 8-16 of the duplex region counting from the 5 '-end of the sense strand; the dsRNA agent can optionally further comprise one or more phosphorothioate or methylphosphonate intemucleotide linkage modification within 1-10 of the termini position(s).
  • the dsRNA agent of the invention further comprises one to five phosphorothioate or methylphosphonate intemucleotide linkage modification(s) within position 1-5 and one to five phosphorothioate or methylphosphonate intemucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5'-end), and one to five phosphorothioate or methylphosphonate intemucleotide linkage modification at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate intemucleotide linkage modification within position 1-5 and one phosphorothioate or methylphosphonate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5'-end), and one phosphorothioate
  • intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate or methylphosphonate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications within position 1-5 and one phosphorothioate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 '-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications within position 1-5 and two phosphorothioate intemucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5 '-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications within position 1-5 and two phosphorothioate intemucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5'-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5'-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 '-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5 '-end), and two phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification within position 1-5 (counting from the 5 '-end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5'-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 (counting from the 5 '-end) of the sense strand, and one phosphorothioate internucleotide linkage
  • the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one within position 18-23 of the sense strand (counting from the 5 '-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 '-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 '-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5 '-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the 5'-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5 '-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate intemucleotide linkage modification at position 21 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one
  • the dsRNA agent of the invention further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5 '-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate intemucleotide linkage modification at position 21 of the antisense strand (counting from the 5 '-end).
  • the dsRNA agent of the invention further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one
  • the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g. , one, two, three, four, five, six, seven or all eight) of the following
  • the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense comprises 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2'-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5'-end of the antisense strand.
  • the antisense strand comprises phosphorothioate
  • the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the sense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g.
  • the antisense comprises 2, 3, 4, 5 or 6 2' -fluoro modifications;
  • the antisense comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages;
  • the sense strand is conjugated with a ligand;
  • the sense strand comprises 2, 3, 4 or 5 2' -fluoro modifications;
  • the sense strand comprises 3 or 4 phosphorothioate intemucleotide linkages;
  • the dsRNA comprises at least four 2' -fluoro modifications;
  • the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and
  • the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3
  • the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e. , at position 2-9 of the 5 '-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g. , one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2'-fluoro
  • the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2'-fluoro modifications; (iv) the sense strand comprises 3 or 4 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2'-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5 '-end of the antisense strand.
  • the dsRNA agent of the invention comprises mismatch(es) with the target, within the duplex, or combinations thereof.
  • the mismatch can occur in the overhang region or the duplex region.
  • the base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g. , on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
  • A:U is preferred over G:C
  • G:U is preferred over G:C
  • Mismatches e.g. , non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
  • the dsRNA agent of the invention comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'- end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g. , non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5 '-end of the duplex.
  • the nucleotide at the 1 position within the duplex region from the 5 '-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
  • at least one of the first 1, 2 or 3 base pair within the duplex region from the 5'- end of the antisense strand is an AU base pair.
  • the first base pair within the duplex region from the 5'- end of the antisense strand is an AU base pair.
  • 5 '-modified nucleoside is introduced at the 3 '-end of a dinucleotide at any position of single stranded or double stranded siRNA.
  • a 5'- alkylated nucleoside may be introduced at the 3 '-end of a dinucleotide at any position of single stranded or double stranded siRNA.
  • the alkyl group at the 5' position of the ribose sugar can be racemic or chirally pure R or S isomer.
  • An exemplary 5 '-alkylated nucleoside is 5 '-methyl nucleoside. The 5 '-methyl can be either racemic or chirally pure R or S isomer.
  • 4'-modified nucleoside is introduced at the 3'-end of a dinucleotide at any position of single stranded or double stranded siRNA.
  • a 4'- alkylated nucleoside may be introduced at the 3 '-end of a dinucleotide at any position of single stranded or double stranded siRNA.
  • the alkyl group at the 4' position of the ribose sugar can be racemic or chirally pure R or S isomer.
  • An exemplary 4'-alkylated nucleoside is 4'-methyl nucleoside. The 4'-methyl can be either racemic or chirally pure R or S isomer.
  • a 4'-Oalkylated nucleoside may be introduced at the 3 '-end of a dinucleotide at any position of single stranded or double stranded siRNA.
  • the 4'-Oalkyl of the ribose sugar can be racemic or chirally pure R or S isomer.
  • An exemplary 4'-Oalkylated nucleoside is 4'-Omethyl nucleoside.
  • the 4'-Omethyl can be either racemic or chirally pure R or S isomer.
  • 5 '-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
  • the 5 '-alkyl can be either racemic or chirally pure R or S isomer.
  • An exemplary 5 '-alkylated nucleoside is 5 '-methyl nucleoside.
  • the 5 '-methyl can be either racemic or chirally pure R or S isomer.
  • 4' -alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
  • the 4'-alkyl can be either racemic or chirally pure R or S isomer.
  • An exemplary 4' -alkylated nucleoside is 4' -methyl nucleoside.
  • the 4' -methyl can be either racemic or chirally pure R or S isomer.
  • 4'-Oalkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
  • the 5 '-alkyl can be either racemic or chirally pure R or S isomer.
  • An exemplary 4'-Oalkylated nucleoside is 4'-Omethyl nucleoside.
  • the 4'-Omethyl can be either racemic or chirally pure R or S isomer.
  • the 2'-5' linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5' end of the sense strand to avoid sense strand activation by RISC.
  • the dsRNA agent of the invention can comprise L sugars (e.g. , L ribose, L-arabinose with 2'-H, 2' -OH and 2'-OMe).
  • L sugars e.g. , L ribose, L-arabinose with 2'-H, 2' -OH and 2'-OMe.
  • these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5' end of the sense strand to avoid sense strand activation by RISC.
  • the dsRNA agent that contains conjugations of one or more carbohydrate moieties to a dsRNA agent can optimize one or more properties of the dsRNA agent.
  • the carbohydrate moiety will be attached to a modified subunit of the dsRNA agent, e.g. , the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g. , a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
  • a cyclic carrier may be a carbocyclic ring system, i.e. , all ring atoms are carbon atoms, or a heterocyclic ring system, i.e. , one or more ring atoms may be a heteroatom, e.g. , nitrogen, oxygen, sulfur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • the ligand may be attached to the polynucleotide via a carrier.
  • the carriers include (i) at least one "backbone attachment point,” preferably two "backbone attachment points” and (ii) at least one "tethering attachment point.”
  • a "backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g. , the phosphate, or modified phosphate, e.g. , sulfur containing, backbone, of a ribonucleic acid.
  • a "tethering attachment point" in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g. , a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
  • the moiety can be, e.g. , a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.
  • the selected moiety is connected by an intervening tether to the cyclic carrier.
  • the cyclic carrier will often include a functional group, e.g.
  • the dsRNA agent of the invention is conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin;
  • the acyclic group is selected from serinol backbone or diethanolamine backbone.
  • the double stranded RNA (dsRNA) agent of the invention may optionally be conjugated to one or more ligands.
  • the ligand can be attached to the sense strand, antisense strand or both strands, at the 3'-end, 5'-end or both ends.
  • the ligand may be conjugated to the sense strand, in particular, the 3 '-end of the sense strand.
  • dsRNA agents of the invention are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus.
  • 5'-phosphate modifications include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO) 2 (0)P-0-5'); 5'-diphosphate ((HO) 2 (0)P-0-P(HO)(0)-0- 5'); 5'-triphosphate ((HO) 2 (0)P-0-(HO)(0)P-0-P(HO)(0)-0-5'); 5'-guanosine cap (7- methylated or non-methylated) (7m-G-0-5'-(HO)(0)P-0-(HO)(0)P-0-P(HO)(0)-0-5'); 5'- adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O-5'- (HO)(0)P-0-(HO)(0)P-0-P(HO)(0)-0-5'); 5'
  • the modification can in placed in the antisense strand of a dsRNA agent.
  • RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA e.g., into a cell.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al. , Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556).
  • the ligand is cholic acid (Manoharan et al, Biorg. Med. Chem.
  • a thioether e.g., beryl-S- tritylthiol (Manoharan et ⁇ ., ⁇ . NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
  • a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated.
  • a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
  • Preferred ligands do not take part in duplex pairing in a duplexed nucleic acid.
  • Ligands can include a naturally occurring substance, such as a protein ⁇ e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate ⁇ e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N- acetylgalactosamine, or hyaluronic acid); or a lipid.
  • the ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
  • polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
  • PLL polylysine
  • poly L-aspartic acid poly L-glutamic acid
  • styrene-maleic acid anhydride copolymer poly(L-lactide-co-glycolied) copolymer
  • divinyl ether-maleic anhydride copolymer divinyl ether-
  • polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
  • Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N- acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate,
  • a cell or tissue targeting agent e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can
  • the ligand is is an asialoglycoprotein receptor ligand.
  • an "an asialoglycoprotein receptor ligand” or “ASGPR ligand” is aligand, such as a carbohydrate ligand (discussed below), that targets a dsRNA agent of the invention to hepatocytes.
  • the ligand is a one or more galactose, e.g. , an N- acetylgalactosamine (GalNAc) or one or more GalNAc derivatives.
