WO2018097593A2 - Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도 - Google Patents

Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도 Download PDF

Info

Publication number
WO2018097593A2
WO2018097593A2 PCT/KR2017/013340 KR2017013340W WO2018097593A2 WO 2018097593 A2 WO2018097593 A2 WO 2018097593A2 KR 2017013340 W KR2017013340 W KR 2017013340W WO 2018097593 A2 WO2018097593 A2 WO 2018097593A2
Authority
WO
WIPO (PCT)
Prior art keywords
mam
protein
calcium
fluorescent
specific
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/013340
Other languages
English (en)
French (fr)
Other versions
WO2018097593A3 (ko
WO2018097593A9 (ko
Inventor
박상기
서영준
김승현
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
POSTECH Academy Industry Foundation
Original Assignee
POSTECH Academy Industry Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020170154218A external-priority patent/KR102020122B1/ko
Application filed by POSTECH Academy Industry Foundation filed Critical POSTECH Academy Industry Foundation
Priority to US16/316,087 priority Critical patent/US11474108B2/en
Publication of WO2018097593A2 publication Critical patent/WO2018097593A2/ko
Publication of WO2018097593A3 publication Critical patent/WO2018097593A3/ko
Publication of WO2018097593A9 publication Critical patent/WO2018097593A9/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH

Definitions

  • the present invention relates to MAM (Mitochondria-Associated endoplasmic reticulum Membrane) specific fluorescent calcium sensor and its use.
  • MAM Mitochondria-Associated endoplasmic reticulum Membrane
  • Calcium ions are one of the important signal transduction agents involved in various physiological processes in cells.
  • cells In order to activate the signaling system sensitively to small stimuli from the outside, cells usually maintain a low concentration of calcium ions in the cytoplasm at around 100 nM. It dynamically adjusts, causing rapid changes in my specific micro compartments.
  • cells are equipped with various types of calcium ion channels and calcium ion responsive signaling materials in cell membranes and organelles.
  • ER and mitochondria play an important role as the backbone of calcium ion signaling system as well as the role of intracellular calcium ion reservoir.
  • MAM mitochondrial calcium
  • the present inventors have developed a MAM-specific calcium ion sensor material that can directly fluoresce the movement of calcium ions through the MAM, using the physical properties of the MAM formed by the ER and the mitochondria at a distance of 10 nm to 25 nm. As a result of intensive research, the present invention has been devised.
  • an object of the present invention is (a) a first fluorescent complementarity structure in which a linker peptide and a fragment of a calcium ion reactive fluorescent sensor protein are in turn bonded to a fragment of an ER (Endoplasmic Reticulum) target protein, and (b) a mitochondria.
  • a MAM specific fluorescent calcium sensor comprising a second fluorescent complementarity structure in which a linker peptide and a fragment of a calcium ion reactive fluorescent sensor protein are in turn bonded to a fragment of a target protein.
  • the ER target protein is characterized in that SAC1 (suppressor of actin 1).
  • the fragment of the SAC1 protein is characterized in that consisting of the 587 th amino acid from the 521 th amino acid of the full-length protein SAC1.
  • the mitochondrial target protein is characterized in that AKAP1 (A Kinase Anchoring Protein 1).
  • the fragment of AKAP1 protein is characterized in that consisting of the 63rd amino acid from the 34th amino acid of the AKAP1 full-length protein.
  • the mitochondrial target protein is characterized in that MFN1 (Mitofusin 1).
  • the fragment of the SAC1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.
  • the fragment of AKAP1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the MFN1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3.
  • the linker peptide is characterized in that the base sequence of SEQ ID NO: 4 is encoded by a polynucleotide is repeated 1 to 8 times.
  • the linker peptide is characterized in that the base sequence of SEQ ID NO: 4 is encoded by a polynucleotide is repeated 2 to 4 times.
  • the calcium ion reactive fluorescent sensor protein is characterized in that the split (Clit) GCaMP protein.
  • the split GCaMP protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5.
  • the split GCaMP protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6.
  • the present invention also provides an expression vector comprising a polynucleotide encoding the first fluorescent complementarity construct.
  • the present invention also provides an expression vector comprising a polynucleotide encoding the second fluorescent complementarity construct.
  • the present invention provides a MAM-specific calcium detection method using the Mitochondria-Associated endoplasmic reticulum Membrane (MAM) -specific fluorescent calcium sensor.
  • MAM Mitochondria-Associated endoplasmic reticulum Membrane
  • the present invention in order to prove calcium migration through MAM, it is possible to overcome the limitations of the conventional method in which the conventional ER and mitochondria were measured by measuring the calcium ion concentrations in the respective contexts, and the calcium ions were moved. By measuring the concentration directly in the passageway, it is possible to exclude the effect on calcium ion changes through the myriad other calcium ion channels present in the mitochondria, thereby providing a simple and accurate MAM specific calcium ion sensor.
  • Figure 1a is a schematic diagram of the design process of the MAM specific fluorescent calcium sensor of the present invention
  • Figure 1b is a schematic diagram showing the operation principle of the MAM specific fluorescent calcium sensor of the present invention.
  • FIG. 2 is a schematic diagram showing the difference between the MAM-specific fluorescent calcium sensor of the present invention and the conventional method.
  • Figure 3a is the structure of the FOS / JUN leucine zipper nucleic acid molecule for experimental confirmation
  • Figure 3b is a schematic diagram showing the separation of candidate genes of the split GCaMP (split GCaMP) of the present invention.
  • Figure 4 shows the fluorescence response to calcium ion stimulation of split GCaMP expressed by candidate genes of split GCaMP of the present invention.
  • FIG. 5 shows the results obtained by time-lapse imaging and calcium quantification of calcium ion stimulation of spGCaMP144 / 149, which is the most effective combination in the isolated GCaMP candidate group of the present invention.
  • 6a and 6b show recombinant expression vectors for the MAM specific fluorescent label of the present invention.
  • Figure 7a is compared with the conventional ER / mitochondrial fluorescent label by observing the intracellular fluorescence pattern to confirm the effectiveness of the MAM specific fluorescent label of the present invention
  • Figure 7b is its co-localization coefficient (Mander's Coefficients )
  • FIG. 7C shows the result of fluorescence line analysis thereof.
  • 8A and 8B show recombinant expression vectors of respective fluorescent complementarity constructs constituting the MAM specific fluorescent calcium sensor of the present invention.
  • FIG. 9 is a result of photographing calcium ion stimulation reactivity by time-lapse imaging technique after transfection of HEK293 cells with the recombinant expression vector of FIG. 8 to confirm calcium reactivity of the MAM-specific fluorescent calcium sensor protein of the present invention. It is the result of numerical quantification.
  • the present invention relates to (a) a first fluorescent complementarity structure in which a fragment of an ER (Endoplasmic Reticulum) target protein is linked to a fragment of a linker peptide and a calcium ion reactive fluorescent sensor protein, and (b) a fragment of a mitochondria target protein.
  • a MAM specific fluorescent calcium sensor comprising a second fluorescent complementarity structure in which a linker peptide and a fragment of a calcium ion reactive fluorescent sensor protein are in turn bound (see FIGS. 1A and 1B).
  • ER-targeted fluorescent calcium ion sensor proteins and mitochondria were used to measure the migration of calcium ions through MAM as a major pathway of calcium ion transfer between ER and mitochondria, and thus the increase in calcium ion concentration in mitochondria.
