WO2018027324A1 - High thebaine poppy and methods of producing the same - Google Patents

High thebaine poppy and methods of producing the same Download PDF

Info

Publication number
WO2018027324A1
WO2018027324A1 PCT/CA2017/050951 CA2017050951W WO2018027324A1 WO 2018027324 A1 WO2018027324 A1 WO 2018027324A1 CA 2017050951 W CA2017050951 W CA 2017050951W WO 2018027324 A1 WO2018027324 A1 WO 2018027324A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene encoding
endogenous gene
plant
t60dm
codm
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2017/050951
Other languages
English (en)
French (fr)
Other versions
WO2018027324A9 (en
Inventor
Igor Kovalchuk
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Api Labs Inc
Original Assignee
Api Labs Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2017310339A priority Critical patent/AU2017310339B2/en
Priority to US15/762,090 priority patent/US10808258B2/en
Priority to DK17838267.7T priority patent/DK3334826T5/da
Priority to JP2019521398A priority patent/JP6906812B2/ja
Priority to EP17838267.7A priority patent/EP3334826B1/en
Priority to CN201780063464.9A priority patent/CN110088284A/zh
Priority to ES17838267T priority patent/ES2970324T3/es
Application filed by Api Labs Inc filed Critical Api Labs Inc
Publication of WO2018027324A1 publication Critical patent/WO2018027324A1/en
Anticipated expiration legal-status Critical
Priority to AU2019201771A priority patent/AU2019201771A1/en
Publication of WO2018027324A9 publication Critical patent/WO2018027324A9/en
Priority to US17/023,569 priority patent/US20210246460A1/en
Priority to AU2021232757A priority patent/AU2021232757A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/485Morphinan derivatives, e.g. morphine, codeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/11031Thebaine 6-O-demethylase (1.14.11.31)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/11032Codeine 3-O-demethylase (1.14.11.32)