  • ligands include dyes, intercalating agents (e.g. acridines), cross- linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g. , phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g.
  • intercalating agents e.g. acridines
  • cross- linkers e.g. psoralene, mitomycin C
  • porphyrins TPPC4, texaphyrin, Sapphyrin
  • polycyclic aromatic hydrocarbons e.g. , phenazine, dihydrophenazine
  • artificial endonucleases e.g. EDTA
  • lipophilic molecules e.g.
  • alkylating agents phosphate, amino, mercapto, PEG (e.g. , PEG-40K), MPEG, [MPEG] 2 , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin),
  • transport/absorption facilitators e.g. , aspirin, vitamin E, folic acid
  • synthetic ribonucleases e.g. , imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
  • Ligands can be proteins, e.g. , glycoproteins, or peptides, e.g. , molecules having a specific affinity for a co-ligand, or antibodies e.g. , an antibody, that binds to a specified cell type such as a hepatic cell.
  • Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- gulucosamine multivalent mannose, or multivalent fucose.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.
  • the ligand can be a substance, e.g. , a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell' s cytoskeleton, e.g. , by disrupting the cell's microtubules, microfilaments, or intermediate filaments.
  • the drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
  • a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator).
  • PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc.
  • Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g. , oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
  • ligands e.g. as PK modulating
  • Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
  • This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
  • oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). Any other methods for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.
  • the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
  • nucleotide-conjugate precursors that already bear a linking moiety
  • the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated
  • the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
  • the ligand or conjugate is a lipid or lipid-based molecule.
  • a lipid or lipid-based molecule preferably binds a serum protein, e.g. , human serum albumin (HSA).
  • HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g. , a non-kidney target tissue of the body.
  • the target tissue can be the liver, including parenchymal cells of the liver.
  • Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used.
  • a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.
  • a serum protein e.g., HSA.
  • a lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue.
  • a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body.
  • a lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
  • the lipid based ligand binds HSA.
  • it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue.
  • the affinity it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.
  • the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney.
  • Other moieties that target to kidney cells can also be used in place of, or in addition to, the lipid based ligand.
  • the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell.
  • a target cell e.g., a proliferating cell.
  • exemplary vitamins include vitamin A, E, and K.
  • B vitamin e.g., folic acid, B 12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells.
  • HSA and low density lipoprotein (LDL) are also included.
  • the ligand is a cell-permeation agent, preferably a helical cell- permeation agent.
  • the agent is amphipathic.
  • An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a pep tidy lmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids.
  • the helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
  • the ligand can be a peptide or peptidomimetic.
  • a peptidomimetic also referred to herein as an oligopeptidomimetic is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide. The attachment of peptide and
  • peptidomimetic s to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption.
  • the peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide ⁇ e.g., consisting primarily of Tyr, Trp, or Phe).
  • the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
  • the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
  • An exemplary hydrophobic MTS -containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:29).
  • An RFGF analogue e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:30) containing a hydrophobic MTS can also be a targeting moiety.
  • the peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein
  • a peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one -bead-one-compound (OBOC) combinatorial library (Lam et ah, Nature, 354:82-84, 1991).
  • OBOC -bead-one-compound
  • Examples of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic.
  • a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
  • the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
  • RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s).
  • RGD-containing peptides and peptidiomimemtics may include D- amino acids, as well as synthetic RGD mimics.
  • a "cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
  • a microbial cell-permeating peptide can be, for example, an a-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond-containing peptide (e.g., a -defensin, ⁇ -defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin).
  • a cell permeation peptide can also include a nuclear localization signal (NLS).
  • NLS nuclear localization signal
  • a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al, Nucl. Acids Res. 31:2717-2724, 2003).
  • an iRNA further comprises a carbohydrate.
  • the carbohydrate conjugated iRNA is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
  • carbohydrate refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
  • Representative carbohydrates include the sugars (mono-, di-, tri-, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
  • Specific monosaccharides include C5 and above ⁇ e.g., C5, C6, C7, or C8) sugars; di- and
  • trisaccharides include sugars having two or three monosaccharide units ⁇ e.g., C5, C6, C7, or C8).
  • a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.
  • a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
  • a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.
  • the monosaccharide is an
  • N-acetylgalactosamine such as
  • Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.
  • the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5'end of the sense strand of a dsRNA agent, or the 5' end of one or both sense strands of a dual targeting RNAi agent as described herein.
  • the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
  • the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.
  • the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
  • linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
  • Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(0)NH, SO, S0 2 , SO 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl,
  • heterocyclylalkyl heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl,
  • alkynylarylalkynyl alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl,
  • alkynylheteroarylalkyl alkynylheteroarylalkenyl, alkynylheteroarylalkynyl,
  • alkylheterocyclylalkyl alkylheterocyclylalkenyl, alkylhererocyclylalkynyl,
  • alkenylheterocyclylalkyl alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), S0 2 , N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic.
  • the linker is between about 1-24 atom
  • a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
  • the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
  • a first reference condition which can, e.g., be selected to mimic or represent intracellular conditions
  • a second reference condition which can, e.g., be selected to mimic or represent conditions found in the blood or serum.
  • Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood.
  • degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
  • redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g
  • a cleavable linkage group such as a disulfide bond can be susceptible to pH.
  • the pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3.
  • Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0.
  • Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
  • a linker can include a cleavable linking group that is cleavable by a particular enzyme.
  • the type of cleavable linking group incorporated into a linker can depend on the cell to be targeted.
  • a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group.
  • Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase- rich.
  • Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
  • Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
  • the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • a degradative agent or condition
  • the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • the evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals.
  • useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
  • a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation.
  • An example of reductively cleavable linking group is a disulphide linking group (-S-S-).
  • a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell.
  • the candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions.
  • candidate compounds are cleaved by at most about 10% in the blood.
  • useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions).
  • the rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
  • a cleavable linker comprises a phosphate-based cleavable linking group.
  • a phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group.
  • An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells.
  • phosphate-based linking groups are -0-P(0)(ORk)-0-, -0-P(S)(ORk)-0-, -0-P(S)(SRk)-0-, -S-P(0)(ORk)-0-, -O- P(0)(ORk)-S-, -S-P(0)(ORk)-S-, -0-P(S)(ORk)-S-, -S-P(S)(ORk)-0-, -0-P(0)(Rk)-0-, -O- P(S)(Rk)-0-, -S-P(0)(Rk)-0-, -S-P(0)(Rk)-0-, -S-P(S)(Rk)-0-, -S-P(0)(Rk)-S-, -0-P(S)( Rk)-S-.
  • Preferred embodiments are -0-P(0)(OH)-0-, -0-P(S)(OH)-0-, -0-P(S)(SH)-0-, -S-P(0)(OH)-0-, -O- P(0)(OH)-S-, -S-P(0)(OH)-S-, -0-P(S)(OH)-S-, -S-P(S)(OH)-0-, -0- ⁇ (0)( ⁇ )-0-, -O- P(S)(H)-0-, -S-P(0)(H)-0, -S-P(S)(H)-0-, -S-P(0)(H)-S-, and -0-P(S)(H)-S-.
  • a preferred embodiment is -0-P(0)(OH)-0-. These candidates can be evaluated using methods analogous to those described above.
  • a cleavable linker comprises an acid cleavable linking group.
  • An acid cleavable linking group is a linking group that is cleaved under acidic conditions.
  • acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid.
  • specific low pH organelles such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups.
  • acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids.
  • a preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl.
  • a cleavable linker comprises an ester-based cleavable linking group.
  • An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells.
  • Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups.
  • Ester cleavable linking groups have the general formula -C(0)0-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above.
  • a cleavable linker comprises a peptide-based cleavable linking group.
  • a peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.
  • Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides.
  • Peptide-based cleavable groups do not include the amide group (-C(O)NH-).
  • the amide group can be formed between any alkylene, alkenylene or alkynelene.
  • a peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins.
  • the peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group.
  • Peptide-based cleavable linking groups have the general formula - NHCHRAC(0)NHCHRBC(0)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
  • an iRNA of the invention is conjugated to a carbohydrate through a linker.
  • iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
  • a ligand is one or more "GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.
  • a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV) (XLVI):
  • q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
  • R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C are each independently for each occurrence
