WO2018051136A1 - Macrophage-based therapy for use in the treatment of liver injury - Google Patents

Macrophage-based therapy for use in the treatment of liver injury Download PDF

Info

Publication number
WO2018051136A1
WO2018051136A1 PCT/GB2017/052769 GB2017052769W WO2018051136A1 WO 2018051136 A1 WO2018051136 A1 WO 2018051136A1 GB 2017052769 W GB2017052769 W GB 2017052769W WO 2018051136 A1 WO2018051136 A1 WO 2018051136A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
macrophages
liver
mice
injury
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2017/052769
Other languages
English (en)
French (fr)
Other versions
WO2018051136A9 (en
Inventor
Stuart Forbes
Philip Starkey LEWIS
Lesley FORRESTER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Edinburgh
Original Assignee
University of Edinburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB1615923.8A external-priority patent/GB201615923D0/en
Priority claimed from GBGB1707183.8A external-priority patent/GB201707183D0/en
Priority to CN201780056623.2A priority Critical patent/CN109789163A/zh
Application filed by University of Edinburgh filed Critical University of Edinburgh
Priority to EP17783964.4A priority patent/EP3515460B1/en
Priority to AU2017328913A priority patent/AU2017328913B2/en
Priority to EP25198861.4A priority patent/EP4640237A3/en
Priority to JP2019515418A priority patent/JP7115755B2/ja
Priority to US16/331,787 priority patent/US11285174B2/en
Publication of WO2018051136A1 publication Critical patent/WO2018051136A1/en
Publication of WO2018051136A9 publication Critical patent/WO2018051136A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/15Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/17Monocytes; Macrophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/20Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/24Antigen-presenting cells [APC]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0606Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/22Colony stimulating factors (G-CSF, GM-CSF)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2304Interleukin-4 (IL-4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2313Interleukin-13 (IL-13)