Definitions

  • This disclosure relates to the production of opium poppies having high levels of thebaine. More particularly, the disclosure relates to the production of opium poppies having high levels of thebaine by simultaneously reducing the expression/activity of thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM).
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Opioids are psychoactive substances derived from the opium poppy (Papaver somniferum), or their synthetic analogues. Opioids have the potential to cause substance dependence that is characterized by a strong desire to take opioids, impaired control over opioid use, persistent opioid use despite harmful consequences, a higher priority given to opioid use than to other activities and obligations, increased tolerance, and a physical withdrawal reaction when opioids are discontinued.
  • opioid dependence i.e. an addiction to opioids
  • opioids in high doses can cause respiratory depression and death.
  • Hydroxymorphinans such as oxycodone, naloxone, naltrexone, nalbuphine and nalmefene are important opiate derivatives due to their utility as potent analgesics and/or narcotic antagonists.
  • the most practical synthetic routes to the preparation of these pharmaceuticals use the alkaloid, thebaine, as a starting material.
  • Other important opiate derivatives such as the ring-C bridged compounds buprenorpine and etorphine are also most practically prepared from thebaine.
  • thebaine is costly due to its limited availability. Total synthesis is difficult and, in poppy plants, thebaine typically accumulates to low levels of only 0.5 to 2% of the total alkaloids in opium poppy.
  • thebaine exists at a branch point of morphine biosynthesis, being the substrate for two competing enzymes.
  • Thebaine 6-O-demethylase (T60DM) converts thebaine to oripavine, and codeine 3-O-demethylase (CODM) converts thebaine to neopinone.
  • WO2009/109012 discloses the mutagenesis of the line designated PTA-91 10 to produce a further line accumulating high levels of thebaine, which was deposited under the Budapest Treaty with the American Type Culture Collection on March 20, 2008, under ATCC ® Patent Deposit Designation PTA-9109.
  • the biochemical basis for the phenotype was not explored.
  • researchers have been interested in using molecular approaches to engineer opium poppy to produce opioids of choice for several years, however, the results have at times been unexpected and frustrating.
  • Allen et al. (Nature Biotechnology 22:1559-1556) used RNA interference (RNAi) to silence the genes encoding codeinone reductase (COR), the penultimate enzyme of morphine biosynthesis.
  • RNAi RNA interference
  • COR converts codeinone to codeine.
  • elimination of COR activity resulted in accumulation of reticuline, i.e. seven enzymatic steps before COR.
  • the surprising accumulation of reticuline suggests a feedback mechanism preventing intermediates from general benzylisoquinoline synthesis entering the morphine-specific branch.
  • This disclosure relates to the production of opium poppies having high levels of thebaine. More particularly, the disclosure relates to the production of opium poppies having high levels of thebaine by simultaneously reducing the expression/activity of thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM).
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Various aspects of the disclosure relate to a method of increasing accumulation of thebaine in an opium poppy plant, the method comprising genetically modifying the plant to simultaneously reduce the activity of thebaine 6-O-demethylase (T60DM) and codeine 3-0- demethylase (CODM) in the poppy plant.
  • T60DM may have the amino acid sequence of SEQ ID NO: 1 .
  • CODM may have the amino acid sequence of SEQ ID NO: 3.
  • genetically modifying the plant to simultaneously reduce the activity of T60DM comprises introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding T60DM.
  • the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding T60DM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4
  • genetically modifying the plant to simultaneously reduce the activity of T60DM comprises introducing a loss of function mutation in an endogenous gene encoding T60DM.
  • genetically modifying the plant to simultaneously reduce the activity of CODM comprises introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding CODM.
  • the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding CODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4.
  • genetically modifying the plant to simultaneously reduce the activity of CODM comprises introducing a loss of function mutation in an endogenous gene encoding CODM.
  • Various aspects of the disclosure relate to a method of producing an opium poppy plant with increased levels of thebaine relative to a wild type plant, the method comprising: crossing a first parent having at least one loss of function allele of the gene encoding thebaine 6-O- demethylase with a second parent having at least one loss of function allele of the gene encoding codeine 3-O-demethylase; and allowing progeny that have both the loss of function mutation allele of the gene encoding thebaine 6-O-demethylase and the loss of function allele of the gene encoding codeine 3-O-demethylase to self pollinate to produce a plant that is homozygous for the loss of function mutation allele of the gene encoding thebaine 6-0- demethylase and homozygous for the loss of function allele of the gene encoding codeine 3- O-demethylase.
  • a method for producing an opium poppy plant with increased thebaine content comprising: decreasing the expression an endogenous gene encoding an endogenous thebaine 6-O-demethylase (T60DM) in the plant; and decreasing the expression of an endogenous gene encoding codeine 3-O-demethylase (CODM) in the plant.
  • decreasing the expression of the endogenous gene encoding T60DM comprises introducing or producing a loss of function allele in the endogenous gene encoding T60DM.
  • decreasing the expression of the endogenous gene encoding CODM comprises introducing or producing a loss of function allele in the endogenous gene encoding CODM.
  • decreasing the expression of the endogenous gene encoding T60DM comprises expressing a first heterologous nucleic acid molecule homologous to a portion of the endogenous gene encoding T60DM, wherein the first heterologous nucleic acid molecule decreases expression of the endogenous gene encoding T60DM.
  • decreasing the expression of the endogenous gene encoding CODM comprises introducing or producing a loss of function allele in the endogenous gene encoding CODM.
  • decreasing expression of the endogenous gene encoding CODM comprises expressing a second heterologous nucleic acid molecule homologous to a portion of the endogenous gene encoding CODM, wherein the second heterologous nucleic acid molecule decreases expression of the endogenous gene encoding CODM.
  • decreasing expression of the endogenous gene encoding CODM comprises expressing a heterologous nucleic acid molecule homologous to a portion of the endogenous gene encoding CODM, wherein the heterologous nucleic acid molecule decreases expression of the endogenous gene encoding CODM.
  • decreasing T60DM activity comprises introducing or producing a loss of function allele in the endogenous gene encoding T60DM.
  • the loss of function allele comprises a disruption or point mutation in the gene.
  • the disruption may be a deletion or an insertion.
  • An insertion may be a T-DNA or a transposable element.
  • the first heterologous nucleic acid molecule decreases expression of the endogenous gene encoding T60DM by RNA interference.
  • the second heterologous nucleic acid molecule decreases expression of the endogenous gene encoding CODM by RNA interference.
  • the heterologous nucleic acid molecule decreases expression of the endogenous gene encoding CODM by RNA interference.
  • the heterologous nucleic acid molecule comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4. In some instances, the heterologous nucleic acid molecule comprises a portion of SEQ ID NO: 7. In some instances, the heterologous nucleic acid molecule comprises a portion of SEQ ID NO: 8.
  • the T60DM has an amino acid sequence at least 95% identical to SEQ ID NO: 1 and the CODM has an amino acid sequence at least 95% identical to SEQ ID NO: 3.
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plan, the method comprising: i) using a molecular methodology to identify a first plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) establishing a cross of said first plant to a second plant having a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); iii) allowing progeny from the cross to self-fertilize; and iv) screening progeny from self-fertilized plants for a plant that is homozygous for both the loss of function allele in the endogenous gene en
  • the second plant having the loss of function allele in the endogenous gene encoding T60DM is identified using a molecular methodology. In some instances, the loss of function allele in the endogenous gene encoding T60DM is generated by genetic modification of the second plant or an ancestor thereof. In some instances, the second plant having the loss of function allele in the endogenous gene encoding T60DM is a plant of the line deposited as ATCC PTA-91 10.
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having an thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a first plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) establishing a cross of said first plant to a second plant having a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing progeny from the cross to self- fertilize; and iv) screening progeny from self-fertilized plants for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • the second plant having the loss of function allele in the endogenous gene encoding CODM is identified using a molecular methodology. In some instances, the loss of function allele in the endogenous gene encoding CODM is generated by genetic modification of the second plant or an ancestor thereof. In some instances, the second plant having the loss of function allele in the endogenous gene encoding CODM is a plant of the line deposited as ATCC PTA-9109.
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) genetically modifying the plant to introduce a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • T60DM endogenous gene encoding thebaine 6-O-demethylase
  • CODM codeine 3-O-de
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) genetically modifying the plant to introduce a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM) in the plant by genetic modification; iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • CODM codeine 3-O-demethylase
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) genetically modifying the plant to reduce expression of an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for the loss of function allele in the endogenous gene encoding T60DM and has reduced expression of the endogenous gene encoding CODM.
  • genetically modifying the plant to reduce expression of the endogenous gene encoding CODM comprises introducing an expression construct to express a hairpin RNA targeting the endogenous gene
  • Various aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) genetically modifying the plant to reduce expression of an endogenous gene encoding thebaine 6-O-demethylase (T60DM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and has reduced expression of the endogenous gene encoding T60DM.
  • genetically modifying the plant to reduce expression of the endogenous gene encoding T60DM comprises introducing an expression construct to express a hairpin RNA targeting the endogen
  • the molecular methodology comprises targeting induced local lesions in genomes (TILLING) methodology.
  • Various aspects of the disclosure relate to an opium poppy plant produced by a method as described above.
  • Various aspects of the disclosure relate to a genetically modified opium poppy plant or plant cell having reduced activity of thebaine 6-O-demethylase (T60DM) and codeine 3-0- demethylase (CODM) relative to a wild type plant, wherein the opium poppy plant is genetically modified to have reduced expression of T60DM, and CODM, or both.
  • the plant comprises a first expression construct for reducing the expression of T60DM and a second expression construct for reducing expression of CODM.
  • the first expression construct comprises a first nucleic acid molecule encoding a first hairpin RNA for reducing expression of an endogenous gene encoding T60DM.
  • the endogenous gene encoding T60DM encodes an mRNA comprising having the sequence of SEQ ID NO: 15.
  • the nucleic acid molecule encoding the first hairpin RNA comprises a portion of SEQ ID NO: 2.
  • the second expression construct comprises a second nucleic acid molecule encoding a second hairpin RNA for reducing expression of an endogenous gene encoding CODM.
  • the endogenous gene encoding CODM encodes an mRNA comprising having the sequence of SEQ ID NO: 16.
  • the nucleic acid molecule encoding the second hairpin RNA comprises a portion of SEQ ID NO: 4.
  • the plant or plant cell comprises an expression construct comprising a nucleic acid molecule for reducing the expression of T60DM and CODM.
  • the nucleic acid molecule encodes a hairpin RNA for reducing expression of an endogenous gene encoding CODM.
  • the nucleic acid molecule encodes a hairpin RNA for reducing expression of an endogenous gene encoding T60DM.
  • the nucleic acid molecule encodes a single hairpin RNA sufficient to reduce expression of endogenous genes encoding T60DM and CODM.
  • the nucleic acid molecule comprises a portion of SEQ ID NO:2, SEQ ID NO:4, or both.
  • the expression construct comprises a first nucleic acid molecule encoding a first hairpin RNA for reducing expression of an endogenous gene encoding T60DM and a second nucleic acid molecule encoding a second hairpin RNA for reducing expression of an endogenous gene encoding CODM.