  • L , L , L , L , L , L , L , V a and L represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide,
  • RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX):
  • L 5A , L 5B and L 5C represent a monosaccharide, such as GalNAc derivative.
  • Suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
  • RNA conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,
  • the present invention also includes iRNA compounds that are chimeric compounds.
  • iRNA compounds preferably dsRNAi agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound.
  • iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid.
  • An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • the RNA of an iRNA can be modified by a non-ligand group.
  • non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al, Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et ah, Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S- tritylthiol
  • Manoharan et ah Ann. NY. Acad. Sci., 1992, 660:306; Manoharan et ah, Bioorg. Med. Chem. Let., 1993, 3:2765
  • a thiocholesterol Olet ah, Nucl.
  • RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
  • an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject can be achieved in a number of different ways.
  • delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo.
  • In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject.
  • in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA.
  • any method of delivering a nucleic acid molecule ⁇ in vitro or in vivo can be adapted for use with an iRNA of the invention (see e.g. , Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139- 144 and WO94/02595, which are incorporated herein by reference in their entireties).
  • factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue.
  • the non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation.
  • RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al.
  • RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.
  • RNA or the pharmaceutical carrier can also permit targeting of the iRNA to the target tissue and avoid undesirable off-target effects.
  • iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
  • lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
  • an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432: 173-178).
  • the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell.
  • Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH, et al (200$) Journal of Controlled Release 129(2): 107- 116) that encases an iRNA.
  • a vesicle or micelle see e.g., Kim SH, et al (200$) Journal of Controlled Release 129(2): 107- 116) that encases an iRNA.
  • the formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically.
  • DOTAP Disposon-based lipid particles
  • Oligofectamine "solid nucleic acid lipid particles”
  • cardiolipin Cholipin, PY, et al (2005) Cancer Gene Ther.
  • an iRNA forms a complex with cyclodextrin for systemic administration.
  • compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7,427,605, which is herein incorporated by reference in its entirety.
  • iRNA targeting the Serpinal gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al, TIG. (1996), 12:5-10; Skillern, A, et al, International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Patent No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type.
  • transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non- integrating vector.
  • the transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al, Proc. Natl. Acad. Sci. USA (1995) 92: 1292).
  • the individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector.
  • two separate expression vectors can be co-introduced ⁇ e.g., by transfection or infection) into a target cell.
  • each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid.
  • a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
  • iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex -planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
  • Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • the constructs can include viral sequences for transfection, if desired.
  • the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors.
  • Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g. , promoters, enhancers, etc., to ensure the expression of the iRNA in target cells.
  • regulatory elements e.g. , promoters, enhancers, etc.
  • the present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention.
  • compositions containing the iRNA are useful for treating a disease or disorder associated with the expression or activity of a Serpinal gene, e.g. , a Serpinal deficiency-associated disorder, e.g., a Serpinal deficiency liver disorder.
  • a Serpinal gene e.g. , a Serpinal deficiency-associated disorder, e.g., a Serpinal deficiency liver disorder.
  • Such pharmaceutical compositions are formulated based on the mode of delivery.
  • compositions that are formulated for direct delivery into the brain parenchyma e.g. , by infusion into the brain, such as by continuous pump infusion.
  • compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers.
  • Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.
  • the RNAi agent may be administered in a solution.
  • a free RNAi agent may be administered in an unbuffered solution, e.g. , in saline or in water.
  • the free siRNA may also be administred in a suitable buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.
  • the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g. , at the physiologic values of the human plasma.
  • Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non- metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts.
  • the agent for controlling the osmolarity of the solution is a salt.
  • the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.
  • compositions of the invention may be administered in dosages sufficient to inhibit expression of a Serpinal gene.
  • a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day.
  • the dsRNA can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.
  • the pharmaceutical composition can be administered once daily, or the iRNA can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage.
  • the dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
  • a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals.
  • a single dose of the pharmaceutical compositions of the invention is administered once per week.
  • a single dose of the pharmaceutical compositions of the invention is administered bi-monthly.
  • treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.
  • Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
  • mice models for the study of various human diseases, such as a liver disorder that would benefit from reduction in the expression of Serpinal. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose.
  • Suitable mouse models are known in the art and include, for example, a mouse containing a transgene expressing human Serpinal.
  • compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer;
  • administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
  • the iRNA can be delivered in a manner to target a particular tissue, such as the liver (e.g., the hepatocytes of the liver).
  • compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable.
  • Coated condoms, gloves and the like can also be useful.
  • Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and
  • iRNAs featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes.
  • iRNAs can be complexed to lipids, in particular to cationic lipids.
  • Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1- monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C 1-2 o alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof).
  • Topical formulations are described in detail in U.S. Patent No.
  • iRNA for use in the compositions and methods of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle.
  • liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition.
  • the lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the iRNA composition, although in some examples, it may.
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the iRNA are delivered into the cell where the iRNA can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the iRNA to particular cell types.
  • a liposome containing a RNAi agent can be prepared by a variety of methods.
  • the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component.
  • the lipid component can be an amphipathic cationic lipid or lipid conjugate.
  • the detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine.
  • the RNAi agent preparation is then added to the micelles that include the lipid component.
  • the cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome.
  • the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.
  • a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition.
  • the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also adjusted to favor condensation.
  • Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al, Proc. Natl. Acad. Set, USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys.
  • Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775: 169, 1984). These methods are readily adapted to packaging RNAi agent preparations into liposomes.
  • Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
  • Liposomes which are pH-sensitive or negatively-charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture.
  • liposomal composition includes phospholipids other than naturally- derived phosphatidylcholine.
  • Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
  • Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl
  • phosphatidylethanolamine DOPE
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4(6) 466).
  • Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G M I, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • liposomes comprising one or more glycolipids are known in the art.
  • Liposomes comprising (1) sphingomyelin and (2) the ganglioside G M I or a galactocerebroside sulfate ester.
  • U.S. Pat. No. 5,543,152 discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
  • cationic liposomes are used.
  • Cationic liposomes possess the advantage of being able to fuse to the cell membrane.
  • Non-cationic liposomes although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245).
  • Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
  • a positively charged synthetic cationic lipid, N-[l-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
  • RNAi agent see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description
  • a DOTMA analogue, l,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles.
  • LipofectinTM Bethesda Research Laboratories, Gaithersburg, Md. is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells.
  • DOTAP cationic lipid, l,2-bis(oleoyloxy)-3,3- (trimethylammonia)propane
  • cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (TransfectamTM, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).
  • DOGS 5-carboxyspermylglycine dioctaoleoylamide
  • DPES dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide
  • Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Choi") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions.
  • Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg,
  • cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
  • Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin.
  • liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin.
  • the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., Journal of Drug Targeting, 1992, vol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising Novasome I (glyceryl)
  • RNAi agent dilaurate/cholesterol/polyoxyethylene-10-stearyl ether
  • Novasome II glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether
  • Liposomes that include iRNA can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome.
  • transfersomes are a type of deformable liposomes.
  • Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.
  • surface edge activators usually surfactants
  • Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self -repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin.
  • the transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
  • Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes.
  • the most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB).
  • HLB hydrophile/lipophile balance
  • the nature of the hydrophilic group also known as the "head" provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