Definitions

  • This invention relates to alternatively-activated macrophages for use in the treatment of liver injury.
  • Acetaminophen (paracetamol, APAP) overdose is a common cause of acute liver injury (ALI) in the clinic and is the leading cause of acute liver failure (ALF) in the United States (1-5).
  • APAP also serves as a paradigm hepatotoxin for pre-clinical studies and the molecular mechanisms that underpin APAP hepatotoxicity are now well understood, accounting for at least four decades of research.
  • the therapeutic management of APAP-induced ALI is primarily limited to n-acetyl cysteine (NAC) therapy which serves as an effective antidote early after drug ingestion (typically within 10 hours).
  • NAC n-acetyl cysteine
  • APAP poisoning is characterised by rapid onset necrosis of centrilobular hepatocytes in the liver. Without immediate clinical intervention, substantial liver injury can progress into liver failure associated with a sepsis-like response known as systemic inflammatory response syndrome (SIRS) typically characterised by immune activation, encephalopathy, hypothermia, and a high risk of multi-organ failure and death (7).
  • SIRS systemic inflammatory response syndrome
  • tissue resident macrophages Kupffer Cells, KCs
  • Macrophages are thought to stimulate ductular cells to proliferate through the secretion of TNF-related weak inducer of apoptosis (TWEAK) (Bird, T. G. et al. Bone marrow injection stimulates hepatic ductular reactions in the absence of injury via macrophage-mediated TWEAK signaling. Proc Natl Acad Sci U S A 110, 6542-6547, doi: 10.1073/pnas.1302168110 (2013); Jakubowski, A. et al. TWEAK induces liver progenitor cell proliferation. J Clin 548 Invest 115, 2330-2340, doi: 10.1 172/jci23486 (2005)).
  • Wh i l st these ductular cells may be associated with fibrosis (Williams, M. J., Clouston, A. D. & Forbes, S. J. Links between hepatic fibrosis, ductular reaction, and progenitor cell expansion. Gastroenterology 146, 349-356, doi: 10.1053/j.gastro.2013.11.034 (2014)) they may also contain regenerative hepatic progenitor cells (HPC) (Lu, W. Y. et al. Hepatic progenitor cells of biliary origin with liver repopulation capacity. Nat Cell Biol 17, 971-983, doi: 10.1038/ncb3203 (2015)).
  • HPC regenerative hepatic progenitor cells
  • KCs also provide an immunological barrier from gut-derived pathogens which become dysregulated during liver injury further risking systemic toxicity (9, 10). There are further systemic immunological effects which lead to a depletion and dysfunction of circulating monocytes which are recruited to the liver in a CCR2-dependent manner (11-13).
  • Novel therapies which can be used in the treatment of liver injury are urgently sought. It is an objection of the invention to provide novel therapies for the liver injury.
  • Such therapies would be able to accelerate the resolution of liver necrosis, suppress the system inflammatory response and promote liver regeneration.
  • AAMs alternatively-activated macrophages
  • the livery injury may be an acute liver injury, such as a liver injury associated with the use of a drug or an overdose of a drug.
  • the liver injury may result from the use of one or more drugs selected from the group consisting of: acetaminophen, clarithromycin, statins, nicotinic acid, amiodarone, methotrexate, isoniazid, nitrofurantoin, augmentin, asprin, indomethacin, ibuprofen, naproxen, piroxicam, nabumetone, diclofenac, tacrine or disulfiram.
  • the drug may be acetaminophen.
  • the liver injury may result from poisoning, such as mushroom poisoning.
  • the AAMs may be administered when the liver is showing signs of necrosis.
  • the AAMs may be administered 10 hours or more following poisoning or drug overdose.
  • Alternatively-activated (M2-like) macrophages may be prepared by polarising macrophages with IL-4, IL-13, CSF-1 or a combination thereof.
  • BMDMs bone-marrow derived macrophages
  • the alternatively-activated macrophages may be prepared from a macrophage sample from a subject to be treated such that the AAMs are autologous to the subject having a liver injury.
  • the alternatively-activated macrophages may be derived from pluripotent cells, such as induced pluripotent stem cells (iPSCs) or embryonic stem cells (ES cells).
  • pluripotent cells such as induced pluripotent stem cells (iPSCs) or embryonic stem cells (ES cells).
  • the alternatively-activated macrophages are formulated for intravenous administration.
  • the alternatively-activated macrophages may be provided at a dose of 10 7 to 10 9 cells.
  • the present invention provides a method of preventing or treating liver injury in a subject, comprising a therapeutically effective amount of alternatively- activated macrophages to said subject.
  • the liver injury may be an acute liver injury, such as a liver injury associated with the use of a drug or an overdose of a drug.
  • the liver injury may result from the use of one or more drugs selected from the group consisting of: acetaminophen, clarithromycin, statins, nicotinic acid, amiodarone, methotrexate, isoniazid, nitrofurantoin, augmentin, asprin, indomethacin, ibuprofen, naproxen, piroxicam, nabumetone, diclofenac, tacrine or disulfiram.
  • the drug may be acetaminophen.
  • the AAMs may be administered when the liver is showing signs of necrosis.
  • the AAMs may be administered 10 hours or more following poisoning or drug overdose.
  • Alternatively-activated (M2-like) macrophages may be prepared by polarising macrophages with IL-4 , IL-13, CSF-1 or a combination thereof.
  • BMDMs bone-marrow derived macrophages.
  • the alternatively-activated macrophages may be prepared from a macrophage sample from a subject to be treated such that the AAMs are autologous to the subject having a liver injury.
  • the alternatively-activated macrophages may be derived from pluripotent cells, such as induced pluripotent stem cells (iPSCs) or embryonic stem cells (ES cells).
  • pluripotent cells such as induced pluripotent stem cells (iPSCs) or embryonic stem cells (ES cells).
  • the administration may be intravenous and/or may be are provided at a dose of 10 7 to 10 9 cells.
  • Figure 1 shows BMDMs administered intravenously rapidly engraft in liver and spleen.
  • A Infrared fluorescent optical imaging shows Vivotrack-labelled BMDMs (5x10 6 , i.v.) accumulating in the upper abdomen within 4 hrs in healthy and APAP-poisoned mice
  • B Quantification of the fluorescent signal from an abdominal ROI measured every 15 mins shows accumulation up to 4 hrs. Open circles represent mice receiving unstained BMDMs and closed circles represent mice receiving Vivotrack-stained BMDMs (black circles, healthy; red circles, APAP-poisoned).
  • C BMDMs tolerate Vivotrack as shown by cellular ATP levels post-labelling.
  • FIG. 2 shows alternatively activated macrophages (AAM) reduce hepatic necrosis following APAP-induced liver injury.
  • Fasted mice were treated with APAP (350 mg/kg; i.p) and were treated with unmanipulated (naive) or pre-polarised BMDMs (classically activated macrophages (CAMs), AAMs, or deactivated macrophages (DAMs)) 16 hours post-APAP administration.
  • APAP 350 mg/kg; i.p
  • BMDMs classically activated macrophages
  • AAMs deactivated macrophages
  • Open circles represents values from individual animals per group as indicated (B) Haematoxylin and Eosin (H+E) stains indicate typical eosinophilic necrotic regions surrounding the central vein characteristic of APAP-induced liver injury. Panels show representative images from mouse liver (2x magnification). Necrotic quantification is shown bottom right as open circles per individual animals around the mean (horizontal line) in groups as shown. Asterisk indicates statistical significance (P ⁇ 0.05, Kruskall-Wallis test). [0023] Figure 3 shows polarised BMDM treatment induces hepatocellular proliferation following APAP-induced liver injury.
  • FIG 4 shows polarised BMDM administration attenuates a panel of circulating inflammatory cytokines in mice with APAP-induced liver injury. Serum from mice receiving BMDMs (naive BMDMs, CAMs and AAMs) was assayed for a 10-plex panel of proinflammatory cytokines using electrochemiluminescence technology (Meso Scale Discovery, Gaithersburg, MD). Panels show data in groups for each cytokine analysed (IFN- Y, IL-10, IL-12p70, IL- ⁇ , IL-2, IL-4, IL-5, IL-6, CXCL1 (KC/GRO), TNFa). Each open circle represents data points from individual animals per group. Asterisks represent levels of statistical significance ( * P ⁇ 0.05, ** P ⁇ 0.01 , *** P ⁇ 0.001 ; one-way ANOVA).
  • FIG. 5 shows AAM administration upregulates Csf1 expression and reduces inflammatory Cxcl1 and 116 expression in mice following APAP-induced liver injury.
  • a panel of cytokines and chemokines known to be implicated in macrophage signalling during ALI was assayed in whole liver following BMDM-treatment for APAP-induced liver injury.
  • Expression of pro-survival gene Csf1 was significantly higher in AAM-treated mice. Consistent with circulating markers, expression of Cxcl1 and II6 was significantly lower in AAM-treated mice. Gapdh served as the housekeeping gene.
  • Asterisk indicates statistical difference (P ⁇ 0.05; one-way ANOVA).
  • FIG. 6 shows AAMs exhibit enhanced phagocytic capacity over naive- and CAMs.
  • A Polarised BMDMs were incubated with apoptotic fluorescent thymocytes.
  • BMDMs were incubated with apoptotic thymocytes (primary thymocytes harvested from 3-5 week old C57BL6 mice, treated with 1 ⁇ hydrocortisone, as previous ( D. A. Ferenbach et a/., 2010).
  • Apoptotic thymocytes were labelled using CMTMR (Invitrogen) according to the manufacturer's instructions ( L. Bosurgi et al.
  • BMDMs polarised towards different phenotypes green, AAMs; red, CAMs; black, naive
  • Panels show the percentage of CMTMR-positive BMDMs (left), their mean fluorescent intensities (MFIs; second from left), the normalised MFI (second from right), and the MFI histogram (right). The pale blue histogram represents unstained cells.
  • Ly6C expression on BMDMs is reduced following phagocytosis in AAMs. Left panel shows the percentage of Ly6C-positive BMDMs polarised towards different phenotypes, right panel shows representative histogram.
  • BMDMs were incubated with zymosan-coated pHrodo bioparticles for up to 125 mins and analysed in real-time via high-content imaging.
  • Graph shows the mean fraction of cells that are above the fluorescent threshold (positive for phagocytosis) around the standard deviation in groups (green, AAMs; red, CAMs, black, naive) over time.
  • D Representative images taken at different times show AAMs exhibit green fluorescence earlier and to a greater capacity than naive macrophages or CAMs. Cells are visualised with blue nuclei stain (NucBlue) and DeepRed Cell Mask.
  • FIG. 7 shows transplanted AAMs are highly phagocytic in vivo and retain their anti-inflammatory phenotype.
  • A Study design timeline shows a single APAP administration to fasted mice before BMDM transplantation 16 hrs post-APAP. Phagocytic capability of endogenous and exogenous cells was assessed by a challenge of PKH26 dye (i.v.; dye ingested exclusively by phagocytic cells) before culling at 36 hours post-APAP.
  • PKH26 dye i.v.; dye ingested exclusively by phagocytic cells
  • Figure 9 shows naive BMDMs administered early (4 hours) after APAP treatment does not reduce liver injury. Markers of liver injury and function were assayed in mouse serum harvested 24 hours after APAP administration (20 hours after BMDM administration; 1 x 106 i.v.). Although the markers measured were not statistically significant, serum transaminases showed a higher trend in a BMDM-treated mice and deaths were only observed in BMDM-treated group (student t-test).
  • FIG 10 shows cytokine-mediated BMDM polarisation occurs on normal and ultra low-attachment plastics.
  • BMDMs were cultured with either LPS (50 ng/mL) and IFNy (20 ng/mL) - for CAMs), IL-4 (20 ng/mL) and IL-13 (20 ng/mL) - for AAMs, IL-10 (10 ng/mL) - for DAMs or without growth factors (naive macrophages) for 48 hours on either normal plastic (black bars) or ultra-low attachment plastic (grey bars).
  • activated genes were upregulated by IL-4/IL-13 on both plastic types whereas 1110 gene expression was higher on low-attachment plastics after IL-10 treatment.
  • FIG 11 shows polarised BMDM administration shows a lower trend across a panel of inflammatory cytokines in whole liver in mice with APAP-induced liver injury.
  • Serum from mice treated with BMDMs (naive, CAMs, AAMs) were assayed for a 10-plex panel of pro-inflammatory cytokines using electrochemiluminescence technology (Meso Scale Discovery, Gaithersburg, MD).
  • Panels show data in groups for each cytokine analysed (IFN- Y, IL-10, IL-12p70, IL- ⁇ , IL-2, IL-4, IL-5, IL-6, CXCL1 (KC/GRO), TNFa).
  • Each open circle represents data points from individual animals per group.
  • Asterisks represent levels of statistical significance (* P ⁇ 0.05, ** P ⁇ 0.01 , *** P ⁇ 0.001 ; one-way ANOVA).
  • FIG. 12 shows human monocyte derived macrophages show altered phagocytosis kinetics after in vitro polarisation.
  • Human monocytes were incubated in vitro with human recombinant CSF1 for 7 days to drive differentiation before culture with LPS/IFN (for classical activation, towards hCAMs), IL4/IL-13 (for alternative activation, towards hAAMs), or no stimuli (naive MDMs).
  • Macrophages were seeded at 1x105 cells/well in 96- well CellCarrier plate and incubated with zymosan green pHrodo bioparticles for 125 minutes.
  • Figure 13 shows flow cytometry gating strategy. Representative flow plots from categorising sub-populations of liver digests. Top panels show all cells used for analysis, excluding doublets, and negative for the liver/dead stain. Sub-populations were expressed as proportions of total hepatic macrophages or CD45+cells. Hepatic resident macrophages were defined as viable CD45+ Ly6G- CD3- NK1.1- CD19- CD1 1 b low F4/80 hi9h .
  • Hepatic infiltrating macrophages were defined as viable CD45+ Ly6G- CD3- NK1.1- CD19- CD11 b hi9 h F4/80l ow cells from non-parenchymal fraction of digested livers and used to identify macrophage subsets. Quantification of absolute numbers of cells per liver was performed by expressing each subset as a proportion of NPCs, counting total number of NPCs in the digested portion of liver, calculating the total number of NPCs in the whole liver by weight differential, thereby calculating the total number of each subpopulation. Transplanted AAMs were identified as CFSE+.
  • the percentage CFSE+ cells was calculated on the gate of total viable CD45+ Ly6G- CD3- CD19- NK1.1- cells.