  • a targeted fluorescent calcium ion sensor protein there is a method of measuring calcium concentration changes in ER and mitochondria, and integrating them to infer calcium ion migration through MAM (see FIG. 2).
  • the bi-molecule fluorescence complementarity (BiFC) system is applied to the protein fragment complementation (protein fragment complementation) of the protein fragments (fluorescent protein) by splitting the fluorescent protein into N-terminal and C-terminal fragments after the two proteins to examine the interaction When the two proteins are closer to each other to interact with each other and then the two fragments of the fluorescent protein are combined to analyze the fluorescence generated when the intact fluorescent protein is formed, in the present invention, MAM-specific fluorescent calcium sensing For the first time this BiFC technique was introduced.
  • the ER target protein constituting the first fluorescent complementarity construct is not particularly limited as long as it can specifically target ER, for example, alnexin, IP3R (inositol 1,4,5-triphosphate receptor), and the like. It may be used but is preferably SAC1 (suppressor of actin 1).
  • the fragment of the SAC1 protein may be composed of the 587 th amino acid from the 521 th amino acid of the SAC1 full-length protein, the base sequence of SEQ ID NO: 1, or 60%, 70%, 80%, 90%, 95% or more of the phase It can be encoded by a polynucleotide consisting of a nucleotide sequence having the same identity.
  • the mitochondrial target protein constituting the second fluorescent complementarity structure is not particularly limited as long as it can specifically target mitochondria, for example, a translocase of outer mitochondrial membrane 20 (TOM20) and a voltage dependent anion channel (VDAC1). 1) and the like, but preferably AKAP1 (A Kinase Anchoring Protein 1) or MFN1 (Mitofusin 1).
  • the fragment of AKAP1 protein may be composed of the 63rd amino acid from the 34th amino acid of the AKAP1 full-length protein, the base sequence of SEQ ID NO: 2, or 60%, 70%, 80%, 90%, 95% or more of the phase It can be encoded by a polynucleotide consisting of a nucleotide sequence having the same identity.
  • the MFN1 protein may be encoded by a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence having 60%, 70%, 80%, 90%, 95% or more homology thereto.
  • the linker peptide is not limited as long as it can link the target protein to the split GCaMP, for example, the nucleotide sequence of SEQ ID NO: 4, or 60%, 70%, 80%, 90% thereof.
  • a base sequence having 95% or more homology may be encoded by a polynucleotide which is repeated 1 to 8 times, preferably 2 to 4 times.
  • percent sequence homology means the degree of identity between any given sequence and the subject sequence.
  • the calcium ion reactive fluorescent sensor protein is a fluorescent protein that can be used in the BiFC assay for analyzing protein-protein interaction, and dimerization or oligomerization in cells, calcium
  • the type is not particularly limited as long as it can measure fluorescence in response to ions.
  • the calcium ion reactive fluorescent sensor protein may use GCaMP, PeriCaM, cameleon, and the like, and may be designed in various sizes according to the type, property, stability, and fluorescence intensity of the protein.
  • the calcium ion reactive fluorescent sensor protein is a GCaMP (fluorescent calcium indicator) fragment encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 or 6.
  • GCaMP is a calcium ion reactive fluorescent sensor protein that fuses calmodulin, a structure that changes in response to calcium ions, and green fluorescent protein (GFP).
  • the present invention also provides a recombinant expression vector for expressing an ER or mitochondrial target protein in the form of a fluorescent protein and a fusion protein through a linker peptide.
  • a "vector” may be any substance capable of delivering and expressing a nucleic acid molecule in a host cell or subject.
  • the vector can be a replicon, such as a plasmid, phage, or cosmid, into which a PCR product or any nucleic acid fragment that is introduced into the cell and integrated into the cell genome can be inserted.
  • vectors can be replicated when combined with suitable control elements.
  • Vector backbones suitable for use in the present invention may be prepared to be expressed by a promoter that exhibits high expression efficiency in mammalian cells, and may include, for example, a CMV promoter.
  • the pEGFP-N1 and pEGFP-C3 vectors disclosed in FIGS. 6A and 6B can be used as the backbone.
  • the method for producing a fusion gene by cloning the desired gene in the vector backbone for example, blunt-ended termini or stagger-ended termini for ligation. Restriction enzyme cleavage to provide appropriate ends, filling of cohesive ends as needed, alkaline phosphatase treatment to avoid undesirable binding, and enzyme ligation can be used.
  • the target protein-linker peptide is expressed in the form of a fusion protein expressed as a polypeptide through peptide bonds with the N-terminal or C-terminal region of the calcium ion reactive fluorescent sensor protein, and the linker peptide is expressed in C of the fluorescent protein. It can be bound to both the terminal or the N-terminus, and thus can be expressed in the form of (calcium ion reactive fluorescent sensor protein terminal region) -linker or linker- (calcium ion reactive fluorescent sensor protein terminal region).
  • the recombinant expression vector of the present invention is transformed into cells and cultured, thereby expressing the protein in the cell and measuring the fluorescence in response to MAM specific calcium, thereby targeting a specific site within the cell and protein-protein interactions. It can be confirmed that can be accurately analyzed. In this case, the fluorescence can be measured using a fluorescence microscope or a confocal microscope.
  • the MAM specific fluorescent calcium sensor by using the MAM specific fluorescent calcium sensor, it is possible to provide a method for detecting MAM specific calcium and measuring MAM specific calcium concentration.
  • amplification of the leucine zipper sequence of the mouse Fos gene (FBJ osteosarcoma oncogene, Mus musculus, Gene ID: 14281) (279 bp gene sequence corresponding to amino acid sequence 118-210) is performed.
  • the Fos Leucine zipper sequence of the gene was inserted.
  • a mouse cDNA library was used as a template, and PCR was performed using the following primers.
  • Fos- (118aa-210aa) forward primer 5'-CCG GGA ATT CTG GGC AGA GCG CAG AGC ATC G-3 '
  • Fos- (118aa-210aa) reverse primer 5'-CGC GGA TCC TCA AAG GTC ATC GGG GAT CTT GCA G-3 '
  • the amplified DNA was treated with EcoR I and BamH I restriction enzymes and inserted into pEGFP-C3 vector cut with Eco R I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-Fos (118aa-210aa) vector.
  • a leucine zipper sequence (jun protooncogene, Mus musculus, Gene ID: 16476) of the leucine zipper sequence (257 th to 257) is based on a pEGFP-C3 vector.
  • the 186 bp gene sequence corresponding to the 318th amino acid sequence was amplified and inserted as the Jun leucine zipper sequence of the recombinant gene.
  • a mouse cDNA library was used as a template, and PCR was performed using the following primers.
  • Jun- (257aa-318aa) forward primer 5'-CCG GAA TTC TGA AGG CAG AGA GGA AGC GCA TG-3 '
  • the amplified DNA was treated with EcoR I and BamH I restriction enzymes and inserted into pEGFP-C3 vector cut with Eco R I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-Jun (257aa-318aa) vector.
  • the following four combination vectors for the seven isolated GCaMP genes are derived to derive the optimal combination of the isolated GCaMP genes exhibiting the fluorescence and calcium ion reactivity characteristics of GCaMP. was produced.
  • the gene corresponding to the amino terminal (N-terminus) based on the protein sequence of GCaMP is pEGFP-C3-Fos (118aa-210aa) vector, and the gene corresponding to the carboxy terminus (C-terminus) is pEGFP-C3-Jun It was replaced with the EGFP gene of the (257aa-318aa) vector (see FIGS. 3A and 3B).
  • PEGFP-C3-Fos (118aa-210aa) vector obtained by cutting the EGFP gene fragment with AgeI and BglII restriction enzyme using T4 ligase after treatment with the corresponding primer of each combination using the primer of GCaMP6s as a template pEGFP-C3-Jun (257aa-318aa) vectors were inserted respectively.