  • the surfactant molecule is not ionized, it is classified as a nonionic surfactant.
  • Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
  • the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
  • amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
  • micellar formulations are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
  • a mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal Cg to C22 alkyl sulphate, and a micelle forming compounds.
  • Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof.
  • the micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide
  • a first micellar composition which contains the siRNA composition and at least the alkali metal alkyl sulphate.
  • the first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition.
  • the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
  • Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth.
  • phenol and/or m-cresol may be added with the micelle forming ingredients.
  • An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
  • the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant.
  • the propellant which is under pressure, is in liquid form in the dispenser.
  • the ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve.
  • the dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.
  • Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen- containing fluorocarbons, dimethyl ether and diethyl ether.
  • HFA 134a (1,1,1,2 tetrafluoroethane) may be used.
  • iRNAs e.g., dsRNAs of in the invention may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.
  • LNP refers to a stable nucleic acid-lipid particle.
  • LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle ⁇ e.g., a PEG-lipid conjugate).
  • LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites ⁇ e.g., sites physically separated from the administration site).
  • LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683.
  • the particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic.
  • the nucleic acids when present in the nucleic acid- lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.
  • the lipid to drug ratio (mass/mass ratio) ⁇ e.g., lipid to dsRNA ratio) will be in the range of from about 1: 1 to about 50: 1, from about 1: 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1, from about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.
  • the cationic lipid can be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I -(2,3- dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I -(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane
  • DODAC N,N-dioleyl-N,N-dimethylammonium chloride
  • DDAB N,N-distearyl-N,N-dimethylammonium bromide
  • DOTAP
  • the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]- dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4- dimethylaminoethyl-[l,3]-dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.
  • the lipid- siRNA particle includes 40% 2, 2-Dilinoleyl-4- dimethylaminoethyl-[l,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0 + 20 nm and a 0.027 siRNA/Lipid Ratio.
  • the ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE),
  • DSPC distearoy
  • the non-cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
  • the conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof.
  • the PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci 2 ), a PEG-dimyristyloxypropyl (Ci 4 ), a PEG-dipalmityloxypropyl (Ci 6 ), or a PEG- distearyloxypropyl (C] 8 ).
  • the conjugated lipid that prevents aggregation of particles can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
  • the nucleic acid-lipid particle further includes cholesterol at, e.g. , about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
  • the lipidoid ND98-4HC1 MW 1487) (see U.S. Patent Application No. 12/056,230, filed 3/26/2008, which is incorporated herein by reference), Cholesterol (Sigma- Aldrich), and PEG-Ceramide C 16 (Avanti Polar Lipids) can be used to prepare lipid- dsRNA nanoparticles (i.e., LNP01 particles).
  • Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml.
  • the ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g. , 42:48: 10 molar ratio.
  • the combined lipid solution can be mixed with aqueous dsRNA (e.g. , in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM.
  • aqueous dsRNA e.g. , in sodium acetate pH 5
  • Lipid- dsRNA nanoparticles typically form spontaneously upon mixing.
  • the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g. , 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc).
  • a thermobarrel extruder such as Lipex Extruder (Northern Lipids, Inc).
  • the extrusion step can be omitted.
  • Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration.
  • Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g. , about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
  • PBS phosphate buffered saline
  • LNP01 formulations are described, e.g. , in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.
  • PEG-DMG PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
  • PEG-DSG PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000)
  • PEG-cDMA PEG-carbamoyl-l,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
  • LNP l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)
  • XTC comprising formulations are described, e.g., in U.S. Provisional Serial No. 61/148,366, filed January 29, 2009; U.S. Provisional Serial No. 61/156,851, filed March 2, 2009; U.S. Provisional Serial No. filed June 10, 2009; U.S. Provisional Serial No.
  • MC3 comprising formulations are described, e.g., in U.S. Publication No.
  • ALNY-100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on November 10, 2009, which is hereby incorporated by reference.
  • any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles of the invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All substituents are as defined below unless indicated otherwise.
  • Alkyl means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms.
  • Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like.
  • saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.
  • Alkenyl means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3 -methyl- 1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl- 2-butenyl, and the like.
  • Alkynyl means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons.
  • Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3- methyl-1 butynyl, and the like.
  • Heterocycle means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms can be optionally oxidized, and the nitrogen heteroatom can be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring.
  • the heterocycle can be attached via any heteroatom or carbon atom.
  • Heterocycles include heteroaryls as defined below.
  • Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.
  • Halogen means fluoro, chloro, bromo and iodo.
  • the methods of the invention can require the use of protecting groups.
  • protecting group methodology is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T.W. et al., Wiley-Interscience, New York City, 1999).
  • protecting groups within the context of this invention are any group that reduces or eliminates unwanted reactivity of a functional group.
  • a protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group.
  • an "alcohol protecting group” is used.
  • An “alcohol protecting group” is any group which decreases or eliminates unwanted reactivity of an alcohol functional group.
  • Protecting groups can be added and removed using techniques well known in the art.
  • compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable.
  • oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration enhancer surfactants and chelators.
  • Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
  • Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and
  • ursodeoxychenodeoxycholic acid UDCA
  • cholic acid dehydrocholic acid
  • deoxycholic acid glucholic acid
  • glycholic acid glycodeoxycholic acid
  • taurocholic acid ursodeoxychenodeoxycholic acid
  • taurodeoxycholic acid sodium tauro-24,25-dihydro-fusidate and sodium
  • Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium).
  • a pharmaceutically acceptable salt thereof e.g., sodium
  • combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts.
  • One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA.
  • Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
  • DsRNAs featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles.
  • DsRNA complexing agents include poly-amino acids; polyimines;
  • polyacrylates polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches;
  • polyalkylcyanoacrylates DEAE-derivatized polyimines, pollulans, celluloses and starches.
  • Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, poly ornithine, poly spermines, protamine, polyvinylpyridine,
  • Oral formulations for dsRNAs and their preparation are described in detail in U.S. Patent 6,887,906, US Publn. No. 20030027780, and U.S. Patent No. 6,747,014, each of which is incorporated herein by reference.
  • compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.
  • the pharmaceutical formulations of the present invention can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media.
  • Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension can also contain stabilizers.
  • compositions of the present invention can be prepared and formulated as emulsions.
  • Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in
  • Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
  • Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants can also be present in emulsions as needed.
  • compositions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
  • a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
  • Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion.
  • Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g. , Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in
  • Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g. , Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV.,
  • Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
  • HLB hydrophile/lipophile balance
  • Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
  • Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid
  • polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2017/062701 2016-11-23 2017-11-21 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF Ceased WO2018098117A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
MYPI2019002873A MY199978A (en) 2016-11-23 2017-11-21 Serpina1 irna compositions and methods of use thereof
JP2019547592A JP7348067B2 (ja) 2016-11-23 2017-11-21 SERPINA1 iRNA組成物およびその使用方法
EP17822812.8A EP3545093A1 (en) 2016-11-23 2017-11-21 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
MX2019005898A MX2019005898A (es) 2016-11-23 2017-11-21 Composiciones de arni de serpina 1 y sus métodos de uso.
RU2019119242A RU2761667C2 (ru) 2016-11-23 2017-11-21 КОМПОЗИЦИИ НА ОСНОВЕ iRNA SERPINA1 И СПОСОБЫ ИХ ПРИМЕНЕНИЯ
CA3044562A CA3044562A1 (en) 2016-11-23 2017-11-21 Serpina1 irna compositions and methods of use thereof
BR112019010342-2A BR112019010342A2 (pt) 2016-11-23 2017-11-21 composições do irna de serpina1 e métodos de uso destas
KR1020197018069A KR20190082317A (ko) 2016-11-23 2017-11-21 SERPINA1 iRNA 조성물 및 그의 사용 방법
AU2017363604A AU2017363604A1 (en) 2016-11-23 2017-11-21 Serpina1 iRNA compositions and methods of use thereof
CN201780074650.2A CN110114463B (zh) 2016-11-23 2017-11-21 丝胺酸蛋白酶抑制剂A1 iRNA组合物及其使用方法
CR20190294A CR20190294A (es) 2016-11-23 2017-11-21 COMPOSICIONES DE ARNi DE SERPINA1 Y SUS MÉTODOS DE USO
PH12019550076A PH12019550076A1 (en) 2016-11-23 2019-04-30 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
IL266746A IL266746A (en) 2016-11-23 2019-05-20 Preparations of serpina1 irna and methods of using them
US16/420,263 US10995336B2 (en) 2016-11-23 2019-05-23 Serpina1 iRNA compositions and methods of use thereof
CONC2019/0005992A CO2019005992A2 (es) 2016-11-23 2019-06-07 Composiciones de arni de serpina1 y sus métodos de uso
US17/194,431 US11725207B2 (en) 2016-11-23 2021-03-08 Serpina1 iRNA compositions and methods of use thereof
US18/644,183 US20250043279A1 (en) 2016-11-23 2024-04-24 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US201662425907P 2016-11-23 2016-11-23
US62/425,907 2016-11-23
US201762548589P 2017-08-22 2017-08-22
US62/548,589 2017-08-22
US201762549099P 2017-08-23 2017-08-23
US62/549,099 2017-08-23
US201762561514P 2017-09-21 2017-09-21
US62/561,514 2017-09-21