  • the negative was set on a liver from an APAP-poisoned mouse receiving vehicle instead of AAMs. AAMs were further classified on their Ly6C expression, gating set using FMO controls.
  • the percentage of phagocytic cells (positive and negative) was calculated on the gate of CFSE+ cells.
  • the negative was set using the liver from an APAP-poisoned mouse transplanted with AAMs but injected with the vehicle instead of PKH26PCL.
  • PKH26PCL MFI was calculated in the same gate.
  • Figure 14 shows flow cytometry gating strategy. Representative flow plots from categorising sub-populations of phagocytosis analysis. Panels show all cells analysed in the study, excluding doublets. BMDMs were identified as CD11 b+. The percentage of phagocytic cells was calculated on the gate of CD11 b+ cells. BMDMs positive for phagocytosis were defined as CMTMR+ (i.e. fluorescent apoptotic thymocytes). The percentage of non-specific binding (phagocytosis at 4 °C, top right panels) was subtracted from the percentage of phagocytic BMDMs (at 37 °C). Phagocytic cells were further classified based on their Ly6C expression (bottom right panels). Gates were set using FMO controls.
  • Figure 15 shows whole blood parameters following AAM delivery in APAP poisoned mice. We observed no statistical difference between any parameter of whole blood in poisoned animals that received DPBS (vehicle control) versus AAM (5x106, i.v.).
  • A Panels show open circles (individual animals) categorised per group as indicated for white blood cells (WBC), red blood cells (RBC), haemoglobin (Hgb), haematocrit (HCT), and platelets (PLT).
  • WBC white blood cells
  • RBC red blood cells
  • Hgb haemoglobin
  • HCT haematocrit
  • PHT platelets
  • B The number (left) and percentage (right) of lymphocytes per group.
  • C The number (left) and percentage (right) of monocytes per group.
  • D The number (left) and percentage (right) of granulocytes per group.
  • Figure 16 shows a comparison of ESDMs and BMDMs.
  • FIG 17 shows M1 and M2 stimulation of ESDMs and BMDMs.
  • [*p ⁇ 0.05, **p ⁇ 0.01 , ***p ⁇ 0.001 , ****p ⁇ 0.0001 ; n 3 per group, Two-way ANOVA with Tukey's multiple comparison test].
  • FIG. 18 shows that higher dose of ESDMs has an anti-fibrotic effect.
  • Scale bars 200 ⁇ . [*p ⁇ 0.05, n 5 per group, Unpaired t-test].
  • FIG. 19 shows that ESDMs can initiate a progenitor response in injured livers.
  • FIG. 20 shows that ESDMs can repopulate the liver of liposomal chlodronate- treated mice.
  • CFSE immunostaining E-H; Scale bars 100 ⁇
  • CFSE immunohistochemistry l-L, Scale bars 50 ⁇ .
  • FIG. 1 Showheads point at CFSE+ cells detected.
  • R Assessment of ESDM and BMDM engraftment in different organs by FITC immunohistochemistry.
  • Figure 21 shows Serum transaminases are not different in ESDM-treated mice 20 hours after injection versus vehicle control.
  • Figure 22 shows ESDMs show a marked increase in M2-associated genes after 24-hour polarisation in vitro with recombinant murine IL-4/IL-13.
  • Figure 23 shows alternatively-activated ESDMs are proficient at phagocytosis in vitro.
  • ESDMs incubated with apoptotic thymocytes in vitro show 79 % positivity for phagocytosis versus unfed equivalent cells.
  • Figure 24 shows ESDM-treated mice show a reduced area of centrilobular necrosis 20 hours after ESDM-injection (5x106, i.v). Panels show Haemotxylin and Eosin (H+E) stains and their corresponding image segmentation (classifier) used during image quantification.
  • H+E Haemotxylin and Eosin
  • Figure 25 shows transplanted ESDMs (black arrows) localise to the liver and spleen.
  • Panel A liver (top row, x20 magnification; bottom row, x 40 magnification) sections.
  • Figure 26 shows production of macrophages from human pluripotent stem cells
  • Macrophage derived from hPSC express both CD11 b and 25F9 (B) but not CD93 (A) and key M1 (C, D) and M2-associated genes (E, F) are upregulated upon stimulation.
  • iPSC-DM live phagocytosis assay iPSC-DM followed the same trend as MDM, where "naive" and M2 activated macrophages were more phagocytic then M1 -activated macrophages (G, H).
  • FIG. 27 shows iPSC-derived macrophages express CD45 (A) 25F9 (B), CD169 (C), CD163 (C), CD14 (D) and CD43 (E). There is a low level of VCAM1 (F) and CD15 (G) in a small proportion of iPSCs. iPSCs do not express CD93 (B).
  • Figure 28 shows iPSC-derived macrophages express CD206 (A), CD115 (B), CD86 (C), CX3CR1 (E), CCR2 (F), CCR5 (G) and CCR8 (H) but do not express HLA-DR (D).
  • Statistically significant genes that are different between APAP and PBS treated mice are above the horizontal line. Student's t-test.
  • AAMs generally retain their anti-inflammatory phenotype with 95% genes analyzed not different between APAP-treated and PBS-treated mice.
  • AAMs alternatively-activated macrophages
  • administration of AAMs may result in one or more of the following advantageous effects: a reduction in necrosis, an increase in liver cell proliferation, a reduction of levels of pro-inflammatory cytokines, an increase is phagocytosis at the injury site and a reduction in the proportion of endogenous inflammatory infiltrating macrophages.
  • AAM therapy may advantageously: accelerate the resolution of hepatitis necrosis, suppress the system inflammatory response, reduce hepatic fibrosis, reduce hepatic scaring and/or promote liver regeneration.
  • Haematopoietic cells derived from ESCs in vitro are thought to be more closely related to blood cells associated with the primitive wave of haematopoiesis in the yolk sac during development (Zambidis, E. T., Peault, B., Park, T. S., Bunz, F. & Civin, C. I. in Blood Vol. 106 860-870 (2005)).
  • Tissue resident macrophages are known to be derived from the primitive wave of haematopoiesis, well before the appearance of haematopoietic stem cells (HSC) in the embryo and develop in the absence of Myb (Schuiz, C. et al.
  • the macrophages described herein may be tissue-resident-like-macrophages.
  • the macrophages described herein may be monocyte-derived-like-macrophages. Tissue-resident-like-macrophages may be characterised by having lower levels of expression of Myb and Ccr2 and higher expression of Pu.1.
  • Alternatively-activated (M2-like) macrophages are known in the art and may be prepared by polarising bone-marrow derived macrophages with T helper 2 (th2) cytokines interleukin-4 (IL-4) and IL-13.
  • T helper 2 th2
  • IL-4 interleukin-4
  • IL-13 IL-13
  • AAMs are detailed in Gordon et al. Immunity 32, May 28, 201 , pages 593-604.
  • the AAMs may be produced from macrophages as described in the Examples of the present invention.
  • AAMs may be characterised by their high expression of Chil3 (Ym1), Retnla (Fizz), Mrc1 (Mannose Receptor 1), and Arg1 (Arginase).
  • liver injury refers to hepatotoxicity.
  • liver injury is incurred by the subject as a result of autoimmune hepatitis, primary graft non- function, small-for-size syndrome, malignancy and/or drug-induced liver injury.
  • drug-induced liver injury may be the result the use of one or more drugs selected from the list consisting of: clarithromycin, statins, nicotinic acid, amiodarone, methotrexate, isoniazid, nitrofurantoin, augmentin, asprin, indomethacin, ibuprofen, naproxen, piroxicam, nabumetone, diclofenac, tacrine or disulfiram. More suitably, drug-induced liver injury is as a result of acetaminophen overdose.
  • Chronic liver injury can be caused viral hepatitis, alcohol, obesity and metabolic disorders.
  • Chronic liver injury may result in fibrosis, hepatic scarring and cirrhosis, which are characterised by the replacement of normal liver tissue by scar tissue.
  • the invention has surprisingly discovered that administered ESDMs significantly reduced the amount of hepatic fibrosis, down-regulated the number of fibrogenic myofibroblasts and activated liver progenitor cells (particularly PanCK+ ductular cells) in vivo.
  • ESDMs can repopulate depleted Kupffer cell compartments.
  • ESDMs may secrete matrix metalloproteinases (MMPs) that break down extracellular matrix (ECM) components of scar tissue.
  • MMPs matrix metalloproteinases
  • ECM extracellular matrix
  • ESDMs polarised to a M2-like macrophage may also have utility in the treatment of a chronic liver injury.
  • the present invention has also surprisingly found that macrophages primed in culture to an AAM phenotype retain this anti-inflammatory phenotype in vivo. This overcomes potential safety concerns that transplanted macrophages could become proinflammatory in phenotype and thereby be detrimental to the treatment of injury.
  • AAMs may be administered in the regenerative phase following liver injury. For example, after 16 hours following a drug-induced liver injury.
  • the present invention had shown that administration of AAMs in this phase reduces necrosis.
  • administration of AAMs in the regenerative phase following acetaminophen overdose has been shown in the Examples to reduce centrilobular necrosis by 60% and yield an 8-fold increase in liver cell proliferation as well as reducing the levels of circulating pro-inflammatory cytokines (such as IFN- ⁇ , IL-6, CXCL1 and TNF-a).
  • cytokines such as IFN- ⁇ , IL-6, CXCL1 and TNF-a
  • the alternatively-activated macrophages may be prepared from a macrophage sample from a subject to be treated such that the AAMs are autologous to the subject having a liver injury.
  • a macrophage sample may be harvested from the subject, expanded, characterised as AAMs and reinfused.
  • the alternatively-activated macrophages may be derived from human induced pluripotent stem cells. This may be advantageous for liver injury which progresses to acute liver failure quickly, such as acetaminophen poisoning.
  • Such macrophages can be polarised to AAMs with T helper 2 (th2) cytokines interleukin-4 (IL-4) and IL-13.
  • Polarisation with IL-4/IL-13 may result in dynamic change in gene expression for Chil3 (e.g. up to approx. 100-fold increase vs naive BMDMs), Retnla (e.g. up to 1000-100000-fold increase), Mrc1 (e.g. up to approx. 10-fold increase), Arg1 (e.g. up to pprox. 100-1000 fold increase).
  • AAMs may derive from ES cells.
  • ES cell derived macrophages may be generated by culturing the ES cells in the presence of colony stimulating factor-1 (CSF-1) (also known as M-CSF) and IL-3 to form embryoid bodies (EB). Whilst EBs adhere to tissue culture plastic, macrophage progenitor cells are non-adherent and thus are released into the medium. The macrophage progenitor cells may then be harvested at various time points, for example after 10 or 20 days and plated onto non-treated Petri dishes and cultured in the presence of CSF-1 alone.
  • CSF-1 colony stimulating factor-1
  • IL-3 embryoid bodies
  • ESDM monocyte-like cells that adhere to the plastic forming a monolayer and mature into ESDM.
  • the maturation of the ES cells into ESDM can be monitored by detecting the presence of mature macrophage specific markers F4/80 (mouse macrophage specific) or 25F9 (human macrophage specific) and CD11 b. Additionally, human macrophages may be characterised by the absence of the monocyte marker CD93.
  • the method described yields a substantially homogenous population of ESDM
  • AAMs may derive from iPSC.
  • the method for differentiation of iPSCs to macrophages may involve supplementing culture medium with a cytokine Mix 1 (comprising bone morphogenetic protein (BMP4), vascular endothelial growth factor (VEGF) and stem cell factor (SCF)).
  • BMP4 bone morphogenetic protein
  • VEGF vascular endothelial growth factor
  • SCF stem cell factor
  • Cells may be cut, dislodged, divided and re-cultured in fresh media supplemented with cytokine mix 1.
  • Cells may be cultured in suspension for 3 days with a cytokine top up on Day 2, to form EBs.
  • the EBs may then be transferred to media supplemented with cytokine Mix 2 (comprising M-CSF, IL3, Glutamax, Penicillin/Streptomycin and ⁇ -mercaptoethanol). EBs can be maintained in this medium for the remaining duration of the protocol, with spent medium being replaced with fresh medium every 3-4 days. After about 2 weeks, the EBs produced macrophage progenitors in the culture supernatant that were harvested and transferred to medium supplemented with cytokine Mix 3 (M-CSF, Glutamax, Penicillin/Streptomycin) and allowed to mature into iPSC- derived macrophages (iPSC-DM). Macrophage progenitors may continue to be harvested twice a week for approximately 2 months.
  • cytokine Mix 2 comprising M-CSF, IL3, Glutamax, Penicillin/Streptomycin and ⁇ -mercaptoethanol.
  • the iPSC-derived macrophages are from human iPSCs.
  • iPSC-DM may be murine derived.
  • ESDMs or iPSC-DM may be subsequently polarised in vitro to adopt either a M1-like phenotype by treatment with LPS and IFNy.
  • ESDMs or iPSC- DM may be polarised to yield AAM with IL-4.
  • ESDMs may be polarized to yield AAMs with IL-4, IL-13 and CSF-1.
  • M1-like polarised macrophages are also known as classically activated macrophages (CAM).
  • AAM derived from ESDMs may be characterised by their high expression of Chil3 (Ym1), Retnla (Fizz), Mrc1 (Mannose Receptor 1), and Arg1 (Arginase).
  • M1-like polarised macrophages (such as ESDM, BMDM or iPSC-DM) may be characterised by a significant increase in NO production and increased gene expression of iNos and Cd86.
  • subject refers to any individual who may benefit from the treatment of a liver injury.
  • the subject may be a human subject.
  • treatment refers to an intervention which prevents the progression, or reduces partially or completely the clinical symptoms with a liver injury in a subject.
  • the treatment may result in an increase in or an acceleration of liver regeneration.
  • a therapeutically effective amount of AAMs will be dependent on various factors including the weight of the subject to be treated.
  • a therapeutically effective amount may be in the form of a dose of 1 x 10 7 to 1 x 10 9 AAMs or a therapeutically effective amount may be in the form of a dose of 2 x 10 7 to 2 x 10 9 AAMs.
  • a therapeutically effective amount may be in the form of a dose of 2 x 10 7 .
  • the AAMs or a pharmaceutical composition comprising AAMs may be provided in a single dose. Though it would be understood that the multiple doses could also be utilised.
  • the AAMs may be comprised in a pharmaceutical composition.
  • the pharmaceutical composition may comprise a therapeutically effective amount of AAMs and a pharmaceutically acceptable carrier.
  • the "term pharmaceutically acceptable carrier” as used herein refers to any suitable diluent, excipient, or a combination thereof, suitable for administration into a subject.
  • a pharmaceutically acceptable carrier may be an organic or inorganic substance, which facilities the delivery of AAMs to the subject.