  • HEK293 cells incubated for 12 hours on a glass-bottomed dish were transfected with the four gene combinations prepared in Example 1 according to the manufacturer's protocol using lipofectamine 2000 reagent.
  • HEK293 cells incubated for 24 hours at 37 ° C. and 5% CO 2 in DMEM medium containing 10% FBS (Fetal Bovine Serum) were subjected to calcium-free imaging buffer (145 mM NaCl, After replacement with 2.5 mM KCl, 10 mM glucose, 10 mM HEPES pH 7.4, 1 mM MgCl 2 ), timelapse imaging experiments were performed at 1 second intervals using a fluorescence microscope.
  • calcium-free imaging buffer 145 mM NaCl
  • Stimulators for the calcium reaction were treated with ionomycin (Sigma-aldrich) and CaCl 2 aqueous solution to a final working concentration of 10 ⁇ M and 1 mM, respectively.
  • the spGCaMP144 and spGCaMP149 react with calcium ions to produce fluorescence only when the combination of spGCaMP144 and spGCaMP149 approaches proximity with similar reactivity to GCaMP6. It was confirmed that it can be used as a bimolecular fluorescent calcium sensor.
  • a 90 base pair gene sequence corresponding to the mitochondrial targeting sequence (34-63 amino acid sequence) of the mouse Akap1 gene (A kinase (PRKA) anchor protein 1, Mus musculus, Gene ID: 11640) )
  • PRKA A kinase anchor protein 1, Mus musculus, Gene ID: 11640
  • PCR was performed using primers having the following sequence using the mouse cDNA library as a template.
  • AKAP1- (34aa-63aa) forward primer
  • the amplified DNA was treated with Nhe I and Xho I restriction enzymes and then inserted into pEGFP-N1 vector cut with Nhe I and Xho I restriction enzymes using T4 ligase to prepare pEGFP-N1-AKAP1 (34aa-63aa) vector.
  • PCR was performed using the following primers as a template of the Venus gene.
  • pVenus with EGFP gene substituted with BiFC gene was inserted into pEGFP-N1-AKAP1 (34aa-63aa) vector from which the EGFP gene was cut with BamHI and NotI restriction enzyme using T4 ligase.
  • 155-C) -N1-AKAP1 (34aa-63aa) vector was constructed.
  • the linker sequence of 60 bp in length was used alone or repeatedly as necessary as follows.
  • the synthesized oligo DNA was treated with Xho I, Sal I restriction enzyme and then treated with Xho I restriction enzyme using T4 ligase, pVenus (155-C) -N1-AKAP1 ( PVenus (155-C) -linker-AKAP1 (34aa-63aa) vector was prepared by inserting into the 34aa-63aa) vector (see FIG. 6A).
  • a mouse Mfn1 gene (mitofusin 1, Mus musculus, Gene ID: 67414) was amplified to construct a mitochondrial targeting vector.
  • PCR was performed using primers having the following sequence using the mouse cDNA library as a template.
  • MFN1 forward primer 5'-ccggaattctggcagaaacggtatctccactgaag-3 '
  • MFN1 reverse primer 5'-cgcggatccttaggattctccactgctcggg-3 ’
  • the amplified DNA was treated with EcoR I and BamH I restriction enzymes and then inserted into pEGFP-C3 vector cut with Eco R I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-MFN1 vector.
  • PCR was performed using the following primers as a template of the Venus gene.
  • the amplified DNA was treated with AgeI and BglII restriction enzymes, and then inserted into pEGFP-C3-MFN1 vector, in which the EGFP gene fragment was cut out with AgeI and BglII restriction enzymes using T4 ligase, and pVenus (N where the EGFP genes were substituted with BiFC genes). -172) -C3-MFN1 vector was constructed.
  • Example 3-1 a 60 bp linker sequence was used alone or repeatedly as needed. Oligo DNA synthesized in the same manner as in Example 3-1 was treated with Xho I and Sal I restriction enzymes. Then, pVenus (N-172) -linker-MFN1 vector was prepared by inserting into the pVenus (N-172) -C3-MFN1 vector treated with XhoI restriction enzyme using T4 ligase (see FIG. 6B).
  • a mouse cDNA library was used as a template, and PCR was performed using primers having the following sequences.
  • the amplified DNA was treated with Kpn I and BamH I restriction enzymes and then inserted into pEGFP-C3 vectors cut with Kpn I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-SAC1 (521aa-587aa) vectors.
  • PCR was performed using the following primers as a template of the Venus gene.
  • the amplified DNA was treated with AgeI and BglII restriction enzymes, and then inserted into pEGFP-C3-SAC1 (521aa-587aa) vector, which was obtained by cutting the EGFP gene with AgeI and BglII restriction enzymes using T4 ligase.
  • a substituted pVenus (149-C) -C3-SAC1 (521aa-587aa) vector was constructed.
  • Example 3-1 a 60 bp linker sequence was used alone or repeatedly as needed. Oligo DNA synthesized in the same manner as in Example 3-1 was treated with Xho I and Sal I restriction enzymes. Then, pVenus (149-C) -linker-SAC1 (521aa-587aa) vector was prepared by inserting the pVenus (149-C) -C3-SAC1 (521aa-587aa) vector treated with XhoI restriction enzyme using T4 ligase. (See FIG. 6B).
  • the pVenus (N-172) -linker-MFN1 vector, pVenus (149-C) -linker-SAC1 (521aa-587aa) ) were transfected into HEK293 cells with mitochondrial fluorescent marker gene vector and ER fluorescent marker gene vector, and then microscopic samples were prepared.
  • MAM specific bi-molecular fluorescent labeling material using these targeting sequences in the cell selectively selects the junction (ER) of the ER and mitochondria It was confirmed that it was labeled.
  • the fluorescence of the two-molecule-type MAM-specific fluorescent labeling material is extracted by extracting the overlapping fluorescence of the ER-labeled fluorescent material and the mitochondrial-labeled fluorescent material, respectively, which label the ER substrate and the mitochondrial substrate, according to the method used in the existing MAM research.
  • Co-localization coefficients with patterns were analyzed.
  • the mitochondrial and ER fluorescence overlaps with each other in the irradiated cells. It was confirmed that they were overlapping to a higher level.
  • the MAM-specific di-molecule fluorescence of the present invention is obtained by the MAM present at the boundary between the mitochondria (blue fluorescence) and the ER (red fluorescence) (where the solid line of the graph intersects, indicated by an arrow). It was confirmed that the labeling substance labeled very accurately.
  • this PCR product was treated with BamHI and NotI restriction enzymes, and then pVenus (155-C) -linker-AKAP1 (34aa-) cut out the Venus (155-C) gene portion with BamHI and NotI restriction enzymes using T4 ligase.
  • pVenus (155-C) -linker-AKAP1 (34aa-) cut out the Venus (155-C) gene portion with BamHI and NotI restriction enzymes using T4 ligase.
  • 63aa) AKAP1 (34aa-63aa) -linker-spGC144 vector was constructed by inserting into the vector (see FIG.
  • the GCaMP6s gene was PCR amplified using the following primers used in Combination 1 of Examples 1-2 as a template.
  • the PCR product was treated with AgeI and BglII restriction enzymes, and then inserted into pVenus (N-172) -linker-MFN1 vector, in which the Venus (N-172) gene was cut with AgeI and BglII restriction enzymes using T4 ligase.
  • SpGC144-linker-MFN1 vector was constructed.
  • pVenus (149-C) -linker-SAC1 (521aa-) was digested with the PCR product by AgeI and BglII restriction enzymes, and then the Venus (149-C) gene fragment was cut with AgeI and BglII restriction enzymes using T4 ligase.
  • SpGC149-linker-SAC1 (521aa-587aa) vector was constructed by inserting into 587aa) vector.
  • HEK293 cells incubated for 24 hours at 37 ° C. and 5% CO 2 in DMEM medium containing 10% FBS (Fetal Bovine Serum) were subjected to calcium-free imaging buffer (145 mM NaCl, 2.5). After replacement with mM KCl, 10 mM glucose, 10 mM HEPES pH 7.4, 1 mM MgCl 2 ), timelapse imaging experiments were performed at 1 second intervals using a fluorescence microscope.
  • FBS Fetal Bovine Serum
  • Stimulators for the MAM-specific calcium response were treated with ionomycin (Sigmaaldrich) and IP3 (inositol-1,4,5-trisphosphate) to a final working concentration of 10 ⁇ M, or CaCl 2 to a final working concentration of 1 mM. .
  • MAM-specific calcium ion sensor protein MAM-spGCaMP
  • the MAM-specific calcium ion sensor according to the present invention can easily and accurately check the change in calcium ions by measuring the calcium concentration directly in the passage through which calcium ions move, overcoming the limitations of the prior art, and detecting the change in calcium ions in vivo. It may be useful in various basic and clinical studies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Inorganic Chemistry (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