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/420,263 Continuation US10995336B2 (en) 2016-11-23 2019-05-23 Serpina1 iRNA compositions and methods of use thereof

Publications (2)

Publication Number Publication Date
WO2018098117A1 true WO2018098117A1 (en) 2018-05-31
WO2018098117A8 WO2018098117A8 (en) 2021-05-14

Family

ID=62195353

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/062701 Ceased WO2018098117A1 (en) 2016-11-23 2017-11-21 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Country Status (23)

Country Link
US (3) US10995336B2 (https=)
EP (1) EP3545093A1 (https=)
JP (1) JP7348067B2 (https=)
KR (1) KR20190082317A (https=)
CN (1) CN110114463B (https=)
AU (1) AU2017363604A1 (https=)
BR (1) BR112019010342A2 (https=)
CA (1) CA3044562A1 (https=)
CL (1) CL2019001388A1 (https=)
CO (1) CO2019005992A2 (https=)
CR (1) CR20190294A (https=)
DO (1) DOP2019000132A (https=)
IL (1) IL266746A (https=)
MA (1) MA46923A (https=)
MX (1) MX2019005898A (https=)
MY (1) MY199978A (https=)
PH (1) PH12019550076A1 (https=)
RU (2) RU2021126115A (https=)
SG (1) SG10201913877WA (https=)
TW (2) TWI788312B (https=)
UY (1) UY37494A (https=)
WO (1) WO2018098117A1 (https=)
ZA (1) ZA202103080B (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10450565B2 (en) 2017-01-10 2019-10-22 Arrowhead Pharmaceuticals, Inc. Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
WO2020236600A1 (en) * 2019-05-17 2020-11-26 Alnylam Pharmaceuticals, Inc. Oral delivery of oligonucleotides
US20220228144A1 (en) * 2019-08-01 2022-07-21 Alnylam Pharmaceuticals, Inc. SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022162155A1 (en) * 2021-01-30 2022-08-04 E-Therapeutics Plc Nucleic acids containing abasic nucleotides
WO2023059948A1 (en) * 2021-10-08 2023-04-13 E-Therapeutics Plc Nucleic acids containing abasic nucleosides
US11725207B2 (en) 2016-11-23 2023-08-15 Alnylam Pharmaceuticals, Inc. Serpina1 iRNA compositions and methods of use thereof
EP3877524A4 (en) * 2018-11-09 2023-10-11 Alnylam Pharmaceuticals Inc. MODIFIED DOUBLE-STRANDED OLIGONUCLEOTIDES
WO2024023256A1 (en) * 2022-07-27 2024-02-01 E-Therapeutics Plc Nucleic acid compounds
US12071619B2 (en) 2013-05-22 2024-08-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA compositions and methods of use thereof
US12188017B2 (en) 2014-06-17 2025-01-07 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin
US12582668B2 (en) 2019-06-06 2026-03-24 Arrowhead Pharmaceuticals, Inc. Methods for the treatment of alpha-1 antitrypsin deficiency (AATD)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2019239971B2 (en) * 2018-03-21 2025-09-11 Regeneron Pharmaceuticals, Inc. 17beta-hydroxysteroid dehydrogenase type 13 (HSD17b13) iRNA compositions and methods of use thereof
US20220259640A1 (en) 2019-07-08 2022-08-18 Md Healthcare Inc. Method for diagnosing brain tumor through bacterial metagenomic analysis
GB2613225B (en) 2020-03-04 2024-01-03 Verve Therapeutics Inc Compositions and methods for targeted RNA delivery
US20230416739A1 (en) * 2020-11-13 2023-12-28 The George Washington University, A Congressionally Chartered Not-For-Profit Corporation B-spectrin (sptbn1) deficiency protects mice from high-fat diet-induced liver disease and cancer development
CA3204340A1 (en) 2021-01-30 2022-08-04 Ahmad Ali MORTAZAVI Conjugated oligonucleotide compounds, methods of making and uses thereof
WO2023015223A2 (en) 2021-08-03 2023-02-09 Verve Therapeutics, Inc. Compositions and methods for targeted rna delivery
US11879125B2 (en) * 2022-03-16 2024-01-23 Empirico Inc. GalNAc compositions for improving siRNA bioavailability
AU2023245603A1 (en) 2022-03-28 2024-11-07 Empirico Inc. Modified oligonucleotides
CN117070583B (zh) * 2023-10-16 2024-05-14 吉林凯莱英制药有限公司 抑制PCSK9基因表达的siRNA的制备方法
WO2025136994A1 (en) * 2023-12-19 2025-06-26 Sirius Therapeutics, Inc. Modifications of polynucleic acid molecules and uses thereof

Citations (210)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US513030A (en) 1894-01-16 Machine for waxing or coating paper
US564562A (en) 1896-07-21 Joseph p
US1861117A (en) 1927-11-14 1932-05-31 Scovill Manufacturing Co Self locking floating trim stud
US1861608A (en) 1929-12-21 1932-06-07 Emerson Electric Mfg Co Fan and means for directing the air current therethrough
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US3974817A (en) 1974-07-18 1976-08-17 Colt Industries Operating Corporation Breakerless ignition control system
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4708717A (en) 1985-02-26 1987-11-24 National Research Development Corporation Suction-irrigation apparatus
WO1988004924A1 (en) 1986-12-24 1988-07-14 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5152817A (en) 1991-01-15 1992-10-06 Corning Incorporated Reactor for coating optical fibers
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5171678A (en) 1989-04-17 1992-12-15 Centre National De La Recherche Scientifique Lipopolyamines, their preparation and their use
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
WO1993024640A2 (en) 1992-06-04 1993-12-09 The Regents Of The University Of California Methods and compositions for in vivo gene therapy
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
WO1994000569A1 (en) 1992-06-18 1994-01-06 Genpharm International, Inc. Methods for producing transgenic non-human animals harboring a yeast artificial chromosome
US5283185A (en) 1991-08-28 1994-02-01 University Of Tennessee Research Corporation Method for delivering nucleic acids into cells
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
WO1996037194A1 (en) 1995-05-26 1996-11-28 Somatix Therapy Corporation Delivery vehicles comprising stable lipid/nucleic acid complexes
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
WO1996040964A2 (en) 1995-06-07 1996-12-19 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
WO1997013499A1 (en) 1995-10-11 1997-04-17 The University Of British Columbia Liposomal formulations of mitoxantrone
US5623008A (en) 1994-12-28 1997-04-22 Toyoda Gosei Co., Ltd. Rubber composition for glass-run
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677195A (en) 1991-11-22 1997-10-14 Affymax Technologies N.V. Combinatorial strategies for polymer synthesis
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5770722A (en) 1994-10-24 1998-06-23 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
WO1998039359A1 (en) 1997-03-06 1998-09-11 Genta Incorporated Dimeric cationic lipids on dicystine basis
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5874219A (en) 1995-06-07 1999-02-23 Affymetrix, Inc. Methods for concurrently processing multiple biological chip assays
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
WO2000003683A2 (en) 1998-07-20 2000-01-27 Inex Pharmaceuticals Corporation Liposomal encapsulated nucleic acid-complexes
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US6147200A (en) 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US6166197A (en) 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US6191105B1 (en) 1993-05-10 2001-02-20 Protein Delivery, Inc. Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin
US6222025B1 (en) 1995-03-06 2001-04-24 Isis Pharmaceuticals, Inc. Process for the synthesis of 2′-O-substituted pyrimidines and oligomeric compounds therefrom
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US20030027780A1 (en) 1999-02-23 2003-02-06 Hardee Gregory E. Multiparticulate formulation
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6528640B1 (en) 1997-11-05 2003-03-04 Ribozyme Pharmaceuticals, Incorporated Synthetic ribonucleic acids with RNAse activity
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6586410B1 (en) 1995-06-07 2003-07-01 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US20030144217A1 (en) 1997-12-24 2003-07-31 Vertex Pharmaceuticals Incorporated Prodrugs of aspartyl protease inhibitors
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6639062B2 (en) 1997-02-14 2003-10-28 Isis Pharmaceuticals, Inc. Aminooxy-modified nucleosidic compounds and oligomeric compounds prepared therefrom
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6747014B2 (en) 1997-07-01 2004-06-08 Isis Pharmaceuticals, Inc. Compositions and methods for non-parenteral delivery of oligonucleotides
US20040127488A1 (en) 1999-02-12 2004-07-01 Vertex Pharmaceuticals Incorporated Inhibitors of aspartyl protease
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US20040167116A1 (en) 1992-09-08 2004-08-26 Vertex Pharmaceuticals Incorporated Novel sulfonamide inhibitors of aspartyl protease
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20050148548A1 (en) 1997-12-24 2005-07-07 Vertex Pharmaceuticals Inc. Sulphonamide derivatives as prodrugs of aspartyl protease inhibitors
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US7045610B2 (en) 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
WO2007091269A2 (en) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEL TANDEM siRNAS
WO2007117686A2 (en) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2008042973A2 (en) 2006-10-03 2008-04-10 Alnylam Pharmaceuticals, Inc. Lipid containing formulations
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US7427605B2 (en) 2005-03-31 2008-09-23 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
WO2009014887A2 (en) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
US7495088B1 (en) 1989-12-04 2009-02-24 Enzo Life Sciences, Inc. Modified nucleotide compounds
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
WO2009127060A1 (en) 2008-04-15 2009-10-22 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
WO2010011895A1 (en) 2008-07-25 2010-01-28 Alnylam Pharmaceuticals, Inc. Enhancement of sirna silencing activity using universal bases or mismatches in the sense strand
WO2010141511A2 (en) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent rna interference, compositions and methods of use thereof
US20100324120A1 (en) 2009-06-10 2010-12-23 Jianxin Chen Lipid formulation
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011031520A1 (en) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
US8030467B2 (en) 2006-05-11 2011-10-04 Isis Pharmaceuticals, Inc. 5′-modified bicyclic nucleic acid analogs
WO2011133876A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
US20110313020A1 (en) 2008-12-03 2011-12-22 Marina Biotech, Inc. UsiRNA Complexes
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US20120157511A1 (en) 2009-07-07 2012-06-21 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
US8278283B2 (en) 2007-07-05 2012-10-02 Isis Pharmaceuticals, Inc. 6-disubstituted or unsaturated bicyclic nucleic acid analogs
US8278426B2 (en) 2007-06-08 2012-10-02 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
US8278425B2 (en) 2007-05-30 2012-10-02 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
US8314227B2 (en) 2007-05-22 2012-11-20 Marina Biotech, Inc. Hydroxymethyl substituted RNA oligonucleotides and RNA complexes
US20130011922A1 (en) 2007-03-02 2013-01-10 F/K/A Mdrna, Inc. Nucleic acid compounds for inhibiting gene expression and uses thereof
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
US20130190383A1 (en) 2010-04-26 2013-07-25 Marina Biotech, Inc. Nucleic acid compounds with conformationally restricted monomers and uses thereof
WO2014179627A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
WO2014190137A1 (en) * 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2016028649A1 (en) * 2014-08-20 2016-02-25 Alnylam Pharmaceuticals, Inc. Modified double-stranded rna agents