  • a pharmaceutical composition of the invention may further comprise a pharmaceutically acceptable concentration of salt, buffering agents, and compatible carriers.
  • the compositions may also include antioxidants and/or preservatives. Suitable antioxidants may be selected from the group consisting of: mentioned thiol derivatives (e.g. thioglycerol, cysteine, acetylcysteine, cystine, dithioerythreitol, dithiothreitol, glutathione), tocopherols, butylated hydroxyanisole, butylated hydroxytoluene, sulfurous acid salts (e.g.
  • Suitable preservatives may for instance be phenol, chlorobutanol, benzylalcohol, methyl paraben, propyl paraben, benzalkonium chloride and cetylpyridinium chloride.
  • the pharmaceutical composition of the present invention may be for administration to the subject via any suitable route.
  • a suitable route of administration may be selected from the group consisting of: intravenous injection or infusion. Other methods for administering pharmaceutical compositions will be known to the skilled in the art.
  • Mouse BMDMs Femurs and tibias of C57/BL6 male mice (8-10 week old) were collected in Hanks' Balanced Salt Solution (HBSS, Gibco) containing penicillin/streptomycin (100 U/mL, 100 Mg/mL). Bone marrow (BM) was flushed out with DMEM:F12 (1 :1) cell culture media (Gibco) supplemented with 10 % fetal bovine serum (FBS), 2 mM glutamine, and penicillin/streptomycin (100 U/mL, 100 ⁇ / ⁇ ).
  • HBSS Hanks' Balanced Salt Solution
  • Mouse BM was centrifuged (400 g, 5 mins) and then resuspended and strained though 100 ⁇ filter, in supplemented DMEM:F12 media (20 ml_) containing 20 ng/mL murine recombinant CSF1 (Peprotech). BM suspensions were then transferred to sterile ultra-low attachment flasks (Corning Inc.) and incubated at 37 °C, 5 % C02 in a 20 ml_ volume. Every second day, 10-20 % of the media was replaced with fresh media containing 400 ng CSF1.
  • BMDM polarisation 24 hours prior to transplantation, cells were polarised with lipopolysaccharide (LPS, 50 ng/mL, Sigma Aldrich) and recombinant murine interferon gamma (IFNy, 20 ng/mL, Peprotech) in ultra-low attachment flasks to generate classically-activated macrophages (CAMs).
  • LPS lipopolysaccharide
  • IFNy recombinant murine interferon gamma
  • CAMs classically-activated macrophages
  • BMDMs were polarised with recombinant murine interleukin-4 and interleukin-13 (IL-4/IL-13, 20 ng/mL, Peprotech).
  • DAMs deactivated macrophages
  • BMDMs were stimulated with recombinant murine interleukin-10 (IL-10, 10 ng/mL, Peprotech) for 24 hours.
  • IL-10 recombinant mur
  • Human monocyte derived macrophages Human monocyte derived macrophages (hMDMs) were differentiated from cryopreserved CD14 monocytes essentially as described previously (19). Briefly, cyropreserved stocks were thawed rapidly and diluted in Iscove's Modified Eagle's Medium (IMEM) supplemented with 10 % FBS (v/v), 2 mM glutamine, penicillin/streptomycin (500 U/mL, 500 ⁇ g/mL), and 100 ng/mL human recombinant CSF1 (Miltenyi) at 2x106 cells/mL in ultra-low attachment flasks (Corning).
  • Iscove's Modified Eagle's Medium IMEM
  • FBS % FBS
  • 2 mM glutamine penicillin/streptomycin
  • penicillin/streptomycin 500 U/mL, 500 ⁇ g/mL
  • 100 ng/mL human recombinant CSF1 Mil
  • hMDMs were differentiated towards macrophages for 7 days with a 10 % media change every second day containing 1 ⁇ g CSF1. After 7 days, hMDMs were harvested, counted, and plated on CellCarrier plates with human recombinant cytokines (Peprotech, details as above) towards CAMs and AAMs, or left unstimulated (naive hMDMs). hMDMs were used for phagocytosis assays (see below).
  • APAP-induced liver injury and BMDM administration All animal experiments were carried out under procedural and ethical guidelines of the British Home Office and experimental designs were independently reviewed by a veterinarian. Wildtype C57BL6 male mice (10 weeks old) were supplied by Harlan (UK) and allowed to acclimatise for a minimum of two weeks in a clean animal facility. Mice were housed in groups of five/six in open-top cages and synchronised to a 12-hour dark/light cycle with access to food and water ad libitum. Prior to APAP administration, mice were fasted at least 12 hours. Mice received either a single injection (i.p.) of APAP (350 mg/kg) dissolved in warm saline or saline alone.
  • APAP 350 mg/kg
  • CFSE-stained BMDMs were resuspended in Dulbecco's Phosphate-Buffered Saline (DPBS) and administered (1 x 106 cells, 100 ⁇ ) via tail vein to mice under gaseous isoflurane/oxygen anaesthesia at either 4 hours or 16 hours after APAP administration.
  • mice were pulsed with 1 mg (i.p.) of 5-Bromo-2'-deoxyuridine (BrdU, Sigma Aldrich) in PBS to label proliferating cells.
  • Mice were humanely culled by asphyxiation in a rising C02 atmosphere. Whole blood was collected via cardiac puncture and allowed to clot overnight at 4 °C to collect serum.
  • Liver tissue was harvested and the left lateral lobe was separated into two pieces and placed in either a freezing isopentane bath or fixed in methacarn for 24 hours. The remaining liver and other organs were fixed in formalin (4% paraformaldehyde) for 24 hours before paraffin-embedding.
  • BMDMs were stained in vitro with VivoTrack 680 (near infra-red fluorescent imaging agent, Perkin Elmer) prior to transplantation.
  • VivoTrack 680 near infra-red fluorescent imaging agent, Perkin Elmer
  • BMDMs (5 x 106) were incubated with reconstituted VivoTrack (2 mL) in 4 mL DPBS and incubated for 15 mins at room temperature in a dark environment and subsequently washed twice to remove excess dye. Imaging was performed on healthy (DPBS-treated, i.p.) or APAP-treated mice at 16 hours.
  • mice were anaesthetised and maintained with gaseous oxygen/isofluorane and fur clipped before longitudinal fluorescent images were taken in the dorsal position at 15 min intervals at 687 nm excitation and 722 nm emission (background correction at 487nm) using a PhotonlMAGERTM (Biospace Lab) imaging suite. After 5 hours mice were humanely culled and organs imaged ex vivo to confirm AAM localisation. In some experiments, BMDMs differentiated from constitutively expressing GFP mice (20) were used to confirm staining with Vivotrack 680 in vitro.
  • CFSE staining BMDMs were stained with CellTrace CFSE (ThermoFisher) essentially following the manufacturer's instructions. Briefly, BMDMs were resuspended in DPBS at 1 x 107 cells/mL and incubated with CFSE at a final concentration of 50 ⁇ at 37 °C in dark conditions for 20 mins. Cells were centrifuged (400 g, 5 mins) and washed in 10 x DPBS volume and incubated again at 37 °C in dark conditions for 20 mins. Finally, stained cells centrifuged and resuspended in DPBS at 1 x 107 cells/mL and stored on ice until transplantation.
  • CellTrace CFSE ThermoFisher
  • Serum preparation Blood was allowed to clot overnight at 4 °C. Serum was obtained via sequential centrifugation. Briefly, serum was separated from blood cells by centrifugation at 1500g (5 mins, 4 °C) and pipetted off to a fresh microtube. Serum was centrifuged again (14 OOOg, 5 mins, 4 °C) to pellet any residual blood cells and cell debris. Serum was transferred to fresh microtubes and frozen at -20 °C until use.
  • Serum chemistry evaluation Serum chemistry was performed by measurement of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total bilirubin, and serum albumin.
  • ALT was measured using the method described by (21), utilising a commercial kit (Alpha Laboratories Ltd).
  • AST and ALP were determined by a commercial kit (Randox Laboratories).
  • Total bilirubin was determined by the acid diazo method described by Pearlman and Lee (22) using a commercial kit (Alpha Laboratories Ltd).
  • Mouse serum albumin measurements were determined using a commercial serum albumin kit (Alpha Laboratories Ltd).
  • Sections were washed again with PBS before mounting in DAPI- containing fluoromount G and a coverslip. Sections were imaged on Operetta high content imaging system (PerkinElmer) and quantified based on percentage of positive cells containing signal at 546 nm in DAPI-positive regions (nuclei). For colocalisation experiments, dual stains were performed with Hnf4a (goat anti-mouse, Santa Cruz) and CD31 (rabbit anti-mouse, Abeam) using an Alexa Fluor® 488 conjugate (incubated for 60 mins in a dark environment).
  • Serum and liver quantification of pro-inflammatory cytokines A panel of proinflammatory cytokines (IFN-Y, IL-10, IL-12p70, IL- ⁇ ⁇ , IL-2, IL-4, IL-5, IL-6, KC/GRO, TNF- a) were multiplexed in mouse serum or liver homogenates using luminescent-based V-plex pro-inflammatory panel 1 (mouse) kit (Meso Scale Diagnostics) essentially according to the manufacturer's instructions.
  • proinflammatory cytokines IFN-Y, IL-10, IL-12p70, IL- ⁇ ⁇ , IL-2, IL-4, IL-5, IL-6, KC/GRO, TNF- a
  • liver homogenates 75 mg liver tissue was lysed in cold lysis buffer (150 mM NaCI, 20 mM Tris, 1 mM EDTA, 1 mM EGTA, 1 % Triton X-100 (v/v), 2 x protease inhibitor cocktail, (Sigma Aldrich) using a Tissue Tearor homogeniser (Biospec Products). Crude homogenates were centrifuged (20,000g, 10 mins, 4°C) to remove cell debris. Protein concentrations were determined on supernatants using the Bicinchoninic Acid (BCA) assay method.
  • BCA Bicinchoninic Acid
  • cytokine quantification 25 ⁇ _ of serum or 100 ⁇ g liver homogenate was added to each well and mixed with diluent 41 in a volume of 50 ⁇ _ and incubated for 2 hours on a shaking plate-mixer (600 rpm). Wells were washed extensively (PBS, 0.05 % Tween 20 v/v) before application of a cocktail of secondary antibodies. Plate was assayed on a QuickPlex SQ 120 analyzer (Meso Scale Diagnostics) and analytes were quantified based on linear regression against the standard curve of each analyte. Standards were assayed in duplicate as recommended. Due to the high intra-assay precision and high number of biological replicates, samples were assayed in singlet.
  • Quantitect primers against Csf1 , Csf2, Csf3, Ccl2, Ccl3, Ccl5, Ccl7, Ccl12, CxcH , Cxcl2, II-6, Tnf and ⁇ were used for gene expression analysis. Gapdh served as the housekeeping gene.
  • Phagocytosis assays Unpolarised BMDMs (naive), CAMs, or AAMs were used to investigate phagocytosis.
  • BMDMs were incubated with apoptotic thymocytes (primary thymocytes harvested from 3-5 week old C57BL6 mice, treated with 1 ⁇ hydrocortisone, as previous (26).
  • Apoptotic thymocytes were labelled using CMTMR (Invitrogen) according to the manufactuer's instructions (27).
  • BMDMs were challenged with labelled apoptotic cells for 30 mins, 1 hour, or 2 hours at a 1 :5 ratio at 37°C or 4°C.
  • Phagocytosis assays for real time experiments Mouse BMDMs or hMDMs were plated (1x105/well) in 96-well CellCarrier microplates (PerkinElmer) overnight before stimulation with appropriate cytokines (see methods above) to drive polarisation. Before imaging, BMDMs were stained with NucBlue live cell stain (ThermoFisher) and CellMask Deep Red plasma membrane stain (ThermoFisher) according to the manufacturer's instructions. Plates were transferred to Operetta high-content imaging system (PerkinElmer) and allowed to equilibrate at 37 °C and 5 % C02.
  • Phagocytosis was initiated by the addition of pHrodo green zymosan bioparticles (ThermoFisher) to the wells following manufacturer's instructions. Fluorescent images were taken in the DAPI channel, 488 nm, and 647 nm before, and at 5 min intervals after the addition of bioparticles for a maximum of 150 mins. Images were quantified on Columbus image analysis software (PerkinElmer). Macrophages positive for phagocytosis were classified based on a fluorescence intensity (488 nm) greater than 500 and expressed as a fraction of all live cells (NucBlue positive cells). Mean fraction values were taken from four separate wells per group.
  • liver digest, leukocyte isolation, and flow cytometry To examine the localisation and phenotype of transplanted AAMs in vivo, CFSE-stained AAMs or vehicle was transplanted to mice at 16 hours after APAP administration. Three hours later, mice were challenged with an i.v. injection of PKH26PCL (100 ⁇ , 0.1 mM) to label phagocytic cells. At 36 hours, blood was collected from sacrificed mice in EDTA-tubes and processed immediately on a Celltac a analyzer (Nihon Kohden) for haematological analysis. Plasma was harvested from the remainder of the blood via centrifugation (6000 rpm, 10 min, 4 °C) and frozen.
  • PKH26PCL 100 ⁇ , 0.1 mM
  • Liver was digested following methods previously described (15, 28) with minor modifications. Briefly, livers were perfused with PBS and the left lateral lobe was collected at 36 hours post-APAP administration in ice-cold RPMI media. Lobes were mechanically disrupted with a scalpel in 5 ml_ liver digestion enzyme cocktail (Collagenase V, Sigma, 0.8 mg/mL; Collagenase D, Roche, 0.63 mg/mL; Dispase, Gibco, 1 mg/mL; DNase 1 , Roche, 100 ⁇ g/mL). Homogenates were digested for 25 mins in a shaking incubator at 37 °C at 240 rpm.
  • Liver digests were passed through a 70 ⁇ filter and made up to 30 mL with RPMI. Digests were centrifuged (300 g, 5 mins, 4 °C) and washed before red blood cell lysis treatment (Sigma). Cells were counted and stained using a panel of antibodies to target cell surface markers with appropriate controls (i.e. unstained, fluorescence minus one). Nonspecific antibody binding was blocked by incubating cells with 10 % mouse serum for 20 mins at 4 °C followed by incubation with combinations of primary antibodies (each used at 1 :200 dilution) for 20 mins at 4 °C.
  • CD1 1 b BV650 (clone M1/70; Ebioscience), Ly-6C V450 (clone HK1.4; Ebioscience), CD45.2 AF700 (clone 104; Ebioscience), F4/80 APC (dilution 1 :100; clone BM8; Invitrogen), Ly-6G PE-Cy7 (clone 1A8; Biolegend), CD3 PE-Cy7 (clone 17A2; Biolegend), NK1.1 PE-Cy7 (clone PK136; Biolegend), CD19 PE-Cy7 (clone 6D5; Biolegend).
  • BMDMs track to spleen and liver rapidly after intravenous administration: in vivo and ex vivo imaging techniques were employed to monitor the early biodistribution of BMDMs in healthy and APAP-poisoned mice.
  • Vivotrack 680 a fluorescent infra-red imaging agent
  • mice 16 hrs post-APAP administration or healthy controls mice 16 hrs post-APAP administration or healthy controls.
  • An almost linear accumulation of fluorescent signal in the upper abdomen of healthy and APAP- treated mice was observed over the first four hours suggesting gradual localisation in one or more abdominal organ (Fig. 1A,B).