본 발명은, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광 칼슘 센서 및 이의 용도에 관한 것이다. 본 발명에 의하면, MAM을 통한 칼슘 이동을 증명하기 위하여 종래 ER과 미토콘드리아 내부의 칼슘 이온 농도를 각각 측정하여 정황적으로 현상을 설명하여야 했던 기존 방식의 한계를 극복할 수 있고, 칼슘 이온이 이동하는 통로에서 직접 농도를 측정함으로써 미토콘드리아에 존재하는 무수한 다른 칼슘 이온 채널을 통한 칼슘 이온 변화에 대한 영향을 배제할 수 있기 때문에, 간편하고도 정확한 MAM 특이적 칼슘 이온 센서를 제공할 수 있다.

Description

ＭＡＭ 특이적 형광 칼슘 센서 및 이의 용도
본 발명은, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광 칼슘 센서 및 이의 용도에 관한 것이다.
칼슘 이온은 세포 내에서 다양한 생리과정에 참여하는 중요 신호 전달 물질 중의 하나이다. 외부로부터의 작은 자극에도 민감하게 신호 체계를 작동시키기 위하여 세포는 세포질 내의 칼슘 이온 농도를 보통 100nM 내외의 낮은 농도로 유지하지만, 자극 시에는 1∼2mM 수준으로 급격하게 증가시켜 신호를 전달하거나, 세포 내 특정 미세 구획에서 빠른 변화를 일으키는 등 다이나믹하게 조절한다. 이를 위해 세포는 세포막, 세포소기관 등에 다양한 종류의 칼슘 이온 채널, 칼슘 이온 반응성 신호물질을 갖추고 있다.
칼슘 이온은 특정 채널을 통해 세포로 유입된 후 신호 전달 체계를 작동시키고 즉시 ER, 미토콘드리아 등의 세포 소기관에 흡수된다. 이 과정에서 ER과 미토콘드리아가 세포 내 칼슘 이온 저장소의 역할은 물론 또 다른 칼슘 이온 신호전달 체계의 중추로서 중요한 역할을 담당하고 있음이 알려져 있다.
한편, 세포 소기관의 역할에 대한 이해가 깊어짐에 따라 최근 ER과 미토콘드리아가 서로 근접거리에서 접합부를 형성하여 직접 칼슘 이온을 교환하는 MAM의 존재가 발견되었다. 현재 MAM이 칼슘 이온의 교환 외에도 지질(lipid) 교환, 신호 물질 전달 등의 기능을 가지고 있는 중요 기능성 구획이며, 실제로 IP3 수용체(inositol-1,4,5-trisphosphate receptors), ryanodine 수용체, 미토콘드리아 칼슘 수송체(mitochondrial calcium unipoter) 등 주요 칼슘 이온 채널 등이 MAM에 모여 있다는 것이 밝혀졌다(Biochim Biophys Acta, 2009. 1787(11): p. 1342-51). 이러한 연구결과는 ER과 미토콘드리아 두 세포 소기관이 보다 직접적인 상호작용을 통하여 주요 역할을 수행하고 있다는 것을 의미한다.
이와 같이 MAM의 존재 및 기능이 일부 밝혀졌음에도 불구하고, ER과 미토콘드리아가 10∼25nm 정도의 초근접 거리에 접근하는 미세 구획을 관찰할 수 있는 실험 기술은 아직까지 미비한 실정이다. 이는 막으로 명확하게 구분되는 미토콘드리아 ER 등의 세포 소기관과는 달리 경계가 명확하지 않으며 다이나믹하게 조절되는 MAM의 물리적 특성에 기인하는 것이다. 현재까지 MAM의 구조와 이를 통한 칼슘 이온 등 신호 물질의 전달을 조절하는 기작이나 이를 감지할 수 있는 센서 등에 대해서는 알려진 바가 거의 없다.
이에, 본 발명자들은 ER과 미토콘드리아가 10nm∼25nm 거리로 근접하여 형성되는 MAM의 물리적인 특성을 이용하여, MAM을 통한 칼슘 이온의 이동을 직접 형광으로 나타낼 수 있는 MAM 특이적 칼슘 이온 센서 물질을 개발하고자 예의 연구한 결과, 본 발명을 고안하게 되었다.
따라서, 본 발명의 목적은, (a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및 (b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체를 포함하는, MAM 특이적 형광 칼슘 센서를 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은, 하기의 구조체를 포함하는, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광 칼슘 센서를 제공한다.
(a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및
(b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체.
본 발명의 일 구체예로서, 상기 ER 표적 단백질은 SAC1(suppressor of actin 1)인 것을 특징으로 한다.
본 발명의 다른 구체예로서, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 미토콘드리아 표적 단백질은 AKAP1(A Kinase Anchoring Protein 1)인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 미토콘드리아 표적 단백질은 MFN1(Mitofusin 1)인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 SAC1 단백질의 단편은 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 AKAP1 단백질의 단편은 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 MFN1 단백질은 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 링커 펩티드는 서열번호 4의 염기서열이 1 내지 8번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 링커 펩티드는 서열번호 4의 염기서열이 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 칼슘 이온 반응성 형광 센서 단백질은 분리형(split) GCaMP 단백질인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 분리형(split) GCaMP 단백질은 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 분리형(split) GCaMP 단백질은 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
또한, 본 발명은 상기 제 1 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터를 제공한다.
또한, 본 발명은 상기 제 2 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터를 제공한다.
또한, 본 발명은 상기 MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광 칼슘 센서를 이용한, MAM 특이적 칼슘 감지 방법을 제공한다.
본 발명에 의하면, MAM을 통한 칼슘 이동을 증명하기 위하여 종래 ER과 미토콘드리아 내부의 칼슘 이온 농도를 각각 측정하여 정황적으로 현상을 설명하여야 했던 기존 방식의 한계를 극복할 수 있고, 칼슘 이온이 이동하는 통로에서 직접 농도를 측정함으로써 미토콘드리아에 존재하는 무수한 다른 칼슘 이온 채널을 통한 칼슘 이온 변화에 대한 영향을 배제할 수 있기 때문에, 간편하고도 정확한 MAM 특이적 칼슘 이온 센서를 제공할 수 있다.
도 1a는 본 발명의 MAM 특이적 형광 칼슘 센서의 고안 과정에 대한 모식도이고, 도 1b는 본 발명의 MAM 특이적 형광 칼슘 센서의 작동원리를 나타낸 모식도이다.
도 2는 본 발명의 MAM 특이적 형광 칼슘 센서과 기존 방식의 차이를 나타낸 모식도이다.
도 3a는 실험적 확인을 위한 FOS/JUN 류신 지퍼 삽입 핵산 분자의 구조를, 도 3b는 본 발명의 분리형 GCaMP(split GCaMP)의 후보 유전자들의 분리기점을 나타낸 모식도이다.
도 4는 본 발명의 분리형 GCaMP(split GCaMP)의 후보 유전자들에 의해 발현된 split GCaMP의 칼슘 이온 자극에 대한 형광 반응성을 나타낸 것이다.
도 5는 본 발명의 분리형 GCaMP 후보군에서 가장 유효한 조합인 spGCaMP144/149의 칼슘 이온 자극 반응성을 time-lapse imaging 기법으로 촬영한 결과 및 이를 수치적으로 정량화한 결과이다.
도 6a 및 도 6b는 본 발명의 MAM 특이적 형광 표지물질에 대한 재조합 발현벡터를 나타낸 것이다.
도 7a는 본 발명의 MAM 특이적 형광 표지물질의 유효성을 확인하기 위해 세포내 형광 패턴을 관찰하여 기존의 ER/미토콘드리아 형광 표지 물질과 비교한 결과이고, 도 7b는 이의 co-localization coefficient(Mander's Coefficients)를 분석한 결과이고, 도 7c는 이의 형광 line analysis를 수행한 결과이다.
도 8a 및 도 8b는 본 발명의 MAM 특이적 형광 칼슘 센서를 구성하는 각 형광 상보성 구조체들의 재조합 발현 벡터를 나타낸 것이다.
도 9는 본 발명의 MAM 특이적 형광 칼슘 센서 단백질의 칼슘 반응성 확인을 위해 도 8의 재조합 발현벡터를 HEK293 세포에 트랜스펙션한 후 칼슘 이온 자극 반응성을 time-lapse imaging 기법으로 촬영한 결과 및 이를 수치적으로 정량화한 결과이다.
본 발명은, (a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및 (b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체를 포함하는, MAM 특이적 형광 칼슘 센서를 제공한다(도 1a 및 도 1b 참조).
종래, 칼슘 이온의 농도를 측정할 수 있는 유전 물질들이 발견된 이래로 많은 연구그룹에서 세포 내 특정 세포 소기관에서의 칼슘 농도를 측정하기 위해, 다양한 유전학적 방법을 응용하여 ER, 미토콘드리아, 리소좀 등 막구조를 가진 세포 소기관을 대상으로 연구를 진행하고 있다.
예를 들면, ER과 미토콘드리아 사이의 칼슘 이온 전달의 주요 통로로서 MAM을 통한 칼슘 이온의 이동 현상과 그에 따른 미토콘드리아 내 칼슘 이온 농도 상승을 측정하기 위하여, ER로 표적화된 형광 칼슘 이온 센서 단백질과 미토콘드리아로 표적화된 형광 칼슘 이온 센서 단백질을 이용하여 ER과 미토콘드리아의 칼슘 농도 변화를 각각 측정한 뒤 이를 종합하여 MAM을 통한 칼슘 이온 이동 현상을 유추해내는 방법이 있다(도 2 참조).