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050137153A1 (en) * 2002-02-20 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of alpha-1 antitrypsin (AAT) gene expression using short interfering nucleic acid (siNA)
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
AU2003295600A1 (en) 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US8053232B2 (en) * 2004-01-23 2011-11-08 Virxsys Corporation Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated RNA trans splicing
WO2005116204A1 (ja) 2004-05-11 2005-12-08 Rnai Co., Ltd. Rna干渉を生じさせるポリヌクレオチド、および、これを用いた遺伝子発現抑制方法
CA2584207A1 (en) 2004-10-19 2006-04-27 Replicor, Inc. Antiviral oligonucleotides
CN101977626A (zh) * 2008-01-21 2011-02-16 德莫迪斯公司 丝氨酸蛋白酶抑制剂在治疗皮肤病中的用途
CA2713379A1 (en) 2008-01-31 2009-11-05 Alnylam Pharmaceuticals, Inc. Optimized methods for delivery of dsrna targeting the pcsk9 gene
US20110130440A1 (en) 2008-03-26 2011-06-02 Alnylam Pharmaceuticals, Inc. Non-natural ribonucleotides, and methods of use thereof
DK2341943T3 (en) 2008-09-22 2019-02-25 Dicerna Pharmaceuticals Inc COMPOSITIONS AND METHODS OF SPECIFIC INHIBITION OF DSRNA REPRINT WITH MODIFICATIONS
KR101728655B1 (ko) 2008-12-18 2017-04-19 다이서나 파마수이티컬, 인크. 유전자 발현의 특이적 억제를 위한 연장된 다이서 기질 제제 및 방법
JP5894913B2 (ja) 2009-06-15 2016-03-30 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. Pcsk9遺伝子を標的とする、脂質で製剤化されたdsrna
WO2012178033A2 (en) * 2011-06-23 2012-12-27 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
US9340784B2 (en) 2012-03-19 2016-05-17 Ionis Pharmaceuticals, Inc. Methods and compositions for modulating alpha-1-antitrypsin expression
US9458457B2 (en) 2013-07-03 2016-10-04 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of alpha-1 antitrypsin by double-stranded RNA
KR20150114637A (ko) * 2014-04-01 2015-10-13 부산대학교 산학협력단 SerpinA1 유전자의 발현을 저해하는 저해제를 유효성분으로 포함하는 위암 치료용 약학적 조성물
TWI788312B (zh) * 2016-11-23 2023-01-01 美商阿尼拉製藥公司 絲胺酸蛋白酶抑制因子A1 iRNA組成物及其使用方法
CN110268060B (zh) 2017-01-10 2024-07-26 箭头药业股份有限公司 α-1抗胰蛋白酶(AAT)RNAi物质、包含AAT RNAi物质的组合物和使用方法

Patent Citations (238)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US513030A (en) 1894-01-16 Machine for waxing or coating paper
US564562A (en) 1896-07-21 Joseph p
US1861117A (en) 1927-11-14 1932-05-31 Scovill Manufacturing Co Self locking floating trim stud
US1861608A (en) 1929-12-21 1932-06-07 Emerson Electric Mfg Co Fan and means for directing the air current therethrough
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US3974817A (en) 1974-07-18 1976-08-17 Colt Industries Operating Corporation Breakerless ignition control system
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4789737A (en) 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US5541313A (en) 1983-02-22 1996-07-30 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5578717A (en) 1984-10-16 1996-11-26 Chiron Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
US5552538A (en) 1984-10-16 1996-09-03 Chiron Corporation Oligonucleotides with cleavable sites
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4708717A (en) 1985-02-26 1987-11-24 National Research Development Corporation Suction-irrigation apparatus
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
WO1988004924A1 (en) 1986-12-24 1988-07-14 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5171678A (en) 1989-04-17 1992-12-15 Centre National De La Recherche Scientifique Lipopolyamines, their preparation and their use
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US7495088B1 (en) 1989-12-04 2009-02-24 Enzo Life Sciences, Inc. Modified nucleotide compounds
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US6900297B1 (en) 1990-01-11 2005-05-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5567810A (en) 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5152817A (en) 1991-01-15 1992-10-06 Corning Incorporated Reactor for coating optical fibers
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5283185A (en) 1991-08-28 1994-02-01 University Of Tennessee Research Corporation Method for delivering nucleic acids into cells
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5677195A (en) 1991-11-22 1997-10-14 Affymax Technologies N.V. Combinatorial strategies for polymer synthesis
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US6380368B1 (en) 1991-11-26 2002-04-30 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
WO1993024640A2 (en) 1992-06-04 1993-12-09 The Regents Of The University Of California Methods and compositions for in vivo gene therapy
WO1994000569A1 (en) 1992-06-18 1994-01-06 Genpharm International, Inc. Methods for producing transgenic non-human animals harboring a yeast artificial chromosome
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US20040167116A1 (en) 1992-09-08 2004-08-26 Vertex Pharmaceuticals Incorporated Novel sulfonamide inhibitors of aspartyl protease
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5658873A (en) 1993-04-10 1997-08-19 Degussa Aktiengesellschaft Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US6191105B1 (en) 1993-05-10 2001-02-20 Protein Delivery, Inc. Hydrophilic and lipophilic balanced microemulsion formulations of free-form and/or conjugation-stabilized therapeutic agents such as insulin
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5591584A (en) 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5770722A (en) 1994-10-24 1998-06-23 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5623008A (en) 1994-12-28 1997-04-22 Toyoda Gosei Co., Ltd. Rubber composition for glass-run
US6222025B1 (en) 1995-03-06 2001-04-24 Isis Pharmaceuticals, Inc. Process for the synthesis of 2′-O-substituted pyrimidines and oligomeric compounds therefrom
US6166197A (en) 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
WO1996037194A1 (en) 1995-05-26 1996-11-28 Somatix Therapy Corporation Delivery vehicles comprising stable lipid/nucleic acid complexes
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6534484B1 (en) 1995-06-07 2003-03-18 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6815432B2 (en) 1995-06-07 2004-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US5976567A (en) 1995-06-07 1999-11-02 Inex Pharmaceuticals Corp. Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5874219A (en) 1995-06-07 1999-02-23 Affymetrix, Inc. Methods for concurrently processing multiple biological chip assays
US6586410B1 (en) 1995-06-07 2003-07-01 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
WO1996040964A2 (en) 1995-06-07 1996-12-19 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
WO1997013499A1 (en) 1995-10-11 1997-04-17 The University Of British Columbia Liposomal formulations of mitoxantrone
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6639062B2 (en) 1997-02-14 2003-10-28 Isis Pharmaceuticals, Inc. Aminooxy-modified nucleosidic compounds and oligomeric compounds prepared therefrom
WO1998039359A1 (en) 1997-03-06 1998-09-11 Genta Incorporated Dimeric cationic lipids on dicystine basis
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6887906B1 (en) 1997-07-01 2005-05-03 Isispharmaceuticals, Inc. Compositions and methods for the delivery of oligonucleotides via the alimentary canal
US6747014B2 (en) 1997-07-01 2004-06-08 Isis Pharmaceuticals, Inc. Compositions and methods for non-parenteral delivery of oligonucleotides
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7034133B2 (en) 1997-09-12 2006-04-25 Exiqon A/S Oligonucleotide analogues
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6528640B1 (en) 1997-11-05 2003-03-04 Ribozyme Pharmaceuticals, Incorporated Synthetic ribonucleic acids with RNAse activity
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US20030144217A1 (en) 1997-12-24 2003-07-31 Vertex Pharmaceuticals Incorporated Prodrugs of aspartyl protease inhibitors
US20050148548A1 (en) 1997-12-24 2005-07-07 Vertex Pharmaceuticals Inc. Sulphonamide derivatives as prodrugs of aspartyl protease inhibitors
US7045610B2 (en) 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
WO2000003683A2 (en) 1998-07-20 2000-01-27 Inex Pharmaceuticals Corporation Liposomal encapsulated nucleic acid-complexes
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US20040127488A1 (en) 1999-02-12 2004-07-01 Vertex Pharmaceuticals Incorporated Inhibitors of aspartyl protease
US20030027780A1 (en) 1999-02-23 2003-02-06 Hardee Gregory E. Multiparticulate formulation
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6147200A (en) 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
US7427605B2 (en) 2005-03-31 2008-09-23 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US8022193B2 (en) 2006-01-27 2011-09-20 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US20090012281A1 (en) 2006-01-27 2009-01-08 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7741457B2 (en) 2006-01-27 2010-06-22 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
WO2007091269A2 (en) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEL TANDEM siRNAS
WO2007117686A2 (en) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
US8030467B2 (en) 2006-05-11 2011-10-04 Isis Pharmaceuticals, Inc. 5′-modified bicyclic nucleic acid analogs
WO2008042973A2 (en) 2006-10-03 2008-04-10 Alnylam Pharmaceuticals, Inc. Lipid containing formulations
US20130011922A1 (en) 2007-03-02 2013-01-10 F/K/A Mdrna, Inc. Nucleic acid compounds for inhibiting gene expression and uses thereof
US20130096289A1 (en) 2007-05-22 2013-04-18 Marina Biotech, Inc. Hydroxymethyl substituted rna oligonucleotides and rna complexes
US8314227B2 (en) 2007-05-22 2012-11-20 Marina Biotech, Inc. Hydroxymethyl substituted RNA oligonucleotides and RNA complexes
US8278425B2 (en) 2007-05-30 2012-10-02 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
US8278426B2 (en) 2007-06-08 2012-10-02 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
US8278283B2 (en) 2007-07-05 2012-10-02 Isis Pharmaceuticals, Inc. 6-disubstituted or unsaturated bicyclic nucleic acid analogs
WO2009014887A2 (en) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
WO2009127060A1 (en) 2008-04-15 2009-10-22 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
WO2010011895A1 (en) 2008-07-25 2010-01-28 Alnylam Pharmaceuticals, Inc. Enhancement of sirna silencing activity using universal bases or mismatches in the sense strand
US20110313020A1 (en) 2008-12-03 2011-12-22 Marina Biotech, Inc. UsiRNA Complexes
WO2010141511A2 (en) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent rna interference, compositions and methods of use thereof
US20100324120A1 (en) 2009-06-10 2010-12-23 Jianxin Chen Lipid formulation
US20120157511A1 (en) 2009-07-07 2012-06-21 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011031520A1 (en) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
WO2011133876A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
US20130190383A1 (en) 2010-04-26 2013-07-25 Marina Biotech, Inc. Nucleic acid compounds with conformationally restricted monomers and uses thereof
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2014179627A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014190137A1 (en) * 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US9574192B2 (en) 2013-05-22 2017-02-21 Alnylam Pharmaceuticals, Inc. Serapina1 iRNA compositions and methods of use thereof
WO2016028649A1 (en) * 2014-08-20 2016-02-25 Alnylam Pharmaceuticals, Inc. Modified double-stranded rna agents