  • BMDMs tolerated Vivotrack labelling well showing no significant reduction in ATP levels post-labelling (Fig. 1 C). Furthermore, fluorescent microscopy showed GFP-positive BMDMs display a strong and uniform infra-red fluorescent signal after vivotrack labelling cells versus unlabelled cells that are only visible at 488 nm (Fig. 1 D). Ex vivo analysis confirmed hepatic and splenic localisation of BMDMs in healthy and APAP-treated mice 4 hours after BMDM administration (Fig. 1 E). There was also substantial signal observed in lung which likely acts as a barrier for venous blood to pass though. Quantification showed that hepatic localisation was higher in healthy mice whilst splenic localisation was equivalent (Fig. 1 F).
  • BMDMs were stained with CFSE (CellTrace, Life Technologies) in vitro, transplanted 16 hours post- APAP, and culled at 36 hours.
  • CFSE-stained cells were detected using DAB-based immunohistochemical staining versus FITC.
  • DAB-positive cells were detected in spleen and liver in FFPE sections that have typical macrophage morphology (Fig. 1 G), but not in lung, heart or brain (data not shown).
  • Fig. 1 G macrophage morphology
  • AAM treatment reduces necrotic area in APAP-treated mice:
  • BMDM transplantation alone in healthy animals did not cause any significant perturbations to circulating liver biomarkers (Fig. 8) routinely measured during clinical chemistry.
  • Fig. 8 circulating liver biomarkers
  • Naive BMDM therapy had no therapeutic benefit given 4 hours after APAP as evidenced by lack of reduction of serum transaminases at 24 hours post-APAP (APAP/PBS vs APAP/BMDMs; ALT: 6365 ⁇ 2955 vs 10603 ⁇ 7974 U/L, AST: 6333 ⁇ 3138 vs 7068 ⁇ 5584 U/L) (Fig. 9).
  • two mice in the BMDM-treated group were culled early for humane reasons after showing an exaggerated phenotype. Therefore, we transplanted BMDMs 16 hours after APAP administration (1x106, i.v.) during the regenerative phase.
  • BMDMs were polarised to different phenotypes in vitro using recombinant factors. Serum ALTs at 36 hours post-APAP were moderately lower in all BMDM-treated groups (Figure 2A, PBS: 3800 ⁇ 1934 U/L vs Naive: 2737 ⁇ 2020, CAMs: 2413 ⁇ 1222, AAMs: 2248 ⁇ 1 196, DAMs: 2993 ⁇ 2182) but did not reach statistical significance. Since serum transaminases have a relatively long circulatory half-life and may still be raised by subsequent injury, we performed haematoxylin and eosin staining on liver tissue harvested at 36 hours.
  • AAM treatment induces parenchymal and non-parenchymal proliferation following APAP-induced liver injury: We measured BrdU incorporation in liver 20 hours after macrophage therapy (36 hrs post-APAP). Mice were pulsed with 1 mg BrdU one hour before cull (i.p.) to label proliferating cells.
  • IF Immunofluorescent
  • a panel of circulating proinflammatory cytokines are lower in polarised- macrophage treated mice following APAP-induced liver injury: We posited that macrophages reduce the inflammatory response after injury to promote healing. To investigate this, we measured a 10-plex panel of inflammatory cytokines (IFN- ⁇ , IL-10, IL- 12p70, IL-1 ⁇ , IL-2, IL-4, IL-5, IL-6, KC/GRO, TNF-a) in mouse serum harvested at 36 hours using electrochemiluminescence technology. Consistently, AAMs showed a substantial reduction in a panel of pro-inflammatory cytokines (Fig.
  • mice treated with naive BMDMs showed reduction in some pro-inflammatory markers, albeit to a lesser extent than the polarised equivalents - IFN- ⁇ (73%, P ⁇ 0.01), CXCL1 (36%, P ⁇ 0.01), TNF (23%, PO.01).
  • MFI mean fluorescence intensity
  • AAMs have a significantly lower percentage of Ly6C positive cells at 30 mins (22 % lower vs naive, 34 % vs CAMs), 60 mins (44 % lower vs naive, 52 % vs CAMs), and 120 mins (61 % lower vs naive, 72 % vs CAMs; Fig 6B).
  • a real-time phagocytosis assay to monitor phagocytosis of pH-sensitive fluorescent microbeads coated with zymosan (a glucan present in yeast) using polarised BMDMs was performed. Concordant to flow cytometry analysis, an increased percentage of pHrodo positive cells in AAMs over time was observed, which plateaued approaching 90 minutes (Fig 6C). Representative images are provided showing an increased phagocytic rate and capacity in AAMs versus naive and CAMs (Fig. 6D).
  • AAMs are highly phagocytic and retain an anti-inflammatory phenotype in vivo: An in vivo phagocytosis experiment was performed to characterise AAMs posttransplantation. CFSE-labelled AAMs were transplanted (5 x 106, i.v.) to mice 16 hours after APAP administration. Three hours later, mice were challenged with an i.v. administration of PKH26 (a red fluorescent dye for specific labelling of phagocytes) to label endogenous and exogenous macrophages (see Fig. 7A for study design).
  • PKH26 a red fluorescent dye for specific labelling of phagocytes
  • Transplanted AAMs in both liver and blood 20 hours after i.v. transplantation were detected, accounting for approximately 1 % of the liver leukocytes harvested during liver digestion (Fig. 7E). Of the transplanted AAMs, 83% of those detected were Ly6Clo, confirming these cells retain their anti-inflammatory phenotype in vivo (Fig. 7F). The percentage of transplanted cells that had phagocytosed PKH26 based on their Ly6C expression was measured. 70% of Ly6Chi cells, and over 98% of Ly6Clo cells were PKH26 positive suggesting transplanted AAMs are highly phagocytic in situ.
  • APAP poisoning is a common reason to attend hospital accounting for many thousands of emergency room admissions in the United States and United Kingdom per annum.
  • the mainstay of treatment involves early administration of NAC, a sulfhydryl donor, to boost the antioxidant capacity in the liver before widespread injury occurs.
  • NAC a sulfhydryl donor
  • APAP poisoning represents the leading cause of ALF in the United States with liver transplantation the only effective therapy. Therefore, there is a clinical need to identify and develop novel therapeutic strategies to treat patients with bona fide liver injury in order to reduce the risk of ALF.
  • a treatment to expedite recovery from ALI and reduce the associated costs and clinical expenditure would also be highly beneficial.
  • BMDMs intravenously (via tail vein) to the liver and spleen within four hours in healthy and APAP poisoned mice.
  • the lung is another obstacle for cells after i.v. injection, but macrophages are suited for peripheral administration due to their relatively small size. In fact, we did not observe any macrophages in the lung 20 hours after administration suggesting that lung localisation is temporary after a bolus injection. Nevertheless, pulmonary embolism remains a safety concern.
  • Hepatocyte death during APAP-ALI is the priming event of the activation of the innate immune system, through release of inflammatory mediators and danger associated molecular patterns (DAMPs), e.g. HMGB1 (35).
  • DAMPs danger associated molecular patterns
  • HMGB1 danger associated molecular patterns
  • Replenishment of this innate immune capacity via adoptive transfer of phagocytes may limit the inflammatory signals released from dying cells, or from gut-derived pathogens, in order to reduce systemic inflammation, and prevent progression towards ALF.
  • One potential safety concern of macrophage-therapy for livery injury is the potential for transplanted macrophages themselves become proinflammatory and exacerbate inflammation and injury, however, we found that once primed in culture to an alternatively-activated phenotype, the transplanted AAMs retained their antiinflammatory phenotype in vivo at least for 20 hours (Fig. 7F).
  • liver regeneration following APAP-ALI is an important feature in the resolution of injury. We found an 8-fold increase in the number of proliferating cells at 36 hours post- APAP suggesting AAM therapy accelerates the regenerative response. This demonstrates that AAMs may have utility in treating various causes of liver injury.
  • Dual staining revealed proliferating cells were of hepatocellular (Hnf4a positive) and endothelial (CD31 positive) origin.
  • Centrilobular hepatocytes are the main site of injury, since these CYP2E1 -positive cells generate the toxic metabolite of APAP, N-acetyl-p-benzo- quinoneimine (NAPQI) that ultimately causes cell death.
  • NAPQI N-acetyl-p-benzo- quinoneimine
  • liver sinusoidal endothelial cells are also known to become perturbed during APAP-ALI (38, 39). Regeneration of the both the parenchyma and the vasculature are perhaps key mechanisms during AAM-mediated repair of the liver.
  • AAMs remove necrotic material due to their highly phagocytic phenotype.
  • CAMs which display a diminished phagocytic capacity, also partly reduced inflammation and stimulated proliferation, albeit to a lesser extent than AAMs.
  • transplanted BMDMs provide a therapeutic secretome and deliver trophic factors to reduce inflammation or promote liver regeneration in situ.
  • transplanted BMDMs are detectable for at least 7 days after transplantation in fibrotic liver via direct hepatic portal vein injection (18).
  • Our group have also used SPIONs to detect BMDMs via MRI not more than 3 weeks in healthy mice, (data not shown).
  • the transient nature of these cells might be beneficial to allow the natural clearance of transplanted cells over several weeks permitting the liver to return to its normal physiological condition.
  • the transient nature of this therapy a concern since the therapeutic window is likely to occur within the first 48 hours post-transplantation. Nevertheless, the pharmacokinetics of this cell based therapy could be optimised to compare multiple rounds of BMDM administrations, if necessary, or supply a constant infusion of BMDMs to reduce the risk of embolism.
  • APAP poisoning is a medical emergency which can lead to ALF devastatingly quickly. This is in contrast to other liver diseases such as liver fibrosis where patients can be monitored for weeks and months before and after treatment allowing time for cell harvest, expansion, characterisation, and re-infusion.
  • liver fibrosis where patients can be monitored for weeks and months before and after treatment allowing time for cell harvest, expansion, characterisation, and re-infusion.
  • an existing bank of macrophages could be set up so that AAMs could be administered immediately in an intensive care unit.
  • iPSCs human induced pluripotent stem cells
  • BMDMs with defined factors to a highly phagocytic phenotype
  • these cells can serve as a cell therapy to stimulate cell proliferation, reduce systemic inflammation, and ameliorate necrotic lesions in liver injury (e.g. during the regenerative phase of APAP-ALI).
  • AAMs may represent a promising cytotherapy to expedite liver tissue repair that has translational potential.
  • EXAMPLE 2 Murine Embryonic Stem Cell Derived Macrophages (ESDM)
  • ⁇ ESDMs reduced fibrosis in a murine model of liver injury and stimulated a ductular response, features seen with BMDM therapy
  • ESDM show some similarity to tissue-resident macrophages, possibly reflecting their developmental origin.
  • ESDMs repopulated the Kupffer cell compartment of mice that had been depleted of macrophages using liposomal clodronate
  • EBs adhere to tissue culture plastic and release non-adherent macrophage progenitor cells into the medium. These cells are harvested and plated onto non-treated Petri dishes in the presence of CSF-1 alone. They give rise to macrophages that adhere to the plastic and form a monolayer.
  • Embryonic stem cell derived macrophages (ESDMs) and BMDMs had a comparable morphology but ESDMs appeared slightly larger in size than BMDMs ( Figure 16A-C).
  • Flow cytometry analyses revealed that over 90% of ESDMs were double positive for the macrophage markers, F4/80 and CD11 b, and that cells derived from different time points during the differentiation process (day 10 to 20) demonstrated comparable levels of cell surface marker expression (Figure 16E, F).
  • the population of BMDMs had a slightly lower percentage of double positive F4/80 and CD1 1 b cells indicating BMDMs generated in this protocol were more heterogeneous than ESDMs (Figure 16D, F).
  • ESDMs and BMDMs were primed in vitro to adopt a M1- or M2-like phenotype by treating them with LPS and IFNy or IL-4, respectively.
  • LPS nitric oxide
  • IFNy or IL-4 IL-4
  • ESDMs as an effective cell therapy in a murine model of liver fibrosis
  • mice were treated with carbon tetrachloride CCI 4 twice weekly for four weeks with a proportion being randomly selected to receive either 10 or 20 x 10 6 ESDM intravenously at the start of the second week. Mice were sacrificed 21 days after ESDM injection and livers were processed for immunohistochemistry (Figure 18A).
  • BMDM therapy had previously been shown to ameliorate fibrosis so we assessed whether ESDMs also had an effect on hepatic fibrosis using Picro Sirius Red (PSR) stain for hepatic collagens.
  • PSR Picro Sirius Red
  • ESDMs can be produced on a large scale and they have the potential to modulate the effect of liver injury by reducing the density of myofibroblasts and resultant collagen deposition.
  • the cell number of ESDM used in these experiments was 10 fold higher than that used for BMDMs in previous studies.
  • Do ESDMs have a phenotype comparable to tissue resident macrophages?
  • Haematopoietic cells derived from ESCs in vitro are thought to be more related to the blood cells associated with the primitive wave of haematopoiesis in the yolk sac during development (Zambidis, ET, Peault, B, Park, TS, Bunz, F & Civin, CI 2005, 'Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development' Blood, vol 106, no. 3, pp. 860-870. DOI: 10.1182/blood-20Q4-11 -4522).
  • Tissue resident macrophages are known to be derived from the primitive wave of haematopoiesis, well before the appearance of haematopoietic stem cells (HSC) in the embryo and develop in the absence of Myb, an important HSC transcription factor (Schulz, C. et al. A lineage of myeloid cells independent of Myb and hematopoietic stem cells. Science 336, 86-90, doi: 10.1 126/science.1219179 (2012)).
  • HSC haematopoietic stem cells
  • ESDM and BMDM were labelled with CFSE cell tracking dye (Molecular probes, Life Technologies) and 5 x 10 6 cells were injected intravenously 48 hours after liposomal clodronate treatment (Figure 20 D). Liver, lung, kidney and heart tissue was harvested 24 hours later and immunostaining using an anti-FITC antibody (which detects all derivatives of fluorescein including CFSE) was used to detect the injected CFSE- stained cells ( Figure 20 E-H, R). CFSE + cells were detected in liver sections derived from liposomal clodronate treated mice that received either BMDM or ESDM.
  • CFSE cell tracking dye Molecular probes, Life Technologies
  • Serum analysis was carried out to assess the effects of the treatments carried out on liver function of the mice ( Figure 20 ⁇ , ⁇ ).
  • Alkaline phosphatase (ALP) levels were significantly elevated in liposomal clodronate treated mice compared to PBS control mice indicating liver damage.