  • the endogenous gene encoding T60DM encodes an mRNA comprising having the sequence of SEQ ID NO: 15.
  • the endogenous gene encoding T60DM encodes a polypeptide having the sequence of SEQ ID NO 1 .
  • the endogenous gene encoding CODM encodes an mRNA comprising having the sequence of SEQ ID NO: 16.
  • the endogenous gene encoding T60DM encodes a polypeptide having the sequence of SEQ ID NO 3.
  • each of the first nucleic acid molecule and the second nucleic acid molecule comprise a portion of SEQ ID NO: 2, SEQ ID NO: 4, or both.
  • nucleic acid molecule encoding the hairpin RNA(s) comprises a portion of SEQ ID NO: 8. In some instances, the nucleic acid molecule encoding the hairpin RNA(s) comprises a portion of SEQ ID NO: 7.
  • the first nucleic acid molecule comprises a portion of SEQ ID NO: 8. In some instances, the first nucleic acid molecule comprises a portion of SEQ ID NO: 7.
  • the second nucleic acid molecule comprises a portion of SEQ ID NO: 8. In some instances, the second nucleic acid molecule comprises a portion of SEQ ID NO: 7.
  • the plant or plant cell is genetically modified to have reduced activity of T60DM, and the reduced activity of CODM is conferred by a mutation in the endogenous gene encoding CODM that was not introduced by genetic modification of the plant or plant cell.
  • mutation in the endogenous gene encoding CODM that was not introduced by genetic modification of the plant or plant cell is the mutation present in seeds of the plant deposited under Patent Deposit Designation PTA-9109.
  • the plant is genetically modified to have reduced activity of CODM, and wherein reduced activity of T60DM is conferred by a mutation in the endogenous gene encoding T60DM that was not introduced by genetic modification of the plant or plant cell.
  • the mutation in the endogenous gene encoding T60DM that was not introduced by genetic modification of the plant or plant cell is the mutation present in seeds of the plant deposited under Patent Deposit Designation PTA-91 10.
  • aspects of the disclosure relate to a genetically modified poppy plant or plant cell having reduced expression of endogenous genes encoding 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM), the genetically modified plant comprising: a transgenic expression construct decreasing the expression of an endogenous gene encoding T60DM in the plant or plant cell; and a transgenic expression construct decreasing the expression of an endogenous gene encoding CODM in the plant or plant cell.
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Various aspects of the disclosure relate to seed of an opium poppy plant as described above.
  • aspects of the disclosure relate to use of a plant as described above for the production of thebaine.
  • Various aspects of the disclosure relate to poppy straw from a plant as described above.
  • Various aspects of the disclosure relate to latex isolated from a plant as defined above.
  • Various aspects of the disclosure relate to a method of producing thebaine, said method comprising isolating thebaine from latex or poppy straw harvested from a plant as described above.
  • nucleic acid molecule wherein the sequence of the nucleic acid molecule comprises a portion of SEQ ID NO:7.
  • Various aspects of the disclosure relate to an expression vector for simultaneously reducing the expression of endogenous genes encoding thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM) in an opium poppy plant, the expression vector comprising a nucleic acid molecule that comprises a portion of SEQ ID NO:7.
  • Various aspects of the disclosure relate to use of a portion of a polynucleotide molecule having a sequence comprising a portion of SEQ ID NO: 2 or SEQ ID NO: 4 for simultaneously reducing the expression of endogenous genes encoding thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM) in an opium poppy plant.
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • the methods disclosed herein may be useful for producing poppy plants having an increased ratio of thebaine:morphine.
  • Particular aspects of the disclosure relate to a method of increasing accumulation of thebaine in an opium poppy plant or plant cell, the method comprising genetically modifying the genome of the plant or plant cell to include one or more stable genetic modifications to simultaneously reduce the activity of thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM) in the poppy plant or plant cell.
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Particular aspects of the disclosure relate to a genetically modified opium poppy plant or plant cell having reduced activity of thebaine 6-O-demethylase (T60DM) and codeine 3-O- demethylase (CODM) relative to a wild type plant or plant cell, wherein the genetically modified opium poppy plant or plant cell comprises one or more stable genetic modifications to reduce expression of T60DM, CODM, or both.
  • T60DM thebaine 6-O-demethylase
  • CODM codeine 3-O- demethylase
  • Particular aspects of the disclosure relate to a method for producing an opium poppy plant with increased thebaine content, the method comprising: (a) decreasing the expression of an endogenous gene encoding an endogenous thebaine 6-O-demethylase (T60DM) in the plant; and (b) decreasing the expression of an endogenous gene encoding codeine 3-O- demethylase (CODM) in the plant, wherein decreasing the expression of the endogenous gene encoding T60DM comprises genetically modifying the plant to have a loss of function allele in the endogenous gene encoding T60DM.
  • T60DM endogenous thebaine 6-O-demethylase
  • CODM codeine 3-O- demethylase
  • Particular aspects of the disclosure relate to a method for producing an opium poppy plant with increased thebaine content, the method comprising: (a) decreasing the expression an endogenous gene encoding an endogenous thebaine 6-O-demethylase (T60DM) in the plant; and (b) decreasing the expression of an endogenous gene encoding codeine 3-0- demethylase (CODM) in the plant, wherein decreasing the expression of the endogenous gene encoding T60DM comprises expressing a heterologous nucleic acid molecule homologous to a portion of the endogenous gene encoding T60DM, wherein expression of the heterologous nucleic acid molecule decreases expression of the endogenous gene encoding T60DM.
  • T60DM endogenous thebaine 6-O-demethylase
  • CODM codeine 3-0- demethylase
  • Particular aspects of the disclosure to a method for producing an opium poppy plant with increased thebaine content comprising: (a) decreasing the expression an endogenous gene encoding an endogenous thebaine 6-O-demethylase (T60DM) in the plant; and (b) decreasing the expression of an endogenous gene encoding codeine 3-0- demethylase (CODM) in the plant, wherein decreasing the expression of the endogenous gene encoding CODM comprises genetically modifying the plant to have a loss of function allele in the endogenous gene encoding CODM.
  • T60DM endogenous thebaine 6-O-demethylase
  • CODM codeine 3-0- demethylase
  • a method for producing an opium poppy plant with increased thebaine content comprising: (a) decreasing the expression of an endogenous gene encoding an endogenous thebaine 6-O-demethylase (T60DM) in the plant; and (b) decreasing the expression of an endogenous gene encoding codeine 3-0- demethylase (CODM) in the plant, wherein decreasing the expression of the endogenous gene encoding CODM comprises expressing a heterologous nucleic acid molecule homologous to a portion of the endogenous gene encoding CODM, wherein expression of the heterologous nucleic acid molecule decreases expression of the endogenous gene encoding CODM.
  • T60DM endogenous thebaine 6-O-demethylase
  • CODM codeine 3-0- demethylase
  • Particular aspects of the disclosure relate to a genetically modified poppy plant or plant cell having reduced expression of endogenous genes encoding 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM), the genetically modified plant comprising: a stably inherited transgenic expression construct for decreasing the expression of an endogenous gene encoding T60DM in the plant or plant cell; and a stably inherited transgenic expression construct for decreasing the expression of an endogenous gene encoding CODM in the plant or plant cell.
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a first plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) establishing a cross of said first plant to a second plant having a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); iii) allowing progeny from the cross to self-fertilize; and iv) screening progeny from self-fertilized plants for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • CODM codeine 3-O-demethylase
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a first plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) establishing a cross of said first plant to a second plant having a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing progeny from the cross to self-fertilize; and iv) screening progeny from self-fertilized plants for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • T60DM endogenous gene encoding thebaine 6-O-demethylase
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) genetically modifying the plant to introduce a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • T60DM endogenous gene encoding thebaine 6-O-demethylase
  • CODM codeine 3-O-demethyl
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) genetically modifying the plant to introduce a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM) in the plant by genetic modification; iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and the loss of function allele in the endogenous gene encoding T60DM.
  • CODM codeine 3-O-demethylase
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding thebaine 6-O-demethylase (T60DM); ii) genetically modifying the plant to reduce expression of an endogenous gene encoding codeine 3-O-demethylase (CODM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for the loss of function allele in the endogenous gene encoding T60DM and has reduced expression of the endogenous gene encoding CODM.
  • T60DM endogenous gene encoding thebaine 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • CODM codeine 3-
  • Particular aspects of the disclosure relate to a method of generating an opium poppy plant having increased thebaine content relative to a wild type opium poppy plant, the method comprising: i) using a molecular methodology to identify a plant as comprising a loss of function allele in an endogenous gene encoding codeine 3-O-demethylase (CODM); ii) genetically modifying the plant to reduce expression of an endogenous gene encoding thebaine 6-O-demethylase (T60DM); iii) allowing the plant to self-fertilize; and iv) screening progeny from the self-fertilized plant for a plant that is homozygous for both the loss of function allele in the endogenous gene encoding CODM and has reduced expression of the endogenous gene encoding T60DM.
  • Particular aspects of the disclosure relate to an isolated nucleic acid molecule, wherein the sequence of the nucleic acid molecule comprises SEQ ID NO:7.
  • Particular aspects of the disclosure relate to a use of a polynucleotide molecule having a sequence comprising a portion of SEQ ID NO: 2 or SEQ ID NO: 4 for simultaneously reducing the expression of endogenous genes encoding thebaine 6-O-demethylase (T60DM) and codeine 3-O-demethylase (CODM) in an opium poppy plant.
  • T60DM 6-O-demethylase
  • CODM codeine 3-O-demethylase
  • Figure 1 is a schematic diagram of the morphine biosynthesis pathway in opium poppy, showing two routes from thebaine to morphine.
  • Figure 2 is a schematic diagram of a hairpin RNA expression cassette for expressing hairpin RNA comprising T60DM sequences for simultaneous reduction expression of the genes encoding CODM and T60DM.
  • Figure 3 is an alignment of cDNA sequences encoding CODM and T60DM.
  • the underlined portion identifies T60DM sequences used in the creation of the hairpin RNA expression construct to reduce expression of both the endogenous gene encoding CODM and the endogenous gene encoding T60DM. Differences between the T60DM and CODM coding sequences within the underlined portion are highlighted in black.
  • Figure 4 are histograms showing the expression of the endogenous genes encoding
  • Figure 5 is a histogram showing expression of the expression construct in transgenic lines
  • Figure 6 are histograms showing reduced expression of the endogenous genes encoding
  • FIG. 7 is a chromatograph showing the accumulation of thebaine in lines (A) AM1 , (B), AM2 , and (C) AM3 relative to (D) line AM10 that does not have the expression construct.
  • This disclosure relates to a genetically modified opium poppy plants, seeds, cells, straw, progeny thereof, or produced latex thereof, which genetically modified plant produces a latex having increased levels of thebaine relative to wild type plants due to the combined reduction in the activity of the enzymes thebaine 6-O-demethylase (T60DM) and codeine 3-0- demethylase (CODM) during opiate biosynthesis.
  • T60DM thebaine 6-O-demethylase
  • CODM codeine 3-0- demethylase
  • Opium poppy plant or “poppy plant” as used herein refers to a plant of the species Papaver Somniferum.
  • a "field" of plants as used herein, refers to a plurality of opium plants cultivated together in close proximity.
  • Activity refers to the level of a particularly enzymatic function in a plant cell.
  • reduced T60DM activity refers to a reduction in O- demethylation activity at position 6
  • reduced CODM activity refers to a reduction in O- demethylation activity at position 3.
  • Reduction in activity can be the result of diminished functionality of the protein due to, for example, mutation, or the result of reduced expression of the protein, for example, due to reduced translation.