그러나, 이러한 방법은 여러 단계에 걸쳐 실험을 진행해야 한다는 불편함이 있을 뿐만 아니라 정확하게는 미토콘드리아로의 칼슘 이온 유입만을 입증할 수 있을 뿐 무수히 많은 미토콘드리아 칼슘 이온 통로 중 특정하게 'MAM을 통하여' ER의 칼슘 이온이 미토콘드리아로 전달되고 있음을 직접적으로 증명해낼 수 없었다. 즉, MAM 외에도 다양한 칼슘 이온 채널이 존재하는 ER과 미토콘드리아의 특성상 MAM 외의 다른 채널을 통한 칼슘 이온의 이동을 배제할 수 없기 때문에, MAM을 통과하는 칼슘 이온의 이동을 직접적으로 증명해낼 수 없다는 한계가 있다.
본 발명에서, 이분자 형광 상보성(BiFC) 시스템은 단백질 절편의 상보작용(protein fragment complementation)을 형광 단백질에 적용시켜 형광 단백질을 N-말단 및 C-말단 절편으로 나눈 후 상호작용을 알아보고자 하는 두 단백질과 함께 각각 발현되게 한 다음, 두 단백질이 상호작용을 하기 위해 가까워질 경우 형광단백질의 두 절편이 합쳐져 온전한 형광단백질이 형성될 때 나타나는 형광을 분석하는 툴로서, 본 발명에서는 MAM 특이적 형광 칼슘 센싱을 위하여 이러한 BiFC 기법을 처음으로 도입하였다.
본 발명에서, 제 1 형광 상보성 구조체를 구성하는 ER 표적 단백질은 ER에 특이적으로 표적화할 수 있는 것이면 특별한 제한은 없으며, 예를 들면 alnexin, IP3R(inositol 1,4,5-triphosphate receptor) 등을 이용할 수 있으나, 바람직하게는 SAC1(suppressor of actin 1)이다.
이때, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것일 수 있으며, 서열번호 1의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다.
본 발명에서, 제 2 형광 상보성 구조체를 구성하는 미토콘드리아 표적 단백질은 미토콘드리아에 특이적으로 표적화할 수 있는 것이면 특별한 제한은 없으며, 예를 들면 TOM20(translocase of outer mitochondrial membrane 20), VDAC1(voltage dependent anion channel 1) 등을 이용할 수 있으나, 바람직하게는 AKAP1(A Kinase Anchoring Protein 1) 또는 MFN1(Mitofusin 1)이다.
이때, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것일 수 있으며, 서열번호 2의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다. 또한 상기 MFN1 단백질은 서열번호 3의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다.
본 발명에서, 상기 링커 펩티드는 상기 표적 단백질을 상기 분리형(split) GCaMP에 연결할 수 있는 것이면 제한이 없으며, 예를 들면 서열번호 4의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열이 1 내지 8번, 바람직하게는 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩될 수 있다.
이때, "서열 상동성 퍼센트"는 임의의 주어진 서열과 대상 서열 사이의 동일성의 정도를 의미한다.
본 발명에서, 상기 칼슘 이온 반응성 형광 센서 단백질은 세포에서 단백질-단백질 상호작용(interaction), 및 다이머화(dimerization) 또는 올리고머화(oligomerization)를 분석하기 위한 BiFC 분석법에 사용될 수 있는 형광 단백질로서, 칼슘 이온에 반응하여 형광을 측정할 수 있는 것이라면 그 종류는 특별히 제한되지 않는다. 바람직하게는 상기 칼슘 이온 반응성 형광 센서 단백질은 GCaMP, PeriCaM, cameleon 등을 이용할 수 있으며, 단백질의 종류, 특성, 안정성, 형광 강도에 따라 다양한 크기로 디자인될 수 있다.
더욱 바람직하게는, 상기 칼슘 이온 반응성 형광 센서 단백질은 서열번호 5 또는 6의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 GCaMP(fluorescent calcium indicator) 단편이다. GCaMP는 칼슘 이온에 반응하여 구조가 변경되는 칼모듈린(Calmodulin)과 녹색형광단백질인 GFP(green fluorescent protein)를 융합시킨 형태의 칼슘 이온 반응성 형광 센서 단백질이다.
또한, 본 발명에서는 ER 또는 미토콘드리아 표적 단백질을 링커 펩티드를 통하여 형광 단백질과 융합 단백질 형태로 발현시키는 재조합 발현 벡터를 제공한다.
본 발명에서 "벡터"는 숙주 세포 또는 피검체 내에서 핵산 분자를 전달하고 발현할 수 있는 임의의 물질일 수 있다. 따라서, 벡터는 세포내로 도입되고 세포 유전체에 통합되는 PCR 생성물 또는 임의의 핵산 조각이 삽입될 수 있는, 레플리콘(replicon), 예컨대, 플라스미드, 파아지, 또는 코스미드일 수 있다. 일반 적으로, 벡터는 적합한 조절 엘리먼트와 결합된 경우 복제될 수 있다. 본 발명에서 이용에 적합한 벡터 백본은, 포유동물의 세포에서 높은 발현 효율을 보이는 프로모터에 의해 발현되도록 제조될 수 있으며, 예를 들면 CMV 프로모터를 포함할 수 있다. 바람직하게는, 도 6a 및 도 6b에 개시된 pEGFP-N1 및 pEGFP-C3 벡터를 백본으로 이용할 수 있다.
본 발명에서 상기 벡터 백본에 원하는 유전자를 클로닝하여 융합 유전자를 제조하는 방법에 제한은 없으며, 예를 들면 라이게이션을 위한 평활-말단(blunt-ended termini) 또는 스태거-말단(stagger-ended termini), 적절한 말단을 제공하기 위한 제한 효소 절단, 필요에 따라 코헤시브 말단(cohesive ends)의 채움, 바람직하지 않은 결합을 회피하기 위한 알카라인 포스파타아제 처리, 및 효소 라이게이션을 이용할 수 있다.
본 발명에서 상기 표적 단백질-링커 펩티드는 칼슘 이온 반응성 형광 센서 단백질의 N 말단 영역 또는 C 말단 영역과 펩타이드 결합을 통하여 하나의 폴리펩타이드로 발현되는 융합 단백질 형태로 발현되며, 링커 펩티드는 형광 단백질의 C-말단 또는 N-말단 모두에 결합될 수 있으므로, (칼슘 이온 반응성 형광 센서 단백질 말단 영역)-링커 또는 링커-(칼슘 이온 반응성 형광 센서 단백질 말단 영역)의 형태로 발현될 수 있다.
본 발명에서는, 본 발명의 재조합 발현 벡터를 세포에 형질전환하여 배양하여 단백질을 세포내에서 발현시키고 MAM 특이적 칼슘에 반응하는 형광을 측정함으로써, 세포내 특정 위치를 표적화 하고, 단백질-단백질 상호작용을 정확하게 분석가능하다는 것을 확인할 수 있었다. 이때, 형광은 형광 현미경 또는 콘포컬 현미경 등을 이용하여 측정할 수 있다.
또한, 본 발명에 의하면 상기 MAM 특이적 형광 칼슘 센서를 이용함으로써, MAM 특이적 칼슘을 감지하여 MAM 특이적 칼슘 농도를 측정하는 방법을 제공할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. split GCaMP의 제작
1-1. 실험적 확인을 위한 류신 지퍼 서열(Leucine zipper sequence) 삽입
① Fos 류신 지퍼
pEGFP-C3 벡터를 기반으로, mouse Fos 유전자(FBJ osteosarcoma oncogene, Mus musculus, Gene ID: 14281)의 류신 지퍼 서열(118번째∼210번째 아미노산 서열에 해당하는 279 bp의 유전자 서열)을 증폭하여 이를 재조합 유전자의 Fos 류신 지퍼 서열(Leucine zipper sequence)로서 삽입하였다.
이를 위해 template로 mouse cDNA library를 사용하였고, 다음의 프라이머를 사용하여 PCR을 수행하였다.
Fos-(118aa-210aa) forward primer: 5'-CCG GGA ATT CTG GGC AGA GCG CAG AGC ATC G-3'
Fos-(118aa-210aa) reverse primer: 5'-CGC GGA TCC TCA AAG GTC ATC GGG GAT CTT GCA G-3'
증폭된 DNA는 EcoRⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 EcoRⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-Fos(118aa-210aa) vector를 제작하였다.
② Jun 류신 지퍼
상기 Fos 류신 지퍼 서열에 상호작용할 수 있는 Jun 류신 지퍼 서열 벡터를 제작하기 위하여 pEGFP-C3 벡터를 기반으로, mouse Jun 유전자(jun protooncogene, Mus musculus, Gene ID: 16476)의 류신 지퍼 서열(257번째∼318번째 아미노산 서열에 해당하는 186 bp의 유전자 서열)을 증폭하여 이를 재조합 유전자의 Jun 류신 지퍼 서열(Leucine zipper sequence)로서 삽입하였다.
이를 위해 template로 mouse cDNA library를 사용하였고, 다음의 프라이머를 사용하여 PCR을 수행하였다.
Jun-(257aa-318aa) forward primer: 5'-CCG GAA TTC TGA AGG CAG AGA GGA AGC GCA TG-3'
Jun-(257aa-318aa) reverse primer: 5'-CGC GGA TCC TCA GTG GTT CAT GAC TTT CTG-3'
증폭된 DNA는 EcoRⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 EcoRⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-Jun(257aa-318aa) vector를 제작하였다.
1-2. split GCaMP 후보군 유전자의 제작
공지의 GCaMP6s의 서열과 enhanced GFP(EGFP) 구조를 기반으로, GCaMP의 형광 및 칼슘 이온 반응성 특성을 나타내는 분리형 GCaMP 유전자의 최적 조합을 도출하기 위하여, 7개의 분리형 GCaMP 유전자에 대하여 하기 4종의 조합 벡터를 제작하였다.
각각의 조합에서 GCaMP의 단백질 서열 기준 아미노 말단(N-terminus)에 해당하는 유전자는 pEGFP-C3-Fos(118aa-210aa) vector, 카르복시 말단(C-terminus)에 해당하는 유전자는 pEGFP-C3-Jun(257aa-318aa) vector의 EGFP 유전자와 교체되었다(도 3a 및 3b 참조).
조합 1 (balanced pair)
(spGC149)-Fos(118aa-210aa) vector
spGC-N-terminus forward primer:
5'-gggaccggtgccaccatgggttctcatcatcatcatcatcatg-3'
spGC149 reverse primer:
5'-ggaagatctgacttgtacagctcgtccatgcc-3’
(spGC144)-Jun(257aa-318aa) vector
spGC144 forward primer:
5'-gggaccggtgccaccatggtgagcaagggcgag-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3’
조합 2 (unbalanced pair #1)
(spGC100)-Fos(118aa-210aa) vector
spGC-N-terminus forward primer:
5'-gggaccggtgccaccatgggttctcatcatcatcatcatcatg-3'
spGC100 reverse primer:
5'-ggaagatctgagaagaagatggtgcgctcctg-3’
(spGC105)-Jun(257aa-318aa) vector
spGC105 forward primer:
*5'-gggaccggtgccaccatgtacaagacccgcgccgag-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3’
조합 3 (unbalanced pair #2-1)
(spGC188)-Fos(118aa-210aa) vector
spGC-N-terminus forward primer:
5'-gggaccggtgccaccatgggttctcatcatcatcatcatcatg-3'
spGC188 reverse primer:
5'-ggaagatctgagatgggggtgttctgctgg-3'
(spGC172)-Jun(257aa-318aa) vector
spGC172 forward primer:
5'-gggaccggtgccaccatggacggcggcgtgcagc-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3’
조합 4 (unbalanced pair #2-2)
(spGC188)-Fos(118aa-210aa) vector
spGC-N-terminus forward primer:
5'-gggaccggtgccaccatgggttctcatcatcatcatcatcatg-3'
spGC188 reverse primer:
5'-ggaagatctgagatgggggtgttctgctgg-3'
(spGC199)-Jun(257aa-318aa) vector
spGC199 forward primer:
5'-gggaccggtgccaccatgcactacctgagcgtgcagtcc-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3'
GCaMP6s의 유전자를 template로 하여 각 조합의 해당 primer로 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-Fos(118aa-210aa) vector, pEGFP-C3-Jun(257aa-318aa) vector에 각각 삽입하였다.
실시예 2. split GCaMP의 칼슘 반응성 확인
2-1. 재조합 벡터의 transfection
glass-bottomed dish 위에서 12시간 동안 배양된 HEK293 세포에 상기 실시예 1에서 제작한 4종의 유전자 조합을 lipofectamine 2000 reagent를 이용하여 제조사의 프로토콜에 따라 각각 트랜스펙션(transfection)하였다.
2-2. 형광현미경을 이용한 실시간 관찰
트랜스펙션 이후 10% FBS(Fetal Bovine Serum)를 포함하는 DMEM 배양액에서 37℃, 5% CO2의 배양 조건으로 24시간 배양한 HEK293 세포에 대하여, 배양액을 calcium-free imaging buffer(145 mM NaCl, 2.5 mM KCl, 10 mM glucose, 10 mM HEPES pH 7.4, 1 mM MgCl2)로 교체한 뒤 형광 현미경을 이용하여 1초 간격으로 timelapse imaging 실험을 수행하였다.
칼슘 반응을 위한 자극원으로는 ionomycin(Sigma-aldrich)과 CaCl2 수용액을 각각 final working concentration 10 μM, 1 mM이 되도록 처리하였다.
그 결과, 도 4에 나타낸 바와 같이, 4종의 이분자형 split GCaMP 조합 중에서 spGCaMP144와 spGCaMP149의 조합이 기존의 GCaMP와 같은 방식으로 칼슘 이온에 반응하여 녹색형광을 나타내는 최적의 조합임을 확인하였다.
또한, 실시간 형광 현미경 분석 방법(time-lapse fluorescent microscopy)을 이용하여 (spGC149)-Fos(118aa-210aa) vector와 (spGC144)-Jun(257aa-318aa) vector를 transfection한 세포에서의 칼슘 이온 반응성을 조사하였다. 이때, 실시간 형광 현미경 분석은 10초 단위로 총 150초가량의 실시간 형광변화를 관찰하였다. 여기서 사용된 split GCaMP와 BiFC는 모두 핵(nucleus)으로 표적화하기 위해 상기 실시예 1의 Fos(118aa-210aa), Jun(257aa-318aa) 서열이 사용되었고, 단일 분자로 사용된 GCaMP의 경우 NLS 서열을 3회 반복하여 연결하여 핵 특이적으로 표적화하였으며, GCaMP-NLS 서열은 서열번호 7에 나타낸 바와 같다.
그 결과, 도 5에 나타낸 바와 같이, 기존에 널리 사용되는 GCaMP6와 비슷한 수준의 반응성을 가지면서 spGCaMP144와 spGCaMP149의 조합이 서로 근접거리(proximity)에 접근했을 때에만 칼슘 이온에 반응해 형광을 만들어낼 수 있는 이분자형(bimolecular) 형광 칼슘 센서로 사용될 수 있음을 확인하였다.
실시예 3. MAM 특이적 재조합 핵산 분자 제작
3-1. AKAP1을 이용한 미토콘드리아 표적화 재조합 핵산 분자 제작
① 미토콘드리아 표적화 서열의 삽입
pEGFP-N1 벡터를 기반으로, mouse Akap1 유전자(A kinase (PRKA) anchor protein 1, Mus musculus, Gene ID: 11640)의 미토콘드리아 표적화 서열(34번째~63번째 아미노산 서열에 해당하는 90 base pair의 유전자 서열)을 증폭하여 미토콘드리아 표적화 vector를 제작하였다.
이를 위해 template로 mouse cDNA library를 사용하여 다음과 같은 서열의 프라이머를 사용하여 PCR을 수행하였다.
AKAP1-(34aa-63aa) forward primer:
5'-ctagctagccaccatggcaatccagttgcgttcg-3'
AKAP1-(34aa-63aa) reverse primer:
5'-ccgctcgagttttttacgagagaaaaaccaccaccagcc-3'
증폭된 DNA는 NheⅠ, XhoⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 NheⅠ, XhoⅠ 제한효소로 잘라낸 pEGFP-N1 벡터에 삽입하여 pEGFP-N1-AKAP1(34aa-63aa) vector를 제작하였다.
② 형광단백질 유전자의 교체
Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
Venus155-N1 forward primer:
5'-cgcggatcccaccatgaagcagaagaacggcatcaag-3'
Venus155-N1 reverse primer:
5'-aaatatgcggccgctttacttgtacagctcgtccatgc-3'
BamHⅠ, NotⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 BamHⅠ, NotⅠ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-N1-AKAP1(34aa-63aa) vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(155-C)-N1-AKAP1(34aa-63aa) vector를 제작하였다.
③ 링커 서열의 삽입
다음과 같이 60bp 길이의 링커 서열을 단독으로, 혹은 필요에 따라 반복하여 사용하였다.
linker sequence:
5'-gacccaaccaggtcagcgaattctggagcaggagcaggagcaggagcaatactctcccgt-3'
구체적으로, 다음 서열의 링커 서열을 합성한 후, 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(155-C)-N1-AKAP1(34aa-63aa) vector에 삽입하여 pVenus(155-C)-linker-AKAP1(34aa-63aa) vector를 제작하였다(도 6a 참조).
linker oligo DNA:
5'-ccgctcgag
(gacccaaccaggtcagcgaattctggagcaggagcaggagcaggagcaatactctcccgt)n gtcgac-3'
3-2. MFN1을 이용한 미토콘드리아 표적화 재조합 핵산 분자 제작
① 미토콘드리아 표적화 서열의 삽입
pEGFP-C3 벡터를 기반으로, mouse Mfn1 유전자(mitofusin 1, Mus musculus, Gene ID: 67414)를 증폭하여 미토콘드리아 표적화 vector를 제작하였다.
이를 위해 template로 mouse cDNA library를 사용하여 다음과 같은 서열의 프라이머로 PCR을 수행하였다.
MFN1 forward primer: 5'-ccggaattctggcagaaacggtatctccactgaag-3'
MFN1 reverse primer: 5'-cgcggatccttaggattctccactgctcggg-3’
증폭된 DNA는 EcoRⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 EcoRⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-MFN1 vector를 제작하였다.
② 형광단백질 유전자의 교체
Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
Venus N172-C3 forward primer:
5'-gggaccggtgccaccatggtgagcaagggcgag-3'
Venus N172-C3 reverse primer:
5'-ggaagatctgactcgatgttgtggcggatc-3'
증폭된 DNA는 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-MFN1 vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(N-172)-C3-MFN1 vector를 제작하였다.
③ 링커 서열의 삽입