  • ALP levels were significantly lowered in mice that received ESDM, compared to controls indicating that ESDMs had some reparative effect.
  • Serum albumin levels of ESDM recipient mice were also comparable to healthy controls.
  • ESDMs Similar to BMDMs, ESDMs exhibited a highly dynamic switch in gene expression for markers of alternative activation (Ym-1 , Fizz, MR, Arg-1) after overnight polarisation with IL-4/IL-13 confirming these signalling pathways are intact in these cells (Figure 22). Furthermore, polarised ESDMs were shown to be capable of phagocytic ingestion of apoptotic material, a proposed therapeutic mechanism of these cells in the liver injury model: we demonstrate that polarised ESDMs can readily phagocytose fluorescently-labelled apoptotic thymocytes in vitro ( Figure 23). Finally, we show via cell tracking that ESDMs populate the liver and spleen soon after i.v. injection ( Figure 25) analogous to BMDMs. Results indicate that ESDMs have therapeutic capacity analogous to primary BMDMs in a model of acute liver injury.
  • DISCUSSION [00134] We developed a live imaging assay to evaluate macrophage phagocytic ability. This allowed us to monitor not only the number of particles engulfed at the end, but also the rate at which macrophages phagocytosed the particles. We found that unstimulated ESDM did not phagocytose as fast or as many bioparticles as BMDM. Furthermore, ESDM and BMDM primed towards the M2-like phenotype phagocytosed more bioparticles than their M1-primed equivalents
  • ESDM aids fibrosis regression in a murine model of liver fibrosis
  • ESDM are more efficient at repopulating a Kupffer cell-depleted liver than BMDM
  • Mouse ESC maintenance and differentiation The mouse embryonic stem cell (ESC) line E14IV was maintained in Glasgow Minimum Essential Medium (Gibco) supplemented with 10% fetal calf serum (FCS) (Lonza), 2 mM Sodium pyruvate (Gibco), 4 mM L-glutamine (Gibco), 1 % Non- essential amino acids (Gibco) and 0.1 mM ⁇ -mercaptoethanol (Sigma) and 100 U/ml of Leukaemia Inhibitory Factor (LIF) as previously described (Jackson, M., Taylor, A.
  • LIF Leukaemia Inhibitory Factor
  • EBs were plated onto gelatinised tissue- culture dishes then non-adherent cells were harvested from these cultures on alternate days (day 10 to 20) then plated onto non-treated bacteriological Petri dishes in Differentiation medium without IL-3. These monocyte-like cells adhered to the plastic petri-dishes forming a monolayer and matured into embryonic stem cell derived macrophages (ESDM).
  • ESDM embryonic stem cell derived macrophages
  • Bone marrow derived macrophages Bone marrow was flushed from murine femurs and tibia, cultured in Ultra-low attachment 25 cm 2 flasks (Corning) in Dulbecco's Modified Eagle Medium (DMEM) (Sigma) with 10% FCS, 15% L929-conditioned media and 1 % Pen/Strep for 7 days (with a media change on day 4) then bone marrow-derived macrophages (BMDM) were harvested by collecting all adherent and non-adherent cells.
  • DMEM Dulbecco's Modified Eagle Medium
  • Cytospin and Rapid Romanowsky Staining Cytospins of macrophages were prepared by harvesting, counting and re-suspending 1 ⁇ 10 5 macrophages in 200 PBS. They were cytocentrifuged at 300 g for 3 minutes in a Thermo Shandon Cytospin 4 and allowed to air dry. The Rapid Romanowsky Stain Pack (TCS Biosciences) was used to fix and stain the cells as per manufacturer's instructions. The slides were rinsed briefly in water, air-dried and mounted with Mowiol (Sigma).
  • Macrophage polarisation Adherent ESDM and BMDM were primed in vitro to adopt a M1- or M2-like phenotype by treating with LPS (0.1 ⁇ g/ml)(Sigma L4391-1 mg) and IFNy (10 U/ml) or IL-4 (20 ng/ml) respectively for 48 hours.
  • LPS 0.1 ⁇ g/ml
  • IFNy 10 U/ml
  • IL-4 20 ng/ml
  • the Griess Reagent System Promega was used to measure NO " levels in culture supernatants according to the manufacturer's instructions.
  • Flow cytometry Cells were harvested, counted and 1 ⁇ 10 6 cells were resuspended in 100 ⁇ _ PBS containing 1 % Bovine Serum Albumin (BSA).
  • BSA Bovine Serum Albumin
  • Pre-conjugated antibodies were added at their optimal concentrations and incubated on ice for 20 minutes. Cells were subsequently washed in 2 mL PBS (containing 1 % BSA) and centrifuged at 400 g for 5 minutes. Cell pellets were resuspended in 200 ⁇ _ PBS with 1 % BSA. In most experiments cells were stained with a Live/Dead cell viability stain such as DAPI or 7- AAD.
  • the following anti-mouse antibodies were used: anti-F4/80 APC (BioLegend), anti- CD11 b Alexafluor 488 (BioLegend).
  • the following anti-human antibodies were used: anti- CD93 PE (eBioscience), anti-25F9 APC (eBioscience), anti-CD1 1 b Alexafluor 488 (BioLegend).
  • Quantitative Real-Time PCR Quantitative Real-Time PCR (qRT-PCR): qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems) and analysed with SDS software Version 1.4 (Applied Biosystems). The Taqman Fast Universal PCR Master Mix (2x) (Applied Biosystems) was used with UPL assays that were designed on the Universal Pro be Library System Assay Design Center (Roche)(Table 1). The AACt method was used with GAPDH to normalize cDNA levels and the "control" sample of each experiment was used as a calibrator to calculate relative change in gene expression. All data is presented as fold-change over the expression level of the calibrator.
  • FIZZ1 TATGAACAGATGGGCCTCCT AGGCAGTTGCAAGTATCTCCA
  • TGM2 TCACCTTCAGTGTCGTGACC C AG C ATCTCTTAGTG G A AA ACG
  • Phagocytosis assay by Live Imaging 1 ⁇ 10 5 macrophages were plated in tissue-culture grade 96-well plates (CellCarrier, PerkinElmer) three days prior to imaging. Cells were washed with PBS, 10 ⁇ NucBlue Live ReadyProbes Reagent (Molecular Probes) (two drops per 1 ml PBS) was added to each well and incubated at 37°C for 20 minutes. Cells were washed with PBS and treated with 100 ⁇ /well of CellMaskTM Deep Red Plasma membrane Stain (Molecular Probes) as per the manufacturer's instructions and incubated for a further 30 minutes. CellMaskTM reagent was aspirated and 100 PBS was added to each well.
  • pHrodoTM Green Zymosan A BioParticles Conjugate (Molecular Probes) was resuspended in 2 ml PBS at 0.5 mg/mL, thoroughly vortexed and briefly sonicated then further diluted 1 :5 in PBS. 100 of pHrodoTM BioParticles were added to each immediately prior to imaging. Imaging was performed on the Operetta High-Content Imaging System (Perkin Elmer) at 5 minute intervals, at 40X magnification, and images were analyzed on the Harmony High-Content Imaging and Analysis Software (Perkin Elmer). Each experiment was carried out three times, and included 3 technical replicates.
  • Murine embryonic stem cell-derived macrophages A pure population of mESDMS were differentiated from murine E14 mouse embryonic stem cell line (Handyman et al., 1989) essentially as described previously (Zhuang et al. 2012). Briefly, ESCs were cultured with GMEM containing recombinant IL-3 (1 ⁇ g/mL) and L929-conditioned medium containing m-CSF (15% v/v) for 8-days to yield non-adherent macrophage progenitor cells. Macrophage progenitors were matured in GMEM containing only L929-conditioned medium containing m-CSF (15% v/v) for 6-10 days after.
  • mESDMs were harvested from ultra-low attachment flasks (Corning), counted and polarised in GMEM containing recombinant murine IL-4 (20 ng/mL), IL-13 (20 ng/mL), and CSF1 (20 ng/mL) for 24 hours.
  • Polarised ESDMs were harvested, counted, and stained with CFSE before injection into mice with acetaminophen (APAP)-induced liver injury (5x10 6 , i.v.).
  • APAP acetaminophen
  • APAP-induced liver injury Prior to APAP administration, mice were fasted for 14 hours. Mice received either a single injection of APAP (350 mg/kg, i.p.) in warm saline or saline alone. CFSE-stained ESDMs were resuspended in Dulbecco's Phosphate-Buffered Saline (DPBS) and administered (5x10 6 cells, 100 ⁇ _) via tail vein to mice 16 hours after APAP administration. One hour before cull, mice were pulsed with 1 mg (i.p.) of 5-Bromo- 2'-deoxyuridine (BrdU, Sigma Aldrich) in PBS to label proliferating cells.
  • DPBS Dulbecco's Phosphate-Buffered Saline
  • mice were culled and whole blood was collected via cardiac puncture. Serum was collected via centrifugation (14,000 g, 4°C) after clotting. Liver tissue was harvested and fixed in formalin (20 hours) or frozen on dry ice and stored at -80 °C before analysis.
  • Necrosis quantification Four micron sections of liver tissue were cut on a rotary microtome and collected on Surgipath Superior Adhesive Slides (Leica Biosystems) and dried overnight at 45 °C. Sections were stained with haematoxylin and eosin on a Shandon Varistain Gemini ES Automated Slide Stainer (ThermoScientific) and mounted using the Shandon ClearVue Coverslipper (ThermoScientific).
  • ESDM cytokine-induced polarisation on ultra-low attachment plastics in vitro
  • ESDM were seeded at 2.5 x 105 cells/well in 24 well plastic plates or 24-well ultra-low attachment plates.
  • Cells were allowed to adhere overnight in complete media (DMEM:F12 media containing 20 ng/mL CSF1).
  • RNA was harvested from cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions.
  • Phagocytosis assays AAMs were incubated with apoptotic thymocytes (primary thymocytes harvested from 3-5 week old C57BL6 mice, treated with 1 ⁇ hydrocortisone, as previous) (30). Apoptotic thymocytes were labelled using CMTMR (Invitrogen) according to the manufactuer's instructions (31). BMDMs were challenged with labelled apoptotic cells for 30 mins, 1 hour, or 2 hours at a 1 :5 ratio at 37°C or 4°C.
  • the slides were incubated with secondary biotinylated goat anti-rabbit antibody (Vector, BA-1000) diluted 1 :500 in antibody diluent and incubated for 1 hour at room temperature.
  • the slides were rinsed in PBS.
  • the slides were incubated with Vector RTU ABC reagent (Vector) for 30 min at room temperature to allow DAB detection.
  • the slides were rinsed in PBS and then incubated with DAB reagent (Dako) for 5 min at room temperature in the dark.
  • the slides were rinsed in PBS.
  • the slides were counterstained in Harris haematoxylin and then placed briefly in Scott's tap water.
  • the slides were dehydrated through alcohols (70%-100%) and cleaned in xylene.
  • the slides were mounted in Pertex mounting medium and imaged using Nikon Eclipse E600 microscope equipped with Qlmaging Retiga 2000R camera.
  • EXAMPLE 3 Human iPSC Derived Macrophages
  • the human induced pluripotent stem cell line, SFCi55 was generated in house and was confirmed to be pluripotent and have a normal karyotype (Yang, C-T., Ma- R., Axton, R., Jackson, M., Taylor, H., Fidanza, A., Marenah L, Frayne, J., Mountford, J & Forrester, L.M. (2016).
  • Activation of KLFI Enhances the Differentiation and Maturation of Red Blood Cells from Human Pluripotent Stem Cells. Stem Cells 10. 1002/stem.2562).
  • StemPro medium prepared by supplementing DMEM/F12 with Glutamax (Invitrogen) with StemPro supplement (Invitrogen), 1.8% BSA (Invitrogen), 0.1 mM ⁇ - mercaptoethanol (Invitrogen) and 20 ng/ml human basic FGF (Invitrogen).
  • the method for differentiation of iPSCs to macrophages was adapted from van Wilgenburg et al. On Day 0, spent medium was removed from one confluent well of a 6-well plate, and replaced with 2 ml StemPro (ThermoFisher) supplemented with cytokine Mix 1 (50 ng/ml BMP4, 50 ng/ml VEGF, and 20 ng/ml SCF).
  • EBs embryoid bodies
  • EBs were lifted and transferred to gelatin-coated tissue-culture grade 6-well plates in X-VIVOTM 15 media supplemented with cytokine Mix 2 (100 ng/ml M-CSF, 25 ng/ml IL3, 2 mM Glutamax, 1 % Penicillin/Streptomycin, 0.055 M ⁇ - mercaptoethanol). Approximately 30 EBs were plated in each well. EBs were maintained in this medium for the remaining duration of the protocol, with spent medium being replaced with fresh medium every 3-4 days.
  • cytokine Mix 2 100 ng/ml M-CSF, 25 ng/ml IL3, 2 mM Glutamax, 1 % Penicillin/Streptomycin, 0.055 M ⁇ - mercaptoethanol.
  • the EBs produced macrophage progenitors in the culture supernatant and these were harvested and transferred to 10 cm 2 bacteriological dishes in X-VIVOTM 15 medium supplemented with cytokine Mix 3 (100 ng/ml M-CSF, 2 mM Glutamax, 1 % Penicillin/Streptomycin) and allowed to mature for 5-7 days into iPSC-derived macrophages (iPSC-DM).
  • Macrophage progenitors could be harvested twice a week for approximately 2 months.
  • iPSC-DM human iPSC-derived macrophages
  • Figure 18B The human iPSC-derived macrophages (iPSC-DM) that were generated expressed both the mature macrophage-specific cell surface marker 25F9 and CD11 b ( Figure 18B) and did not express the monocyte marker CD93 ( Figure 26A).
  • i PSC-derived macrophages also express CD45, CD169, CD163, CD14, CD43, CD206, CD1 15, CD86, CXCR1 , CCR2, CCR5 and CCR8 ( Figures 27 and 28).
  • There is a low level of VCAM and CD15 in a small proportion of iPSCs Figure 27F, G).
  • iPSCDM do not express HLA-DR. ( Figures 28D).
  • M1-related genes CD40 and CD80 were upregulated when activated by LPS-IFNy, whereas M2-related genes TGM2 and MRC1 gene expression were elevated in response to IL4 (Figure 26C-F).
  • EXAMPLE 3 Determining the transcriptional profile of alternatively- activated macrophages following injection into mice with paracetamol (APAP)- induced acute liver injury (APAP-ALI).
  • CFSE-stained AAMs were collected from digested livers of healthy and APAP- poisoned mice as above, except collected directly into lysis buffer (Qiagen) after sorting via FACS (FACS ARIA II, BD Biosciences). Cell yields ranged from
  • AAMs generally retain their anti-inflammatory phenotype with 95% of genes analysed unaltered between APAP-treated and PBS-treated mice. Thus, the results indicated that AAMs retain their M2 phenotype in a pro-inflammatory environment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pain & Pain Management (AREA)
  • Virology (AREA)
  • Transplantation (AREA)
  • Dermatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/GB2017/052769 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of liver injury Ceased WO2018051136A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US16/331,787 US11285174B2 (en) 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of liver injury
JP2019515418A JP7115755B2 (ja) 2016-09-19 2017-09-18 肝損傷の処置における使用のためのマクロファージに基づく治療法
CN201780056623.2A CN109789163A (zh) 2016-09-19 2017-09-18 用于在治疗肝损伤中使用的基于巨噬细胞的疗法
EP17783964.4A EP3515460B1 (en) 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of acute liver injury
AU2017328913A AU2017328913B2 (en) 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of liver injury
EP25198861.4A EP4640237A3 (en) 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of acute liver injury