  • a “genetic modification” as used herein broadly refers to any a novel combination of genetic material obtained with techniques of modern biotechnology. Genetic modifications include, but are not limited to, "transgenes” in which the genetic material has been altered by the insertion of exogenous genetic material. However, genetic modifications also include alterations (e.g. insertions, deletions, or substitutions) in endogenous genes introduced in a targeted manner with techniques such as CRISPR/Cas9, TALENS, etc. as discussed below. However, for the purposes of this disclosure "genetic modification” is not intended to include novel combinations of genetic material resulting from mutations generated by traditional means of random mutagenesis following by traditional means of breeding.
  • Transgene refers to a recombinant gene or genetic material that has been transferred by genetic engineering techniques into the plant cell.
  • Transgenic plants or “transformed plants” as used herein refers to plants that have incorporated or integrated exogenous nucleic acid sequences or DNA fragments into the plant cell.
  • a transgene may include a homologous or heterologous promoter operably linked to a DNA molecule encoding the RNA or polypeptide of interest.
  • operably linked refers to a functional linkage between a promoter and a second DNA sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second DNA sequence.
  • operably linked means that the nucleic acid sequences being linked are contiguous.
  • a “genetically modified” plant or plant cell as used herein broadly refers to any plant or plant cell that possesses a genetic modification as defined herein.
  • polypeptide encompasses any chain of naturally or non-naturally occurring amino acids (either D- or L-amino acids), regardless of length (e.g., at least 5, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 100 or more amino acids) or post-translational modification (e.g., glycosylation or phosphorylation) or the presence of e.g.
  • non- amino acyl groups for example, sugar, lipid, etc.
  • covalently linked to the peptide includes, for example, natural proteins, synthetic or recombinant polypeptides and peptides, hybrid molecules, peptoids, peptidomimetics, etc.
  • polypeptide polypeptide
  • peptide protein
  • protein may be used interchangeably.
  • Nucleotide sequence refers to a polymer of DNA or RNA which can be single or double stranded and optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
  • Nucleic acid encompasses genes, cDNA, DNA and RNA encoded by a gene.
  • Nucleic acids, nucleic acid sequences, polynucleotide sequence and nucleic acid molecule may comprise at least 3, at least 10, at least 100, at least 1000, at least 5000, or at least 10000 nucleotides or base pairs.
  • a “fragment”, a “fragment thereof”, “gene fragment” or a “gene fragment thereof” as used herein refers to a portion of a "nucleotide sequence", “polynucleotide sequence”, “nucleic acid” or “nucleic acid molecule” that may still reduce expression of the gene(s) encoding CODM and/or T60DM.
  • the fragment comprises at least 20, at least 40, at least 60, at least 80, at least 100, at least 150, at least 200, at least 150, at least 300, at least 350, at least 400, at least 450 or at least 500 contiguous nucleotides.
  • non-natural variant refers to nucleic acid sequences native to an organism but comprising modifications to one or more of its nucleotides introduced by mutagenesis.
  • allele or “allelic variant” as used herein refers to an alternate form of the same gene at a specific location of the genome.
  • Wildtype refers to a plant or plant material that was not transformed with a nucleic acid molecule or construct, genetically modified, or otherwise mutated as described herein.
  • a “wildtype” may also refer to a plant or plant material in which T60DM activity and CODM activity were not reduced.
  • identity refers to sequence similarity between two polypeptide or polynucleotide molecules. Identity can be determined by comparing each position in the aligned sequences. A degree of identity between amino acid or nucleic acid sequences is a function of the number of identical or matching amino acids or nucleic acids at positions shared by the sequences, for example, over a specified region. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, as are known in the art, including the Clustal WTM program, available at http://clustalw.genome.ad.jp, the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl.
  • Math 2: 482 the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wis., U.S.A.). Sequence identity may also be determined using the BLAST algorithm (e.g. BLASTn and BLASTp), described in Altschul et al., 1990, J. Mol. Biol. 215:403- 10 (using the published default settings).
  • BLAST algorithm e.g. BLASTn and BLASTp
  • sequence identity between two nucleic acid sequences can be determined using the BLASTn algorithm at the following default settings: expect threshold 10; word size 1 1 ; match/mismatch scores 2, -3; gap costs existence 5, extension 2.
  • Sequence identity between two amino acid sequences may be determined using the BLASTp algorithm at the following default settings: expect threshold 10; word size 3; matrix BLOSUM 62; gap costs existence 1 1 , extension 1 .
  • the person skilled in the art can readily and properly align any given sequence and deduce sequence identity/homology by mere visual inspection.
  • heterologous As used herein, “heterologous”, “foreign” and “exogenous” DNA and RNA are used interchangeably and refer to DNA or RNA that does not occur naturally as part of the plant genome in which it is present or which is found in a location or locations in the genome that differ from that in which it occurs in nature.
  • heterologous or foreign DNA or RNA is nucleic acid that is not normally found in the host genome in an identical context (i.e. linked to identical 5' and 3' sequences).
  • heterologous DNA may be the same as the host DNA but introduced into a different place in the host genome and/or has been modified by methods known in the art, where the modifications include, but are not limited to, insertion in a vector, linked to a foreign promoter and/or other regulatory elements, or repeated at multiple copies.
  • heterologous DNA may be from a different organism, a different species, a different genus or a different kingdom, as the host DNA.
  • the heterologous DNA may be a transgene.
  • transgene refers to a segment of DNA containing a gene sequence that has been isolated from one organism and introduced into a different organism.
  • the nucleic acid molecules may comprise nucleic acid that is heterologous to the plant in which CODM and T60DM activity is reduced.
  • “Expression” or “expressing”, as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product, and may relate to production of any detectable level of a product, or activity of a product, encoded by a gene.
  • Gene expression may be modulated (i.e. initiated, increased, decreased, terminated, maintained or precluded) at many levels including transcription, RNA processing, translation, post-translational modification, protein degradation.
  • Gene expression can also be modulated by the introduction of mutations that affect the activity of the gene product, e.g. the ability of a gene product to convert substrate.
  • reduced expression of the endogenous gene(s) encoding CODM and/or T60DM, or reduced expression of the CODM and/or T60DM polypeptides can be effected by reduced transcription of the endogenous gene(s) encoding CODM and/or T60DM, by reduced translation of mRNA transcripts coding for CODM and/or T60DM, or by the introduction of mutations that either prevent the translation of functional polypeptides or result in the translation of polypeptides with reduced abilities to convert substrate.
  • Such reduced expression of the endogenous genes may result from expression of transgenes comprising expression constructs designed to reduce expression of the endogenous genes.
  • "Poppy straw” as used herein refers to the straw material resulting from threshing of mature poppy capsules and the poppy capsule stems to remove the seeds.
  • “Latex” as used herein refer to the air-dried, milky exudation from lansed, unripe poppy capsules.
  • the term “increased thebaine content” or “increased level of thebaine” as used herein refers to a significantly increased levels of thebaine in one or more tissues as compared to the levels of thebaine in a corresponding wild type plant.
  • the term “increased” also encompasses levels of thebaine that are significantly increased in one or more tissues compared to the same tissues of a wild type plant, while wild type levels of thebaine persist elsewhere in the plant.
  • reduced morphine content refers to a significantly decreased levels of morphine in one or more tissues as compared to the levels of morphine in a corresponding wild type plant.
  • reduced also encompasses levels of morphine that are significantly reduced in one or more tissues compared to the same tissues of a wild type plant, while wild type levels of morphine persist elsewhere in the plant.
  • Decreasing expression”, “decreasing activity”, “reducing expression”, and “reducing activity” are intended to encompass well known equivalent terms regarding expression and activity such as “inhibiting”, “down-regulating”, “knocking out”, “silencing”, etc.
  • “substantially no” when referring to alkaloid content means that the particular alkaloid or combination of alkaloids constitutes less than 0.6% by weight, preferably, less than 0.5% by weight, more preferably, less than 0.4% by weight, or less than 0.2% by weight of the alkaloid combination of the poppy straw, concentrate of poppy straw or opium.
  • “Expression construct” as used herein refers to any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be.
  • expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest into, for example, an siRNA.
  • An expression construct of the disclosure nucleic acid molecule may further comprise a promoter and other regulatory elements, for example, an enhancer, a silencer, a polyadenylation site, a transcription terminator, a selectable marker or a screenable marker.
  • a "vector” or a “construct” may refer to any recombinant polynucleotide molecule such as a plasmid, cosmid, virus, vector, autonomously replicating polynucleotide molecule, phage, or linear or circular single-stranded or double-stranded DNA or RNA polynucleotide molecule, derived from any source.
  • a “vector” or a “construct” may comprise a promoter, a polyadenylation site, an enhancer or silencer and a transcription terminator, in addition to a nucleotide sequence encoding a gene or a gene fragment of interest.
  • a "transformation vector” may refer to a vector used in the transformation of, or in the introduction of DNA into, cells, plants or plant materials.
  • a "promoter” refers to a nucleotide sequence that directs the initiation and rate of transcription of a coding sequence (reviewed in Roeder, Trends Biochem Sci, 16: 402, 1991 ). The promoter contains the site at which RNA polymerase binds and also contains sites for the binding of other regulatory elements (such as transcription factors). Promoters may be naturally occurring or synthetic (see Datla et al. Biotech Ann. Rev 3:269, 1997 for review of plant promoters). Further, promoters may be species specific (for example, active only in B.
  • tissue specific for example, the napin, phaseolin, zein, globulin, dlec2, ⁇ -kafirin seed specific promoters
  • developmental ⁇ specific for example, active only during embryogenesis
  • constitutive for example maize ubiquitin, rice ubiquitin, rice actin, Arabidopsis actin, sugarcane bacilliform virus, CsVMV and CaMV 35S, Arabidopsis polyubiquitin, Solanum bulbocastanum polyubiquitin, Agrobacterium tumefaciens-derived nopaline synthase, octopine synthase, and mannopine synthase gene promoters); or inducible (for example the stilbene synthase promoter and promoters induced by light, heat, cold, drought, wounding, hormones, stress and chemicals).
  • a promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box or an Inr element, and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
  • a promoter may also refer to a nucleotide sequence that includes a minimal promoter plus DNA elements that regulates the expression of a coding sequence, such as enhancers and silencers.
  • the expression of the constructs of the present disclosure may be regulated by selecting a species specific, a tissue specific, a development specific or an inducible promoter.
  • Constant promoter refers to a promoter which drives the expression of the downstream-located coding region in a plurality of or all tissues irrespective of environmental or developmental factors.
  • Enhancers and silencers are DNA elements that affect transcription of a linked promoter positively or negatively, respectively (reviewed in Blackwood and Kadonaga, Science, 281 : 61 , 1998).
  • Polyadenylation site refers to a DNA sequence that signals the RNA transcription machinery to add a series of the nucleotide A at about 30 bp downstream from the polyadenylation site.
  • Transcription terminators are DNA sequences that signal the termination of transcription. Transcription terminators are known in the art.
  • the transcription terminator may be derived from Agrobacterium tumefaciens, such as those isolated from the nopaline synthase, mannopine synthase, octopine synthase genes and other open reading frame from Ti plasmids.
  • Other terminators may include, without limitation, those isolated from CaMV and other DNA viruses, dlec2, zein, phaseolin, lipase, osmotin, peroxidase, Pinll and ubiquitin genes, for example, from Solanum tuberosum.
  • nucleic acid construct may further comprise a selectable marker.
  • Selectable markers may be used to select for plants or plant cells that contain the exogenous genetic material.
  • the exogenous genetic material may include, but is not limited to, an enzyme that confers resistance to an agent such as a herbicide or an antibiotic, or a protein that reports the presence of the construct.