Non-Patent Citations (163)

* Cited by examiner, † Cited by third party
Title
"Current protocols in nucleic acid chemistry", JOHN WILEY & SONS, INC.
"GenBank", Database accession no. 189163524
"GenBank", Database accession no. GI:357588423
"GENBANK", Database accession no. GI:357588426
"GenBank", Database accession no. GI:402766667
"GenBank", Database accession no. GI:77020249
"Modified Nucleosides in Biochemistry, Biotechnology", 2008, WILEY-VCH
"RNA Research and Applications", 1993, CRC PRESS, pages: 276 - 278
"The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859
AIGNER, A., J. BIOMED. BIOTECHNOL., 2006, pages 71659
AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602
AKHTAR S.; JULIAN RL., TRENDS CELL. BIOL., vol. 2, no. 5, 1992, pages 139 - 144
ALLEN ET AL., FEBS LETTERS, vol. 223, 1987, pages 42
ALLEN, LV.; POPOVICH NG.; ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
ALLEN, LV; POPOVICH NG.; ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
ARNOLD, AS ET AL., J. HYPERTENS., vol. 25, 2007, pages 197 - 205
BANGHAM ET AL., M. MOL. BIOL., vol. 23, 1965, pages 238
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 1118
BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363
BITKO, V. ET AL., NAT. MED., vol. 11, 2005, pages 50 - 55
BLOCK: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 335
BLOCK: "Pharmaceutical Dosage Forms", vol. 2, 1988, MARCEL DEKKER, INC., pages: 335
BONNET ME ET AL., PHARM. RES., 2008
BRUNTON ET AL.: "Goodman & Gilman's The Pharmacological Basis of Therapeutics", 1996, MCGRAW-HILL, pages: 934 - 935
BUUR ET AL., J. CONTROL REL., vol. 14, 1990, pages 43 - 51
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
CHIEN, PY ET AL., CANCER GENE THER., vol. 12, 2005, pages 321 - 328
CHILD; TURCOTTE: "In: The liver and portal hypertension", 1964, SAUNDERS, article "Surgery and portal hypertension", pages: 50 - 64
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385 - 1390
COUTURE, A ET AL., TIG, vol. 12, 1996, pages 5 - 10
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
DORN, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages e49
EL HARIRI ET AL., J. PHARM. PHARMACOL., vol. 44, 1992, pages 651 - 654
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200
ELMEN, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 1, 2005, pages 439 - 447
ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613
FARNSWORTH ET AL., AM J SURGERY, vol. 188, 2004, pages 580 - 583
FEIGNER, J. BIOL. CHEM., vol. 269, 1994, pages 2550
FEIGNER, P. L. ET AL., PROC. NATL. ACAD. SCI., USA, vol. 8, 1987, pages 7413 - 7417
FIRE ET AL., NATURE, vol. 391, 1998, pages 806 - 811
FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039
FUKUNAGA ET AL., ENDOCRINOL, vol. 115, 1984, pages 757
GABIZON ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 6949
GAO, X.; HUANG, L., BIOCHIM. BIOPHYS. RES. COMMUN., vol. 179, 1991, pages 280
GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292
GERSHON, BIOCHEM., vol. 32, 1993, pages 7143
GREEN, T.W. ET AL.: "Protective Groups in Organic Synthesis", 1999, WILEY-INTERSCIENCE
GRUNWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
HIGUCHI ET AL.: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 301
HO ET AL., J. PHARM. SCI., vol. 85, 1996, pages 138 - 143
HOWARD, KA. ET AL., MOL. THER., vol. 14, 2006, pages 476 - 484
HU ET AL., S.T.P.PHARMA. SCI., vol. 4, no. 6, 1994, pages 466
IDSON: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199
IDSON: "Pharmaceutical Dosage Forms, Lieberman", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199
ITANI, T. ET AL., GENE, vol. 56, 1987, pages 267 - 276
JARRETT, J. CHROMATOGR., vol. 618, 1993, pages 315 - 339
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
KATDARE, A. ET AL.: "Excipient development for pharmaceutical, biotechnology, and drug delivery", 2006, CRC PRESS
KIM ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 728, 1983, pages 339
KIM SH ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116
KIM, WJ. ET AL., MOL. THER., vol. 14, 2006, pages 343 - 350
KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 365, no. 1, 2007, pages 54 - 61
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 - 1177
LAM ET AL., MOLECULAR THERAPY NUCLEIC ACIDS, vol. 4, 2015, pages e252
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
LEE ET AL., CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1991, pages 92
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553
LETSINGER ET AL., PROC. NATL. ACID. SCI. USA, vol. 86, 1989, pages 6553 - 6556
LEUNG; SHAH: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215
LI, S. ET AL., MOL. THER., vol. 15, 2007, pages 515 - 523
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487
LIZARDI ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1197
MAKIMURA, H. ET AL., BMC NEUROSCI., vol. 3, 2002, pages 18
MALMSTEN, M., SURFACTANTS AND POLYMERS IN DRUG DELIVERY, INFORMA HEALTH CARE, 2002
MALMSTEN, M.: "Surfactants and polymers in drug delivery", INFORMA HEALTH CARE, 2002
MANNINO, R. J.; FOULD-FOGERITE, S., BIOTECHNIQUES, vol. 6, 1988, pages 682 - 690
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MAYER ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 858, 1986, pages 161
MAYHEW ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 775, 1984, pages 169
MCNAMARA, JO ET AL., NAT. BIOTECHNOL., vol. 24, 2006, pages 1005 - 1015
MELTON ET AL., NUC. ACIDS RES., vol. 12, pages 7035
MIKHAILOV, TETRAHEDRON LETTERS, vol. 26, no. 17, 1985, pages 2059
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
MIYAO ET AL., DSRNA RES. DEV., vol. 5, 1995, pages 115 - 121
MOOK, OR. ET AL., MOL CANC THER, vol. 6, no. 3, 2007, pages 833 - 843
MURANISHI, CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 7, 1990, pages 1 - 33
MURANISHI: "7", CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1990, pages 1 - 33
NABEL, HUMAN GENE THER., vol. 3, 1992, pages 649
NABEL, PROC. NATL. ACAD. SCI., vol. 90, 1993, pages 11307
NICOLAU, C. ET AL., METH. ENZ., vol. 149, 1987, pages 157 - 176
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
NUC. ACIDS SYMP. SERIES, vol. 52, 2008, pages 133 - 134
NYKANEN ET AL., CELL, vol. 107, 2001, pages 309
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
OLSON ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 557, 1979, pages 9
PAL, A ET AL., INT J. ONCOL., vol. 26, 2005, pages 1087 - 1091
PAPAHADJOPOULOS ET AL., ANN. N.Y. ACAD. SCI., vol. 507, 1987, pages 64
PILLE, J. ET AL., MOL. THER., vol. 11, 2005, pages 267 - 274
PLESSIS ET AL., ANTIVIRAL RESEARCH, vol. 18, 1992, pages 259 - 265
PUGH ET AL., BR J SURG, vol. 60, 1973, pages 648 - 52
REICH, SJ. ET AL., MOL. VIS., vol. 9, 2003, pages 210 - 216
RIEGER: "Pharmaceutical Dosage Forms", 1988, MARCEL DEKKER, INC., pages: 285
RIEGER: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 285
RITSCHEL, METH. FIND. EXP. CLIN. PHARMACOL., vol. 13, 1993, pages 205
ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 245
ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, pages: 245
ROSOFF: "Pharmaceutical Dosage Forms, Lieberman", vol. 1, 1988, MARCEL DEKKER, INC., pages: 245
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111
SANGHVI, Y S.: "dsRNA Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SCHOTT: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 271
SHARP ET AL., GENES DEV., vol. 15, 2001, pages 485
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SHISHKINA, GT. ET AL., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528
SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724
SORENSEN, DR ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766
SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178
STRAUBINGER, R. M.; PAPAHADJOPOULOS, D., METH. ENZ., vol. 101, 1983, pages 512 - 527
STRAUSS, EMBO J., vol. 11, 1992, pages 417
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
SWINYARD: "In: Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO., pages: 782 - 783
SZOKA ET AL., PROC. NATL. ACAD. SCI., vol. 75, 1978, pages 4194
TAKAHASHI ET AL., J. PHARM. PHARMACOL., vol. 40, 1988, pages 252
TAKAKURA ET AL., DSRNA & NUCL. ACID DRUG DEV., vol. 6, 1996, pages 177 - 183
TAN, PH. ET AL., GENE THER., vol. 12, 2005, pages 59 - 66
THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275
TOLENTINO, MJ ET AL., RETINA, vol. 24, 2004, pages 132 - 138
TOMALIA, DA ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67
TOUITOU, E. ET AL.: "Enhancement in Drug Delivery", 2006, CRC PRESS
VERMA, UN ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300
WANG ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 147, 1987, pages 980 - 985
WANG, C. Y.; HUANG, L., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7851 - 7855
WEINER ET AL., JOURNAL OF DRUG TARGETING, vol. 2, 1992, pages 405 - 410
WU ET AL., CANCER RESEARCH, vol. 53, 1993, pages 3765
YAMAMOTO ET AL., J. PHARM. EXP. THER., vol. 263, 1992, pages 25
YAMASHITA ET AL., J. PHARM. PHARMACOL., vol. 39, 1987, pages 621 - 626
YAMASHITA ET AL., J. PHARM. SCI., vol. 79, 1990, pages 579 - 583
YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804
ZAIMIDOU, S. ET AL., HUM MUTAT., vol. 230, no. 3, 2009, pages 308 - 13
ZHANG, X. ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 10677 - 10684
ZHOU ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 19, 1992, pages 269 - 274
ZHOU, X. ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1065, 1991, pages 8
ZIMMERMANN, TS ET AL., NATURE, vol. 441, 2006, pages 111 - 114