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB1615923.8 2016-09-19
GBGB1615923.8A GB201615923D0 (en) 2016-09-19 2016-09-19 Macrophage-based therapy
GBGB1707183.8A GB201707183D0 (en) 2017-05-05 2017-05-05 Macrophage-based therapy
GB1707183.8 2017-05-05

Publications (2)

Publication Number Publication Date
WO2018051136A1 true WO2018051136A1 (en) 2018-03-22
WO2018051136A9 WO2018051136A9 (en) 2019-02-07

Family

ID=60083347

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2017/052769 Ceased WO2018051136A1 (en) 2016-09-19 2017-09-18 Macrophage-based therapy for use in the treatment of liver injury

Country Status (6)

Country Link
US (1) US11285174B2 (https=)
EP (2) EP4640237A3 (https=)
JP (1) JP7115755B2 (https=)
CN (1) CN109789163A (https=)
AU (1) AU2017328913B2 (https=)
WO (1) WO2018051136A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2572005A (en) * 2018-03-16 2019-09-18 Univ Court Univ Of Edinburgh Macrophage-based therapy
CN111933006A (zh) * 2020-07-30 2020-11-13 四川大学华西医院 一种模拟巨噬细胞改善小鼠急性肾损伤实验的方法及系统
CN112955161A (zh) * 2018-09-06 2021-06-11 泰克年研究发展基金会公司 通过活化细胞修复组织
WO2021240169A1 (en) * 2020-05-27 2021-12-02 University Court Of The University Of Edinburgh Cryopreserving macrophages
WO2023075623A1 (en) * 2021-10-26 2023-05-04 Ineb (Instituto Nacional De Engenharia Biomédica) Macrophage phenoypes for use in the treatment of intravertebral discs

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017072580A1 (en) 2015-10-30 2017-05-04 Biolamina Ab Methods for producing hepatocytes
CN114622017A (zh) * 2020-12-14 2022-06-14 中山大学孙逸仙纪念医院 Isg15、isg15诱导的巨噬细胞及其分泌物在肿瘤治疗中的应用
US20230241250A1 (en) * 2022-02-01 2023-08-03 Massachusetts Institute Of Technology Methods and Compositions to Target and Treat Macrophages
CN115212320B (zh) * 2022-08-04 2025-07-15 温州医科大学慈溪生物医药研究院 一种双靶向脂质体及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103977029A (zh) * 2014-04-11 2014-08-13 中国人民解放军第四军医大学 经典激活的巨噬细胞在治疗肝纤维化的应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10724003B2 (en) * 2015-01-16 2020-07-28 Agency For Science, Technology And Research Method of differentiating human pluripotent stem cells into primitive macrophages

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103977029A (zh) * 2014-04-11 2014-08-13 中国人民解放军第四军医大学 经典激活的巨噬细胞在治疗肝纤维化的应用

Non-Patent Citations (80)

* Cited by examiner, † Cited by third party
Title
A. M. LARSON ET AL.: "Acetaminophen-induced acute liver failure: Results of a United States multicenter, prospective study", HEPATOLOGY, vol. 42, 11 January 2011 (2011-01-11), pages 1364
ANTONIO SICA ET AL: "Macrophage plasticity and polarization: in vivo veritas", JOURNAL OF CLINICAL INVESTIGATION, vol. 122, no. 3, 1 March 2012 (2012-03-01), pages 787 - 795, XP055111479, ISSN: 0021-9738, DOI: 10.1172/JCI59643 *
B. GAO; W. I. JEONG; Z. TIAN: "Liver: An organ with predominant innate immunity", HEPATOLOGY, vol. 47, February 2008 (2008-02-01), pages 729
B. M. STUTCHFIELD ET AL.: "CSF1 Restores Innate Immunity After Liver Injury in Mice and Serum Levels Indicate Outcomes of Patients With Acute Liver Failure", GASTROENTEROLOGY, vol. 149, December 2015 (2015-12-01), pages 1896
BIRD, T. G. ET AL.: "Bone marrow injection stimulates hepatic ductular reactions in the absence of injury via macrophage-mediated TWEAK signaling", PROC NATL ACAD SCI U S A, vol. 110, 2013, pages 6542 - 6547
BIRD, T. G. ET AL.: "Bone marrow injection stimulates hepatic ductular reactions in the absence of injury via macrophage-mediated TWEAK signaling", PROC NATL ACAD SCI USA, vol. 110, 2013, pages 6542 - 6547
BUCHRIESER, J.; JAMES, W.; MOORE, M. D.: "Human Induced Pluripotent Stem Cell-Derived Macrophages Share Ontogeny with MYB-Independent Tissue- Resident Macrophages", STEM CELL REPORTS, vol. 8, pages 334 - 345
C. A. SCHNEIDER; W. S. RASBAND; K. W. ELICEIRI: "NIH Image to ImageJ: 25 years of image analysis", NAT METHODS, vol. 9, July 2012 (2012-07-01), pages 671
C. C. BAIN ET AL.: "Long-lived self-renewing bone marrow-derived macrophages displace embryo-derived cells to inhabit adult serous cavities", NAT COMMUN, vol. 7, 2016
C. G. ANTONIADES ET AL.: "Reduced monocyte HLA-DR expression: a novel biomarker of disease severity and outcome in acetaminophen-induced acute liver failure", HEPATOLOGY, vol. 44, July 2006 (2006-07-01), pages 34
C. G. ANTONIADES ET AL.: "Source and characterization of hepatic macrophages in acetaminophen-induced acute liver failure in humans", HEPATOLOGY, vol. 56, August 2012 (2012-08-01), pages 735
C. JU ET AL.: "Protective role of kupffer cells in acetaminophen-induced hepatic injury in mice", CHEM.RES. TOXICOL., vol. 15, 2002, pages 1504
D. A. FERENBACH ET AL.: "Macrophages expressing heme oxygenase-1 improve renal function in ischemia/reperfusion injury", MOL THER, vol. 18, September 2010 (2010-09-01), pages 1706
D. J. ANTOINE ET AL.: "Mechanistic biomarkers provide early and sensitive detection of acetaminophen-induced acute liver injury at first presentation to hospital", HEPATOLOGY, vol. 58, August 2013 (2013-08-01), pages 777
D. S. GILCHRIST; J. URE; L. HOOK; A. MEDVINSKY: "Labeling of hematopoietic stem and progenitor cells in novel activatable EGFP reporter mice", GENESIS, vol. 36, July 2003 (2003-07-01), pages 168
DREYMUELLER, D. ET AL.: "Embryonic stem cell-derived M2-like macrophages delay cutaneous wound healing", WOUND REPAIR AND REGENERATION, vol. 21, 2016, pages 44 - 54
E. FRANK; M. HALL; L. TRIGG; G. HOLMES; I. H. WITTEN: "Data mining in bioinformatics using Weka", BIOINFORMATICS, vol. 20, 12 October 2004 (2004-10-12), pages 2479, XP055196256, DOI: doi:10.1093/bioinformatics/bth261
E. ZIGMOND ET AL.: "Infiltrating monocyte-derived macrophages and resident kupffer cells display different ontogeny and functions in acute liver injury", J IMMUNOL, vol. 193, 1 July 2014 (2014-07-01), pages 344
F. C. PEARLMAN; R. T. LEE: "Detection and measurement of total bilirubin in serum, with use of surfactants as solubilizing agents", CLIN CHEM, vol. 20, April 1974 (1974-04-01), pages 447
FRIEDMAN, S. L.: "Mechanisms of hepatic fibrogenesis", GASTROENTEROLOGY, vol. 134, 2008, pages 1655 - 1669, XP022632381, DOI: doi:10.1053/j.gastro.2008.03.003
G. OSTAPOWICZ ET AL.: "Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States", ANN INTERN MED, vol. 137, 17 December 2002 (2002-12-17), pages 947
GORDON ET AL., IMMUNITY, vol. 32, no. 201, pages 593 - 604
GORDON SIAMON ET AL: "Alternative activation of macrophages: mechanism and functions.", IMMUNITY, vol. 32, no. 5, 28 May 2010 (2010-05-28), pages 593 - 604, XP002776700, ISSN: 1097-4180, DOI: 10.1016/j.immuni.2010.05.007 *
GORDON SIAMON: "Alternative activation of macrophages", THE JOURNAL OF IMMUNOLOGY, vol. 3, no. 1, 1 January 2003 (2003-01-01), NATURE PUB. GROUP, GB, pages 23 - 35, XP002565133, ISSN: 1474-1733, DOI: 10.1038/NRI978 *
H. U. BERGMEYER; P. SCHEIBE; A. W. WAHLEFELD: "Optimization of methods for aspartate aminotransferase and alanine aminotransferase", CLIN CHEM, vol. 24, January 1978 (1978-01-01), pages 58
H. ZHANG ET AL.: "Functional analysis and transcriptomic profiling of iPSC-derived macrophages and their application in modeling Mendelian disease", CIRC RES, vol. 117, 19 June 2015 (2015-06-19), pages 17
HALE ET AL.: "Induced Pluripotent Stem Cell Derived Macrophages as a Cellular System to Study Salmonella and Other Pathogens", PLOS, Retrieved from the Internet <URL:http://dx.doi.org/10.1371/journal.pone.0124307>
HOLT MICHAEL P ET AL: "Identification and characterization of infiltrating macrophages in acetaminophen-induced liver injury.", December 2008 (2008-12-01), pages 24PP, XP002776701, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2614594/?report=printable> [retrieved on 20171211], DOI: 10.1189/jlb.0308173 *
HUME, D. A.; MACDONALD, K. P.: "Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling", BLOOD, vol. 119, 2012, pages 1810 - 1820, XP002720010, DOI: doi:10.1182/blood-2011-09-379214
J. A. THOMAS ET AL.: "Macrophage therapy for murine liver fibrosis recruits host effector cells improving fibrosis, regeneration, and function", HEPATOLOGY, vol. 53, June 2011 (2011-06-01), pages 2003
J. C. MOSSANEN ET AL.: "Chemokine (C-C motif) receptor 2-positive monocytes aggravate the early phase of acetaminophen-induced acute liver injury", HEPATOLOGY, 15 June 2016 (2016-06-15)
J. CANALESE ET AL.: "Reticuloendothelial system and hepatocytic function in fulminant hepatic failure", GUT, vol. 23, April 1982 (1982-04-01), pages 265
J. K. MOORE ET AL.: "Phenotypic and functional characterization of macrophages with therapeutic potential generated from human cirrhotic monocytes in a cohort study", CYTOTHERAPY, vol. 17, November 2015 (2015-11-01), pages 1604
J. SCHINDELIN ET AL.: "Fiji: an open-source platform for biological-image analysis", NAT METHODS, vol. 9, July 2012 (2012-07-01), pages 676, XP055343835, DOI: doi:10.1038/nmeth.2019
JACKSON, M.; TAYLOR, A. H.; JONES, E. A.; FORRESTER, L. M.: "The culture of mouse embryonic stem cells and formation of embryoid bodies", METHODS MOL BIOL, vol. 633, 2010, pages 1 - 18
JAKUBOWSKI, A. ET AL.: "TWEAK induces liver progenitor cell proliferation", J CLIN 548 INVEST, vol. 115, 2005, pages 2330 - 2340
K. ALASOO ET AL.: "Transcriptional profiling of macrophages derived from monocytes and iPS cells identifies a conserved response to LPS and novel alternative transcription", SCI REP, vol. 5, 2015, pages 12524
KLIMCHENKO, O. ET AL.: "Monocytic cells derived from human embryonic stem cells and fetal liver share common differentiation pathways and homeostatic functions", BLOOD, vol. 117, 2011, pages 3065 - 3075
L. BOSURGI ET AL.: "Vessel-associated myogenic precursors control macrophage activation and clearance of apoptotic cells", CLIN EXP IMMUNOL, vol. 179, no. 62, January 2015 (2015-01-01), pages 28
L. F. PRESCOTT; R. N. ILLINGWORTH; J. A. J. H. CRITCHLEY: "Intravenous N-acetylcysteine: The treatment of choice for paracetamol poisoning", BR.MED.J., vol. 2, 1979, pages 1097
L. P. JAMES ET AL.: "Elevation of serum interleukin 8 levels in acetaminophen overdose in children and adolescents", CLIN PHARMACOL THER, vol. 70, September 2001 (2001-09-01), pages 280
LU, W. Y. ET AL.: "Hepatic progenitor cells of biliary origin with liver repopulation capacity", NAT CELL BIOL, vol. 17, 2015, pages 971 - 983
M. NISHIDA ET AL.: "Adoptive transfer of macrophages ameliorates renal fibrosis in mice", BIOCHEM BIOPHYS RES COMMUN, vol. 332, 24 June 2005 (2005-06-24), pages 11, XP027229822, DOI: doi:10.1016/j.bbrc.2005.04.083
MUCCI ET AL.: "Murine iPSC-Derived Macrophages as a Tool for Disease Modeling of Hereditary Pulmonary Alveolar Proteinosis due to Csf2rb Deficiency", STEM CELL REPORTS, vol. 7, no. 2, 9 August 2016 (2016-08-09), pages 292 - 305
MURRAY PETER J ET AL: "Macrophage Activation and Polarization: Nomenclature and Experimental Guidelines", IMMUNITY, vol. 41, no. 1, July 2014 (2014-07-01), pages 14 - 20, XP002776702, DOI: 10.1016/j.immuni.2014.06.008 *
N. LACHMANN ET AL.: "Large-scale hematopoietic differentiation of human induced pluripotent stem cells provides granulocytes or macrophages for cell replacement therapies", STEM CELL REPORTS, vol. 4, 10 February 2015 (2015-02-10), pages 282, XP055384440, DOI: doi:10.1016/j.stemcr.2015.01.005
N. ROLANDO ET AL.: "The systemic inflammatory response syndrome in acute liver failure", HEPATOLOGY, vol. 32, October 2000 (2000-10-01), pages 734
NISHIDA M ET AL: "Adoptive transfer of macrophages ameliorates renal fibrosis in mice", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 332, no. 1, 24 June 2005 (2005-06-24), ELSEVIER, AMSTERDAM, NL, pages 11 - 16, XP027229822, ISSN: 0006-291X, [retrieved on 20050514], DOI: 10.1016/J.BBRC.2005.04.083 *
P. A. BERRY ET AL.: "Admission levels and early changes in serum interleukin-10 are predictive of poor outcome in acute liver failure and decompensated cirrhosis", LIVER INT, vol. 30, May 2010 (2010-05-01), pages 733
P. RAMACHANDRAN ET AL.: "Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis", PROC NATL ACAD SCI U S A, vol. 109, 13 November 2012 (2012-11-13), pages E3186
P. SCAFFIDI; T. MISTELI; M. E. BIANCHI: "Release of chromatin protein HMGB1 by necrotic cells triggers inflammation", NATURE, vol. 418, 2002, pages 191, XP002261326, DOI: doi:10.1038/nature00858
Q. YOU ET AL.: "Role of hepatic resident and infiltrating macrophages in liver repair after acute injury", BIOCHEM PHARMACOL, vol. 86, 15 September 2013 (2013-09-15), pages 836
R. ANDREESEN ET AL.: "Adoptive transfer of tumor cytotoxic macrophages generated in vitro from circulating blood monocytes: a new approach to cancer immunotherapy", CANCER RES, vol. 50, 1 December 1990 (1990-12-01), pages 7450
R. PARSA ET AL.: "Adoptive transfer of immunomodulatory M2 macrophages prevents type 1 diabetes in NOD mice", DIABETES, vol. 61, November 2012 (2012-11-01), pages 2881
RUSSO, F. P. ET AL.: "The bone marrow functionally contributes to liver fibrosis", GASTROENTEROLOGY, vol. 130, 2006, pages 1807 - 1821, XP005470482, DOI: doi:10.1053/j.gastro.2006.01.036
SCHULZ, C. ET AL.: "A lineage of myeloid cells independent of Myb and hematopoietic stem cells", SCIENCE, vol. 336, 2012, pages 86 - 90
SNEJU ET AL.: "Application of iPS cell-derived macrophages to cancer therapy", ONCOIMMUNOLOGY, vol. 3, 2014, pages e27927
SOLTYS, K. A. ET AL.: "Barriers to the successful treatment of liver disease by hepatocyte transplantation", J HEPATOL, vol. 53, 2010, pages 769 - 774, XP027241366
T. SUZUKI ET AL.: "Pulmonary macrophage transplantation therapy", NATURE, vol. 514, 23 October 2014 (2014-10-23), pages 450
TACKE FRANK ET AL: "Macrophage heterogeneity in liver injury and fibrosis", JOURNAL OF HEPATOLOGY, vol. 60, no. 5, May 2014 (2014-05-01), pages 1090 - 1096, XP002776704, DOI: 10.1016/j.jhep.2013.12.025 *
THOMAS J. A. ET AL.: "Macrophage therapy for murine liver fibrosis recruits host effector cells improving fibrosis, regeneration, and function", HEPATOLOGY, vol. 53, 2011, pages 2003 - 2015
THOMAS JAMES A ET AL: "Macrophage Therapy for Murine Liver Fibrosis Recruits Host Effector Cells Improving Fibrosis, Regeneration, and Function", HEPATOLOGY, vol. 53, no. 6, June 2011 (2011-06-01), pages 2003 - 2015, XP002776703, DOI: 10.1002/hep.24315 *
THOMAS, J. A. ET AL.: "Macrophage therapy for murine liver fibrosis recruits host effector cells improving fibrosis, regeneration, and function", HEPATOLOGY, vol. 53, 2011, pages 2003 - 2015
VAN WIGENBURT ET AL.: "Efficient, Long Term Production of Monocyte-Derived Macrophages from Human Pluripotent Stem Cells under Partly-Defined and Fully-Defined Conditions", PLOS ONE, vol. 8, no. 8, pages e71098
VAN WILGENBURG ET AL.: "Efficient, long term production of monocyte-derived macrophages from human pluripotent stem cells under partly-defined and fully-defined conditions", PLOS ONE, vol. 8, 2013, pages e71098
W. M. LEE: "Acetaminophen and the U.S. acute liver failure study group: Lowering the risks of hepatic failure", HEPATOLOGY, vol. 40, 2004, pages 6
W. M. LEE: "Acetaminophen-related acute liver failure in the United States", HEPATOLOGY RESEARCH, vol. 38, 2008, pages S3
W. M. LEE: "Recent developments in acute liver failure", BEST PRACT RES CLIN GASTROENTEROL, vol. 26, February 2012 (2012-02-01), pages 3
WILLIAMS, M. J.; CLOUSTON, A. D.; FORBES, S. J.: "Links between hepatic fibrosis, ductular reaction, and progenitor cell expansion", GASTROENTEROLOGY, vol. 146, 2014, pages 349 - 356
Y. ITO; E. R. ABRIL; N. W. BETHEA; R. S. MCCUSKEY: "Role of nitric oxide in hepatic microvascular injury elicited by acetaminophen in mice", AM J PHYSIOL GASTROINTEST LIVER PHYSIOL, vol. 286, January 2004 (2004-01-01), pages G60
Y. ITO; E. R. ABRIL; N. W. BETHEA; R. S. MCCUSKEY: "Role of nitric oxide in hepatic microvascular injury elicited by acetaminophen in mice", AMERICAN JOURNAL OF PHYSIOLOGY - GASTROINTESTINAL AND LIVER PHYSIOLOGY, vol. 286, 2004, pages G60
Y. ITO; N. W. BETHEA; E. R. ABRIL; R. S. MCCUSKEY: "Early hepatic microvascular injury in response to acetaminophen toxicity", MICROCIRCULATION, vol. 10, October 2003 (2003-10-01), pages 391
YANG, C-T.; MA R.; AXTON, R.; JACKSON, M.; TAYLOR, H.; FIDANZA, A.; MARENAH L.; FRAYNE, J.; MOUNTFORD, J; FORRESTER, L.M: "Activation of KLF1 Enhances the Differentiation and Maturation of Red Blood Cells from Human Pluripotent Stem Cells", STEM CELLS, 2016
YEUNG ET AL.: "Conditional-ready mouse embryonic stem cell derived macrophages enable the study of essential genes in macrophage function", SC. REP., vol. 5, 10 March 2015 (2015-03-10), pages 8909
ZAMBIDIS, E. T.; PEAULT, B.; PARK, T. S.; BUNZ, F.; CIVIN, C. I., BLOOD, vol. 106, 2005, pages 860 - 870
ZAMBIDIS, ET; PEAULT, B; PARK, TS; BUNZ, F; CIVIN, CI: "Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development", BLOOD, vol. 106, no. 3, 2005, pages 860 - 870, XP002658043
ZHANG ET AL.: "Functional Analysis and Transcriptomic Profiling of iPSC-derived Macrophages and Their Application in Modeling Mendelian Disease", CIRC RES., vol. 117, no. 1, 19 June 2015 (2015-06-19), pages 17 - 28
ZHUANG ET AL.: "Pure populations of murine macrophages from cultured embryonic stem cells. Application to studies of chemotaxis and apoptotic cell clearance", J IMMUNOL METHODS, vol. 385, no. 1-2, 30 November 2012 (2012-11-30), pages 1 - 14, XP028940449, DOI: doi:10.1016/j.jim.2012.06.008
ZHUANG LIHUI ET AL: "Pure populations of murine macrophages from cultured embryonic stem cells. Application to studies of chemotaxis and apoptotic cell clearance", JOURNAL OF IMMUNOLOGICAL METHODS, vol. 385, no. 1, 1 January 2012 (2012-01-01), pages 1 - 14, XP028940449, ISSN: 0022-1759, DOI: 10.1016/J.JIM.2012.06.008 *
ZHUANG, L. ET AL.: "Pure populations of murine macrophages from cultured embryonic stem cells. Application to studies of chemotaxis and apoptotic cell clearance", J IMMUNOL METHODS, vol. 385, 2012, pages 1 - 14, XP028940449, DOI: doi:10.1016/j.jim.2012.06.008