실시예 3-1에서와 마찬가지로 60 bp 길이의 링커 서열이 단독으로, 혹은 필요에 따라 반복되어 사용되었으며, 실시예 3-1에서와 동일한 방법으로 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(N-172)-C3-MFN1 vector에 삽입하여 pVenus(N-172)-linker-MFN1 vector를 제작하였다(도 6b 참조).
linker oligo DNA:
5'-ccgctcgag
(gacccaaccaggtcagcgaattctggagcaggagcaggagcaggagcaatactctcccgt)n gtcgac-3'
3-3. SAC1을 이용한 ER 표적화 재조합 핵산 분자 제작
① ER 표적화 서열의 삽입
pEGFP-C3 벡터를 기반으로, mouse Sac1 유전자(SAC1; suppressor of actin mutations 1-like (yeast), Mus musculus, Gene ID: 83493)의 ER 표적화 서열(521번째∼587번째 아미노산 서열에 해당하는 204 base pair의 유전자 서열)을 증폭하여 이를 재조합 유전자의 ER 표적화 서열(ER targeting sequence)로서 삽입하였다.
이를 위해 template로 mouse cDNA library를 사용하였고, 다음과 같은 서열의 프라이머를 사용하여 PCR을 수행하였다.
SAC1-(521aa-587aa) forward primer:
5'-cggggtaccgttcctggcgttgcctatcatc-3'
SAC1-(521aa-587aa) reverse primer:
5'-cgcggatcctcagtctatcttttctttctggaccag-3'
증폭된 DNA는 KpnⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 KpnⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-SAC1(521aa-587aa) vector를 제작하였다.
② 형광단백질 유전자의 교체
Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
Venus149C-C3 forward primer:
5'-gggaccggtgccaccatgaacgtctatatcaccgccgac-3'
Venus149C-C3 reverse primer:
5'-ggaagatctgacttgtacagctcgtccatgcc-3'
증폭된 DNA는 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-SAC1(521aa-587aa) vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(149-C)-C3-SAC1(521aa-587aa) vector를 제작하였다.
③ 링커 서열의 삽입
실시예 3-1에서와 마찬가지로 60 bp 길이의 링커 서열이 단독으로, 혹은 필요에 따라 반복되어 사용되었으며, 실시예 3-1에서와 동일한 방법으로 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(149-C)-C3-SAC1(521aa-587aa) vector에 삽입하여 pVenus(149-C)-linker-SAC1(521aa-587aa) vector를 제작하였다(도 6b 참조).
3-4. MAM 표적화 검증
① 현미경 샘플의 제작 및 관찰
본 발명에서 제작된 이분자형 MAM 특이적 형광 표지 물질의 MAM 표적화를 검증하기 위하여, 상기 제작된 pVenus(N-172)-linker-MFN1 vector, pVenus(149-C)-linker-SAC1(521aa-587aa) vector를 미토콘드리아 형광 표지 유전자 vector, ER 형광 표지 유전자 vector와 함께 HEK293 세포에 transfection한 뒤 현미경 샘플을 제작하였다.
이후, 형광 현미경을 이용하여 세포내 형광 패턴을 관찰한 결과, 도 7a에 나타낸 바와 같이, 세포 내에서 이들 표적화 서열을 이용한 MAM 특이적 이분자 형광 표지 물질이 ER과 미토콘드리아의 접합부(MAM)를 선택적으로 표지하고 있음을 확인하였다.
② MAM 표적화 분석
본 발명에서 제작된 이분자형 MAM 특이적 형광 표지 물질의 MAM 표적화 수준을 분석하기 위하여, 상기 제작한 현미경 샘플을 이용하여 촬영한 형광 사진들을 NIH에서 배포한 범용 이미지 분석 프로그램 Image J를 이용하여 분석하였다.
먼저, 기존의 MAM 연구에서 사용된 방법대로 각각 ER의 기질과 미토콘드리아 기질을 표지하는 ER 표지 형광 물질, 미토콘드리아 표지 형광 물질의 형광이 겹쳐지는 부분을 추출하여, 이분자형 MAM 특이적 형광 표지 물질의 형광 패턴과의 co-localization coefficient(Mander's Coefficients)를 분석하였다.
그 결과, 도 7b에 나타낸 바와 같이, 본 발명의 이분자형 MAM 특이적 형광 표지 물질의 경우, 조사된 모든 세포에서 미토콘드리아, ER 각자의 형광 표지보다 미토콘드리아와 ER의 형광이 겹쳐지는 부분(overlapped)에 더 높은 수준으로 겹쳐지고 있음을 확인하였다.
또한, MAM 특이적 형광 표지 신호가 나타나는 구간에서 MAM 특이적 형광 표지 물질과 ER 형광 표지 물질, 미토콘드리아 형광 표지 물질의 패턴을 분석하기 위해 line analysis를 수행하였다.
그 결과, 도 7c에 나타낸 바와 같이, 미토콘드리아(파란색 형광)와 ER(붉은색 형광)의 경계(그래프의 실선이 교차하는 부분, 화살표로 표시)에 존재하는 MAM을 본 발명의 MAM 특이적 이분자 형광 표지 물질이 매우 정확하게 표지하고 있음을 확인하였다.
실시예 4. MAM 특이적 칼슘 이온 센서 재조합 발현 벡터 제작
실시예 3에서 제작된 pVenus(155-C)-linker-AKAP1(34aa-63aa) vector를 기반으로, GCaMP6s 유전자를 template로 실시예 1-2의 조합 1에서 사용된 하기의 primer를 이용하여 PCR 증폭하였다.
spGC144 forward primer:
5'-gggaccggtgccaccatggtgagcaagggcgag-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3’
이후, 이 PCR 산물을 BamHⅠ, NotⅠ 제한효소로 처리한 후 T4 ligase를 이용하여, BamHⅠ, NotⅠ 제한효소로 Venus(155-C) 유전자 부분을 잘라낸 pVenus(155-C)-linker-AKAP1(34aa-63aa) vector에 삽입함으로써 AKAP1(34aa-63aa)-linker-spGC144 vector를 제작하였다(도 8a 참조).
마찬가지로, 상기 실시예 3에서 제작된 pVenus(N-172)-linker-MFN1 vector를 기반으로, GCaMP6s 유전자를 template로 실시예 1-2의 조합 1에서 사용된 하기 primer를 이용하여 PCR 증폭하였다.
spGC144 forward primer:
5'-gggaccggtgccaccatggtgagcaagggcgag-3'
spGC-C-terminus reverse primer:
5'-ggaagatctgacttcgctgtcatcatttgtacaaac-3’
이후, 이 PCR 산물을 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여, AgeⅠ, BglⅡ 제한효소로 Venus(N-172) 유전자 부분을 잘라낸 pVenus(N-172)-linker-MFN1 vector에 삽입하여 spGC144-linker-MFN1 vector를 제작하였다.
또한, 실시예 3에서 제작된 pVenus(149-C)-linker-SAC1(521aa-587aa) vector를 기반으로, GCaMP6s 유전자를 template로 실시예 1-2의 조합 1에서 사용된 하기의 primer를 이용하여 PCR 증폭하였다.
spGC-N-terminus forward primer:
5'-gggaccggtgccaccatgggttctcatcatcatcatcatcatg-3'
spGC149 reverse primer:
5'-ggaagatctgacttgtacagctcgtccatgcc-3'
이후, 이 PCR 산물을 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여, AgeⅠ, BglⅡ 제한효소로 Venus(149-C) 유전자 부분을 잘라낸 pVenus(149-C)-linker-SAC1(521aa-587aa) vector에 삽입함으로써 spGC149-linker-SAC1(521aa-587aa) vector를 제작하였다.
실시예 5. MAM 특이적 칼슘 이온 센서 단백질의 칼슘 반응성 확인
5-1. 재조합 유전자 벡터의 transfection
실시예 4에서 제작된 재조합 발현 벡터인 AKAP1(34aa-63aa)-linker-spGC144 vector 및 spGC149-linker-SAC1(521aa-587aa) vector를 각각 glass-bottomed dish 위에 12시간 배양된 HEK293 세포에 lipofectamine 2000 reagent를 이용하여 제조사의 프로토콜에 따라 트랜스펙션(transfection)하였다.
5-2. 형광현미경을 이용한 실시간 관찰
트랜스펙션 이후 10% FBS(Fetal Bovine Serum)를 포함하는 DMEM 배양액에서 37℃, 5% CO2의 배양 조건으로 24시간 배양한 HEK293 세포에 대하여, 배양액을 calcium-free imaging buffer (145mM NaCl, 2.5mM KCl, 10mM glucose, 10mM HEPES pH 7.4, 1mM MgCl2)로 교체한 뒤 형광 현미경을 이용하여 1초 간격으로 timelapse imaging 실험을 수행하였다.
MAM 특이적 칼슘 반응을 위한 자극원으로는 ionomycin(Sigmaaldrich)과 IP3(inositol-1,4,5-trisphosphate)를 각각 final working concentration 10μM이 되도록, 또는 CaCl2를 final working concentration 1 mM이 되도록 처리하였다.
그 결과, 도 9에 나타낸 바와 같이 상기 HEK293 세포에 발현시킨 MAM 특이적 칼슘 이온 센서 단백질(MAM-spGCaMP)의 경우, IP3 또는 CaCl2를 처리하였을 때 형광이 증가하는 것을 통해 실제로 칼슘 변화를 감지할 수 있음을 확인하였다.
상기 진술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 MAM 특이적 칼슘 이온 센서는 종래의 한계점을 극복하여 칼슘 이온이 이동하는 통로에서 직접 칼슘 농도를 측정함으로써 간편하고 정확하게 칼슘 이온의 변화를 확인할 수 있는바, 생체 내 칼슘 이온 변화 감지를 통한 다양한 기초 및 임상 연구에서 유용하게 이용될 수 있을 것이다.