  • Examples of a selectable marker include, but are not limited to, a neo gene, which codes for kanamycin resistance and can be selected for using kanamycin, Nptll, G418, hpt etc.; an amp resistance gene for selection with the antibiotic ampicillin; an hygromycinR gene for hygromycin resistance; a BAR gene (encoding phosphinothricin acetyl transferase) which codes for bialaphos resistance including those described in WO/2008/070845; a mutant EPSP synthase gene, aadA, which encodes glyphosate resistance; a nitrilase gene, which confers resistance to bromoxynil; a mutant acetolactate synthase gene (ALS), which confers imidazolinone or sulphonylurea resistance, ALS, and a methotrexate resistant DHFR gene.
  • a neo gene which codes for kanamycin resistance and can be selected
  • screenable markers that may be used in the context of the invention include, but are not limited to, a ⁇ -glucuronidase or uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known, green fluorescent protein (GFP), and luciferase (LUX).
  • GUS ⁇ -glucuronidase or uidA gene
  • GFP green fluorescent protein
  • LUX luciferase
  • Figure 1 is a schematic diagram depicting two routes of morphine biosynthesis from thebaine.
  • O- demethylation of thebaine at position 6 (ring C) is catalyzed by thebaine 6-O-demethylase (T60DM) whereas O-demethylation at position 3 (ring A) is catalyzed by codeine O-demethylase (CODM).
  • thebaine can undergo O-demethylation at position 6 or position 3 to yield neopinone or oripavine, respectively.
  • Neopinone converts spontaneously to codeinone, which is then reduced to codeine by codeinone reductase (COR).
  • Codeine is demethylated at position 3 by CODM to produce morphine.
  • Wild type amino acid sequences of the T60DM and CODM enzymes are presented in SEQ ID NOs: 1 and 3, respectively.
  • the cDNA sequence corresponding to the endogenous gene coding for the T60DM enzyme is presented as SEQ ID NO: 2
  • the cDNA sequence corresponding to the endogenous gene coding for the CODM enzyme is presented as SEQ ID NO: 4.
  • CODM and T60DM expression and/or activity in genetically modified plants of the present invention may be reduced by any method that results in reduced activity of these enzymes in the plant. This may be achieved by e.g. by altering CODM and T60DM activity at the DNA, mRNA and/or protein levels.
  • activity refers to the biochemical reaction of an enzyme with its cognate substrate.
  • reduced T60DM (or CODM) activity may result from reduced protein levels of T60DM (or CODM) enzyme and/or the reduced rate at which a T60DM (or CODM) enzyme catalyzes its reaction with thebaine.
  • the present disclosure relates to genetic modifications targeting the endogenous genes encoding CODM and T60DM to alter CODM and T60DM expression and/or activity.
  • the endogenous CODM and T60DM genes may be altered by, without limitation, knocking-out CODM and T60DM genes; or knocking-in a heterologous DNA to disrupt CODM and T60DM genes.
  • knocking-out CODM and T60DM genes or knocking-in a heterologous DNA to disrupt CODM and T60DM genes.
  • technologies such as CRISPR/Cas9 and TALENS can be used to introduce loss of function mutations in both the endogenous genes encoding CODM and T60DM.
  • Plants having at least one allele of each gene comprising such loss of function mutations can then be self-fertilized to produce progeny homozygous for the loss of function alleles in the genes encoding CODM and T60DM.
  • genetic modification of the endogenous gene encoding the CODM (or T60DM) enzyme results in a polypeptide that differs in sequence by one or more amino acid insertions, deletions, or substitutions, and has diminished or no CODM (or T60DM) activity.
  • Deletions involve lack one or more residues of the endogenous protein.
  • a deletion variant includes embodiments in which no amino acids of the endogenous protein are translated, e.g. where the initial "start" methionine is substituted or deleted.
  • Insertional mutations typically involve the addition of material at a non-terminal point in the polypeptide, but may include fusion proteins comprising amino terminal and carboxy terminal additions.
  • Substitutional variants typically involve a substitution of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide. Substitutions of this kind may, in some embodiments, be conservative, i.e. where one amino acid is replaced with one of similar shape, size, charge, hydrophobicity, hydrophilicity, etc.
  • Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
  • the CODM enzyme may have an amino acid sequence that possesses at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1 .
  • the T60DM enzyme may have an amino acid sequence that possesses at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 2.
  • the present disclosure relates to reducing the expression and/or activity of CODM and T60DM by targeting their respective mRNA transcripts.
  • levels of CODM and T60DM T mRNA transcripts may be reduced by methods known in the art including, but not limited to, co-suppression, antisense expression, small hair pin (shRNA) expression , interfering RNA (RNAi) expression, double stranded (dsRNA) expression, inverted repeat dsRNA expression, micro interfering RNA (miRNA), simultaneous expression of sense and antisense sequences, or a combination thereof.
  • shRNA small hair pin
  • RNAi interfering RNA
  • dsRNA double stranded
  • miRNA micro interfering RNA
  • the present disclosure relates to the use of nucleic acid molecules that are complementary, or essentially complementary, to at least a portion of the molecules set forth in SEQ ID NO:2 or SEQ ID NO:4.
  • Nucleic acid molecules that are "complementary” are those that are capable of base-pairing according to the standard Watson-Crick complementary rules.
  • the term “complementary sequences” means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:2 or SEQ ID NO:4 under relatively stringent conditions such as those described herein.
  • Nucleic acid molecules may be substantially complementary (or are homologues/have identity) if the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions.
  • Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65 ° C, and washing in 0.2xSSC/0.1 % SDS at 42 ° C. (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
  • hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% SDS, 1 mM EDTA at 65° C, and washing in 0.1 xSSC/0.1 % SDS at 68 ° C. (see Ausubel, et al. (eds), 1989, supra).
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, N.Y.).
  • stringent conditions are selected to be about 5 ° C. lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • the phenomenon of co-suppression in plants relates to the introduction of transgenic copies of a gene resulting in reduced expression of the transgene as well as the endogenous gene.
  • the observed effect depends on sequence identity between the transgene and the endogenous gene.
  • RNA interference refers to well-known methods for down-regulating or silencing expression of a naturally occurring gene in a host plant. RNAi employs a double- stranded RNA molecule or a short hairpin RNA to change the expression of a nucleic acid sequence with which they share substantial or total homology.
  • RNA is both an initiator and target in the process. This mechanism targets RNA from viruses and transposons and also plays a role in regulating development and genome maintenance.
  • RNA-induced silencing complex RISC
  • RISC RNA-induced silencing complex
  • RISC associated RNA strand pairs with genomic DNA resulting in epigenetic changes that affect gene transcription.
  • Micro RNA miRNA is a type of RNA transcribed from the genome itself and works in a similar way.
  • shRNA may be cleaved by dicer and associate with RISC resulting in mRNA cleavage.
  • Antisense suppression of gene expression does not involve the catalysis of mRNA degradation, but instead involves single-stranded RNA fragments binding to mRNA and blocking protein translation.
  • sRNAs silencing RNAs
  • dsRNA double stranded RNA
  • sRNAs RNA- dependant RNA polymerase
  • major classes of sRNAs include short-interfering RNAs (siRNAs) and microRNAs (miRNAs) which differ in their biosynthesis.
  • RISC RNA-induced silencing complexes
  • T60DM and CODM expression may be suppressed using a synthetic gene(s) or an unrelated gene(s) that contain about 21 bp regions or longer of high homology (preferably 100% homology) to the endogenous coding sequences for T60DM and CODM.
  • nucleic acid molecules that are substantially identical to portions of the endogenous coding sequences for CODM and T60DM may also be used in the context of the disclosure.
  • one nucleic acid molecule may be "substantially identical" to another if the two molecules have at least 60%, at least 70%, at least 80%, at least 82.5%, at least 85%, at least 87.5%, at least 90%, at least 92.5%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.
  • nucleic acid sequence comprising a nucleic acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2 or SEQ ID NO: 4 may be suitable for use in the context of this disclosure.
  • the two nucleic acid molecules each comprise at least 20 identical contiguous nucleotides.
  • Fragments of nucleic acid sequences encoding CODM or T60DM may be used. Such fragments may have lengths of at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence encoding a CODM or T60DM as the case may be.
  • such fragments may have a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 3000, less than 2000, less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid sequence encoding CODM or T60DM as the case may be.
  • a genetically modified opium poppy plant of the disclosure comprises, stably integrated into its genome a first nucleic acid molecule heterologous to the plant.
  • the first nucleic acid molecule encodes an RNA, e.g. a hairpin RNA, for reducing expression of the CODM enzyme.
  • the genetically modified opium poppy plant further comprises and a second nucleic acid molecule heterologous to the plant.
  • the second nucleic acid molecule encodes an RNA, e.g. a hairpin RNA, for reducing expression of the T60DM enzyme.
  • the first and second nucleic acid molecules may be present in a single genetic construct or in multiple constructs.
  • first and/or second nucleic acid molecules may be arranged in the sense orientation relative to a promoter.
  • first and/or second nucleic acid molecules may be arranged in the anti-sense orientation relative to a promoter.
  • a genetic construct may comprise at least two nucleic acid molecules in both the sense and anti-sense orientations, relative to a promoter.
  • a genetic construct comprising nucleic acids in both the sense and anti-sense orientations may result in mRNA transcripts capable of forming stem-loop (hairpin) structures.
  • One or both of the nucleic acid molecules may be under transcriptional control of the same promoter.
  • the first and second heterologous nucleic acid molecules respectively comprise: at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4; at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2.
  • the first and second nucleic acid molecules respectively comprise: a nucleic acid molecule with a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:4; and a nucleic acid molecule with a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid
  • a genetically modified opium poppy plant of the disclosure comprises, stably integrated into its genome a nucleic acid molecule heterologous to the plant.
  • the nucleic acid molecule encodes a single transcript comprising an RNA (e.g., a hairpin RNA) for reducing expression of the CODM enzyme and an RNA (e.g. a hairpin RNA) for reducing expression of the T60DM enzyme.
  • the nucleic acid molecule encodes a single transcript comprising a single hairpin RNA for reducing expression of both the CODM enzyme and the T60DM enzyme.
  • a nucleic acid molecule may comprise a portion(s) of the coding sequence for CODM (SEQ ID NO: 4); T60DM (SEQ ID NO: 2); an allelic variant thereof; a non-natural variant thereof; a fragment thereof; or any combination thereof.
  • a fragment of the coding sequence for T60DM (SEQ ID NO: 2) is suitable for the production of an expression construct coding for an RNAi hairpin that targets expression of the endogenous coding sequences of both CODM and T60DM.
  • such fragment comprises SEQ ID NO: 7.
  • such expression construct comprises SEQ ID NO: 5.
  • the RNAi hairpin is encoded by a nucleic acid comprising SEQ ID NO: 6.
  • An expression construct comprising nucleic acids in both orientations relative to a promoter may further comprise a spacer to separate the nucleic acid molecules in sense orientation and those in the anti-sense orientation.
  • a "spacer" may comprise at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 150, or at least 200 nucleotides.
  • genetically modified plants of the present disclosure may further comprise a third nucleic acid molecule heterologous to the plant.
  • the third nucleic acid molecule is for increasing expression of Cyp80B3 to increase the total level of morphinans. Expression of transqenes targeting the endogenous CODM and T6QDM polypeptides
  • the disclosure relates to reducing CODM and/or T60DM activity by targeting CODM and T60DM at the protein level.
  • CODM (or T60DM) activity may be reduced by affecting the post-translational modification of the enzyme; or by the introduction of a heterologous protein (e.g. a mutated form of CODM or (T60DM) may be expressed such that it associates with the wildtype enzyme and alters its activity or outcompetes the wildtype enzyme for substrate without being able to convert the substrate; or an antibody that binds specifically to the CODM (or T60DM) enzyme.
  • a heterologous protein e.g. a mutated form of CODM or (T60DM) may be expressed such that it associates with the wildtype enzyme and alters its activity or outcompetes the wildtype enzyme for substrate without being able to convert the substrate; or an antibody that binds specifically to the CODM (or T60DM) enzyme.
  • nucleic acid molecule comprising the sequence of a CODM or T60DM gene promoter and/or other regulatory elements may be used in the context of the invention.