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2572005A (en) * 2018-03-16 2019-09-18 Univ Court Univ Of Edinburgh Macrophage-based therapy
US12318476B2 (en) 2018-03-16 2025-06-03 The University Court Of The University Of Edinburgh Macrophage-based therapy
CN112955161A (zh) * 2018-09-06 2021-06-11 泰克年研究发展基金会公司 通过活化细胞修复组织
WO2021240169A1 (en) * 2020-05-27 2021-12-02 University Court Of The University Of Edinburgh Cryopreserving macrophages
US20230210105A1 (en) * 2020-05-27 2023-07-06 The University Court Of The University Of Edinburgh Cryopreserving macrophages
CN111933006A (zh) * 2020-07-30 2020-11-13 四川大学华西医院 一种模拟巨噬细胞改善小鼠急性肾损伤实验的方法及系统
CN111933006B (zh) * 2020-07-30 2022-06-03 四川大学华西医院 一种模拟巨噬细胞改善小鼠急性肾损伤实验的方法及系统
WO2023075623A1 (en) * 2021-10-26 2023-05-04 Ineb (Instituto Nacional De Engenharia Biomédica) Macrophage phenoypes for use in the treatment of intravertebral discs

Also Published As

Publication number Publication date
AU2017328913A1 (en) 2019-02-28
EP4640237A2 (en) 2025-10-29
US11285174B2 (en) 2022-03-29
WO2018051136A9 (en) 2019-02-07
JP7115755B2 (ja) 2022-08-09
CN109789163A (zh) 2019-05-21
JP2019532634A (ja) 2019-11-14
EP4640237A3 (en) 2026-01-07
EP3515460B1 (en) 2025-09-17
EP3515460A1 (en) 2019-07-31
AU2017328913B2 (en) 2023-08-17
US20190240256A1 (en) 2019-08-08

Similar Documents

Publication Publication Date Title
EP3515460B1 (en) Macrophage-based therapy for use in the treatment of acute liver injury
AU2021203382B2 (en) Therapeutic pooled blood apoptotic cell preparations and uses thereof
King et al. Sphingosine-1-phosphate prevents egress of hematopoietic stem cells from liver to reduce fibrosis
JP2013528230A (ja) ノーオプション重症虚血肢(cli)を処置するための組成物および方法
WO2014089397A1 (en) Compositions and methods of treating and preventing pulmonary fibrosis
JP2023001294A (ja) 臓器線維症の予防または治療剤
Leng et al. Experimental study on the effect of allogeneic endothelial progenitor cells on wound healing in diabetic mice
Gaowa et al. Recombinant soluble thrombomodulin accelerates epithelial stem cell proliferation in mouse intestinal organoids and promotes the mucosal healing in colitis
CN107970435B (zh) 联合诱导内源Lgr5+肝脏干细胞增多的方法及应用
US20240189364A1 (en) Villi stromal cells compositions and uses thereof
Mu et al. SECTM1A positively regulates tissue-resident macrophage self-renewal capacity by boosting T helper cells in mice during endotoxemia
Janmohamed Investigating the immunomodulatory role of mesenchymal stromal cells in primary sclerosing cholangitis
Ghita Adipose derived stromal vascular fraction: therapeutic potential of renal artery administration in renal ischaemia reperfusion injury
CN107982518A (zh) 一种Lgr5阳性肝脏干细胞诱导方法及其检测应用
Alfaifi Cell therapy for acute liver injury-in vivo efficacy of mesenchymal stromal cells in toxic and immune-mediated murine hepatitis
Giménez The anti-inflammatory effect of mesenchymal stromal cells in urate crystal-induced arthritis and its mechanism of action
CN114887036A (zh) 抗菌肽在制备对乙酰氨基酚诱导的急性肝损伤和/或肝衰竭治疗制剂中的应用
Mohamed et al. COMPARATIVE STUDY BETWEEN THE EFFECTS OF HUMAN CD34 AND RAT BONE MARROW MESENCHYMAL STEM CELLS ON AMELIORATION OF CCL4 INDUCED LIVER FIBROSIS.
Cremers Cytoprotective mechanisms, palatogenesis, and wound repair
Norman Jr Origin and Maturation of the Pulmonary Lymphatic Endothelium
Mohammadipoor Enhanced Therapeutic Potential of Preactivated Mesenchymal Stromal Cells and Their Secretory Factor Stanniocalcin-1 in Models for Acute Injuries and Inflammation
Rea The role of bone marrow derived cells (BMDCs) in burn wound healing
US20150037303A1 (en) Cells, compositions, and treatment methods for stimulation of hematopoiesis
Ben-Shoshan et al. Endothelial Progenitor Cells: From Bench to Bedside
King Optimising stem cell therapy for liver disease through modulation of sphingosine 1-phosphate signalling

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17783964

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017328913

Country of ref document: AU

Date of ref document: 20170918

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019515418

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017783964

Country of ref document: EP

Effective date: 20190423

WWG Wipo information: grant in national office

Ref document number: 2017783964

Country of ref document: EP