Claims (17)

  1. 하기의 구조체를 포함하는, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광 칼슘 센서:
    (a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및
    (b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 칼슘 이온 반응성 형광 센서 단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체.
  2. 제 1 항에 있어서, 상기 ER 표적 단백질은 SAC1(suppressor of actin 1)인 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  3. 제 2 항에 있어서, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  4. 제 1 항에 있어서, 상기 미토콘드리아 표적 단백질은 AKAP1(A Kinase Anchoring Protein 1)인 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  5. 제 4 항에 있어서, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  6. 제 1 항에 있어서, 상기 미토콘드리아 표적 단백질은 MFN1(Mitofusin 1)인 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  7. 제 3 항에 있어서, 상기 SAC1 단백질의 단편은 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  8. 제 5 항에 있어서, 상기 AKAP1 단백질의 단편은 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  9. 제 6 항에 있어서, 상기 MFN1 단백질은 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  10. 제 1 항에 있어서, 상기 링커 펩티드는 서열번호 4의 염기서열이 1 내지 8번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  11. 제 10 항에 있어서, 상기 링커 펩티드는 서열번호 4의 염기서열이 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  12. 제 1 항에 있어서, 상기 칼슘 이온 반응성 형광 센서 단백질은 분리형(split) GCaMP 단백질인 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  13. 제 12 항에 있어서, 상기 분리형(split) GCaMP 단백질은 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  14. 제 12 항에 있어서, 상기 분리형(split) GCaMP 단백질은 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, MAM 특이적 형광 칼슘 센서.
  15. 제 1 항의 제 1 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터.
  16. 제 1 항의 제 2 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터.
  17. 제 1 항의 센서를 이용한, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 칼슘 감지 방법.
PCT/KR2017/013340 2016-11-25 2017-11-22 Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도 Ceased WO2018097593A2 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/316,087 US11474108B2 (en) 2016-11-25 2017-11-22 MAM-specific fluorescence calcium sensor and use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2016-0157967 2016-11-25
KR20160157967 2016-11-25
KR1020170154218A KR102020122B1 (ko) 2016-11-25 2017-11-17 Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도
KR10-2017-0154218 2017-11-17

Publications (3)

Publication Number Publication Date
WO2018097593A2 true WO2018097593A2 (ko) 2018-05-31
WO2018097593A3 WO2018097593A3 (ko) 2018-09-27
WO2018097593A9 WO2018097593A9 (ko) 2018-11-15

Family

ID=62195997

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/013340 Ceased WO2018097593A2 (ko) 2016-11-25 2017-11-22 Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2018097593A2 (ko)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002253261A (ja) * 2001-03-05 2002-09-10 Inst Of Physical & Chemical Res 蛍光タンパク質

Also Published As

Publication number Publication date
WO2018097593A3 (ko) 2018-09-27
WO2018097593A9 (ko) 2018-11-15

Similar Documents

Publication Publication Date Title
WO2018062866A2 (en) CELL-PERMEABLE (CP)-Cas9 RECOMBINANT PROTEIN AND USES THEREOF
WO2016028036A1 (en) Advanced macromolecule transduction domain (amtd) sequences for improvement of cell-permeability, polynucleotides encoding the same, method to identify the unique features of amtds comprising the same, method to develop the amtd sequences comprising the same
WO2012128580A1 (en) Water-soluble polypeptides comprised of repeat modules, method for preparing the same and method for a target-specific polypeptide and analysis of biological activity thereof
WO2018124766A2 (ko) 키메라 항원 수용체 및 이를 발현하는 자연 살해 세포
WO2017217768A1 (ko) 온타겟 및 오프타겟의 다중 타겟 시스템을 이용하는, 표적 특이적 유전자 가위 스크리닝 방법 및 이의 용도
WO2015053523A1 (ko) 항체 발현용 바이시스트로닉 발현벡터 및 이를 이용한 항체의 생산 방법
WO2020111449A1 (ko) 보툴리눔 독소 활성을 결정하는 세포 기반 방법
WO2010056043A2 (en) Cell-penetrating, sequence-specific and nucleic acid-hydrolyzing antibody, method for preparing the same and pharmaceutical composition comprising the same
WO2012115454A2 (ko) 뉴클레아제에 의해 유전자 변형된 세포를 농축시키는 방법
WO2014077648A1 (ko) 인간 및 마우스 ｌ１ｃａｍ 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2012053823A2 (ko) 인자 ix 활성을 갖는 융합 단백질
WO2018097593A9 (ko) Ｍａｍ 특이적 형광 칼슘 센서 및 이의 용도
WO2020085563A1 (ko) 인간 순수 만능줄기세포에 특이적인 단일클론항체 n16-f2
WO2019132579A2 (ko) 세포질 침투 항체에 융합된 rna 분해효소를 포함하는 면역독소
WO2019103512A9 (ko) 목적 단백질의 발현 효율을 증진시키기 위한 신규한 펩타이드 및 이를 포함하는 융합 단백질
WO2019182417A1 (ko) 황열 바이러스 유래 ns1 단백질, 이에 특이적으로 결합하는 단일클론항체 및 이의 용도
WO2023085582A1 (ko) 식물에서 재조합 단백질 발현의 증진에 있어서 gb1 도메인 융합의 효과
WO2023229330A1 (ko) 바이러스 뉴클레오캡시드를 이용한 오량체형 독소 단백질 기반 목적 단백질 융합 오량체 제조 플랫폼
WO2017043703A1 (ko) 새로운 만니톨 기반의 양친매성 화합물 및 이의 활용
WO2016117949A1 (ko) 포스파티딜이노시톨포스페이트 결합 물질의 세포 사멸 검출 용도
WO2024091058A1 (ko) 세포 패닝 방법
WO2018097598A2 (ko) Ｍａｍ 특이적 형광 표지 물질 및 이의 용도
WO2022065759A1 (ko) 티오레독신 trx-h2 단백질을 과발현하는 추위 저항성 형질전환 식물체
WO2023214801A1 (ko) 단백질의 발현 수준 및 발현 위치 조절을 위한 utr 서열 및 이를 포함하는 mrna 서열
WO2009145573A2 (ko) 아미노 말단의 메티오닌이 제거된 재조합 사람 변이 인터페론-베타 단백질을 생산하는 재조합 대장균 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17874303

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17874303

Country of ref document: EP

Kind code of ref document: A2