  • a heterologous nucleic acid molecule comprising sequences of a CODM (or T60DM as the case may be) gene promoter and/or regulatory element may be used to bias the cellular machinery away from an endogenous CODM (or T60DM as the case may be) gene promoter thus resulting in reduced CODM (or T60DM) expression.
  • the size or length of the nucleic acid construct or elements thereof, are not limited to the specific embodiments described herein.
  • the size of a transgene element may be defined instead by transgene element function; and that the promoter element may be determined instead as one that was capable of driving transcription at a sufficient level and in the desired tissues.
  • the stem loop structure formed by the mRNA transcribed by a nucleic acid construct of the invention may comprise a number of gene segments which may vary in length.
  • the stem loop may comprise 3 gene segments of about 21 -30 basepairs each, in addition to a spacer, such as an intron (126 bp plus intron).
  • the size of the gene segments may be established by the sum of the element sizes combined and may depend on the transformation method used to deliver the transgene into the target organism. For example, each transformation method (Agrobacterium, biolistics, VIGS-based delivery systems) may be limited to theoretical maximum transgene sizes.
  • DNA into plant cells by Agrobacterium mediated transfer is well known to those skilled in the art. If, for example, the Ti or Ri plasmids are used for the transformation of the plant cell, at least the right border, although more often both the right and the left border of the T-DNA contained in the Ti or Ri plasmid must be linked to the genes to be inserted as flanking region. If agrobacteria are used for the transformation, the DNA to be integrated must be cloned into special plasmids and specifically either into an intermediate or a binary vector. The intermediate vectors may be integrated into the Ti or Ri plasmid of the agrobacteria by homologous recombination due to sequences, which are homologous to sequences in the T- DNA.
  • Intermediate vectors cannot replicate in agrobacteria.
  • the intermediate vector can be transferred to Agrobacterium tumefaciens by means of a helper plasmid (conjugation).
  • Binary vectors are able to replicate in E. coli as well as in agrobacteria. They contain a selection marker gene and a linker or polylinker framed by the right and left T-DNA border region. They can be transformed directly into agrobacteria.
  • the agrobacterium acting as host cell should contain a plasmid carrying a vir-region. The vir-region is required for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present.
  • Such a transformed agrobacterium is used for the transformation of plant cells.
  • T-DNA for the transformation of plant cells has been intensively studied and has been adequately described in standard review articles and manuals on plant transformation.
  • Plant explants cultivated for this purpose with Agrobacterium tumefaciens or Agrobacterium rhizogenes can be used for the transfer of DNA into the plant cell.
  • Agrobacterium transformation can be used to transform opium poppy plants (Chitty et al. (Meth. Molec. Biol, 344:383-391 ; Chitty et al. (Functional Plant Biol, 30: 1045-1058); Facchini et al. (Plant Cell Rep., 27(4) 719-727)). Facchini et al. (2008) disclosed A. tumefaciens- mediated genetic transformation protocol via somatic embryogenesis for the production of fertile, herbicide-resistant opium poppy plants.
  • Transformation was mediated using pCAMBIA3301 , a transformation vector that harbors the phosphinothricin acetyltransferase (pat) gene driven by the cauliflower mosaic virus (CaMV) 35S promoter and the ⁇ - glucuronidase (GUS) gene also driven by the CaMV 35S promoter.
  • pCAMBIA3301 a transformation vector that harbors the phosphinothricin acetyltransferase (pat) gene driven by the cauliflower mosaic virus (CaMV) 35S promoter and the ⁇ - glucuronidase (GUS) gene also driven by the CaMV 35S promoter.
  • Explants were co- cultivated with A. tumefaciens in the presence of 50 1 M ATP and 50 1 M MgCI2. Root explants pre-cultured on callus induction medium were then used for transformation.
  • Herbicide- resistant, proliferating callus was obtained from explants on a medium containing both 2,4- dichlorophenoxyacetic acid (2,4-D) and 6-benzyladenine (BA).
  • Globular embryo genie callus was induced by removal of the BA from the medium, and placed on a hormone-free medium to form somatic embryos.
  • the somatic embryos were converted to plantlets under specific culture conditions and transferred to soil. Plants were allowed to mature and set seed. PAT and GUS transcripts and enzyme activities were detected in the transgenic lines tested.
  • Methods for introducing nucleic acids into cells are known in the art and include, but are not limited to: Viral methods (Clapp. Clin Perinatol, 20: 155-168, 1993; Lu et al. J Exp Med, 178: 2089-2096, 1993; Eglitis and Anderson. Biotechniques, 6: 608-614, 1988; Eglitis et al, Avd Exp Med Biol, 241 : 19-27, 1988); physical methods such as microinjection (Capecchi.
  • Another method for introducing DNA into plant cells is by biolistics.
  • This method involves the bombardment of plant cells with microscopic particles (such as gold or tungsten particles) coated with DNA.
  • the particles are rapidly accelerated, typically by gas or electrical discharge, through the cell wall and membranes, whereby the DNA is released into the cell and incorporated into the genome of the cell.
  • This method is used for transformation of many crops, including corn, wheat, barley, rice, woody tree species and others.
  • Biolistic bombardment has been proven effective in transfecting a wide variety of animal tissues as well as in both eukaryotic and prokaryotic microbes, mitochondria, and microbial and plant chloroplasts (Johnston. Nature, 346: 776-777, 1990; Klein et al. Bio/Technol, 10: 286-291 , 1992; Pecorino and Lo. Curr Biol, 2: 30-32, 1992; Jiao et al, Bio/Technol, 1 1 : 497-502, 1993).
  • Another method for introducing DNA into plant cells is by electroporation. This method involves a pulse of high voltage applied to protoplasts/cells/tissues resulting in transient pores in the plasma membrane which facilitates the uptake of foreign DNA. The foreign DNA enter through the holes into the cytoplasm and then to the nucleus.
  • Plant cells may be transformed by liposome mediated gene transfer.
  • This method refers to the use of liposomes, circular lipid molecules with an aqueous interior, to deliver nucleic acids into cells. Liposomes encapsulate DNA fragments and then adhere to the cell membranes and fuse with them to transfer DNA fragments. Thus, the DNA enters the cell and then to the nucleus.
  • Other well-known methods for transforming plant cells which are consistent with the present invention include, but are not limited to, pollen transformation (See University of Toledo 1993 U.S. Pat. No. 5,177,010); Whiskers technology (See U.S. Pat. Nos. 5,464,765 and 5,302,523).
  • the nucleic acid constructs of the present invention may be introduced into plant protoplasts.
  • Plant protoplasts are cells in which its cell wall is completely or partially removed using either mechanical or enzymatic means, and may be transformed with known methods including, calcium phosphate based precipitation, polyethylene glycol treatment and electroporation (see for example Potrykus et al., Mol. Gen. Genet., 199: 183, 1985; Marcotte et al., Nature, 335: 454, 1988).
  • Polyethylene glycol (PEG) is a polymer of ethylene oxide. It is widely used as a polymeric gene carrier to induce DNA uptake into plant protoplasts. PEG may be used in combination with divalent cations to precipitate DNA and effect cellular uptake.
  • a nucleic acid molecule of the present invention may also be targeted into the genome of a plant cell by a number of methods including, but not limited to, targeting recombination, homologous recombination and site-specific recombination (see review Baszcynski et al. Transgenic Plants, 157: 157-178, 2003 for review of site-specific recombination systems in plants). Homologous recombination and gene targeting in plants (reviewed in Reiss. International Review of Cytology, 228: 85-139, 2003) and mammalian cells (reviewed in Sorrell and Kolb. Biotechnology Advances, 23: 431 -469, 2005) are known in the art.
  • targeted recombination refers to integration of a nucleic acid construct into a site on the genome, where the integration is facilitated by a construct comprising sequences corresponding to the site of integration.
  • Homologous recombination relies on sequence identity between a piece of DNA that is introduced into a cell and the cell's genome. Homologous recombination is an extremely rare event in higher eukaryotes. However, the frequency of homologous recombination may be increased with strategies involving the introduction of DNA double-strand breaks, triplex forming oligonucleotides or adeno-associated virus.
  • site-specific recombination refers to the enzymatic recombination that occurs when at least two discrete DNA sequences interact to combine into a single nucleic acid sequence in the presence of the enzyme.
  • Site-specific recombination relies on enzymes such as recombinases, transposases and integrases, which catalyse DNA strand exchange between DNA molecules that have only limited sequence homology. Mechanisms of site specific recombination are known in the art (reviewed in Grindley et al. Annu Rev Biochem, 75: 567-605, 2006).
  • the recognition sites of site-specific recombinases (for example Cre and att sites) are usually 30-50 bp.
  • the pairs of sites between which the recombination occurs are usually identical, but there are exceptions e.g. attP and attB of ⁇ integrase (Landy. Ann Rev Biochem, 58: 913-949, 1989).
  • Additional methods might be selected from the resent years of development of methods and compositions to target and cleave genomic DNA by site specific nucleases e.g. Zinc Finger Nucleases, ZFNs, Meganucleases, Transcription Activator- Like Effector Nucleases, TALENS and Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas) with an engineered crRNA/tracr RNA), to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination of an exogenous donor DNA polynucleotide within a predetermined genomic locus.
  • site specific nucleases e.g. Zinc Finger Nucleases, ZFNs, Meganucleases, Transcription Activator- Like Effector Nucleases, TALENS and Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRIS
  • zinc fingers defines regions of amino acid sequence within a DNA binding protein binding domain whose structure is stabilized through coordination of a zinc ion.
  • a “zinc finger DNA binding protein” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • Zinc finger binding domains can be "engineered” to bind to a predetermined nucleotide sequence.
  • Non-limiting examples of methods for engineering zinc finger proteins are design and selection.
  • a designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. (U.S. Pat. No. 6,453,242; see also WO 98/53058).
  • a "TALE DNA binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence.
  • a single “repeat unit”, also referred to as a “repeat”, is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. (U.S. Patent Publication No. 201 1 /0301073).
  • the CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Cas CRISPR Associated nuclease system.
  • a "CRISPR DNA binding domain” is a short stranded RNA molecule that acting in concert with the CAS enzyme can selectively recognize, bind, and cleave genomic DNA.
  • the CRISPR/Cas system can be engineered to create a double- stranded break (DSB) at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair. (Jinek et al (2012) Science 337, p. 816-821 ).
  • Zinc finger, CRISPR and TALE binding domains can be "engineered” to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger.
  • TALEs can be “engineered” to bind to a predetermined nucleotide sequence, for example by engineering of the amino acids involved in DNA binding (the repeat variable diresidue or RVD region). Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non- naturally occurring.
  • Non-limiting examples of methods for engineering DNA-binding proteins are design and selection.
  • a designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria.
  • Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. (U.S. Pat. No. 6,453,242; see also WO 98/53058; and U.S. Publication Nos. 201 1 /0301073).
  • a "selected” zinc finger protein, CRISPR or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection.
  • the polynucleotide encodes a zinc finger protein that binds to a gene encoding a T60DM or a CODM polypeptide, resulting in reduced expression of the gene.
  • the zinc finger protein binds to a regulatory region of a gene encoding T60DM or CODM.
  • the zinc finger protein binds to a messenger RNA encoding a T60DM or a CODM polypeptide and prevents its translation.
  • the nucleic acid molecule becomes stably integrated into the plant genome such that it is heritable to daughter cells in order that successive generations of plant cells have reduced CODM and T60DM expression. This may involve the nucleic acid molecules of the present invention integrating, for instance integrating randomly, into the plant cell genome. Alternatively, the nucleic acid molecules of the present invention may remain as exogenous, self-replicating DNA that is heritable to daughter cells. As used herein, exogenous, self- replicating DNA that is heritable to daughter cells is also considered to be "stably integrated into the plant genome”.
  • CODM and T60DM enzymatic activity may be confirmed by methods known in the art of molecular biology. For example, disruption of endogenous genes may be assessed by PCR followed by Southern blot analysis. CODM and T60DM mRNA levels may, for example, be measured by real time PCR, RT-PCR, Northern blot analysis, micro-array gene analysis, and RNAse protection. CODM and T60DM protein levels may, without limitation, be measured by enzyme activity assays, ELISA and Western blot analysis. CODM and T60DM expression, or lack thereof, may be used as a predictor of increased thebaine accumulation. CODM and/or T60DM enzymatic activity may be assessed biochemically or functionally.