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12071619B2 (en) 2013-05-22 2024-08-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA compositions and methods of use thereof
US12188017B2 (en) 2014-06-17 2025-01-07 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin
US11725207B2 (en) 2016-11-23 2023-08-15 Alnylam Pharmaceuticals, Inc. Serpina1 iRNA compositions and methods of use thereof
US11203756B2 (en) 2017-01-10 2021-12-21 Arrowhead Pharmaceuticals, Inc. Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
US10450565B2 (en) 2017-01-10 2019-10-22 Arrowhead Pharmaceuticals, Inc. Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
US11884920B2 (en) 2017-01-10 2024-01-30 Arrowhead Pharmaceuticals, Inc. Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
US12600965B2 (en) 2018-11-09 2026-04-14 Alnylam Pharmaceuticals, Inc. Modified double stranded oligonucleotide
EP3877524A4 (en) * 2018-11-09 2023-10-11 Alnylam Pharmaceuticals Inc. MODIFIED DOUBLE-STRANDED OLIGONUCLEOTIDES
WO2020236600A1 (en) * 2019-05-17 2020-11-26 Alnylam Pharmaceuticals, Inc. Oral delivery of oligonucleotides
AU2020279101B2 (en) * 2019-05-17 2025-07-24 Alnylam Pharmaceuticals, Inc. Oral delivery of oligonucleotides
US12582668B2 (en) 2019-06-06 2026-03-24 Arrowhead Pharmaceuticals, Inc. Methods for the treatment of alpha-1 antitrypsin deficiency (AATD)
US20220228144A1 (en) * 2019-08-01 2022-07-21 Alnylam Pharmaceuticals, Inc. SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022162155A1 (en) * 2021-01-30 2022-08-04 E-Therapeutics Plc Nucleic acids containing abasic nucleotides
WO2023059948A1 (en) * 2021-10-08 2023-04-13 E-Therapeutics Plc Nucleic acids containing abasic nucleosides
WO2024023256A1 (en) * 2022-07-27 2024-02-01 E-Therapeutics Plc Nucleic acid compounds

Also Published As

Publication number Publication date
TW201829443A (zh) 2018-08-16
US20210269796A1 (en) 2021-09-02
JP7348067B2 (ja) 2023-09-20
UY37494A (es) 2018-06-29
JP2020500929A (ja) 2020-01-16
RU2021126115A (ru) 2021-09-16
CA3044562A1 (en) 2018-05-31
US20250043279A1 (en) 2025-02-06
PH12019550076A1 (en) 2020-01-20
CL2019001388A1 (es) 2019-10-04
WO2018098117A8 (en) 2021-05-14
MA46923A (fr) 2019-10-02
KR20190082317A (ko) 2019-07-09
CO2019005992A2 (es) 2019-06-28
SG10201913877WA (en) 2020-03-30
MX2019005898A (es) 2020-01-27
US20190316127A1 (en) 2019-10-17
TWI788312B (zh) 2023-01-01
CR20190294A (es) 2019-08-29
MY199978A (en) 2023-12-01
US10995336B2 (en) 2021-05-04
US11725207B2 (en) 2023-08-15
CN110114463B (zh) 2024-08-30
DOP2019000132A (es) 2019-08-15
EP3545093A1 (en) 2019-10-02
AU2017363604A1 (en) 2019-06-06
RU2019119242A (ru) 2020-12-25
RU2019119242A3 (https=) 2021-02-24
ZA202103080B (en) 2023-03-29
IL266746A (en) 2019-07-31
BR112019010342A2 (pt) 2019-10-22
CN110114463A (zh) 2019-08-09
TW202313978A (zh) 2023-04-01
RU2761667C2 (ru) 2021-12-13

Similar Documents

Publication Publication Date Title
US11725207B2 (en) Serpina1 iRNA compositions and methods of use thereof
AU2024200717B2 (en) Factor XII (Hageman Factor) (F12), Kallikrein B, plasma (Fletcher Factor) 1 (KLKB1), and Kininogen 1 (KNG1) iRNA compositions and methods of use thereof
US11052103B2 (en) Patatin-like phospholipase domain containing 3 (PNPLA3) iRNA compositions and methods of use thereof
AU2019239971A1 (en) 17beta-hydroxysteroid dehydrogenase type 13 (HSD17b13) iRNA compositions and methods of use thereof
WO2017100542A1 (en) Sterol regulatory element binding protein (srebp) chaperone (scap) irna compositions and methods of use thereof
WO2016209862A1 (en) Glucokinase (gck) irna compositions and methods of use thereof
AU2015217301A1 (en) Ketohexokinase (KHK) iRNA compositions and methods of use thereof
CA2948381A1 (en) Angiotensinogen (agt) irna compositions and methods of use thereof
WO2013163430A2 (en) Serpinc1 irna compositions and methods of use thereof
WO2014190137A1 (en) SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
EP3853364A1 (en) Ketohexokinase (khk) irna compositions and methods of use thereof
EP3714054A1 (en) Serum amyloid p component (apcs) irna compositions and methods of use thereof
WO2021154941A1 (en) Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als)
EP4127171A2 (en) Compositions and methods for silencing dnajc15 gene expression
WO2025250680A1 (en) Solute carrier family 27 member 5 (slc27a5) irna compositions and methods of use thereof
EP4051796A1 (en) Compositions and methods for silencing dnajb1-prkaca fusion gene expression
NZ753769B2 (en) Serpina1 iRNA compositions and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17822812

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3044562

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 122023000705

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2019547592

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019010342

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017363604

Country of ref document: AU

Date of ref document: 20171121

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2019/0005992

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 20197018069

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017822812

Country of ref document: EP

Effective date: 20190624

WWP Wipo information: published in national office

Ref document number: NC2019/0005992

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112019010342

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190521

WWG Wipo information: grant in national office

Ref document number: NC2019/0005992

Country of ref document: CO

WWW Wipo information: withdrawn in national office

Ref document number: NC2019/0005992

Country of ref document: CO

Ref document number: 753666

Country of ref document: NZ