  • CODM (and/or T60DM) activity may be measured biochemically by methods known in the art including, but not limited to, the detection of products formed by the enzyme in the presence of any number of heterologous substrates, for example, thebaine.
  • CODM (and/or T60DM) activity may also be measured functionally, for example, by assessing thebaine levels in the poppy tissues.
  • a genetically modified opium poppy plant of the present disclosure may result in the reduction of CODM and/or T60DM activity in said plant or its seed, seedling, straw, capsules, or progeny thereof, by at least 57%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% relative to a wild type seed, seedling, straw, capsules, or progeny thereof.
  • Targeted Screening for Loss of Function Mutations in CODM and/or T6QDM Targeted Screening for Loss of Function Mutations in CODM and/or T6QDM.
  • This disclosure further relates to methods of generating opium poppy plants with high levels of thebaine that involve targeted screening for loss of function mutations in the endogenous genes encoding CODM and/or T60DM and subsequent breeding of plants to combine the mutations to obtain plants homozygous for the loss of function mutations at both loci.
  • Opium poppy breeders have used a variety of selection techniques in the development of improved cultivars. However, the most successful breeding method involving the hybridization of parents with a variety of different desired characteristics. Such approach has been used successfully to increase capsule numbers, seed and opium yield, morphine content, and lodging resistance.
  • T-DNA insertion refers to methods utilizing transfer-DNA (T-DNA) for disrupting genes via insertional mutagenesis. Down-regulating or silencing expression of the endogenous gene(s) encoding CODM and/or T60DM in an opium poppy plant can thus be achieved by T-DNA mutagenesis, wherein the T-DNA is used to randomly inserting in the plant genome to introduce mutations . Subsequently, plants can be screen for T-DNA insertions in the genes encoding CODM and/or T60DM by PCR, using a primer pair comprising one primer specific for the T-DNA and one primer specific for the gene encoding CODM (or T60DM as the case may be), or other high-throughput technologies.
  • Mutagenized plants and plant cells can also be specifically screened for mutations in the genes encoding CODM and/or T60DM, for example, by TILLING (Targeting Induced Local Lesions IN Genomes). Loss of function mutations present in natural plant populations can be identified by EcoTILLING.
  • loss of function mutations in the endogenous genes encoding CODM and T60DM can be combined through traditional breeding processes to produce plants homozygous for the loss of function mutations at both loci.
  • a loss of function mutation identified in the endogenous gene encoding CODM can be combined with mutations in the endogenous gene encoding T60DM that are introduced by genetic modification, and vice versa.
  • a loss of function mutation identified in the endogenous gene encoding CODM can be combined with genetic modification comprising an expression construct designed to reduce expression of T60DM as described above, and vice versa.
  • Opium poppy cultivation and opium harvesting traditionally involved the processes of manually lancing the seed capsule and collecting the latex.
  • methods to extract morphine and related compounds from opium poppy straw circumvented the traditional technique and makes it possible to obtain high quality seeds and pharmaceutically valuable raw materials simultaneously.
  • Recovering thebaine from poppy straw or latex of an opium poppy plant is well known in the art as discussed in WO2009109012.
  • methods of analyzing alkaloid extracts from opium poppy straw or latex are also discussed in WO2009109012.
  • the inventor used a single hairpin construct targeting genes coding for CODM and T60DM enzymes to test the hypothesis that plants containing elevated levels of thebaine (and reduced levels of codeine and morphine) compared to parental plants can be produced by simultaneously reducing the activity of the T60DM and CODM enzymes.
  • the coding sequences for CODM and T60DM genes have very high level of identity. Accordingly, the inventor created a single expression construct to target both the endogenous gene encoding CODM and the endogenous gene encoding T60DM from a portion of the T60DM coding sequence by RNAi.
  • the portion of the T60DM coding sequence used for the sense and antisense portions of the RNAi gene construct depicted in Figure 2 is underlined in Figure 3.
  • a 342 base pair sense fragment was amplified from cDNA isolated from opium poppy plant material using primers AAAGGCGCGCCCCTTGTCCTCAACCAAAT and AAAATTTAAATTCCACTTTTAAACAAAGC).
  • a 342 base pair antisense fragment was amplified from cDNA isolated from opium poppy plant material using primers AAAACTAGTCCTTGTCCTC AACC AAAT) , OPP026 (AAAGG ATCCTCCACTTTTAAACAAAGC) . These two fragments were used to create a nucleotide molecule with these to fragments interposed by sequences from ⁇ -glucuronidase.
  • the sequence of the nucleic acid molecule to be transcribed to produce a hairpin RNA is provided as SEQ ID NO: 6.
  • the T60DM sequences are underlined, whereas the intervening "hairpin" sequence between the T60DM sequences is derived from coding sequences for ⁇ - glucuronidase.
  • the complete expression construct comprising SEQ ID NO: 6 along with the Cauliflower Mosaic Virus 35S promoter and transcription and translation termination sequences from octopine synthase was cloned into a TDNA transfer vector.
  • the sequences between the left and right boarders of the vector are provided as provided as SEQ ID NO: 5.
  • the sequence 5' to the first underlined region i.e.
  • the "sense" T60DM-specific sequence comprises the 35S promoter sequence, whereas the sequences 3' to the second underlined region (i.e. the "antisense” T60DM-specific sequence) comprises the transcription and translation termination sequences from octopine synthase. While this expression construct was generated using a combination of traditional polymerase chain reaction (PCR) and cloning techniques (e.g. with restriction enzymes and ligations), the skilled person will understand that various conventional techniques could be used to produce the construct, including overlap extension PCR cloning or direct synthesis.
  • SEQ ID NO: 4 The sequence of the entire T-DNA comprising SEQ ID NO:6, from Right Border to Left Border, is provided as SEQ ID NO: 4.
  • VIGS Virus-induced gene silencing
  • transient expression of the expression construct resulted in substantial downregulation of transcripts from the endogenous genes encoding CODM and T60DM at 48 h post transformation (first bar from the right in both Figure 3a and 3b above).
  • B5 medium containing 30 g/l sucrose, 2.0 mg/l NAA, and 0.1 mg/l BAP, 8 g/l agar.
  • B5 medium containing 1 .0 mg/l NAA, 0.5 mg/ 1 BAP, 50 mg/l paromomycin, 300 mg/l timentin and 8 g/l agar.
  • Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 1 mg/l 2,4-D, 2.5 mg/l AgN0 3 , 8 g/l agar. pH - 5.6 ⁇ 0.2. (Plus antibiotic - Timentin 300 mg/l ) Embryo Maturation and germination
  • Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 1 mg/l Benzyl adenine, 1 mg/l Zeatin, 2.5 mg/l AgN0 3 , 8 g/l agar. pH - 5.6 ⁇ 0.2. (Plus antibiotic - Timentin 300 mg/l) Phytohormone-free plant regeneration medium
  • B5 medium containing 50 mg/L paromomycin, 300 mg/L timentin, and 8 g/L agar Shoot elongation medium
  • Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 0.5 mg/l Benzyl adenine, 2.5 mg/l AgN0 3 , 8 g/l agar. pH - 5.6 ⁇ 0.2. (Plus antibiotic - Timentin 300 mg/l)
  • Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 2.5 mg/l AgN0 3 , 8 g/l agar. pH - 5.6 ⁇ 0.2. (Plus antibiotic - Timentin 300 mg/l) Seed sterilization and germination
  • the seeds were surface-sterilized with 70% (w- 1 ) ethanol for 30 s and 1 % (w- 1 ) sodium hypochlorite solution for 2 min each three times, then rinsed five times in sterile water.
  • Approximately 50 seeds were placed on 25 ml of agar-solidified culture medium in jars.
  • the basal medium consisted of 1 ⁇ 2 Murashige and Skoog basal medium supplemented with 30 g/l sucrose (Gamborg et al. 1968) and solidified with 0.8% (wv- 1 ) agar.
  • the medium was adjusted to pH 5.6-5.8 before adding the agar, and then sterilized by autoclaving.
  • the seeds were germinated in a growth chamber at 25 °C under standard cool white fluorescent tubes and a 16-h photoperiod.
  • the binary vector pORE::ALM-MIRMAC was mobilized by electroporation in Agrobacterium tumefaciens strain EHA105.
  • Excised cotyledons from 12-day-old seedlings, line 1 18, were isolated by longitudinal bisection of the hypocotyl.
  • the hypocotyls were dipped into the A. tumefaciens culture in liquid inoculation medium for 15 min, blotted dry on sterile filter paper, and incubated in the dark at 25 °C on primary callus induction medium.
  • the hypocotyls were transferred to fresh primary callus induction medium containing 50 mg/L paromomycin and 300 mg/L timentin. After 4-5 weeks of incubation, primary calli were subcultured on somatic embryo induction medium.
  • Roots and hypocotyl segments from 1 2 day old seedlings were cut into ⁇ 5 mm segments while dipping in the Agrobacterium suspension.
  • Rooted plantlets are washed under tap water to remove the entire adhering agar and then are transferred to sterile soil in small pots, covered with saran wrap and incubated in a growth cabinet for acclimatization.
  • Paromomycin sulfate stock Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at -20C.
  • Kanamycin stock Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at -20C.
  • Rifampicin stock Prepare by dissolving powder in DMSO, aliquot, and store at -20C.
  • Timentin stock Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at -20C.
  • 5 2.0 mg/ml NAA stock Prepare by dissolving powder in 1 N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at -20C.
  • BAP stock Prepare by dissolving powder in 1 N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at -20C.
  • AgN03 stock Prepare by dissolving powder in water and sterilize by filtration, and store at +4C.
  • Zeatin stock Prepare by dissolving powder in 1 N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at -20C.
  • the T-DNA comprising the expression construct included the nptll gene, which confers resistance to paromycin.
  • Six plantlets (AM1 to AM6) were identified as resistant to paromomycin, suggesting that these plants were transformed with the expression construct.
  • Polymerase chain reaction on genomic DNA isolated from these plantlets using primers specific for the hairpin expression construct (SEQ ID NO: 9, TAACCGACTTGCTGCCCCGA; SEQ ID NO: 10, AAATAGAGATGCTTGCAGAAGATCCCG) showed that plants AM1 , AM2 and AM3 contain amplicon from genomic DNA.
  • Primers for actin (SEQ ID NO: 1 1 , CGTTTGAATCTTGCTGGCCGTGAT; SEQ ID NO: 12, TAGACGAGCTGCCTTTGGAAGTGT) were used as a positive control to confirm that the samples contained genomic DNA from Papaver somniferum.
  • RT-PCR reverse transcription polymerase chain reaction
  • RT-PCR was performed on the RNA extracts from plants AM1 to AM6 using primers specific for endogenous transcripts encoding CODM and T60DM.
  • expression of the expression construct appeared sufficient to downregulate the expression of the endogenous gene encoding T60DM relative to plants that did not express the expression construct.
  • expression of the expression construct appeared sufficient to downregulate the expression of the endogenous gene encoding CODM relative to plants that did not express the expression construct.
  • Acidic extraction 0.1 OOg of ground capsule or stems (from poppy) was mixed with 5 ml of a solution of 10% acetic acid, 10% water and 80% methanol followed by agitation for 30 minutes, and then filtered. The filtrate was directly injected into the HPLC.
  • Plants were grown from progeny seed of AM1 that contained the expression construct.
  • concentration of morphine, oripavine, codeine, and morphine in poppy straw from six AM1 progeny carrying the expression construct are provided in Table 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nutrition Science (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pain & Pain Management (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Emergency Medicine (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/CA2017/050951 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same Ceased WO2018027324A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
ES17838267T ES2970324T3 (es) 2016-08-12 2017-08-11 Adormidera con alto contenido de tebaína y métodos para producirla
DK17838267.7T DK3334826T5 (da) 2016-08-12 2017-08-11 Valmue med højt indhold af thebain og fremgangsmåder til fremstilling heraf
JP2019521398A JP6906812B2 (ja) 2016-08-12 2017-08-11 テバインが増加したポピーおよびおよびその生産方法
EP17838267.7A EP3334826B1 (en) 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same
CN201780063464.9A CN110088284A (zh) 2016-08-12 2017-08-11 高水平蒂巴因罂粟及其生产的方法
AU2017310339A AU2017310339B2 (en) 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same
US15/762,090 US10808258B2 (en) 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same
AU2019201771A AU2019201771A1 (en) 2016-08-12 2019-03-14 High thebaine poppy and methods of producing the same
US17/023,569 US20210246460A1 (en) 2016-08-12 2020-09-17 High thebaine poppy and methods of producing the same
AU2021232757A AU2021232757A1 (en) 2016-08-12 2021-09-16 High thebaine poppy and methods of producing the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662374682P 2016-08-12 2016-08-12
US62/374,682 2016-08-12
CA2,941,315 2016-09-07
CA2941315A CA2941315C (en) 2016-08-12 2016-09-07 High thebaine poppy and methods of producing the same

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/762,090 A-371-Of-International US10808258B2 (en) 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same
US17/023,569 Continuation US20210246460A1 (en) 2016-08-12 2020-09-17 High thebaine poppy and methods of producing the same

Publications (2)

Publication Number Publication Date
WO2018027324A1 true WO2018027324A1 (en) 2018-02-15
WO2018027324A9 WO2018027324A9 (en) 2019-07-18

Family

ID=57243364

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2017/050951 Ceased WO2018027324A1 (en) 2016-08-12 2017-08-11 High thebaine poppy and methods of producing the same

Country Status (11)

Country Link
US (2) US10808258B2 (cg-RX-API-DMAC7.html)
EP (1) EP3334826B1 (cg-RX-API-DMAC7.html)
JP (2) JP6906812B2 (cg-RX-API-DMAC7.html)
CN (1) CN110088284A (cg-RX-API-DMAC7.html)
AU (3) AU2017310339B2 (cg-RX-API-DMAC7.html)
CA (1) CA2941315C (cg-RX-API-DMAC7.html)
DK (1) DK3334826T5 (cg-RX-API-DMAC7.html)
ES (1) ES2970324T3 (cg-RX-API-DMAC7.html)
HU (1) HUE065349T2 (cg-RX-API-DMAC7.html)
PT (1) PT3334826T (cg-RX-API-DMAC7.html)
WO (1) WO2018027324A1 (cg-RX-API-DMAC7.html)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10519453B2 (en) 2015-05-04 2019-12-31 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
US10544420B2 (en) 2017-08-03 2020-01-28 Antheia, Inc. Engineered benzylisoquinoline alkaloid epimerases and methods of producing benzylisoquinoline alkaloids
US10738335B2 (en) 2016-10-18 2020-08-11 Antheia, Inc. Methods of producing nor-opioid and nal-opioid benzylisoquinoline alkaloids
US10858681B2 (en) 2013-03-15 2020-12-08 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloids (BIA) producing microbes, and methods of making and using the same
US11124814B2 (en) 2013-11-04 2021-09-21 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
EP3758728A4 (en) * 2018-03-02 2021-12-22 Tasmanian Alkaloids Pty. Ltd. PAPAVER SOMNIFERUM PLANT WITH AN MODIFIED ALKALOID PROFILE
US11859225B2 (en) 2015-05-08 2024-01-02 The Board Of Trustees Of The Leland Stanford Junior University Methods of producing epimerases and benzylisoquinoline alkaloids
US12480131B2 (en) 2019-03-08 2025-11-25 The Board Of Trustees Of The Leland Stanford Junior University Tropane alkaloid (TA) producing non-plant host cells, and methods of making and using the same

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2018203033B2 (en) * 2017-05-02 2021-07-01 Sun Pharmaceutical Industries Australia Pty Limited Modified plant
JP7555091B2 (ja) * 2020-02-29 2024-09-24 国立大学法人千葉大学 代謝物センサ及び酵素活性のスクリーニング方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998053058A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding proteins
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
WO2009109012A1 (en) * 2008-03-07 2009-09-11 Tasmanian Alkaloids Pty. Ltd. Papaver somniferum with high concentration of thebaine
WO2011058446A2 (en) * 2009-11-12 2011-05-19 Uti Limited Partnership Thebaine 6-o-demethylase and codeine o-demethylase from papaver somniferum
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6067749A (en) * 1996-07-11 2000-05-30 Tasmanian Alkaloids Pty. Ltd. Papaver somniferum strain with high concentration of thebaine and oripavine
CA2317508A1 (en) 1998-01-08 1999-07-15 Commonwealth Scientific And Industrial Research Organisation Methods for plant transformation and regeneration
US6730838B1 (en) 1999-02-12 2004-05-04 Council Of Scientific And Industrial Research Opiumless and alkaloid-free non-narcotic opium poppy (Papaver somniferum) variety “Sujata”
AUPP946399A0 (en) 1999-03-26 1999-04-22 Johnson & Johnson Research Pty. Limited Codeinone reductase from alkaloid poppy
EP1270727A1 (en) 2001-06-11 2003-01-02 Institut für Pflanzenbiochemie Salutaridinol 7-O-acetyltransferase and derivatives thereof
CH695417A5 (de) * 2001-11-15 2006-05-15 Ddr Wassyl Nowicky Dipl Ing Verfahren zur Umsetzung von Alkaloiden.
US6790959B1 (en) 2003-06-05 2004-09-14 Halsey Drug Company, Inc. Process for manufacturing thebaine
US6864370B1 (en) 2003-06-05 2005-03-08 Zhaiwei Lin Process for manufacturing oxycodone
EP1512748A1 (en) 2003-09-03 2005-03-09 Johnson & Johnson Research Pty Limited O-methyltransferases of tetrahydrobenzylisoquinoline alkaloid biosynthesis in papaver somniferum
EP1632565A1 (en) 2004-08-12 2006-03-08 Johnson & Johnson Research Pty Limited Modulation of alkaloid biosynthesis in plants and plants having altered alkaloid biosynthesis
DE102005005449A1 (de) * 2005-02-04 2006-08-10 Grünenthal GmbH Verfahren zur Herstellung einer gegen Missbrauch gesicherten Darreichungsform
AU2006216715A1 (en) 2005-02-22 2006-08-31 Ceres Inc. Modulating plant alkaloids
WO2006115575A1 (en) 2005-04-20 2006-11-02 Ceres Inc. Regulatory regions from papaveraceae
US8541647B2 (en) 2008-05-29 2013-09-24 Tasmania Alkaloids Pty, Ltd. Papaver somniferum with high concentration of codeine
CA2872079A1 (en) * 2012-04-30 2013-11-07 Tpi Enterprises Ltd Papaver bracteatum with modified alkaloid content

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998053058A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding proteins
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
WO2009109012A1 (en) * 2008-03-07 2009-09-11 Tasmanian Alkaloids Pty. Ltd. Papaver somniferum with high concentration of thebaine
WO2011058446A2 (en) * 2009-11-12 2011-05-19 Uti Limited Partnership Thebaine 6-o-demethylase and codeine o-demethylase from papaver somniferum
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAGEL, J.M. ET AL.: "Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy", NATURE CHEMICAL BIOLOGY, vol. 6, no. 4, April 2010 (2010-04-01), pages 273 - 275, XP055090844, ISSN: 1552-4469, Retrieved from the Internet <URL:https://www. nature .com/articles/nchembio.317> [retrieved on 20171115] *
KAWANO, N. ET AL.: "Genetic and Phenotypic Analyses of a Papaver somniferum T-DNA Insertional Mutant with Altered Alkaloid Composition", PHARMACEUTICALS, vol. 5, no. 2, 2012, pages 133 - 154, XP055462609, ISSN: 1424-8247 *
KRYSAN, P.J. ET AL., PLANT CELL, vol. 11, 1999, pages 2283 - 2290
OSSOWSKI SSCHWAB RWEIGEL D: "Gene silencing in plants using artificial microRNAs and other small RNAs", THE PLANT JOURNAL, vol. 53, 2008, pages 674 - 690, XP055050162, DOI: 10.1111/j.1365-313X.2007.03328.x
WIJEKOON, C.P. ET AL.: "Systematic knockdown of morphine pathway enzymes in opium poppy using virus-induced gene silencing", THE PLANT JOURNAL, vol. 69, 2012, pages 1052 - 1063, XP055067993, ISSN: 1365-313X *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10988787B2 (en) 2013-03-15 2021-04-27 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloids (BIA) producing microbes, and methods of making and using the same
US11214819B2 (en) 2013-03-15 2022-01-04 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloids (BIA) producing microbes, and methods of making and using the same
US10858681B2 (en) 2013-03-15 2020-12-08 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloids (BIA) producing microbes, and methods of making and using the same
US12018304B2 (en) 2013-11-04 2024-06-25 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
US11124814B2 (en) 2013-11-04 2021-09-21 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
US10752903B2 (en) 2015-05-04 2020-08-25 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
US10519453B2 (en) 2015-05-04 2019-12-31 The Board Of Trustees Of The Leland Stanford Junior University Benzylisoquinoline alkaloid (BIA) precursor producing microbes, and methods of making and using the same
US11859225B2 (en) 2015-05-08 2024-01-02 The Board Of Trustees Of The Leland Stanford Junior University Methods of producing epimerases and benzylisoquinoline alkaloids
US12497638B2 (en) 2015-05-08 2025-12-16 The Board Of Trustees Of The Leland Stanford Junior University Methods of producing epimerases and benzylisoquinoline alkaloids
US10738335B2 (en) 2016-10-18 2020-08-11 Antheia, Inc. Methods of producing nor-opioid and nal-opioid benzylisoquinoline alkaloids
US11427827B2 (en) 2017-08-03 2022-08-30 Antheia, Inc. Engineered benzylisoquinoline alkaloid epimerases and methods of producing benzylisoquinoline alkaloids
US10544420B2 (en) 2017-08-03 2020-01-28 Antheia, Inc. Engineered benzylisoquinoline alkaloid epimerases and methods of producing benzylisoquinoline alkaloids
EP3758728A4 (en) * 2018-03-02 2021-12-22 Tasmanian Alkaloids Pty. Ltd. PAPAVER SOMNIFERUM PLANT WITH AN MODIFIED ALKALOID PROFILE
US12480131B2 (en) 2019-03-08 2025-11-25 The Board Of Trustees Of The Leland Stanford Junior University Tropane alkaloid (TA) producing non-plant host cells, and methods of making and using the same

Also Published As

Publication number Publication date
DK3334826T5 (da) 2024-10-07
ES2970324T3 (es) 2024-05-28
PT3334826T (pt) 2024-02-07
CN110088284A (zh) 2019-08-02
HUE065349T2 (hu) 2024-05-28
AU2017310339A1 (en) 2018-04-12
JP2021000097A (ja) 2021-01-07
US20190169625A1 (en) 2019-06-06
CA2941315A1 (en) 2016-11-08
EP3334826A1 (en) 2018-06-20
AU2019201771A1 (en) 2019-04-04
US10808258B2 (en) 2020-10-20
JP6906812B2 (ja) 2021-07-21
DK3334826T3 (da) 2024-01-15
JP2019528084A (ja) 2019-10-10
US20210246460A1 (en) 2021-08-12
WO2018027324A9 (en) 2019-07-18
CA2941315C (en) 2018-03-06
EP3334826A4 (en) 2018-08-08
EP3334826B1 (en) 2023-10-11
AU2017310339B2 (en) 2019-01-17
AU2021232757A1 (en) 2021-10-21

Similar Documents

Publication Publication Date Title
US10808258B2 (en) High thebaine poppy and methods of producing the same
US20240067978A1 (en) Transcription factors that regulate nicotine biosynthesis in tobacco
US20050144669A1 (en) MicroRNAs in plants
US10119148B2 (en) RNAs from pathogens inhibit plant immunity
US10724049B2 (en) Controlling fungal pathogens by disabling their small RNA pathways using RNAi-based strategy
CN111630171A (zh) 植物抗倒伏性
JP5594137B2 (ja) カプシノイドを生合成する遺伝子改変植物
US20120278944A1 (en) Altered senescence for improved forage quality
WO2019075387A1 (en) METHODS AND COMPOSITIONS FOR MODULATING GOSSYPOL CONTENT IN COTTON PLANTS
US20160319301A1 (en) Methods for Increasing Resistance to Soybean Cyst Nematode in Soybean Plants
CN104487576A (zh) 具有修饰的生物碱含量的大红罂粟
WO2019232277A1 (en) Methods of altering seed weight and seed oil content by manipulating alpha-carboxyltransferase (a-ct) activity via carboxyltransferase interactor (cti) protein expression
KR20160067973A (ko) 제아 메이스 조절 요소 및 그의 용도
Gao Identification and Characterization of IAMH1 Gene in Biosynthesis of Plant Hormone Auxin
WO2005054482A2 (en) Nucleic acids having utility in seeds

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2017838267

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017310339

Country of ref document: AU

Date of ref document: 20170811

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019521398

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE