WO2011058446A2 - Thebaine 6-o-demethylase and codeine o-demethylase from papaver somniferum - Google Patents

Abstract

The present invention relates to gene and protein sequences for a thebaine 6-O- demethylase from Papaver somniferum and methods of use therefor. The present invention also relates to gene and protein sequences for a codeine O-demethylase from Papaver somniferum and methods of use therefor. The present invention also relates to gene and protein sequences for a protoberberine 10 O-demethylase from Papaver somniferum and methods of use therefor. In particular, systems for the recombinant production of opiates in yeast and transgenic plants for the production of opiates are provided.

Description

DESCRIPTION

THEBAINE 6-O-DEMETHYLASE, PROTOBERBERINE 10 O-DEMETHYLASE AND CODEINE O-DEMETHYLASE FROM PAPA VER SOMNIFERUM

BACKGROUND OF THE INVENTION

This application claims benefit of priority to U.S. Provisional Application Serial No. 61/260,647, and 61/260,659, both filed November 12, 2009, the entire contents of which are hereby incorporated by reference in their entirety. I. Field of the Invention

The present invention relates to the fields of botany, molecular biology and biochemistry. More particular, the invention relates to the identification and characterization of a thebaine 6-O-demethylase, codeine O-demethylase and protoberberine 10 O-demethylase from Papaver somniferum, and uses therefor.

II. Related Art

The medicinal properties of opium poppy {Papaver somniferum) have been recognized since the dawn of civilization, and the plant remains one of the world's most important crops. The licit cultivation of opium poppy in several countries remains the sole commercial source for narcotic analgesics morphine, codeine and semi-synthetic derivatives of thebaine, such as oxycodone. The more prevalent illicit cultivation of opium poppy for the production of 0,0-diacetylmorphine {i.e., heroin) has long resulted in profound and negative global consequences. These compounds belong to the large and diverse group of benzylisoquinoline alkaloids (BIAs), many of which possess potent pharmacological properties (Ziegler and Facchini, 2008). In addition to morphine and codeine, opium poppy produces the antimicrobial sanguinarine, the muscle relaxant papaverine, and the antitumorogenic agent noscapine. Benzylisoquinoline alkaloids share a common biosynthetic origin beginning with the formation of (5)-norcoclaurine via the condensation of dopamine and 4-hydroxyphenylacetaldehyde (4-HPAA). From (5)-norcoclaurine, four enzymatic steps lead to the formation of the central branch-point intermediate (5 -reticuline, which undergoes diverse intramolecular coupling reactions to yield a variety of precursors for several BIA subclasses {e.g., morphinan, protoberberine, benzophenanthridine, and aporphine). Entry into the morphinan branch requires the conversion of (5)-reticuline to its (i?)-enantiomer, followed by cytochrome P450-catalzyed C-C phenol coupling (Gesell et al, 2009), NADPH-dependent reduction (Ziegler et al, 2006), acetylation (Grothe et al, 2001) and subsequent acetate elimination to form the first pentacyclic morphinan alkaloid thebaine (FIG. 1). In total, the formation of thebaine from dopamine and 4-HPAA involves eleven enzymes, all of which have been isolated. Cognate cDNAs have been identified for eight of these enzymes.

In contrast with the inventors' understanding of thebaine formation, the enzymatic conversion of thebaine to morphine is not well characterized. Early feeding studies suggested a route through neopinone and codeinone (Parker et al, 1972). The discovery of oripavine led to the proposal of a bifurcated pathway (Brochmann-Hanssen, 1984) (FIG. 1), which was subsequently supported by the catalytic properties of codeinone reductase (COR), a NADPH- dependent aldo-keto reductase capable of reducing both codeinone and morphinone to codeine and morphine, respectively (Unterlinner et al, 1999). The bifurcated scheme required O-demethylation at position 6 (ring C) and position 3 (ring A). Although enzymes catalyzing these reactions have never been detected, it was presupposed that cytochromes P450 were responsible (Grothe et al, 2001 ; Unterlinner et al, 1999). In humans and other mammals, the O-demethylation O-demethylation of thebaine and codeine is catalyzed by the cytochrome P450 (CYP)2D6 (Zhu, 2008; Grobe et al, 2009).

Available biosynthetic genes involved in BIA metabolism have facilitated the development of transgenic opium poppy lines engineered for the accumulation of commercially desirable morphinan alkaloids. Most of the licit morphine recovered from opium poppy is synthetically 3-0-methylated to produce codeine (Intl. Narcotis Control Board, 2008), which has more versatile applications as an analgesic and a cough suppressant. In an attempt to produce high-codeine, morphine-free opium poppy, RNAi technology was used to silence COR expression, which unexpectedly lead to the replacement of morphine with (5)-reticuline (Allen et al, 2004). An alternative to conventional agriculture is the potential commercial production of morphinan alkaloids in microbial systems (Leonard et al, 2009). Recently, the feasibility of reconstituting BIA metabolism in yeast {Saccharomyces cerevisiae) has been demonstrated (Minami et al, 2008; Hawkins and Smolke, 2008). The isolation of cDNAs cognate for the enzymes catalyzing the 6-0- and 3-( -demethylation reactions is an essential prerequisite for the microbial production of codeine and morphine.

Natural and induced mutants of opium poppy accumulating thebaine and oripavine rather than morphine and codeine have been reported (Nyman, 1978), including the topi variety derived through chemical mutagenesis (Millgate et al, 2004). The development of topi was a major breakthrough for the opium poppy industry in Australia, which is the source of over 40% of the world's licit opiates, by allowing the efficient production of thebaine from morphine-free crops. Although the metabolic block in topi was suggested to result from a defect in the enzyme catalyzing the 6-O-demethylation of thebaine and oripavine, the biochemical basis for the phenotype was not determined. Microarray-based analysis comparing the transcriptomes of topi and its morphine/codeine-producing parent did not reveal any candidate genes potentially involved in BIA metabolism.

SUMMARY OF THE INVENTION

Thus, in accordance with the present invention, there is provided an isolated thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO:l . The thebaine 6-0- demethylase may be fused to a non-demethylase peptide or polypeptide sequence. The thebaine 6-O-demethylase may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID NO:l . Thebaine 6-0-demethylase may comprise the sequence of SEQ ID NO: 1, or may consist of the sequence of SEQ ID NO:l .

In another embodiment, there is provided an isolated nucleic acid encoding a thebaine

6-( -demethylase having the sequence of SEQ ID NO:l . The isolated nucleic acid may have at least 70% sequence homology to SEQ ID NO:2. The isolated nucleic acid may have at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%), 88%o, 89%) or 90% sequence homology to SEQ ID NO:2.The nucleic acid may comprise the sequence of SEQ ID NO:2, or the nucleic acid may consist of the sequence of SEQ ID NO:2.

Another embodiment comprises an isolated nucleic acid encoding a thebaine 6-0- demethylase that hybridizes under medium stringency conditions to SEQ ID NO:2. The nucleic acid may hybridize under medium-high or high stringency conditions to SEQ ID NO:2. The nucleic acid may encode SEQ ID NO: 1. The nucleic acid may encode a thebaine 6-O-demethylase that has at least 90% sequence homology to to SEQ ID NO:2. The nucleic acid may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:2.

In yet another embodiment, there is provided an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-0- demethylase having 90% sequence homology to SEQ ID NO: 1. The promoter may be a plant promoter, a bacterial promoter, a phage promoter or a yeast promoter. The expression cassette may further comprise a transcription termination signal. In still yet another embodiment, there is provided a vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID N0:1. The promoter may be a plant promoter, a bacterial promoter, a phage promoter or a yeast promoter. The vector may be a transposon, a yeast artificial chromosome, a phage or a bacterial plasmid.

In a further embodiment, there is provided a recombinant cell comprising an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID N0:1. The cell may be a plant cell, a bacterial cell or a yeast cell. The promoter may be heterologous to a native Papaver somniferum thebaine 6-O-demethylase gene. The expression cassette may be comprised in a transposon, a phage genome, a yeast artificial chromosome, or a bacterial plasmid. The recombinant cell may further comprise a heterologous selectable marker.

In yet a further embodiment, there is provided a transgenic Papaver somniferum plant, cells of which comprise a thebaine 6-O-demethylase gene with a heterologous nucleic acid inserted therein. The heterologous nucleic acid may result in premature termination of transcription or translation of thebaine 6-O-demethylase. Also provided are seeds and progeny of this plant, and seeds of the progeny. In other embodiments, there is provided a method of producing thebaine or oripavine comprising culturing the plant.

In still yet a further embodiment, there is provided a transgenic Papaver somniferum plant, cells of which comprise a heterologous expression cassette that encodes a thebaine 6-O- demethylase inhibitory sequence. The inhibitory sequence may be an antisense sequence or siRNA. Also provided are seeds and progeny of this plant, and seeds of the progeny. In other embodiments, there is provided a method of producing thebaine or oripavine comprising culturing the plant.

Yet an additional embodiment involves a method of producing morphinone comprising (a) contacting oripavine with an isolated Papaver somniferum thebaine 6-O- demethylase having 90% sequence homology to SEQ ID N0: 1. The method may further comprise (b) contacting morphinone produced in step (a) with a codeinone reductase to produce morphine.

Another embodiment involves a method of producing neopinone and codeinone comprising (a) contacting thebaine with an isolated Papaver somniferum thebaine 6-O- demethylase having 90% sequence homology to SEQ ID N0:1. The method may further comprise (b) contacting neopinone/codeinone produced in step (a) with a codeinone reductase to produce codeine.

Also contemplated in accordance with the present invention is a system comprising: (a) a bacterial cell comprising a Papaver somniferum thebaine 6-O-demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O- demethylase; and (b) a medium-containing vessel suitable for culturing the bacterial cell.

or

a system comprising:

(a) a yeast cell comprising a Papaver somniferum thebaine 6-O-demethylase, a

Papaver somniferum codeinone reductase and a Papaver somniferum codeine O- demethylase; and (b) a medium-containing vessel suitable for culturing the yeast cell. Still further, there is provided a method for the recombinant production of an opiate comprising (a) providing a bacterial cell comprising a Papaver somniferum thebaine 6-0- demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O-demethylase; and (b) culturing the bacterial cell under conditions supporting the production of one or more opiates.

There also is provided a method for the recombinant production of an opiate comprising (a) providing a yeast cell comprising a Papaver somniferum thebaine 6-0- demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O-demethylase; and (b) culturing the yeast cell under conditions supporting the production of one or more opiates.

Also provided is an oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:2. The oligonucleotide may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length. The oligonucleotide may comprise 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:2. The oligonucleotide may be RNA or DNA. The oligonucleotide may comprise at least one modified base, such as a 2'-0-methyl or 2'-fluoro modification. The oligonucleotide may comprise a detectable marker, such as a sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic label. The oligonucleotide may comprise a non-Papaver sequence. The oligonucleotide may be single- stranded.

In addition, there is provided an isolated codeine ( -demethylase having 90% sequence homology to SEQ ID NO:3. The codeine O-demethylase may be fused to a non-demethylase peptide or polypeptide sequence. The codeine (2-demethylase may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID NO:3. The codeine O- demethylase may comprise the sequence of SEQ ID NO:3. The codeine O-demethylase may consist of the sequence of SEQ ID NO:3.

In another embodiment, there is provided an isolated nucleic acid encoding a codeine

( -demethylase having the sequence of SEQ ID NO:3. The isolated nucleic acid may have at least 70% sequence homology to SEQ ID NO:4. The isolated nucleic acid may have at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% sequence homology to SEQ ID NO:4.The nucleic acid may comprise the sequence of SEQ ID NO:4, or the nucleic acid may consist of the sequence of SEQ ID NO:4.

Another embodiment comprises an isolated nucleic acid encoding a codeine O- demethylase that hybridizes under medium stringency conditions to SEQ ID NO:4. The nucleic acid may hybridize under medium-high or high stringency conditions to SEQ ID NO:4. The nucleic acid may encode SEQ ID NO:3. The nucleic acid may encode a codeine O-demethylase that has at least 90% sequence homology to to SEQ ID NO:4. The nucleic acid may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:4.

In yet another embodiment, there is provided an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O- demethylase having 90% sequence homology to SEQ ID NO:3. The promoter may be a plant promoter, a bacterial promoter, or a yeast promoter. The expression cassette may further comprise a transcription termination signal.

In still yet another embodiment, there is provided a vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID NO:3. The promoter may be a plant promoter, a bacterial promoter, or a yeast promoter. The vector may be a transposon, a yeast artificial chromosome or a bacterial plasmid.

A further embodiment comprises a recombinant cell comprising an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID NO:3. The cell may be a plant cell, a bacterial cell or a yeast cell. The promoter may be heterologous to a native Papaver somniferum codeine O-demethylase gene. The expression cassette may be comprised in a transposon, a yeast artificial chromosome, or a bacterial plasmid. The cell may further comprise a heterologous selectable marker. Yet a further embodiment comprises a transgenic Papaver somniferum plant, cells of which comprise a codeine O-demethylase gene with a heterologous nucleic acid inserted therein. The heterologous nucleic acid may result in premature termination of transcription or translation of codeine O-demethylase. Also provided are a seed of this plant, progeny of this plan, and seed of the progeny plant.

A transgenic Papaver somniferum plant, cells of which comprises a heterologous expression cassette the encodes an codeine O-demethylase inhibitory sequence. The inhibitory sequence may be an antisense sequence or an siRNA. Also provided are a seed of this plant, progeny of this plan, and seed of the progeny plant.

Still other embodiments comprise a method of producing thebaine comprising culturing the plants described above, or a method of producing codeine comprising culturing the plants described above.

Another method provides for production of oripavine comprising (a) contacting thebaine with an isolated Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID N0:3. The method may further comprise (b) contacting oripavine produced in step (a) with a thebaine 6-O-demethylase to produce morphinone. Also provided is a method of producing morphine comprising contacting codeine with an isolated Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID ΝΟ:3.

Also provided is an oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:4. The oligonucleotide may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length. The oligonucleotide may comprise 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:4. The oligonucleotide may be RNA or DNA. The oligonucleotide may comprise at least one modified base, such as a 2'-0-methyl or 2'-fluoro modification. The oligonucleotide may comprise a detectable marker, such as a sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic label. The oligonucleotide may comprise a non-Papaver sequence. The oligonucleotide may be single- stranded.

In a further embodiment, there is provided an isolated protoberberine 10 O- demethylase having 90% sequence homology to SEQ ID NO:25. The isolated protoberberine 10 O-demethylase may is fused to a non-demethylase peptide or polypeptide sequence. The protoberberine 10 O-demethylase may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID N0:25. The protoberberine 10 O-demethylase may comprise the sequence of SEQ ID NO:25. The P10 O-demethylase may consist of the sequence of SEQ ID NO:25.

Another embodiment comprises an isolated nucleic acid encoding a protoberberine 10 O-demethylase having the sequence to SEQ ID NO:25. The nucleic acid may hae at least 70% sequence homology to SEQ ID NO:26. The nucleic acid may have at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% sequence homology to SEQ ID NO:26. The nucleic acid may comprise the sequence of SEQ ID NO:26. The nucleic acid may consist of the sequence of SEQ ID NO:26.

Still another embodiment comprises an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 O- demethylase having 90% sequence homology to SEQ ID NO:25. The promoter may be a plant promoter, a bacterial promoter, or a yeast promoter. The expression cassette may further comprise a transcription termination signal.

An additional embodiment comprises a vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 O-demethylase having 90% sequence homology to SEQ ID ΝΟ:25. The promoter may be a plant promoter, a bacterial promoter, or a yeast promoter. The vector may be a transposon, a yeast artificial chromosome or a bacterial plasmid.

Yet another embodiment comprises a recombinant cell comprising an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 O-demethylase having 90% sequence homology to SEQ ID N0:25. The cell may be a plant cell, a bacterial cell or a yeast cell. The promoter may be heterologous to a native Papaver somniferum protoberberine 10 O-demethylase gene. The expression cassette may be comprised in a transposon, a yeast artificial chromosome, or a bacterial plasmid. The cell may further comprise a heterologous selectable marker.

An additional embodiment comprises a transgenic Papaver somniferum plant, cells of which comprise a protoberberine 10 O-demethylase gene with a heterologous nucleic acid inserted therein. The heterologous nucleic acid may result in premature termination of transcription or translation of protoberberine 10 O-demethylase. Also contemplated are seeds of the plant, progeny of the plant and seed of the progeny plant.

Another embodiment comprises a transgenic Papaver somniferum plant, cells of which comprises a heterologous expression cassette the encodes a protoberberine 10 O- demethylase inhibitory sequence. The inhibitory sequence may an antisense sequence or an siRNA. Also contemplated are seeds of the plant, progeny of the plant and seed of the progeny plant.

Still another embodiment comprises an isolated nucleic acid encoding a protoberberine 10 O-demethylase that hybridizes under medium stringency conditions to SEQ ID NO:26. The nucleic acid may hybridize under high stringency conditions to SEQ ID NO:26. The nucleic acid may encode SEQ ID NO:26. A related embodiment comprises an isolated nucleic acid encoding a protoberberine 10 O-demethylase that has at least 90% sequence homology to to SEQ ID NO:26. The nucleic acid may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:26.

Also provided is an oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:26. The oligonucleotide may 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length, and/or may comprise 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:26. The oligonucleotide may be RNA or DNA. The oligonucleotide may comprise at least one modified base, such as a 2'-0-methyl or 2'-fluoro modification. The oligonucleotide may comprise a detectable marker, such as a sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic. The oligonucleotide may comprise a non-Papaver sequence. The oligonucleotide may be single- stranded.

It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.

The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

These, and other, embodiments of the invention will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following description, while indicating various embodiments of the invention and numerous specific details thereof, is given by way of illustration and not of limitation. Many substitutions, modifications, additions and/or rearrangements may be made within the scope of the invention without departing from the spirit thereof, and the invention includes all such substitutions, modifications, additions and/or rearrangements. BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein:

FIG. 1 - Morphinan alkaloid biosynthesis in opium poppy, showing two routes from thebaine to morphine. O-Demethylation at position 6 (ring C) is catalyzed by thebaine 6-O-demethylase (T60DM) whereas O-demethylation at position 3 (ring A) is catalyzed by codeine O-demethylase (CODM). Thebaine can undergo 0-demethylation at position 6 or position 3 to yield neopinone or oripavine, respectively. Neopinone spontaneously rearranges to the more stable codeinone in aqueous solution over a wide pH range (Parker et al, 1972), a process that is expedited under physiological conditions by the reduction of codeinone to codeine by codeinone reductase (COR). Codeine is demethylated by CODM to produce morphine. Demethylation of oripavine by T60DM yields morphinone, which is reduced to morphine by COR. The opium poppy variety T used in this study is blocked at T60DM, and accumulates thebaine and oripavine rather than morphine and codeine.

FIG. 2 - Unrooted neighbor-joining. Phylogenetic tree for selected plant 2- oxoglutarate (20G)/Fe(II)-dependent dioxygenases. Bootstrap frequencies for each clade are percentages of 1,000 iterations.

FIGS. 3A-D - Extracted ion chromatograms (EICs) showing the substrates and products of T60DM (FIG. 3A, 3B) and CODM (FIG. 3C, 3D) enzyme assays. In each panel, the upper EIC corresponds to assays performed with boiled enzyme, whereas the lower EIC corresponds to assays performed with native enzyme. Reaction products were unambiguously identified using collision-induced dissociation (CID) analysis, and the resulting daughter ion mass spectra are shown in FIG. 4. (FIG. 3A) T60DM assay with thebaine as the substrate (m/z 312.1) and codeinone as the product (m/z 298.1). Neopinone, which is unstable and spontaneously rearranges to codeinone in aqueous solutions (Parker et al, 1972) was not detected. (FIG. 3B) T60DM assay with oripavine as the substrate (m/z 298.0) and morphinone as the product (m/z 284.0). (FIG. 3C) CODM assay with codeine as the substrate (m/z 300.1) and morphine as the product (m/z 286.1). (FIG. 3D) CODM assay with thebaine as the substrate (m/z 312.1) and oripavine as the product (m/z 298.0). T60DM assays were analyzed. after one hour to minimize the spontaneous formation of codeinone or morphinone adducts. CODM assays were stopped after 4 hours. Refer to Supplementary Methods for experimental details.

FIG. 4A-H - Collision-induced dissociation (CID) mass spectra for substrates (left panels) and products (right panels) of T60DM (ad) and CODM (eh) enzyme assays.

Following liquid chromatography (LC), molecular parent ions (indicated with arrowheads) were generated and focused using electrospray ionization (ESI), and subjected to mass spectrometry (MS) as described in Methods section. To unambiguously identify reaction components, daughter ions were generated using argon gas collision at the following energies: -15.0 eV (thebaine and oripavine), -25.0 (codeinone and morphinone), -32.0 eV (morphine) and -30.0 eV (codeine). The observed ESI mass spectra were in agreement with previously published ESI spectra (Raith et al, 2003) and with those acquired for authentic standards. Structures corresponding to the parent molecules are shown.

FIG. 5 - Substrate specificities of recombinant T60DM, DIOX2 and CODM.

Enzyme assays were based on the decarboxylation of [l-¹⁴C]2-oxoglutarate coupled with the O-demethylation of a benzylisoquinoline alkaloid co-substrate as described in Supplementary Methods. The incubation time (45 min), protein concentration (10 ng/μΐ) and other assay parameters were optimized prior to enzyme kinetic analyses. The structures of compounds tested as potential enzymatic substrates are shown adjacent to values indicating percent relative activities for T60DM, DIOX2, and CODM, respectively. Hyphens indicate that enzyme activity was not detected.

FIGS. 6A-C - Virus-induced gene silencing (VIGS) analysis. Opium poppy seedlings were infiltrated with Agrobacterium tumefaciens strain GV3101 harboring pTRVl and one of five different pTRV2 constructs. DIOX-a contained a highly conserved sequence from the coding regions of T60DM, DIOX2 and CODM. DIOX-b, DIOX-c and DIOX-d contained gene-specific sequences from the 3'-UTRs of T60DM, DIOX2, and CODM, respectively. pTRV2 was used as the empty vector. (FIG. 6A) Thin-layer chromatography (TLC) of latex extracted in methanol. The Rf positions of authentic alkaloid standards are indicated in the left margin. (FIG. 6B) High performance liquid chromatography (HPLC) of latex extracts. Each bar represents the mean ± standard deviation for triplicate samples from 3 independent plants. (FIG. 6C) Real-time quantitative PCR (RT-qPCR) analysis of T60DM, DIOX2 and CODM transcript levels in stem samples from plants analyzed by TLC and HPLC. Each bar represents the mean ± standard deviation of 27 values (i.e., 3 technical replicates on RNA samples extracted from each of 3 stem segments taken from each of 3 individual plants).

FIG. 7A-L - Relative abundance of transcripts encoding T60DM, DIOX2 and CODM in opium poppy plant organs. Real-time quantitative PCR was used to quantify the relative transcript abundance in roots, stems, leaves and flower buds of opium poppy varieties T, L, 11 and 40. Data were calculated using nine independent trials per plant line (i.e., 3 technical replicates on each of 3 individual plants). Normalization was performed using elongation factor la (elf la) as the internal control, and the plant line exhibiting the highest expression level served as the calibrator for each target gene. DIOX2 and CODM transcripts were below detection limits in root (a and c, respectively). Abbreviation: nd, not detected.

FIG. 8 - Biosynthesis of morphine in opium poppy. The enzymes reported in this study, and the location of the metabolic block in the topi mutant (Millgate et al, 2004), are shown in red. The topi mutant variety of opium poppy accumulates thebaine and oripavine (highlighted in yellow) rather than codeine and morphine. This phenotype has also been reported in variety T (Hagel et al, 2008), which exhibits a dramatic reduction in shoot T60DM transcript levels (FIG. 7). Enzymes for which corresponding cDNAs have previously been isolated are shown in green. Although activity has been detected in plant protein extracts for enzymes shown in blue, the corresponding genes have not yet been isolated. An enzyme capable of catalyzing thebaine biosynthesis has been suggested

(THS) (Fisinger et al, 2007). However, the formation of thebaine from salutaridinol Ί-Ο- acetate occurs spontaneously at pH 8-9 (Lenz and Zenk, 1995). Enzyme-catalyzed and/or spontaneous structural rearrangements and functional group modulations are indicated on each molecule in red. Abbreviations: NCS, norcoclaurine synthase; 60MT, norcoclaurine 6-(9-methyltransferase; CNMT, coclaurineiV-methyltransferase; NMCH, N- methylcoclaurine 3' -hydroxylase; 4ΌΜΤ, 3'-hydroxy-N-methylcoclaurine 4'-O- methyltransferase; DRS, 1 ,2-dehydroreticuline synthase; DRR, 1,2-dehydroreticuline reductase; SalSyn, salutaridine synthase; SalR, salutaridine reductase; SalAT, salutaridinol 7-O-acetyltransferase; THS, thebainesynthase; T60DM, thebaine 6-O-demethylase; CODM, codeine O-demethylase; COR, codeinone reductase.

FIG. 9 - Venn diagrams summarizing the results of microarray hybridization experiments that compared the abundance of transcripts in the stems of opium poppy variety T with varieties L, 11 and 40. The numbers of genetic elements on the microarray that showed decreased hybridization of RNA from variety T compared with varieties L, 11 and/or 40 are indicated in the upper panel (red). Conversely, the numbers of genetic elements that showed increased hybridization of RNA from variety T compared with varieties L, 11 and/or 40 are indicated in the lower panel (green). Decreased or increased hybridization was indicative of lower or higher transcript abundance, respectively, and thus revealed a relative suppression in the expression of specific genes.

Genes were considered differentially expressed based on a signal intensity ratio cutoff of 1.8. Microarray hybridization experiments involving pair- wise comparisons of varieties T versus L, T versus 11, and T versus 40 revealed 8 genes putatively suppressed in T compared with at least two other varieties, but only a single gene suppressed in T compared with all three varieties (upper panel).

FIGS. 10A-B - Heat maps illustrating the relative abundance of transcripts in the stems of opium poppy variety T with varieties L, 11 and 40. Results are shown only for genes exhibiting low (FIG. 10A) or high (FIG. 10B) expression in T compared with at least two other varieties, based on a ratio cutoff of 1.8. Corresponding functional annotations and microarray coordinates are shown to the right of each diagram. Average signal intensity ratios from 6 independent microarray hybridization experiments were log₂ normalized and plotted based on the indicated color scheme. Positive values (red color) indicate relatively lower transcript levels in variety T, whereas negative values (green color) indicate relatively higher transcript levels in variety T compared with varieties L, 11 and 40. Images were generated using MultiExperiment Viewer (TIGR TM4

Microarray Software Suite) (Saeed et al, 2003).

FIG. 11. Complete cDNA and deduced amino acid sequences for opium poppy DIOX1, identified as thebaine 6-0-demethylase (T60DM). The red color indicates the open reading frame sequence common to T60DM, DIOX2 and codeine demethylase (CODM) and used to build pTRV2-based VIGS vector DIOX-a. The blue color indicates the sequence within the 3'-UTR specific to T60DM and used to build the pTRV2 -based VIGS vector DIOX-b. The stop codon is marked with an asterisk. GenBank accession number: GQ500139.

FIG. 12. Complete cDNA and translated amino acid sequences for opium poppy protoberberine 10 0-demethylase (P10ODM; formerly DIOX2). The blue color indicates the sequence within the 3'-UTR and C-terminal ORF specific to DIOX2 used to build the pTRV2 -based VIGS vector DIOX-c. The stop codon is marked with an asterisk. GenBank accession number: GQ500140. FIG. 13. Complete cDNA and translated amino acid sequences for opium poppy DIOX3, identified as codeine 0-demethylase (CODM). The blue color indicates the sequence within the 3'-UTR specific to CODM used to build the pTRV2 -based VIGS vector DIOX-d. The stop codon is marked with an asterisk. GenBank accession number: GQ500141.

FIG. 14. Alignment of the deduced amino acid sequences of opium poppy thebaine 6-0-demethylase (T60DM), DIOX2, and codeine 0-demethylase (CODM) with other plant 2-oxogIutarate (20G)/Fe(II)-dependent dioxygenases. Sequences were aligned using ClustalX (Chenna et al, 2003). Shaded boxes indicate residues that are identical in at least 40% of the alignedproteins. Dots represent introduced gaps into sequences to maximize the alignment. Abbreviations: AtSRGl, Arabidopsis thaliana senescence-related gene 1; CjNCS, Coptis japonica norcoclaurine synthase; HnH6H, Hyoscyam ws ^'gerhyoscyamine όβ-hydroxylase, CrD4H,

CatharanthusroseusdQS&CQtoxyvmdoline 4-hydroxylase.

FIG. 15. SDS-PAGE of recombinant proteins produced by pDIOXl (thebaine 6-

0-demethylase, T60DM), pDIOX2, and pDIOX3 (codeine 0-demethylase, CODM) in Escherichia coli. The left lane contains molecular weight protein markers and corresponding sizes are indicated to the left of the panel. All other lanes feature total (crude) or purified protein from E. coli strain SGI 3009 cells induced with IPTG. Purification of polyhistidine-tagged recombinant proteins was achieved using a cobalt- affinity column. Bacteria harboring the empty pQE30 vector were included as a negative control. Visualization was achieved using Coomassie blue staining.

FIGS. 16A-F. Steady-state enzyme kinetics of purified recombinant thebaine 6-O- demethylase (T60DM, left panels) and codeine 0-demethylase (CODM, right panels) with varying different substrate concentrations. Enzyme assays were based on the decarboxylation of [l-¹⁴C]2-oxoglutarate coupled with the O-demethylation of a benzylisoquinoline alkaloid co-substrate. The incubation time (45 min), protein concentration (10 ng/μΐ) and other assay parameters were optimized prior to enzyme kinetic analyses. Values represent the mean specific activity ± standard deviation monitored as a function of substrate concentration for three independent replicates. Data was subjected to further analysis using FigP v. 2.98 (BioSoft, Cambridge, UK), generating maximum velocity (V_m) and substrate affinity (K_m) constants based on Michaelis-Menten kinetics. Curve-fitting for data shown in (FIG. 9A) and (FIG. 9B) revealed moderate substrate inhibition; thus, optimal velocity ( Popt) and inhibition (K{) constants were also calculated (Table 2). Corresponding r² values are displayed in the right-hand corners of each panel.

FIGS. 17A-B. O-Demethylation is common in benzylisoquinoline alkaloid metabolism. (FIG. 17A). Benzylisoquinoline alkaloid (BIA) biosynthesis begins with (S)- norcoclaurine, which acquires two O-methyl groups en route to the central intermediate

(S)-reticuline. Intramolecular rearrangement of (S)-reticuline yields a variety of skeletal structures including promorphinan {e.g., salutaridine), protoberberine {e.g., (S)- scoulerine), and aprophine {e.g., (S)-corytuberine and (S)-isoboldine). (FIG. 17B) Examples of BIAs exhibiting different O-methylation patterns relative to the established or putative precursors shown in FIG. 17A. Green and blue highlights indicate positions corresponding to the 6-0- and 4' -O-methyl moities of (S)-reticuline. Enzymes indicated in red are norcoclaurine 6-O-methyltransferase (60MT) and 3'-hydroxy-N-methylcoclaurine 4'-0-methyltransferase (4ΌΜΤ).

FIGS. 18A-B. Codeine 0-demethylase (CODM) also catalyzes the 3-0- demethylation of protoberberine alkaloids. (FIG. 18A). Scoulerine to 3-0- demethylscoulerine. (FIG. 18B) Tetrahydrocolumbamine to 3-0- demethyltetrahydrocolumbamine. Enzyme assays were performed using a reaction mixture of 100 mM Tris-HCl (pH 7.4), 10% (v/v) glycerol, 14 mM 2-mercaptoethanol, 1 mM protoberberine alkaloid, 10 mM 2-oxoglutarate, 10 mM sodium ascorbate, 0.5 mM FeS04, and up to 100 μg of purified recombinant CODM. Assays were carried out at

30°C for 1 or 4 hours, stopped by immersing the reaction tube in boiling water for 5 min, and subjected to LC/MS analysis. Reaction products were separated by liquid chromatography and analyzed by tandem mass spectrometry. Product identification was determined using diagnostic MRM transitions.

FIGS. 19A-B. Protoberberine 10-0-demethylase (P10ODM; formerly DIOX2) catalyzes the regiospecific 10-O-demethylation of protoberberine alkaloids. (FIG.. 19A) Tetrahydropalmatine tol O-O-demethyltetrahydropalmatine. (FIG. 19B) Tetrahydrocolumbamine to 10-O-demethyltetrahydrocolumbamine. Enzyme assays were performed using a reaction mixture of 100 mM Tris-HCl (pH 7.4), 10% (v/v) glycerol, 14 mM 2-mercaptoethanol, 1 mM protoberberine alkaloid, 10 mM 2-oxoglutarate, 10 mM sodium ascorbate, 0.5 mM FeS04, and up to 100 μg of purified recombinant CODM. Assays were carried out at 30°C for 1 or 4 hours, stopped by immersing the reaction tube in boiling water for 5 min, and subjected to LC/MS analysis. Reaction products were separated by liquid chromatography and analyzed by tandem mass spectrometry. Product identification was determined using diagnostic MRM transitions.

FIGS. 20A-C. Reaction mechanism of 2-oxogIutarate (20G)/Fe(II)-dependent enzymes involved in benzylisoquinoline alkaloid metabolism. (FIG. 20A) Morphine biosynthesis in opium poppy requires two O-demethylation steps catalyzed by 2- oxoglutarate (20G)/Fe(II)-dependent enzymes thebaine 6-O-demethylase (T60DM) and codeine 0-demethylase (CODM). (FIG. 20B) Formation of the iron-oxo intermediate, resulting in C0₂ and succinate biproducts. (FIG. 20C) Demethylation by 20G/Fe(II)- dependent dioxygenases proceeds through hydroxylation at the O-linked methyl group by an iron-oxo intermediate, followed with the release of formaldehyde.

FIG. 21. Strategy for the reconstitution in yeast of the codeine/morphine biosynthetic pathway from opium poppy.

FIG. 22. T60DM/CODM/COR1.3 assembly. The three genes which allow the conversion of thebaine to morphine, as well as intermediates, were optimized for expression in Saccharomyces cerevisiae and synthesized by DNA 2.0. These genes have been assembled together as three expression casseFes in a low-copy (CEN/ARS origin) plasmid in S. cerevisiae. Each cassette is comprised of a promoter, the open reading frame of the indicated gene, and a terminator. Other promoter and terminator sequences can be used as well as increasing the number of gene cassettes present. Additionally, the coupling of promoter, gene and terminator as well as the number of expression cassettes can be randomized The cassettes can be assembled into a high-copy (2μ origin) plasmid for use in S. cerevisiae or integrated into the genome as single or multiple copies, at either specific or random locations. Alternatively, these genes can be expressed as plasmid- or chromosomal-based constructs in other microorganisms.

FIG. 23. Production of morphine from thebaine using engineered yeast cell-free assay. Engineered yeast strains are grown for 30 hours at 30 °C and 200 r.p.m in 10 ml of YNB with 2% dextrose (w/v). Yeast lysates derived from cells expressing the genes depicted in FIGS. 18A-B are prepared such that enzymatic activity is preserved (i.e., use of protease inhibitors and maintaining samples at 4 °C when possible). The lysate is clarified by centrifuging and used in the assay. Conversion of thebaine to morphine is obtained using the reaction conditions previously described for CODM and T60DM (Nat Chem Biol. 2010. 6:273) and adding the cofactor for COR1.3 (NADPH; Plant J. 1999. 18:465) and the yeast lysate. Detailed reaction conditions: 100 mM Tris-HCl pH 7.4, 10% v/v glycerol, 14 mM 2-mercaptoethanol, 1 mM thebaine, 10 mM 2-oxoglutarate, 10 mM sodium ascorbate, 0.5 mM FeS0₄, 150 μΜ NADPH and up to 25% v/v of yeast lysate. Assay is carried out at 30 °C for 2 hours and stopped by immersing the solution in boiling water for 5 minuts and pelleting denatured proteins by centrifugation. Before LC/MS analysis alkaloids are extracted in MeOH by adding an equal volume of MeOH, dryed by speed vacuum, resuspended in MeOH + 0.2 % formic acid and clarifying the sample by centrifugation. The above diagram illustrates the detection of precursor, thebaine, and final product, morphine, from a cell-free assay identified by LC/MS.

FIG. 24. MS/MS analysis of the morphine produced. The obtained CID mass spectrum of the morphine produced in the assay matches both published and standard spectra.

FIG. 25. Evaluation of T60DM protein expression in Saccharomyces cerevisiae. Western blot of Papaver somniferum cDNA (lane 1) and the synthetic yeast-optimized (DNA 2.0; lane 2) T60DM expressed in CEN.P 113-13D. Both genes were cloned in the expression vector pYES2 (Invitrogen) and HA-tagged at the c-terminus. Protein expression was induced by growing cells in YNB broth supplemented with 2% galactose and 1.92g/L synthetic drop-out medium lacking uracil (Sigma- Aldrich) for 5h. Lanes were loaded with 30 μg of total protein and the blot was obtained using anti-HA DyLight 649 antibodies (Rockland). Detection was performed on a Typhoon TRIO (GE Healthcare). A red arrow indicates the bands of appropriate size. It would appear that the syntheti@c gene is expressed at higher levels and should therefore catalyze more enzymatic conversions.

FIG. 26. Systematic silencing of genes encoding the six secific enzymes in the biosynthetic branch pathway leading to codeine and morphine in opium poppy. Gene silencing was achieved using virus-induced gene silencing (VIGS). Each silencing event results in a unique change in alkaloid phenotype. The empty vector yields the wild-type phenotype. T60DM and CODM produce high-thebaine/low-morphine and high- codeine/low-morphine phenotypes, respectively.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

It is well-established that morphine and codeine are effective analgesics. Currently, organic synthesis is not a practical method for the preparation of these pharmaceuticals because numerous steps are involved and low yields are obtained due to the structural complexity of this family of compounds. For commercial purposes, morphine and codeine can only be obtained from their natural source, the opium poppy. Due to the low concentration of codeine in opium (0.7-2.5%), codeine is often obtained synthetically from natural morphine. Notably, the global medical applications of codeine are more common than those involving any other natural narcotic. Therefore, the ability to grow a high-codeine opium poppy variety, or employ microbes to produce codeine, is attractive. Protocols like these are anticipated to enhance efficiency, and potentially lower expenses, compared to synthetic production of codeine via morphine extracted from its natural source.

Most genes involved in the multi-step pathway from tyrosine to morphine/codeine have been cloned. However, several key components have yet to be identified, including a putative thebaine 6-O-demethylase (T60DM). One of the projected applications of T60DM will involve the reconstitution of the entire biochemical pathway in microorganisms (e.g., yeast, bacteria) and the commercial synthesis of current naturally- and semi-synthetically- produced pharmaceuticals in these organisms. In addition, it seems that blocking of this enzyme would be critical for achieving a high-thebaine, low-morphine/codeine opium poppy phenotype, which provides a commercial route to several high- value pharmaceuticals.

Previously, the inventors reported a similar phenotype for a variety (designated T) possessing the same metabolic block in the morphine pathway (Hagel et al, 2008). Avoiding the assumption that the 0-demethylation of morphinan alkaloids is catalyzed by cytochromes P450 in opium poppy, the inventors used a non-biased, microarray-based screen to identify genes that were differentially expressed in T compared with three independent morphine- producing varieties. Using this approach, they identified a cDNA encoding thebaine 6-0- demethylase (T60DM) that was absent from the stem transcriptome of the T variety. Sequence homology interrogation uncovered a highly-related cDNA encoding codeine O- demethylase (CODM). Phylogenetic analysis showed that T60DM and CODM are members of the 2-oxoglutarate (20D)/Fe(II)-dependent dioxygenase protein family. Characterization of purified recombinant enzymes showed that T60DM and CODM catalyze regiospecific O- demethylation reactions at positions 6 and 3, respectively, of thebaine, oripavine and/or codeine. Virus-induced gene silencing (VIGS) resulted in dramatic changes in the relative abundance of morphinan alkaloids, thus, confirming the biochemical roles for T60DM and CODM in planta. The availability of T60DM and CODM creates unprecedented opportunities for targeted metabolic engineering in plants, and for the potential development of synthetic biosystems for the production of high- value pharmaceuticals in microbes. These and other aspects of the invention are described in detail below. I. Papaver somniferum

Poppies are members of a family of colorful flowers, typically with one per stem. They include a number of attractive wildflower species growing singularly or in large groups; many species are also grown in gardens. Those that are grown in gardens include large plants used in a mixed herbaceous border and small plants that are grown in rock or alpine gardens.

The opium poppy, Papaver somniferum, is grown for opiates, including morphine, thebaine, codeine, papaverine, and noscapine, or poppy seed for use in cooking and baking, for example poppy seed rolls, in addition growing for the decorative flowers. The binomial name means, loosely, the "sleep-bringing poppy," referring to its narcotic properties. The seeds are important food items, and contain healthy oils used worldwide in the culinary arts. The plant itself is valuable for ornamental purposes, and has been known as the "common garden poppy." It is widely grown in ornamental gardens throughout Europe, North America, South America, and Asia.

Papaver somniferum is a species of plant with many sub-groups or varieties. Colors of the flower vary widely, as do other physical characteristics such as number and shape of petals, number of pods, production of morphine, etc. Papaver somniferum Paeoniflorum Group (sometimes called Papaver paeoniflorum) is a sub-type of opium poppy whose flowers are highly double, and are grown in many colors. Papaver somniferum Laciniatum Group (sometimes called Papaver laciniatum) is a sub-type of opium poppy whose flowers are highly double and deeply lobed, to the point of looking like a ruffly pompon.

A few of the varieties, notably the Norman variety, have low morphine content (less than one percent), but have much higher concentrations of other alkaloids. Most varieties, however, including those most popular for ornamental use or seed production, have a higher morphine content, with the average content being 10%.

Natural and induced mutants of opium poppy accumulating thebaine and oripavine rather than morphine and codeine have been reported (Nyman 1978), including the topi variety derived through chemical mutagenesis (Millgate et al. 2004). The development of topi was a major breakthrough for the opium poppy industry in Australia, which is the source of over 40% of the world's licit opiates, by allowing the efficient production of thebaine from morphine-free crops. Although the metabolic block in topi was suggested to result from a defect in the enzyme catalyzing the 6-( -demethylation of thebaine and oripavine, the biochemical basis for the phenotype was not determined. Using a 17,000-element opium poppy microarray, gene expression in topi was compared with its parent cultivar, generating a list of 10 genes underexpressed in the morphine-free mutant. This gene listing included a signal recognition particle mediating protein trafficking, an ATP-dependent transmembrane flippase, and a metalloprotease. However, the list did not include any enzymes theoretically capable of O-demethylation, and the study ultimately failed to explain the biochemical basis for the topi phenotype. Recently, a variety (designated T) was reported to possess the same metabolic block in the morphine pathway (Hagel et al, 2008)

A. T60DM

Fragments, including the N-terminus of the molecule may be generated by genetic engineering of translation stop sites within the coding region (discussed below). Alternatively, treatment of the T60DM molecule with proteolytic enzymes, known as proteases, can produce a variety of N-terminal, C-terminal and internal fragments. Examples of fragments may include contiguous residues of the T60DM sequence given in SEQ ID NO:l of 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 80, 85, 90, 95, 100, 125, 150, or 178 amino acids in length. These fragments may be purified according to known methods, such as precipitation {e.g., ammonium sulfate), HPLC, ion exchange chromatography, affinity chromatography (including immunoaffmity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration).

A phylogenetic tree was constructed to compare T60DM with other plant 20G/Fe(II)- dependent dioxygenases, including two opium poppy enzymes DIOX2 and DIOX3 (FIG. 2). High bootstrap support indicated a monophyletic clade containing T60DM, DIOX2 and DIOX3, with the nearest-neighbor clade containing uncharacterized putative dioxygenases and the translation product of the Arabidopsis thaliana senescence-related gene 1 (AtSRGl) (Callard et al, 1996). Although substantial (-40%) amino acid sequence identity was observed between the opium poppy sequences and a putative norcoclaurine synthase from Coptis japonica (CjNCS) (Minami et al, 2007), monophylogeny with other plant alkaloid biosynthetic enzymes (i.e. desacetoxyvindoline 4-hydroxylase (Vazquez-Flota et al, 1997) and hyoscyamine όβ-hydroxylase (Hashimoto et al, 1991) was not supported. Aligning the deduced amino acid sequences of opium poppy enzymes with those of other plant 20D/Fe(II)-dependent dioxygenases revealed a conserved HXDX_nH motif (beginning with His₂₃g in T60DM) which likely serves to coordinate Fe(II) (Clifton et al, 2006). Additionally, a conserved arginine occurring as an RXS motif (beginning with Arg₃₀₅ in T60DM) represents a candidate binding-site for the 20G side-chain carboxylate.

B. CODM

Fragments, including the N-terminus of the molecule may be generated by genetic engineering of translation stop sites within the coding region (discussed below). Alternatively, treatment of the CODM molecule with proteolytic enzymes, known as proteases, can produce a variety of N-terminal, C-terminal and internal fragments. Examples of fragments may include contiguous residues of the CODM sequence given in SEQ ID NO:3 of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 80, 85, 90, 95, 100, 125, 150, or 178 amino acids in length. These fragments may be purified according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, ion exchange chromatography, affinity chromatography (including immunoaffmity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration).

A phylogenetic tree was constructed to compare CODM with other plant 20G/Fe(II)- dependent dioxygenases, including two opium poppy enzymes DIOXl and DIOX2 (FIG. 2). CODM is 73% identical to DIOXl and 74% identical to DIOX2 at the amino acid level. High bootstrap support indicated a monophyletic clade containing CODM, DIOXl and DIOX2, with the nearest-neighbor clade containing uncharacterized putative dioxygenases and the translation product of the Arabidopsis thaliana senescence-related gene 1 (AtSRGl) (Callard et al, 1996). Although substantial (~40%) amino acid sequence identity was observed between the opium poppy sequences and a putative norcoclaurine synthase from Coptis japonica (CjNCS) (Minami et al., 2007), monophylogeny with other plant alkaloid biosynthetic enzymes {i.e. desacetoxyvindoline 4-hydroxylase (Vazquez-Flota et al, 1997) and hyoscyamine 6 -hydroxylase (Hashimoto et al, 1991)) was not supported. Aligning the deduced amino acid sequences of opium poppy enzymes with those of other plant 20D/Fe(II)-dependent dioxygenases revealed a conserved HXDX_nH motif (beginning with His₂₃₈ in T60DM) which likely serves to coordinate Fe(II) (Clifton et al, 2006). Additionally, a conserved arginine occurring as an RXS motif (beginning with Arg₃o₅ in T60DM) represents a candidate binding-site for the 20G side-chain carboxylate.

C. PIODM

Protoberberine 10 D. Variants of T60DM and CODM

Amino acid sequence variants of the polypeptide can be substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein which are not essential for function or immunogenic activity, and are exemplified by the variants lacking a transmembrane sequence described above. Another common type of deletion variant is one lacking secretory signal sequences or signal sequences directing a protein to bind to a particular part of a cell. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide. This may include the insertion of an immunoreactive epitope or simply a single residue. Terminal additions, called fusion proteins, are discussed below.

Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties. Substitutions of this kind preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.

The following is a discussion based upon changing of the amino acids of a protein to create an equivalent or improved molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below. Table 1 shows the codons that encode particular amino acids. TABLE 1

Amino Acids Codons

Alanine Ala A GCA GCC GCG GCU

Cysteine Cys C UGC UGU

Aspartic acid Asp D GAC GAU

Glutamic acid Glu E GAA GAG

Phenylalanine Phe F UUC uuu

Glycine Gly G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine He I AUA AUC AUU

Lysine Lys K AAA AAG

Leucine Leu L UUA UUG CUA CUC CUG CUU

Methionine Met M AUG

Asparagine Asn N AAC AAU

Proline Pro P CCA CCC CCG CCU

Glutamine Gin Q CAA CAG

Arginine Arg R AGA AGG CGA CGC CGG CGU

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Valine Val V GUA GUC GUG GUU

Tryptophan Trp w UGG

Tyrosine Tyr Y UAC UAU In making substitutional variants, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte & Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics (Kyte & Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (- 0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (- 0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take various foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

Another embodiment for the preparation of polypeptides according to the invention is the use of peptide mimetics. Mimetics are peptide-containing molecules that mimic elements of protein secondary structure. See, for example, Johnson et al. (1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen. A peptide mimetic is expected to permit molecular interactions similar to the natural molecule. These principles may be used, in conjunction with the principles outline above, to engineer second generation molecules having many of the natural properties of T60DM, but with altered and even improved characteristics. E. Domain Switching

Domain switching involves the generation of chimeric molecules using different but, in this case, related polypeptides. By comparing the T60DM or CODM sequence with other enzymes having similar function, one can make predictions as to the functionally significant regions of these molecules. It is possible, then, to switch related domains of these molecules in an effort to determine the criticality of these regions to T60DM or CODM function, as well as possibly to alter substrate specificity or even activity. These molecules may have additional value in that these "chimeras" can be distinguished from natural molecules, while possibly providing the same function. F. Fusion Proteins

A specialized kind of insertional variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide. For example, fusions typically employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host. Another useful fusion includes the addition of an immunologically active domain, such as an antibody epitope, to facilitate purification of the fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification.

F. Purification of Proteins

It will be desirable to purify T60DM, CODM or variants thereof. Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. A particularly efficient method of purifying peptides is fast protein liquid chromatography or even HPLC.

Certain aspects of the present invention concern the purification of, and in particular embodiments, the substantial purification of an encoded protein or peptide. The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.

Generally, "purified" will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition.

Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.

Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulphate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite and affinity chromatography; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

There is no general requirement that the protein or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified products will have utility in certain embodiments. Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater "- fold" purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al, 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.

High Performance Liquid Chromatography (HPLC) is characterized by a very rapid separation with extraordinary resolution of peaks. This is achieved by the use of very fine particles and high pressure to maintain an adequate flow rate. Separation can be accomplished in a matter of minutes, or at most an hour. Moreover, only a very small volume of the sample is needed because the particles are so small and close-packed that the void volume is a very small fraction of the bed volume. Also, the concentration of the sample need not be very great because the bands are so narrow that there is very little dilution of the sample.

Gel chromatography, or molecular sieve chromatography, is a special type of partition chromatography that is based on molecular size. The theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance that contain small pores, separates larger molecules from smaller molecules as they pass through or around the pores, depending on their size. As long as the material of which the particles are made does not adsorb the molecules, the sole factor determining rate of flow is the size. Hence, molecules are eluted from the column in decreasing size, so long as the shape is relatively constant. Gel chromatography is unsurpassed for separating molecules of different size because separation is independent of all other factors such as H, ionic strength, temperature, etc. There also is virtually no adsorption, less zone spreading and the elution volume is related in a simple matter to molecular weight.

Affinity Chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule that it can specifically bind to. This is a receptor-ligand type interaction. The column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (alter pH, ionic strength, temperature, etc.).

A particular type of affinity chromatography useful in the purification of carbohydrate containing compounds is lectin affinity chromatography. Lectins are a class of substances that bind to a variety of polysaccharides and glycoproteins. Lectins are usually coupled to agarose by cyanogen bromide. Conconavalin A coupled to Sepharose was the first material of this sort to be used and has been widely used in the isolation of polysaccharides and glycoproteins, other lectins that have been include lentil lectin, wheat germ agglutinin which has been useful in the purification of N-acetyl glucosaminyl residues and Helix pomatia lectin. Lectins themselves are purified using affinity chromatography with carbohydrate ligands. Lactose has been used to purify lectins from castor bean and peanuts; maltose has been useful in extracting lectins from lentils and jack bean; N-acetyl-D galactosamine is used for purifying lectins from soybean; N-acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been used in obtaining lectins from clams and L-fuctose will bind to lectins from lotus.

The matrix should be a substance that itself does not adsorb molecules to any significant extent and that has a broad range of chemical, physical and thermal stability. The ligand should be coupled in such a way as to not affect its binding properties. The ligand should also provide relatively tight binding. And it should be possible to elute the substance without destroying the sample or the ligand. One of the most common forms of affinity chromatography is immunoaffmity chromatography. The generation of antibodies that would be suitable for use in accord with the present invention is discussed below.

G. Synthetic Peptides

The present invention also describes T60DM- or CODM-related peptides for use in various embodiments of the present invention. Because of their relatively small size, the peptides of the invention, can also be synthesized in solution or on a solid support in accordance with conventional techniques. Various automatic synthesizers are commercially available and can be used in accordance with known protocols. See, for example, Stewart and Young (1984); Tam et al. (1983); Merrifield (1986); and Barany and Merrifield (1979), each incorporated herein by reference. Short peptide sequences, or libraries of overlapping peptides, usually from about 6 up to about 35 to 50 amino acids, which correspond to the selected regions described herein, can be readily synthesized and then screened in screening assays designed to identify reactive peptides. Alternatively, recombinant DNA technology may be employed wherein a nucleotide sequence which encodes a peptide of the invention is inserted into an expression vector, transformed or transfected into an appropriate host cell and cultivated under conditions suitable for expression. II. Nucleic Acids

The present invention also provides, in another embodiment, genes encoding T60DM or CODM. The native gene for the T60DM enzyme has been provided as SEQ ID NO:2, and the native gene for the CODM enzyme has been provided as SEQ ID NO:4. The present invention is not limited in scope to this gene, however, as one of ordinary skill in the could readily identify related homologs in various other species (e.g., Papaver bracteatum, Argemone Mexicana, Corydalis glauca, berberis Canadensis, Mahonia nervosa).

In addition, it should be clear that the present invention is not limited to the specific nucleic acids disclosed herein. As discussed below, a "T60DM gene" or a "CODM gene" may contain a variety of different bases and yet still produce a corresponding polypeptide that is functionally indistinguishable from, and in some cases structurally identical to, the human gene disclosed herein.

Similarly, any reference to a nucleic acid should be read as encompassing a host cell containing that nucleic acid and, in some cases, capable of expressing the product of that nucleic acid. In addition to therapeutic considerations, cells expressing nucleic acids of the present invention may prove useful in the context of screening for agents that induce, repress, inhibit, augment, interfere with, block, abrogate, stimulate or enhance the function of T60DM or CODM.

A. Nucleic Acids Encoding T60DM or CODM

Nucleic acids according to the present invention may encode an entire T60DM or

CODM gene, a domain of T60DM of CODM that expresses enzyme activity, or any other fragment of the T60DM or CODM sequences set forth herein. The nucleic acid may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In preferred embodiments, however, the nucleic acid would comprise complementary DNA (cDNA). The term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy. It also is contemplated that a given T60DM or CODM from a given poppy species may be represented by natural variants that have slightly different nucleic acid sequences but, nonetheless, encode the same protein (see Table 1 , above).

As used in this application, the term "a nucleic acid encoding a T60DM" or "a nucleic acid encoding a CODM" refers to a nucleic acid molecule that has been isolated free of total cellular nucleic acid. In certain embodiments, the invention concerns a nucleic acid sequence essentially as set forth in SEQ ID NO:2 or SEQ ID NO:4. The term "as set forth in SEQ ID NO:2" or "a set forth in SEQ ID NO:4" means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO:2 or SEQ ID NO:4. The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids, as discussed in the following pages.

Allowing for the degeneracy of the genetic code, sequences that have at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about, 91%), at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of nucleotides that are identical to the nucleotides of SEQ ID NO:2 or SEQ ID NO:4. Sequences that are essentially the same as those set forth in SEQ ID NO:2 or SEQ ID NO:4 also may be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:2 or SEQ ID NO:4 under standard conditions.

The DNA segments of the present invention include those encoding biologically functional equivalent T60DM or CODM proteins and peptides, as described above. Such sequences may arise as a consequence of codon redundancy and amino acid functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site- directed mutagenesis techniques or may be introduced randomly and screened later for the desired function, as described below. B. Oligonucleotide Probes and Primers

Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO:2 or SEQ ID NO:4. Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementary rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:2 or SEQ ID NO:4 under relatively stringent conditions such as those described herein. Such sequences may encode the entire T60DM or CODM protein or functional or non- functional fragments thereof.

Alternatively, the hybridizing segments may be shorter oligonucleotides. Sequences of 17 bases long should occur only once in the human genome and, therefore, suffice to specify a unique target sequence. Although shorter oligomers are easier to make and increase in vivo accessibility, numerous other factors are involved in determining the specificity of hybridization. Both binding affinity and sequence specificity of an oligonucleotide to its complementary target increases with increasing length. It is contemplated that exemplary oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more base pairs will be used, although others are contemplated. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or longer are contemplated as well. Such oligonucleotides will find use, for example, as probes in Southern and Northern blots and as primers in amplification reactions.

Suitable hybridization conditions will be well known to those of skill in the art. In certain applications, for example, substitution of amino acids by site-directed mutagenesis, it is appreciated that lower stringency conditions are required. Under these conditions, hybridization may occur even though the sequences of probe and target strand are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results. High stringency conditions are defined as those permitting nucleic acid hybridization using a long DNA probe (>100 base pairs) and incubation in 2X SSC (17.53g NaCl and 8.82g sodium citrate per litre, pH 7.0) and 0.1% SDS at 65°C. Furthermore, DNA must remain hybridized after washing with the following two solutions at 65°C: a) 2X SSC/0.1% SDS and b) 0.1X SSC/0.1% SDS.

One method of using probes and primers of the present invention is in the search for genes related to T60DM or CODM or, more particularly, homologs of T60DM or CODM from other species. Normally, the target DNA will be a genomic or cDNA library, although screening may involve analysis of RNA molecules. By varying the stringency of hybridization, and the region of the probe, different degrees of homology may be discovered.

Another way of exploiting probes and primers of the present invention is in site- directed, or site-specific mutagenesis. Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site- specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.

The technique typically employs a bacteriophage vector that exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.

In general, site-directed mutagenesis is performed by first obtaining a single-stranded vector, or melting of two strands of a double- stranded vector which includes within its sequence a DNA sequence encoding the desired protein. An oligonucleotide primer bearing the desired mutated sequence is synthetically prepared. This primer is then annealed with the single-stranded DNA preparation, taking into account the degree of mismatch when selecting hybridization conditions, and subjected to DNA polymerizing enzymes such as E. coli polymerase I lenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.

The preparation of sequence variants of the selected gene using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of genes may be obtained. For example, recombinant vectors encoding the desired gene may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.

D. Vectors for Cloning, Gene Transfer and Expression

Within certain embodiments, expression vectors are employed to express the T60DM or CODM polypeptide product, which can then be purified for various uses. In other embodiments, the expression vectors are used in gene therapy. Expression requires that appropriate signals be provided in the vectors, and which include various regulatory elements, such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in host cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.

Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.

The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al. (1989) and Ausubel et al. (1994), both incorporated herein by reference.

The term "expression vector" refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.

Chitty et al. (2007) summarizes salient information regarding opium poppy transformation. Chitty et al. (2003) and Facchini et al. (2008) both report methods for the transformation of opium poppy.

(i) Regulatory Elements

A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. The phrases "operatively positioned," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cz^'s-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

A promoter may be one naturally-associated with a gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally-occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Patent 4,683,202, U.S. Patent 5,928,906, each incorporated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. One example is the native T60DM or CODM promoter. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (1989), incorporated herein by reference. The promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous. Other useful promoters include bacterial promoters, yeast promoters and other plant promoters.

Promoters useful for expressing genes in plants include (i) promoters for constitutive expression, such as the Cauliflower Mosaic Virus (CaMV) 35S promoter and nopaline synthase (nos) promoter (Gruber and Crosby, 1993), (i) Tobacco Mosaic Virus (TMV) and Tobacco Rattle Virus (TRV)-derived promoters (Grill et al, 2002), (iii) Opium poppy tyrosine decarboxylase {tydc) promoters (Facchini et al, 1998), (iv) SalT promoter (Elleuch et al, 2001). Promoters for alkaloid biosynthetic genes, including PrPsBBE, PrPs4'OMT2, PrPs70MT and PrPsSAT (Apuya et al, 2008).

(ii) IRES

In certain embodiments of the invention, the use of internal ribosome entry sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5 '-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patents 5,925,565 and 5,935,819, herein incorporated by reference).

(iii) Multi-Purpose Cloning Sites

Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector. See Carbonelli et al. (1999), Levenson et al. (1998), and Cocea (1997), incorporated herein by reference. "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology. (iv) Splicing Sites

Most transcribed eukaryotic RNA molecules will undergo RNA splicing to remove introns from the primary transcripts. Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see Chandler et al, 1997, herein incorporated by reference.) (v) Termination Signals

The vectors or constructs of the present invention will generally comprise at least one termination signal. A "termination signal" or "terminator" is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.

In eukaryotic systems, the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 A residues (polyA) to the 3 ' end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently. Thus, in other embodiments involving eukaryotes, it is preferred that that terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message. The terminator and/or polyadenylation site elements can serve to enhance message levels and/or to minimize read through from the cassette into other sequences.

Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator. In certain embodiments, the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.

(vi) Polyadenylation Signals

In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and/or any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal and/or the bovine growth hormone polyadenylation signal, convenient and/or known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport. (vii) Origins of Replication

In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.

(viii) Selectable and Screenable Markers

In certain embodiments of the invention, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art.

E. Yeast Expression Systems

While efforts are being made to develop new varieties of opium poppy exhibiting commercially desirable alkaloid profiles, lack of knowledge regarding the regulation of benzylisoquinoline alkaloid metabolism, compounded with issues such as cellular compartmentalization of biosynthetic processes, limits in planta engineering achievements. A viable alternative to conventional agriculture is the production of valuable bioproducts in microbial systems. The field of synthetic biology holds promise for the assembly of entire pathways in yeast and/or bacteria, using natural or novel enzymes and biosynthetic routes (Martin et al, 2009; Carothers et al, 2009; Picataggio 2009; Keasling 2008). Whereas much work to date has focused on the heterologous expression of "natural" enzymes for the reconstitution of pathways mirroring those "naturally" occurring in plant systems, new synthetic biology approaches have included methodically altered enzymes (Yoshikuni et al, 2008; Runguphan and O'Connor 2009; Dietrich et al, 2009) and synthetic protein scaffolds (Dueber et al, 2009) for enhanced control over product selectivity and metabolic flux, respectively. Furthermore, the use of nonnatural substrates in natural systems (Runguphan et al. 2009) represents yet another tool for the development of improved pharmaceuticals. In benzylisoquinoline alkaloid metabolism, only SalR has been targeted for structural modification (Ziegler et al , 2009) although key branch-point enzymes such as norcoclaurine synthase (NCS) and berberine bridge enzyme (BBE) are likely future targets (Ursera and O'Connor, 2009). Theoretical and experimental strategies aimed at modeling unnatural synthetic routes for bioproduct formation are continually evolving (Martin et al, 2009) marked by the development of standardized promoter libraries, tunable intergenic regions, artificial transcription factors, and so on (Santos and Stephanopoulos, 2008; Leonard et al, 2008). Progress has been made toward the microbial production of valuable isoprenoids such as antimalarial artemisinin (Ro et al, 2006) and anticancer paclita el (Newman et al, 2006; Muntendam et al, 2009). Two recent publications have outlined the manufacture of benzylisoquinoline alkaloids in Saccharomyces cerevisiae and Escherichia coli (Minami et al, 2008; Hawkins and Smolke, 2008). Using a combination of animal- and plant-sourced recombinant enzymes, minor amounts of the promorphinan salutaridine were achieved in yeast (Hawkins and Smolke, 2008) providing a basis for the production of codeine and morphine in alternative biological systems.

Engineering morphinan alkaloid biosynthesis through protein expression has thus far relied primarily upon whole-plant and yeast systems. Protein expression is also achieved using bacteria. For example, T60DM and CODM proteins were generated in Escherichia coli for the purpose of enzyme characterization (FIGS. 3-5). For this purpose, the E. coli strain SGI 3009 was transformed using the vector pQE30 (Qiagen) containing the T60DM or CODM cDNA sequence. Using the whole opium poppy plant as an expression system has permitted the study of morphinan alkaloid biosynthesis. For example, transformation of opium poppy with a DNA construct encoding codeinone reductase (COR) designed to increase expression of COR (Larkin et al, 2007) lead to increased morphinan alkaloid levels. In another study, the overexpression of the enzyme CYP80B3 in opium poppy lead to a 450% increase in total alkaloid levels (Frick et al, 2007). The production of proteins in undifferentiated opium poppy cell cultures is not generally applied for the study of morphinan alkaloid biosynthesis, since opium poppy cell cultures do not make these products (Zulak et al, 2007). For the purpose of building de novo routes for morphinan alkaloid biosynthesis, yeast expression systems have been used (Hawkins and Smolke, 2008; Minami et al, 2008).

F. Host Cells

As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors. A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny.

Host cells may be derived from prokaryotes or eukaryotes, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded nucleic acid sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Bacterial cells used as host cells for vector replication and/or expression include DH5a, JM109, and KC8, as well as a number of commercially available bacterial hosts such as SURE^® Competent Cells and SOLOPACK™ Gold Cells (STRATAGENE^®, La Jolla). Alternatively, bacterial cells such as E. coli LE392 could be used as host cells for phage viruses.

Yeast strains used for the production of alkaloid biosynthetic enzymes have included those based on the haploid yeast strain W303a (MATa his3-l l,15 trpl-1 leu2-3 ura3-l ade2- 1)41 (Hawkins and Smolke, 2008). Chromosomal integration of DNA fragments through homologous recombination using a standard lithium acetate transformation protocol is then used to construct novel strains stably expressing combinations of biosynthetic enzymes. Gene insertion cassettes can be build that harbor the appropriate enzyme expression construct and associated selection marker flanked by loxP sites to allow removal of the selection marker following integration with a Cre-loxP system (Hawkins and Smolke, 2008). Important platform strains for the production of morphinan alkaloids in S. cerevisiae include L-tyrosine over-producers, and dopamine and 4-hydroxyphenylacetaldehyde (4-HPA) overproduces. The genetic modifications for downstream pathway optimization may be integrated in the platform strains.

Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.

III. Papaver somniferum Transformation

In general, Agrobacterium transformation processes are the choice when transforming poppy plants. Agrobacterium tumefaciens is the causal agent of crown gall disease in over 140 species of dicot. It is a rod-shaped, Gram-negative soil bacterium (Smith et al, 1998). Symptoms are caused by the insertion of a small segment of DNA (known as the T-DNA, for 'transfer DNA') into the plant cell, which is incorporated at a semi-random location into the plant genome.

Agrobacterium tumefaciens (or A. tumefaciens) is an alphaproteobacterium of the family Rhizobiaceae, which includes the nitrogen fixing legume symbionts. Unlike the nitrogen fixing symbionts, tumor producing Agrobacterium are pathogenic and do not benefit the plant. The wide variety of plants affected by Agrobacterium makes it of great concern to the agriculture industry. Economically, A. tumefaciens is a serious pathogen of walnuts, grape vines, stone fruits, nut trees, sugar beets, horse radish and rhubarb.

In order to transfer the T-DNA into the plant cell A. tumefaciens uses a Type IV secretion mechanism, involving the production of a T-pilus. The VirA/VirG two component sensor system is able to detect phenolic signals released by wounded plant cells, in particular acetosyringone. This leads to a signal transduction event activating the expression of 11 genes within the VirB operon which are responsible for the formation of the T-pilus. First, the VirB pro-pilin is formed. This is a polypeptide of 121 amino acids which requires processing by the removal of 47 residues to form a T-pilus subunit. The subunit is circularized by the formation of a peptide bond between the two ends of the polypeptide.

Products of the other VirB genes are used to transfer the subunits across the plasma membrane. Yeast two-hybrid studies provide evidence that VirB6, VirB7, VirB8, VirB9 and VirBlO may all encode components of the transporter. An ATPase for the active transport of the subunits would also be required. The T-DNA must be cut out of the circular plasmid. A VirDl/D2 complex nicks the DNA at the left and right border sequences. The VirD2 protein is covalently attached to the 5' end. VirD2 contains a motif that leads to the nucleoprotein complex being targeted to the type IV secretion system (T4SS).

In the cytoplasm of the recipient cell, the T-DNA complex becomes coated with VirE2 proteins, which are exported through the T4SS independently from the T-DNA complex. Nuclear localization signals, or NLS, located on the VirE2 and VirD2 are recognised by the importin alpha protein, which then associates with importin beta and the nuclear pore complex to transfer the T-DNA into the nucleus. VIP1 also appears to be an important protein in the process, possibly acting as an adapter to bring the VirE2 to the importin. Once inside the nucleus, VIP2 may target the T-DNA to areas of chromatin that are being actively transcribed, so that the T-DNA can integrate into the host genome.

The DNA transmission capabilities of Agrobacterium have been extensively exploited in biotechnology as a means of inserting foreign genes into plants. Van Montagu and Schell, (University of Ghent and Plant Genetic Systems, Belgium) discovered the gene transfer mechanism between Agrobacterium and plants, which resulted in the development of methods to alter Agrobacterium into an efficient delivery system for genetic engineering in plants. The plasmid T-DNA that is transferred to the plant is an ideal vehicle for genetic engineering. This is done by cloning a desired gene sequence into the T-DNA that will be inserted into the host DNA. This process has been performed using firefly luciferase gene to produce glowing plants. This luminescence has been a useful device in the study of plant chloroplast function and as a reporter gene. It is also possible to transform Arabidopsis by dipping their flowers into a broth of Agrobacterium, the seed produced will be transgenic. Under laboratory conditions the T-DNA has also been transferred to human cells, demonstrating the diversity of insertion application.

General methods for Agrobacterium transformation are provided in U.S. Patents 6,051 ,757, 4,693,976, 4,940,838, 5,464,763, and 5,129,645. Modified co-integration vector technologies are described in U.S. Patents 4,693,976, 5,635,381, and 5,731 ,179, while U.S. Patent 6,165,780, describes modified binary vector technologies. Other Agrobacterium transformation technologies are described in U.S. Patent 7,598,430, 7,569,746, 7,285,705, 7,279,336, 7,276,374, 7,179,599, 7,126,041, 7,122,716, 7,029,908, 6,822,144, 6,759,573, 6,696,622, 6,664,108, 6,603,061 , 6,455,761, 6,323,396, 6,300,545, 6,265,638, 6,255,559, 6,162,965, 5,981,840, 5,922,928, and 5,565,347. All of the preceding are incorporated herein by reference.

IV. Gene Silencing in Papaver somniferum

A. Antisense

Antisense technology may be used to "knock-out" function of T60DM or CODM.

Antisense methodology takes advantage of the fact that nucleic acids tend to pair with "complementary" sequences. By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.

Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense polynucleotides, when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and/or stability. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.

Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemplated that the most effective antisense constructs will include regions complementary to intron/exon splice junctions. Thus, it is proposed that a preferred embodiment includes an antisense construct with complementarity to regions within 50-200 bases of an intron-exon splice junction. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.

As stated above, "complementary" or "antisense" means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region {e.g., ribozyme; see below) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions. B. RNAi

The present invention contemplates the use of RNA interference (RNAi) to reduce expression of T60DM and/or CODM. Two types of small interfering RNA molecules - microRNA (miRNA) and small interfering RNA (siRNA) - are central to RNA interference. RNAs are the direct products of genes, and these small RNAs can bind to specific other RNAs and either increase or decrease their activity, for example by preventing a messenger RNA from producing a protein. RNA interference has an important role in defending cells against parasitic genes - viruses and transposons - but also in directing development as well as gene expression in general.

The RNAi pathway is found in many eukaryotes including plants and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short fragments of -20 nucleotides. One of the two strands of each fragment, known as the guide strand, is then incorporated into the RNA-induced silencing complex (RISC). The most well- studied outcome is post-transcriptional gene silencing, which occurs when the guide strand base pairs with a complementary sequence of a messenger RNA molecule and induces cleavage by Argonaute, the catalytic component of the RISC complex. This process is known to spread systemically throughout the organism despite initially limited molar concentrations of siRNA.

The selective and robust effect of RNAi on gene expression makes it a valuable research tool, both in cell culture and in living organisms because synthetic dsRNA introduced into cells can induce suppression of specific genes of interest. RNAi may also be used for large-scale screens that systematically shut down each gene in the cell, which can help identify the components necessary for a particular cellular process or an event such as cell division. Exploitation of the pathway is also a promising tool in biotechnology and medicine.

Historically, RNA interference was known by other names, including post transcriptional gene silencing, and quelling. Only after these apparently unrelated processes were fully understood did it become clear that they all described the RNAi phenomenon. In 2006, Fire and Mello shared the Nobel Prize in Physiology or Medicine for their work on RNA interference in the nematode worm C. elegans, which they published in 1998.

RNAi is an RNA-dependent gene silencing process that is controlled by the RNA- induced silencing complex (RISC) and is initiated by short double-stranded RNA molecules in a cell's cytoplasm, where they interact with the catalytic RISC component argonaute. When the dsRNA is exogenous (coming from infection by a virus with an RNA genome or laboratory manipulations), the RNA is imported directly into the cytoplasm and cleaved to short fragments by the enzyme dicer. The initiating dsRNA can also be endogenous (originating in the cell), as in pre-microRNAs expressed from RNA-coding genes in the genome. The primary transcripts from such genes are first processed to form the characteristic stem-loop structure of pre-miRNA in the nucleus, then exported to the cytoplasm to be cleaved by dicer. Thus, the two dsRNA pathways, exogenous and endogenous, converge at the RISC complex.

Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cleaves double-stranded RNAs (dsRNA)s to produce double-stranded fragments of 21-25 base pairs with a few unpaired overhang bases on each end. Bioinformatics studies on the genomes of multiple organisms suggest this length maximizes target-gene specificity and minimizes non-specific effects. These short double-stranded fragments are called small interfering RNAs (siRNAs). These siRNAs are then separated into single strands and integrated into an active RISC complex. After integration into the RISC, siRNAs base-pair to their target mRNA and induce cleavage of the mRNA, thereby preventing it from being used as a translation template.

Exogenous dsRNA is detected and bound by an effector protein, known as RDE-4 in C. elegans and R2D2 in Drosophila, that stimulates dicer activity. This protein only binds long dsRNAs, but the mechanism producing this length specificity is unknown. These RNA- binding proteins then facilitate transfer of cleaved siRNAs to the RISC complex. This initiation pathway may be amplified by the cell through the synthesis of a population of 'secondary' siRNAs using the dicer-produced initiating or 'primary' siRNAs as templates. These siRNAs are structurally distinct from dicer-produced siRNAs and appear to be produced by an RNA-dependent RNA polymerase (RdRP).

icroRNAs (miRNAs) are genomically encoded non-coding RNAs that help regulate gene expression, particularly during development. The phenomenon of RNA interference, broadly defined, includes the endogenously induced gene silencing effects of miRNAs as well as silencing triggered by foreign dsRNA. Mature miRNAs are structurally similar to siRNAs produced from exogenous dsRNA, but before reaching maturity, miRNAs must first undergo extensive post-transcriptional modification. An miRNA is expressed from a much longer RNA-coding gene as a primary transcript known as a pri-miRNA which is processed, in the cell nucleus, to a 70-nucleotide stem-loop structure called a pre-miRNA by the microprocessor complex. This complex consists of an RNase III enzyme called Drosha and a dsRNA-binding protein Pasha. The dsRNA portion of this pre-miRNA is bound and cleaved by Dicer to produce the mature miRNA molecule that can be integrated into the RISC complex; thus, miRNA and siRNA share the same cellular machinery downstream of their initial processing.

The siRNAs derived from long dsRNA precursors differ from miRNAs in that miRNAs, especially those in animals, typically have incomplete base pairing to a target and inhibit the translation of many different mRNAs with similar sequences. In contrast, siRNAs typically base-pair perfectly and induce mRNA cleavage only in a single, specific target. In Drosophila and C. elegans, miRNA and siRNA are processed by distinct argonaute proteins and dicer enzymes.

The active components of an RNA-induced silencing complex (RISC) are endonucleases called argonaute proteins, which cleave the target mRNA strand complementary to their bound siRNA. As the fragments produced by dicer are double- stranded, they could each in theory produce a functional siRNA. However, Only one of the two strands, which is known as the guide strand, binds the argonaute protein and directs gene silencing. The other anti-guide strand or passenger strand is degraded during RISC activation. Although it was first believed that an ATP-dependent helicase separated these two strands, the process is actually ATP-independent and performed directly by the protein components of RISC. The strand selected as the guide tends to be the one whose 5' end is least paired to its complement, but strand selection is unaffected by the direction in which dicer cleaves the dsRNA before RISC incorporation. Instead, the R2D2 protein may serve as the differentiating factor by binding the more-stable 5' end of the passenger strand. The structural basis for binding of RNA to the argonaute protein was examined by X- ray crystallography of the binding domain of an RNA-bound argonaute protein. Here, the phosphorylated 5' end of the RNA strand enters a conserved basic surface pocket and makes contacts through a divalent cation (an atom with two positive charges) such as magnesium and by aromatic stacking (a process that allows more than one atom to share an electron by passing it back and forth) between the 5' nucleotide in the siRNA and a conserved tyrosine residue. This site is thought to form a nucleation site for the binding of the siRNA to its mRNA target.

It is not understood how the activated RISC complex locates complementary mRNAs within the cell. Although the cleavage process has been proposed to be linked to translation, translation of the mRNA target is not essential for RNAi-mediated degradation. Indeed, RNAi may be more effective against mRNA targets that are not translated. Argonaute proteins, the catalytic components of RISC, are localized to specific regions in the cytoplasm called P- bodies (also cytoplasmic bodies or GW bodies), which are regions with high rates of mRNA decay; miRNA activity is also clustered in P-bodies. Disruption of P-bodies decreases the efficiency of RNA interference, suggesting that they are the site of a critical step in the RNAi process.

Components of the RNA interference pathway are also used in many eukaryotes in the maintenance of the organisation and structure of their genomes. Modification of histones and associated induction of heterochromatin formation serves to downregulate genes pre- transcriptionally; this process is referred to as RNA-induced transcriptional silencing (RITS), and is carried out by a complex of proteins called the RITS complex. In fission yeast this complex contains argonaute, a chromodomain protein Chpl, and a protein called Tas3 of unknown function. As a consequence, the induction and spread of heterochromatic regions requires the argonaute and RdRP proteins. Indeed, deletion of these genes in the fission yeast S. pombe disrupts histone methylation and centromere formation, causing slow or stalled anaphase during cell division. In some cases, similar processes associated with histone modification have been observed to transcriptionally upregulate genes.

The mechanism by which the RITS complex induces heterochromatin formation and organization is not well understood, and most studies have focused on the mating-type region in fission yeast, which may not be representative of activities in other genomic regions or organisms. In maintenance of existing heterochromatin regions, RITS forms a complex with siRNAs complementary to the local genes and stably binds local methylated histones, acting co-transcriptionally to degrade any nascent pre-mRNA transcripts that are initiated by RNA polymerase. The formation of such a heterochromatin region, though not its maintenance, is dicer-dependent, presumably because dicer is required to generate the initial complement of siRNAs that target subsequent transcripts. Heterochromatin maintenance has been suggested to function as a self-reinforcing feedback loop, as new siRNAs are formed from the occasional nascent transcripts by RdRP for incorporation into local RITS complexes. The relevance of observations from fission yeast mating-type regions and centromeres to mammals is not clear, as heterochromatin maintenance in mammalian cells may be independent of the components of the RNAi pathway.

Specific examples of gene silencing in poppy have been reported using RNAi approaches. For example, Facchini et al. (2008) reported on a reliable genetic transformation protocol via somatic embryogenesis for the production of fertile, herbicide-resistant opium poppy plants. Transformation was mediated by A. tumefaciens using the pCAMBIA3301 vector, which harbors the phosphinothricin acetyltransferase (pat) gene driven by a tandem repeat of the cauliflower mosaic virus (CaMV) 35S promoter and the β-glucuronidase (gus) structural gene driven by a single copy of the CaMV 35S promoter between left- and right- border sequences. Co-cultivation of explants and A. tumefaciens was performed in the presence of 50 1M ATP and 50 1M MgCl₂. Root explants pre-cultured on callus induction medium were used for transformation. Herbicide-resistant, proliferating callus was obtained from explants on a medium containing both 2,4-dichlorophenoxyacetic acid (2,4-D) and 6- benzyladenine (BA). Globular embryo genie callus, induced by removal of the BA from the medium, was placed on a hormone-free medium to form somatic embryos, which were converted to plantlets under specific culture conditions. Plantlets with roots were transferred to soil, allowed to mature and set seed. Both pat and gus gene transcripts, and PAT and GUS enzyme activities were detected in the transgenic lines tested. Histochemical localization of GUS activity in Tl opium poppy plants revealed transgene expression in most tissues of all plant organs. The protocol required 8-12 months to establish transgenic Tl seed stocks and was developed using a commercial opium poppy cultivar that produces high levels of pharmaceutical alkaloids.

In 2008, Allen et al. reported both over-expression and suppression of the gene encoding the morphinan pathway enzyme salutaridinol 7-O-acetyltransferase (SalAT) in opium poppy and the effects thereof on the alkaloid products that accumulate. Overexpression of the gene in most of the transgenic events resulted in an increase in capsule morphine, codeine and thebaine on a dry-weight basis. The transgenic line with the highest alkaloid content had 41%, 37% and 42 % greater total alkaloids than the control in three independent trials over 3 years. DNA-encoded hairpin RNA-mediated suppression of SalAT resulted in the novel accumulation of the alkaloid salutaridine at up to 23% of total alkaloid; this alkaloid is not detectable in the parental genotype. Salutaridine is not the substrate of SalAT but the substrate of the previous enzyme in the pathway, salutaridine reductase. RNA transcript analysis of 16 primary To transformants and their segregating T₍ progeny revealed an average reduction in SalAT transcript to about 12% of the control. Reduction in SalAT transcript was evident in both leaves and latex. Reverse transcriptase PCR and high-performance liquid chromatography analyses confirmed cosegregation of the expressed transgene with the salutaridine accumulating phenotype.

Previously, Allen et al. (2004) reported on the silencing of codeinone reductase (COR) in opium poppy, Papaver somniferum, using a chimeric hairpin RNA construct designed to silence all members of the multigene COR family through RNAi. After gene silencing, the precursor (S)-reticuline - seven enzymatic steps upstream of codeinone - accumulated in transgenic plants at the expense of morphine, codeine, oripavein and thebaine. Methylated derivatives of reticuline also accumulated. Analysis verified loss of Cor gene transcript, appearance of 22-mer degradation products and reduction of enzyme activity. The surprising accumulation of (»S)-reticuline suggests a feedback mechanism preventing intermediates from general benzylisoquinoline synthesis entering the morphine-specific branch. However, transcript levels for seven other enzymes in the pathway, bothe before and after (5)-reticuline, were unaffected.

V. Papaver somniferum Cultivation, Breeding and Processing

The following information is reviewed by Hagel et al. (2007). Traditionally, opium poppy cultivation and opium harvesting have involved the laborious processes of manually lancing the unripe seed capsule and collecting the latex. In 1928, the Hungarian pharmacist Janos Kabay developed a method to extract morphine and related compounds from opium poppy straw, which previously was separated as waste from the seeds in the final step of commercial poppy cultivation. This approach circumvented the arduous techniques associated with the harvesting of opium and made it possible to obtain high quality seeds and pharmaceutically valuable raw materials simultaneously. The harvesting of straw has several other advantages over the traditional method of collecting opium. The harvesting and processing of straw can be highly mechanized, thus, reducing labor costs. Licit production of opiate raw materials, both latex-derived and poppy derived, is restricted to assigned countries under the Single Convention on Narcotic Drugs 1961 and relevant resolutions of the United Nations Economic and Social Council. In compliance with these resolutions, the International Narcotics Control Board (INCB) is responsible for monitoring the licit supply of, and demand for, opiates in addition to maintaining an acceptable global "balance."

European countries such as the Netherlands, Germany, Austria and Poland cultivate opium poppy primarily for seed production, whereas Spain, France and Turkey produce poppy straw for the extraction of alkaloids. Seeds are valued directly as food and for their oil, which has both alimentary and industrial applications. Currently, only India exports raw opium, although other Asian countries are entitled to its production. Australia, specifically the island of Tasmania, supplies a large proportion of the world's opiate material, particularly for the extraction of thebaine. Although not used for medicinal purposes, the morphinan alkaloid thebaine is a starting material in the manufacture of several semi-synthetic opiates, including oxycodone, oxymorphone, etorphine and buprenorphine. Additionally, thebaine is the starting material for the synthesis of naloxone, naltrexone, nalorphine and nalbuphine, some of which are used to treat opiate poisoning and opium addiction. Until 1998, thebaine was mainly obtained as a byproduct from opium, but since the development of high-thebaine, low- morphine varieties, the alkaloid is now recovered from opium poppy straw.

Thebaine-accumulating opium poppy has been cultivated in Australia since 1998 and in France since 1999. In 2002, the cultivation of thebaine-rich opium poppy varieties surpassed that of morphine-rich varieties in Australia. Global production of thebaine has increased sharply since 1998. The United States, a major manufacturer has increased thebaine production from 4.6 tons in 1996 to 40.3 tons in 2000. The increased manufacture of thebaine reflects a rising demand for oxycodone, which is used to treat moderate to severe pain. Oxycodone is marketed as Oxycontin™ or Percocet™ (acetaminophen with oxycodone). Abuse of Oxycontin™, which produces euphoric "highs" similar to those induced by morphine, has prompted the United States Drug Enforcement Administration (DEA) to list this pharmaceutical as a Schedule II drug.

Prior to 1977, opium, the oxidized, resinous latex obtained by lancing the unripe seed capsules, was the main source for the extraction of morphine. In traditional, morphine-rich opium poppy varieties, raw opium contains 4-21% morphine, depending on moisture level and quality. Codeine is usually present at 0.7-2.5% and thebaine is generally present at even lower levels. Most licit opium is used for the extraction of alkaloids, whereas about 5% is processed directly into medicinal preparations in some countries. China, North Korea, India, and Japan are the only countries permitted by international law to cultivate opium poppy for the production of raw opium. However, only India produces substantial quantities of the product

Opium poppy is a herbaceous annual with a distinctive vegetative phase characterized by several, horizontally-spread large pinnatisect leaves, and a reproductive stage during which flowering stems and drooping buds are formed. Maturation of the capsule occurs about 110- 150 days after sowing. The long history of domestication and breeding has lead to the development of many different opium poppy land races, which are chemotype varieties and cultivars adapted to particular uses and climatic conditions. As a result, cultivation of the plant extends over a wide area, from Mexico to Russia to Tasmania. P. somniferum (2n = 22) is considered as a predominantly self-pollinating species, although out-crossing occurs at various rates depending on variety and environmental factors. Large, often colorful flowers with numerous stamens and large quantities of pollen attract insects, especially bees. However, pollination also occurs by wind.

The success of any breeding program necessitates the availability of a highly varied gene pool. Evaluations of the genetic variation in cultivated germplasms of P. somniferum have shown that only limited variation occurs in Indian and European genetic stocks for most agronomic and chemical traits, a feature related to the narrow genetic base of genotypes with common ancestry. In Europe during the early 1960s, the genetic and breeding aspects of opium poppy were investigated with the aim of increasing yields for straw, seeds, and seed oil. India, on the other hand, has historically aimed at increasing latex yield and morphine content. Also, the different climates of Europe and India have directed the breeding of diverse cultivars with variations in height, susceptibility to lodging, disease resistance, photoperiod requirements, latex yield, and morphine content.

Opium poppy breeders have used a variety of selection techniques in the development of improved cultivars. However, the most successful breeding method, which has generated several commercial cultivars, is the pedigree selection process whereby desired traits are combined through the hybridization of parents with a variety of different characteristics. The pedigree selection approach has been used successfully to increase capsule numbers, seed and opium yield, morphine content, and lodging resistance. A disadvantage of this approach is that it markedly reduces genetic variability and contributes to the genetic narrowing of the cultivated germplasm. Nonetheless, through the use of genetic, and to a smaller extent agro- technological improvements, France has increased its morphine yield from 4.5 kg per hectare in 1961 to 10.5 kg per hectare in 1991 without significantly altering the yield of dry matter. However, the continued selection of new opium poppy lines is an essential and ongoing part of successful breeding programs to ensure the renewal of a large base of genetic variation.

Although male sterility, either genie or genic-cytoplasmic, is widely employed in the commercial production of hybrid lines for most crops, the natural occurrence of male sterility have not been reported for opium poppy. However, irradiation of opium poppy seeds with gamma rays has allowed isolation of male-sterile plants in the Mi generation. Male- sterile plants have also been observed in the F₂ generation of an inter-specific hybrid between P. somniferum and P. setigerum. In many crop species, difficulties in promoting cross- pollination are circumvented by the use of male-sterile varieties. The development of male- sterile lines of opium poppy could increase hybrid vigor and heterosis in terms of morphine yield and/or seed content. Self-incompatibility might also facilitate the production of hybrid seeds, although little work has been done in this area.

Most breeding programs use a selection index to maximize the inheritance of desirable traits. A multi-character index would involve criteria such as days to flowering, plant height, capsule and leaf number, and capsule husk weight. Positive correlations have been drawn between capsule size and opium yield, although no relationship have been found between the agro-morphological characteristics and the content of morphinan alkaloids of poppy capsules. In a direct approach, an index based on a single criterion - opium yield - was used for selection purposes. A selection index has been described based on a study of twenty-four European opium poppy varieties and their hybrids, which took into account the heritability and correlation coefficients of different components governing morphine yield. The total yield of morphine equivalents, defined as 100% of the morphine content, 96.9% of the codeine content, plus 91.6% of the thebaine content, was considered the most important criterion.

VI. Large Scale Production in Yeast

There are several advantages of using yeast platform strains in a large-scale genomics project. Foremost, these strains allow for simple high-throughput screening of enzyme activities as opposed to relying on time consuming and costly enzyme assays. Simple inexpensive sugars can be used to generate, endogenously, expensive substrates or intermediates that are not commercially available. Furthermore, inherently unstable membrane enzymes such as P450s can be reliably tested in vivo; microsome preparation required for in vitro P450 assays are not necessary. Finally, these strains often yield sufficient amount of the desired natural products (mg level) that can be easily identified by standard analytical techniques such as LC-MS, GC-MS or NMR. It has been demonstrated that S. cerevisiae has efficient non-specific efflux pumps (PDR5, SNQ2 and other related ABC transporters), which can facilitate secretion of some terpenoids and potentially other phytochemicals.

S. cerevisiae is amenable to the expression of some of the plant genes such as the P450s and polyketide prenyltransferase enzymes. As mentioned above, platform strains could include L-tyrosine over-producers for BIA and polyketide platform strains; dopamine and 4- hydroxyphenylacetaldehyde (4-HPA) for the BIA platform strains, L-tryptophan and geraniol over-producers for the MIA platform strains; and /?-coumaroylCoA, malonylCoA, DMADP over-producers for the polyketide platform strains.

Generally characterized by the presence of a nitrogen atom within a heterocyclic ring, alkaloids draw on the products of primary metabolism for their biosynthesis, with amino acids serving as the main precursors. The biosynthesis of all BIAs begins with the condensation of dopamine and 4-hydroxyphenylacetaldehyde (4-HPAA) by norcoclaurine synthase (NCS) to yield (5)-norcoclaurine. Both dopamine and 4-HPAA are derived from L-tyrosine. Dopamine could be produced by the consecutive decarboxylation and hydroxylation of L-tyrosine by L- tyrosine/dopa decarboxylase (TYDC) and an as yet unidentified hydrolase. However, in opium poppy, 4-HPAA appears to be derived via the decarboxylation of 4- hydroxyphenylpyravate (Schmidt et al, 2007), which could result from the transamination of L-tyrosine. Alternatively 4-HPAA might be the direct product of a bi-functional L-tyrosine decarboxylase/oxidase (Kaminaga et al , 2006). In light of what is known of the precursors required for BIA biosynthesis in plants, we propose to build a platform strain that will overproduce L-tyrosine and convert it to both dopamine and 4-HPAA or 3,4- dihydroxyphenylacetaldehyde (3,4-DiHPAA). Targeting production of the latter compound has the advantage of precluding the requirement for CYP80B3, a P450 responsible for the 3'- hydroxylation of N-methylcoclaurine to yield the basic benzylisoquinoline structure.

Due to the considerable commercial value of aromatic amino acids as food and feed additives, the metabolic engineering of microbes such as E. coli for the production of L- phenylalanine, L-tryptophan and L-tyrosine has matured to the point that strains are now available that can generate in excess of 10 g/L in simple shake flask cultures. These strains rely on the deregulation of the aromatic amino acid biosynthetic pathway, the reduction of byproduct formation, and the increase in the activity of rate limiting enzymes (Chavez-Bejar et al, 2008; Ikeda, 2006; Lutke-Eversloh and Stephanopoulos, 2007; Sprenger, 2007). Two L- tyrosine over-producing E. coli strains have been described that can produce 9.7 g/L in shake flask (Lutke-Eversloh and Stephanopoulos, 2007) and 55g/L in 200 L batch fermentation (Olson et al., 2007; Patnaik et al., 2008). Much like E.coli, the biosynthesis of aromatic amino acids in yeasts proceeds via a common pathway to chorismate, at which point the pathway branches in two directions, one for L-tryptophan and the other for L-phenylalanine/L-tyrosine synthesis. Moreover, flux of aromatic amino acid biosynthesis in E. coli and S. cerevisiae is controlled, in part, through feedback inhibition by pathway end products at 3-deoxy-D- arabino-heptulosonate-7-phosphate synthase (Aro3 and Aro4) and chorismate mutase (Aro7) (Braus, 1991). To date, only one report provides a glimpse into the possibility of developing S. cerevisiae into a L-tyrosine over-producer using L-tyrosine feedback resistant versions of both Aro3 and Aro7 (Luttik et al, 2008). In this strain, production of aromatic compounds increased over 200-fold.

Biochemical steps necessary to form dopamine and 4-HPAA from L-tyrosine in plants have not yet been identified. To fill these gaps in the early steps of the BIA pathway we will deploy a combination of recombinant enzymes isolated from microbes using two different approaches. The first approach relies on the use of E. coli (strain W) 4-hydroxyphenylacetate hydrolase (HP AH) to make L-DOPA from L-tyrosine (U.S. Patent 5,837,504) combined with a decarboxylase (L-tyrosine decarboxylase TYDC or dopa decarboxylase DDC) to yield dopamine. E. coli 's HP AH is a two-component enzyme composed of a reduced flavin adenine dinucleotide (FADH2) utilizing monooxygenase (HpaB) and an NAD(P)H-flavin oxidoreductase (HpaC) (Carter et al, 2003). S. cerevisiae produce 4-hydroxyphenylpyruvate (4-HPP) as an intermediate in L-tyrosine biosynthesis; thus, for the synthesis of 4-HPAA, it proposed to use a pyruvate decarboxylase enzyme from S. cerevisiae (Sc-PDC6 or Sc-PDCl) to decarboxylate 4-HPP to 4-HPAA. This enzyme normally functions in the L-tyrosine degradation (Ehrlich) pathway of S. cerevisiae for nitrogen scavenging. To increase 4-HPAA yield, alcohol dehydrogenases that convert 4-HPAA to the corresponding alcohol will be deleted in the platform strain. An alternative approach forgoes L-tyrosine transamination altogether by converting dopamine directly to 3,4-diHPAA using a monoamine oxidase (MAO) as described by Minami et al. (2008). This approach eliminates the need for CYP80B3, the P450 downstream of (5 -norcoclaurine.

During heterologous protein expression, low expression or the formation of denatured proteins may be attributable to the differences in synonymous codon usage between the heterologous host and the natural host (Kimchi-Sarfaty et al, 2007; Komar et al., 1999). Optimizing codon usage and eliminating mRNA secondary structure can significantly improve the levels of target protein expression in a heterologous host (Komar et al, 1999; Yoshikuni et al, 2008). However, even after codon optimization and the elimination of secondary structure a heterologous target protein may be poorly expressed. Recently, it has been shown that rare codons, codon context and specific amino acid residues can be important determinants of protein expression, perhaps through their roles in modulating translation efficiency and proper protein folding (Kimchi-Sarfaty et al, 2007; Komar et al, 1999; Yoshikuni et al, 2008; Gutman and Hatfield, 1989; hatfield and Roth, 2007).

To ensure that target pathways support high flux levels and product formation, synthetic versions of the heterologous genes that will be used to reconstitute the four core pathways targeted in this proposal will be produced. These synthetic versions will be optimized for expression in S. cerevisiae. Enzyme genes, in addition to those disclosed herein, that may be used include tyrosine/dopa decarboxylase (TYDC), norcoclaurine synthase (NCS), norcoclaurine 6- O-methyl transferase (60MT), coclaurine N- methyltransferase (CNMT), N-methylcoclaurine 3'-0-hydroxylase (NMCH), 3'-hydroxy-N- methylcoclaurine 4'-O-methyltransferase (4ΌΜΤ), salutaridine synthase (SalSyn), salutaridine reductase (SalR), salutaridinol 7-O-acetyltransferase (SalAT), codeinone reductase (COR), thebaine 6-O-demethylase (T60DM) and codeine O-demethylase (CODM) (Ziegler and Facchini, 2008; Hagel and Facchini, 2009).

Codeine is a morphinan alkaloid produced in opium poppy (Papaver somniferum) by a 6-4alpha attack in (i?)-reticuline, which results from the epimerization of (5)-reticuline. Per capita, Canadians are the top consumers of codeine, which is found in a variety of over-the- counter and prescription medications. Despite their importance and widespread use, Canada imports more than $100M of codeine (Hagel et al, 2007). The vast licit Canadian market for opiates represents an opportunity to develop a newindustry involving fermentation technology as an alternative to importation of raw opiates obtained from plant cultivation. Targeting codeine as a prototype molecule presents several challenges, but none that should be considered infeasible. The first is the epimerization of (.S)-reticuline to (i?)-reticuline, which occurs as a two-step process involving the oxidation of (,S)-reticuline by 1 ,2-dehydroreticuline synthase (DRS), and the reduction of 1 ,2-dehydroreticuline to (/?)-reticuline via 2- dehydroreticuline reductase (DRR) (FIG. 1). Both steps have been biochemically characterized and the enzymes partially purified. Candidate cDNAs from the opium poppy 454-sequenced transcriptome will be tested alone and in combination for their ability to catalyze the epimerization of reticuline. From the perspective of prototype development, the availability of DRS and DRR while preferred, is not essential to the stepwise reconstitution of the morphinan pathway. This results from the stereochemical promiscuity of the methyltransferases involved in reticuline biosynthesis. The exclusive formation of (S)- reticuline results from the catalytic mechanism of NCS, which stereospecifically couples dopamine and 4-HPAA to yield (^-reticuline. However, dopamine and 4-HPAA are highly reactive molecules that condense spontaneously to yield racemic (i?,5)-norcoclaurine. (R)- Norcoclaurine would be converted directly to ft)-reticuline via the methyltransferases in the pathway that accepts both (R)- and (5)-isomers. However, CYP80B3 hydroxylates the 3' position of (5)-N-methylcoclaurine, but does not accept the (i?)-epimer of this intermediate; thus, the strategy to utilize 3,4-diHPAA would be required in this case. Intramolecular carbon-carbon phenol coupling between C2 of the benzyl and C4a of the isochinoline moiety of (i?)-reticuline leads to the formation of salutaridine by the P450-dependent enzyme salutaridine synthase (SalSyn). The next two steps in the pathway are catalyzed by salutaridine reductase (Sal ) and salutaridinol 7-O-acetyltransferase (SalAT), yielding salutaridinol-7-O-acetate. cDNAs encoding SalSyn, SalR and SalAT have been reported. The acetyl group in salutaridinol-7-O-acetate is eliminated spontaneously, leading to the formation of an oxide bridge between C-4 and C-5 to yield thebaine, which is only two enzymatic steps removed from codeine. The gene for one of these enzymes, codeinone reductase has been cloned from opium poppy and, in contrast to SalR, belongs to the aldo-keto reductase (AKR) family. The oxidative enzyme involved in the conversion of neopinone to codeinone is uncharacterized. The conversion of ( )-norcoclaurine and (/S)-norlaudanosoline (produced by the condensation of dopamine and 3,4-diHPAA) to the central BIA pathway intermediate (S)- reticuline has been reported previously (Minami et al, 2008) and a similar strategy will be utilized here. cDNA sequences encoding the two relevant O-methyltransferases (60MT and 4ΌΜΤ), the N-methyltransferase (CNMT) and the P450 (CYP80B3) are all available from several different plant species (Ziegler, and Facchini, 2008).

VII. Production of Semisynthetic Opiates

A number of semi-synthetic opioids can be created from the natural opiates, such as hydromorphone, hydrocodone, oxycodone, oxymorphone, desomorphine, diacetylmorphine (heroin), nicomorphine, dipropanoylmorphine, benzylmorphine and ethylmorphine.

Dihydrocodeine is the parent drug of a series of moderately strong narcotics including hydrocodone, nicocodeine, nicodicodeine, thebaine, acetyldihydrocodeine and others. The removal of the double-bond makes the structure much more stable. It is more resistant to metabolic attack (hence a duration of action of 6 hours rather than 4 for codeine). It is also more stable in acidic, high-temperature environments. Whereas converting codeine to morphine is a difficult and unrewarding task, dihydrocodeine can be converted to dihydromorphine with very high yields (over 95%). The dihydromorphine can be quantitatively converted to hydromorphone using potassium tert butoxide.

Hydrocodone or dihydrocodeinone is a semi-synthetic opioid derived from codeine and thebaine.

Hydromorphone is made from morphine via catalytic hydrogenation and is also produced in trace amounts by human and other mammalian metabolism of morphine and occasionally appears in assays of opium latex in very small quantities, apparently forming in the plant in an unknown percentage of cases under poorly-understood conditions.

Commercially, hydromorphone is made from morphine either by direct rearrangement (made by reflux heating of alcoholic or acidic aqueous solution of morphine in the presence of platinum or palladium catalyst), or reduction to dihydromorphine (usually via catalytic hydrogenation), followed by oxidation with benzophenone in presence of potassium tert butoxide or aluminium tert butoxide (Oppenauer oxidation). The 6 ketone group can be replaced with a methylene group via the Wittig reaction to produce 6- Methylenedihydrodesoxymorphine which is 80X stronger than morphine.

Changing morphine into hydromorphone increases its activity and therefore makes hydromorphone about eight times stronger than morphine on a weight basis, all other things being equal. Changed also is lipid solubility, contributing to hydromorphone having a more rapid onset of action and alterations to the overall Absorption, Distribution, Metabolism & Elimination profile as well as the side effect profile (generally less nausea and itching) versus that of morphine. The semi-synthetic opiates, of which hydromorphone and its codeine analogue hydrocodone are amongst the best-known and oldest, include a huge number of drugs of varying strengths and with differences amongst themselves both subtle and stark, allowing for many different options for treatment.

The human liver produces hydromorphone when processing hydrocodone using the cytochrome p450 II-D-6 enzyme pathway (CYP2D6). This is the same route that is used to convert many different opiate prodrugs into the active form. The proportion of drug that is converted into the stronger form is around 10% on average although this varies markedly between individuals. Drugs that are bioactivated in this way include codeine into morphine, oxycodone to oxymorphone and dihydrocodeine to dihydromorphine. Some bacteria have been shown to be able to turn morphine into closely related drugs including hydromorphone and dihydromorphine amongst others. The bacterium Pseudomonas putida, serotype Ml 0 produces a naturally occurring NADH-dependent morphinone reductase which can work on unsaturated 7,8 bonds - with result that when these bacteria are living in an aqueous solution containing morphine, significant amounts of hydromophone form as it is an intermediary metabolite in this process; the same goes for codeine being turned into hydrocodone.

The process gave rise to various concentrations of hydromorphone, dihydromorphine, 14p-hydroxymorphine, and 14P-hydroxymorphone during the experiments and there were two paths from morphine to hydromorphine, one having dihydromorphine as the penultimate step, and another in which it was morphinone. A third path was from morphine to 14β- hydroxymorphine to hydromorphone. The same method subtituting oxymorphone as the starting drug yields oxymorphol.

Nicomorphine (Vilan, Subellan, Gevilan, MorZet) is the 3,6-dinicotinate ester of, and can be produced from, morphine.

Oxycodone is an opioid analgesic medication synthesized from opium-derived thebaine. Oxycodone's chemical name is derived from codeine, and the chemical structures are very similar, differing only in that Oxycodone has a hydroxyl group at carbon- 14 (codeine has just a hydrogen in its place), hence oxycodone; Oxycodone has a 7,8-dihydro feature, whereas codeine has a double bond between those two carbons; and Oxycodone has a carbonyl group (as in ketones) in place of the hydroxyl group of codeine, hence the "-one" suffix. It is also similar to hydrocodone, differing only in that it has a hydroxyl group at carbon-14. See U.S. Patent 7,153,966.

Oxymorphone is commercially produced from thebaine, which is a minor constituent of Papaver somniferum, but thebaine is found in greater abundance (3%) in the roots of the oriental poppy (Papaver orientate). Oxymorphone can also be synthesized from morphine or oxycodone, and is an active metabolite of the latter drug. The structure-activity relationship of oxymorphone and its derivatives has been well-examined. Esterification of the hydroxyl groups yields stronger compounds. The acetyl ester is 2.5 times more potent and the propenyl ester six times more potent than the parent compound. If the 14-hydroxyl group is formed into the cinnamyl ester, the product is 114 times more potent. The most powerful oxymorphone derivative known is the 14-cinnamyl 3 -acetyl ester, which is over 200 times more potent than morphine. Another derivative of oxymorphone is the narcotic antagonist naloxone (Narcan). Desomorphine (Dihydrodesoxymorphine, Permonid) is an opiate analogue invented in 1932 in the United States, that is a derivative of morphine, where the 6-hydroxy group has been removed and the 7,8 double bond has been saturated.

Dipropanoylmorphine (Dipropionylmorphine in U.S. English) is an opiate derivative, the 3,6-dipropanoyl ester of morphine. Dipropanoylmorphine is prepared by reacting morphine with propionic anhydride, in an analogous manner to how heroin is produced by reacting morphine with acetic anhydride.

Benzylmorphine (Peronine) is a semi-synthetic opiate narcotic introduced to the international market in 1896 and that of the United States very shortly thereafter. It is much like codeine, containing a benzyl group attached to the morphine molecule just as the methyl group creates codeine and the ethyl group creates ethylmorphine or dionine.

Chemically, ethylmorphine is a morphine molecule with a -OC₂H₅ group substituted for the aromatic 3 -OH group. Therefore the closest chemical relative of ethylmorphine is codeine, also known as methylmorphine. Ethylmorphine also has a hydromorphone analogue (ethyldihydromorphinone or 3-ethoxy-7,8-dihydro-morphin-6-one), and a dihydromorphine analogue known as ethyldihydromorphine.

VIII. Kits

For use in the applications described herein, kits are also within the scope of the invention. Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements of the present invention, and those elements to be used in methods of the present invention, in particular, polypeptides, nucleic acids, recombinant vectors, and cells.

The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial end user standpoint, including buffers, diluents, filters, plates, media, and package inserts with instructions for use. In addition, a label can be provided on the container to indicate that the composition is used for a specific application. Directions and or other information can also be included on an insert which is included with the kit. IX. Examples

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. EXAMPLE 1: Materials & Methods

Chemicals. Morphine and codeine were gifts from Sanofi-Aventis (Paris, France). Thebaine and oripavine were isolated from the latex of opium poppy variety T (Supplementary Methods). Noscapine and papaverine were purchased from SigmaAldrich (St. Louis, MO). All other alkaloids were obtained or synthesized as described previously (Liscombe et al, 2009; Ziegler et al, 2009). [l-¹⁴C]2-Oxoglutarate was purchased from American Radiolabeled Chemicals (St. Louis, MO). All other chemicals were purchased from Sigma-Aldrich.

Microarray-based analysis. A total of 6 hybridization experiments were performed, including technical (i.e., dye-flip) replicates, in which the relative abundance of transcripts in variety T was compared with those of varieties L, 1 1 and 40, respectively (i.e., duplicate experiments for each of T vesrus L, T versus 1 1 and T versus 40). Procedural details are found in Supplementary Methods. Transcripts that were potentially less or more abundant in T compared with the other varieties were identified using a signal intensity ratio cutoff of 1.8. Based on this criterion, eigh genes were putatively underexpressed in T compared with at least two other varieties. Only one of these eight genes, represented on the microarray as the EST sequence 06_B04 (GenBank accession FE964517) originating from the cell culture cDNA library was putatively underexpressed in T compared with all three morphine- producing varieties.

Protein expression and purification. The EST sequence 06 B04 (GenBank accession FE964517) identified using microarray analysis was used to query an EST database containing 10,148 sequences from elicitor-treated cell cultures 48 and 7,949 sequences from stems of opium poppy using the tBLASTn algorithm. Although the 06_B04 cDNA was incomplete, a full-length cDNA (named DIOX1) was identified in the cell culture EST database. Two additional, full-length cDNAs with substantial nucleotide identity to DIOX1 were identified in the cell culture (DIOX2, 86%) and stem (DIOX3, 67%) cDNA libraries. Protein expression constructs were assembled using pQE vector (Qiagen, Valencia, CA) and protein expression was achieved in Escherichia coli SGI 3009. Protein purification was performed using Talon cobalt affinity columns (Clontech, Mountain View, CA). Refer to Supplementary Methods for procedural details.

Enzyme assays. The direct enzyme assay for 2-oxoglutarate-dependent dioxygenase activity was performed using a reaction mixture of 100 mM Tris-HCl (pH 7.4), 10% (v/v) glycerol, 14 mM 2-mercaptoethanol, 1 mM alkaloid, 10 mM 2-oxoglutarate, 10 mM sodium ascorbate, 0.5 mM FeSC , and up to 100 g of purified recombinant enzyme. Assays were carried out at 30°C for 1 or 4 hours, stopped by immersing the reaction tube in boiling water for 5 min, and subjected to LC-MS analysis. 2-Oxoglutarate-dependent dioxygenase activity was also assayed using an indirect method based on the O-demethylation-coupled decarboxylation of [l-¹⁴C]2-oxoglutarate (Supplementary Methods). Incubation time (45 min), protein concentration (10 ng/μΐ) and other assay parameters were optimized prior to substrate specificity and enzyme kinetic analyses. Saturation curves and kinetic constants were calculated based on Michaelis-Menten kinetics using FigP v. 2.98 (BioSoft, Cambridge, UK). Refer to Supplementary Methods for procedural details.

Liquid chromatography-tandem mass spectrometry. Enzyme assays were diluted

1 :10 with 0.1% (v/v) formic acid and analyzed using a 6410 Triple Quadrupole LC-MS system (Agilent Technologies; Santa Clara, CA). Liquid chromatography was performed using a Zorbax Eclipse Plus Ci8 column (2.1 x 50 mm, 1.8 μηι particle size; Agilent Technologies) at a flow rate of 0.4 ml/min, beginning with 20% (v/v) acetonitrile/0.1% (v/v) formic acid/79.9% (v/v) water and increasing to 99.9% (v/v) acetonitrile/0.1% (v/v) formic acid over 4 min. Injection into the mass analyzer was performed using an electrospray ionization (ESI) probe inlet. Ions were generated and focused using an ESI voltage of 4000 kV, 9 1/min gas flow, 40 psi nebulizing pressure, and gas temperature of 330°C. MS data acquisition was carried out in positive ion mode over 50-400 m/z. The collision-induced dissociation (CID) mass spectra were recorded 50-400 m/z. The collision-induced dissociation (CID) mass spectra were recorded using collision energies of -15.0 eV (thebaine and oripavine), -25.0 (codeinone and morphinone), -32.0 eV (morphine) and -30.0 eV (codeine). Argon collision gas was set at a pressure of 1.8 x 10^"3 torr. Alkaloids were identified based on either previously published ESI mass spectra (Raith et al, 2003) or by comparison with ESI mass spectra of authentic standards.

Virus-induced gene silencing. Assembly of VIGS vectors and infiltration procedures are described below. Infiltrated opium poppy plants were analyzed at maturity {i.e., the emergence of flower buds). Stems were cut immediately below the flower bud and 10 μΐ of exuding latex was collected. At the same time, three 1-cm segments of stem tissue directly below the flower bud were excised and flash frozen in liquid nitrogen for RT-qPCR analysis. Initial phenotypic screening was performed by thin layer chromatography (TLC). Latex samples were suspended in 30 μΐ methanol and 10 μΐ was spotted on TLC Silica gel 60 F2S4 plates (Merck). Separation was achieved using a previously described solvent system (Millgate et al, 2004) and alkaloids were visualized by shadowing under 254 nm UV illumination. Major alkaloids were identified based on the comparison of Rf values with those of authentic standards. TLC results were confirmed using high performance liquid chromatography (HPLC) as described previously (Hagel et al, 2008). Fifteen microliters of methanol-latex suspension was diluted with 235 μΐ of methanol, vortexed and centrifuged for 10 min at ΙΟ,ΟΟΟ,ρ to remove insoluble debris and 100 vortexed and centrifuged for 10 min at 10,000$ to remove insoluble debris and 100 μΐ of the supernatant was analyzed by HPLC.

Gene expression analysis. Real-time quantitative PCR was performed as described in Supplementary Methods. Gene expression data for VIGS analysis were determined based on 27 independent values per plant line {i.e., 3 technical replicates performed on each of 3 stem segments taken from each of 3 individual plants). Organ-specific gene expression data were based on nine independent values per plant line {i.e., 3 technical replicates on each of 3 individual plants). The 2^_AACt method was used for the analysis of relative gene expression (Livak et al, 2001) as described previously (Hagel et al, 2008). The gene encoding elongation factor la {elf la) was used as the internal control and the plant line showing the highest expression level served as the calibrator for each target gene.

Accession codes. Sequence data in this article has been deposited in the GenBank/EMBL databases under accession numbers GQ500139 (T60DM), GQ500140 (DIOX2) and GQ500141 (CODM).

Plant material. Three commercial, high-morphine varieties (L, 11 and 40) of opium poppy {Papaver somniferum) and a mutant variety (T) that accumulates high levels of thebaine and oripavine,but lacks morphine and codeine (Hagel et al, 2008) were cultivated in a growth chamber (Conviron, Winnipeg, Canada) at 20°C/18°C (light/dark) under high- intensity metal halide lights with a photoperiod of 16 h. Plant materials for gene expression and/or alkaloid analysis was harvested one day before anthesis and stored at -80°C until further analysis. For virus-induced gene silencing (VIGS) experiments, the opium poppy variety Bea's Choice was cultivated under greenhouse conditions.

Isolation of thebaine and oripavine. Thebaine and oripavine were isolated from the latex of opium poppy variety T. Methanol extracts of T latex were concentrated under reduced pressure and spotted on thin layer chromatography (TLC) Silica gel 60 F₂₅₄ plates (Merck, Whitehouse Station, NJ). TLC was performed as described previously (Millgate et al, 2004) and alkaloids were visualized under UV illumination at 254 nm. Silica was scraped off the plates from regions corresponding to the R_f values of authentic thebaine and oripavine and extracted three times with methanol. Pooled methanol extracts were concentrated under reduced pressure. The purity and identity of thebaine and oripavine were confirmed by electron-impact-mass spectrometry (EI-MS). The EI mass spectra were in agreement with those reported previously (Nielsen et al., 1983; Wheeler et al., 1967).

Genetic inheritance. To determine the mode of inheritance underlying the alkaloid phenotype of variety T (i.e., high-thebaine/oripavine, morphine/codeine-free) reciprocal crosses were generated between T and the high-morphine cultivars 11 and 40. Flower buds were dissected one day prior to anthesis, immature stamens were excised and stigmas were pollinated with pollen from the appropriate variety or cross. Pollinated flowers were covered for 1-2 days to allow the development of seed capsules free from contaminating pollen. F_t plants were either self-pollinated for the production of F₂ seed, or backcrossed with Pi plants. The alkaloid phenotype of individual F₂ and backcrossed plants was qualitatively scored as described in the metabolite profiling section. The frequency of plants from each cross that displayed the high-thebaine/oripavine, morphine/codeine-free phenotype (i.e., %T) in shown in Table 3.

Microarray construction. A custom-built opium poppy microarray was constructed based on expressed sequence tags (ESTs) derived from elicited cell culture (Zulak et al., 2007) and stem cDNA libraries. A total of 22,752 spots were printed corresponding to 12,768 ESTs from cell culture and 9,984 ESTs from stem, which represented a total of 19,185 genetic elements and 14,355 unigenes. To construct the stem cDNA library, 10 cm of stem immediately below the flower buds of opium poppy variety L were harvested one day prior to anthesis. Total RNA isolation was performed as described previously (Zulak et al., 2007) and poly(A)⁺RNA was selected by oligo(dT)-cellulosechromatography. A unidirectional cDNA library wasconstructed in λΙΙηΐ-ΖΑΡΠ XR, according to theinstructions of the manufacturer (Stratagene, Santa Clara, CA). An amplified cDNA library derived fromapproximately 1 x 10⁷ primary plaque-forming unitswas mass excised, and individual bacterial colonies were randomly isolated and cultured in 96-well microtiterplates. Plasmid DNA was prepared using the TempliPhiamplification kit (GE Healthcare Life Sciences, Piscataway, NJ) and sequenced from the 5 '-end using a3730x/ capillaryelectrophoresis DNA analyzer (Applied Biosystems, Foster City, CA). Stem expressed sequence tags (ESTs) were analyzed as described previously (Liscombe et al, 2009; Zulak et al, 2007). Sequenced cDNAs from elicited cell culture and stem libraries were amplified from pBluescript SK^" using T3 and T7 primers in 0.2 ml capacity 96-well PCR plates (Corning, Corning, NY). Agarose gel electrophoresis was used to ensure that each reaction produced sufficient amplicon abundance. PCR products were purified using Montage PCR_% plates (Millipore, Billerica, MA), recovered in 50 μΐ of water, transferred to polypropylene V-bottom 96-well plates(Corning), lyophilized to dryness, resuspended in 6 μΐ 3 x SSC buffer, and arrayed into 384- well polypropylene V-bottom plates (Axygen; Union City, CA) for printing (Microarray and Proteomics Facility, University of Alberta). Individual spots were printed using a BioMek FX (Beckman-Coulter, Fullerton, CA) onto SuperAmine Substrate (Arralt, Sunnyvale, CA) slides.

Microarray hybridization and analysis. RNA from opium poppy stem tissue was isolated using a previously described protocol (Chirgwin et al, 1979) involving guanidiniumthiocyanate-based extraction and cesium chloride-based density centrifugation. High quality RNA (100 μg) was reverse transcribed using BD PowerScript reverse transcriptase (BD Biosciences, Franklin Lakes, NJ) and labeled with Cy3- or Cy5-dCTP fluorescent dyes (Amersham Biosciences). Microarray slide preparation, probe-target hybridization, and washing steps were performed as described previously ((Zulak et al, 2007). A total of 6 hybridization experiments were performed, including technical {i.e., dye- flip) replicates, in which the relative abundance of transcripts in variety T was compared with those of varieties L, 11 and 40, respectively {i.e., duplicate experiments for each of T versus L, T versus 1 1 and T versus 40). Fluorescence signatures were captured using a Scanarray 5000 scanner (PerkinElmer, Waltham, MA) and analyzed using the TIGR TM4 suite of microarray tools (Saeed et al, 2003). Poor quality, low intensity or missing spots were flagged and excluded from further analysis. Florescence signals for each experiment were subjected to LOWESS normalization, followed by manual analysis. Transcripts that were potentially less or more abundant in T compared with the other varieties were identified using a signal intensity ratio cutoff of 1.8. Based on this criterion, eight genes were putatively expressed at substantially lower levels in T compared with at least two other varieties. Only one of these eight genes, represented on the microarray as the EST sequence 06_B04 (GenBank accession numberFE964517) originating from the cell culture cDNA library was putatively expressed at substantially lower levelsin T compared with all three morphine- producing varieties.

Phylogenetic analysis. Amino acid alignments and phylogeny were performed using ClustalX (Chenna et al, 2003) and phylogenetic data were displayed using TREEVIEW (Page, 1996). Species and associated GenBankaccession numbers are as follows: Anisodusacutangulus yoscyamine όβ-hydroxylase AaH6H (ABM74185); Arabidopsis thaliana senescence-related gene 1 AtSRGl (NP_173145); Arabidopsis thaliana 4- hydroxyphenylpyruvate dioxygenase At4HPPD (AAB58404); Arabidopsis thaliana anthocyanidinsynthaseAtAS (Q96323); Atropa 6e//adonnahyoscyamine όβ-hydroxylase AbH6H (BAA78340); CatharanthusrosemdesacQto ywinAoline 4-hydroxylase CrD4H (AAC49827); Citrus unsAwflavanolsynthaseCuFS (BAA36554); Coptis japonica norcoclaurine synthase-1 CjNCS (A2A1A0) Cucurbita wax magibberellin 7-oxidase CmG70 (AAB64346); Cucurbita ma z^'wagibberellin 20-oxidase CmG20O (AAB64345); Citrus wraA uflavanolsynthaseCuFS (BAA36554); Papaver somniferummebaine 6-O-demethylase PsT60DM (GQ500139); Papaver somniferum codeine O-demethylase PsCODM (GQ500141); Papaver somniferum PsDIOX2 (GQ500140); Petunia hybridaflav one 3β- hydroxylase PhF3H (AAC49929); PopulustrichocarpdPt dioxygenase-like (XP_002300453); RicinuscommunisRc dioxygenase-like (EEF42734); SolanumlycopersicumACC oxidaseSlACCO (P24157); VitisviniferaVw dioxygenase-like (CAO70478); Hyoscyamusnigerhyoscy amine όβ-hydroxylase HnH6H (AAA3338);

Zeaffja^flavonolsynthase/flavanone 3-hydroxylase ZmFS/F3H (ACG44904).

Protein expression and purification. Open reading frames (ORFs) encoding DIOX1,

DIOX2 and DIOX3 were amplified from cDNA templates with taq polymerase (Invitrogen, Carlsbad, CA), using sense and antisense primers with flanking BamHl and Pstl restriction sites, respectively (Table 4). PCR products were individually ligated to pGEM-T (Promega, Madison, WI), digested with Bam l and Pstl, and ligated to pQE30 (Qiagen, Valencia, CA) pre-cut with BamHl and Pstl. DNA sequencing of cloned amplicons was performed following ligation into pGEM-T and pQE30 vectors (UCDNA Services, University of Calgary). Plasmid propagation was performed in the Escherichia coli strain XL 1 -Blue, and expression constructs were transformed into E. coli strain SG13009 to generate recombinant enzymes. Production of DIOX1, DIOX2 and DIOX3 proteins was achieved by inducinglog- phase cultures with 0.3 mM isopropyl β-D-thiogalactopyranoside (IPTG) followed by incubation at either 20°C for 4 hours (DIOX1 and DIOX2) or 4°C for 24 hours (DIOX3). Cells were harvested and bacterial pellets were resuspended in Buffer A (100 mMTris-HCl pH 7.4, 10% (v/v) glycerol and 14 mM 2-mercaptoethanol). Lysis was achieved using a French Press at 0.1 GPa (15,000 psi) and lysates were cleared by centrifugation at 10,000g for 10 min. Cleared lysates were loaded onto Talon cobalt affinity columns (Clontech, Mountain View, CA) and purified, His-tagged proteins were eluted according to the manufacturer's instructions. The columns with protein bound were washed with Buffer A, and recombinant proteins were eluted using Buffer A containing 100 mM imidazole. Desalting was performed using PD10 columns (GE Healthcare Life Sciences) and protein concentrations were determined using the, Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). The purity of recombinant proteins was determined using SDS-PAGE (Laemmli, 1970).

Enzyme assays. 2-Oxoglutarate-dependent dioxygenase activity was assayed using a method based on the O-demethylation-coupled decarboxylation of [l-¹⁴C]2-oxoglutarate (Tiainen et al, 2005). Briefly, the standard assay contained 10 μΜ of a 10% mole/mole (n/n) solution of [l-¹⁴C]2-oxoglutarate (specific activity 55 mCi/mmol) diluted with 90% n/n unlabeled 2-oxoglutarate, 10 μΜ unlabelled alkaloid substrate, 10 mM sodium ascorbate, 0.5 mM iron sulfate, and 5 μg purified enzyme in a 500 μΐ buffered (100 mMTris-HCl, 10% [v/v] glycerol, 14 mM 2-mercaptoethanol, pH 7.4) reaction. Assays were initiated by the addition of enzyme, incubated for 45 min at 30°C, and stopped by removing the ¹⁴C0₂-trapping glass fiber filters (Whatman grade GF/D, pretreated with NCS-II tissue solubilizer, Amersham Biosciences) from the reaction vial. For enzyme kinetic analyses, 10 μΜ of a 1% (n/n) solution of [l -¹⁴C]2-oxoglutarate (specific activity 55 mCi/mmol) diluted with 99% (n/n) unlabeled 2-oxoglutarate was used. inetic data for T60DM were obtained by varying the thebaine or oripavine concentration in the reaction between 1 and 500 μΜ at a constant 20D concentration of 500 μΜ. Conversely, the 20D concentration was varied between 1 and 500 μΜ at a constant thebaine concentration of 30 μΜ, which produced the maximum reaction velocity (FIGS. 16A-B). Kinetic data for CODM were obtained by varying the codeine or thebaine concentration between 1 and 500 μΜ at a constant 20D concentration of 500 μΜ, and varying the 20D concentration between 1 and 500 μΜ at a constant codeine concentration of 50 μΜ.

Virus-induced gene silencing. Vector construction - Unique 3'-UTR sequences were used for the construction of virus-induced gene silencing (VIGS) vectors to specifically silence genes encoding DIOX1, DIOX2 and DIOX3, and to avoid the suppression of highly homologous genes: DIOX-b (DIOX1 -specific; 221 bp), DIOX-c (D/OO-specific; 152 bp) and DIOX-d (D/O -specific; 292 bp) (Dinesh-Kumar et al, 2003). In addition, a construct was assembled for the purpose of simultaneously silencing DIOX1, DIOX2 and DIOX3. The design of this non-specific construct (DIOX-a; 342 bp) was based on a highly conserved ORF sequence in all three genes. Full-length cDNA clones were used as templates to amplify selectedfragments (FIGS. 11-13). Forward and reverse PCR primers were designed with flanking BamHl and Xhol restriction endonuclease sites, respectively (Table 4). Amplicons were, generated using Tag DNA polymerase (Invitrogen), ligated to pGEM-T (Promega), digested with BamHl and Xhol, and isolated inserts ligated to pTRV2 (Liu et al, 2002) pre- cut with BamHl and Xhol. DNA sequencing of cloned products was performed after ligation into both vectors. Plasmid propagation was achieved in the E. coli strain XLl-Blue, and the pTRV2 constructs {i.e., DIOX-a, DIOX-b, DIOX-c, DIOX-d and the empty vector) and pTRVl (Liu et al, 2002) were independently mobilized in Agrobacteriumtumefaciens strain GV3101.

Infiltration. Bacteria were prepared for infiltration using a previously reported protocol (Hileman et al, 2005). Independent overnight liquid cultures of A. tumefaciens containing each construct were used to inoculate 500 ml of Luria-Bertani (LB) medium containing 10 mM MES, 20 μΜ acetosyringone and 50 g/ml kanamycin. Cultures were maintained at 28°C for 24 hours, harvested by centrifugation at 3000g for 20 min, and resuspended in infiltration solution (10 mM MES, 200 μΜ acetosyringone, 10 mM MgCl₂) to an OD₆oo of 2.5. Agrobacteriumtumefaciens harboring DIOX-a, DIOX-b, DIOX-c, DIOX-d and the pTRV2 empty vector were each mixed 1 :1 (v/v) with A. tumefaciens containing pTRVl, and incubated for one hour at 20°C prior to infiltration. Opium poppy plants used for VIGS analysis were 2-3 weeks old with emerging first leaves. Infiltration of the A. tumefaciensm cvlum to the emerging leaves was performed using a 1-cc syringe. Plants inoculated with pTRVl and pTRV2, the latter containing a fragment of the opium poppy gene encoding phytoenedesaturase (PapsPDS) (Hileman et al, 2005) displayed photobleaching and were used as a visual marker of VIGS efficiency, which was typically in the range of 20-25%.

Gene expression analysis. Total RNA was isolated with TRIzol (Invitrogen) according to the manufacturer's instructions. Reverse transcription was performed at 42°C for 60 min using 2.5 mM anchored oligo(dT) primer (dT20VN), 0.5 mMdNTP, 10 to 40

and 5 microunits/ul reverse transcriptase (Fermentas, Burlington, Canada) following denaturing of the RNA-primer mix at 70°C for 5 min. Real-time quantitative PCR using SYBR Green detection was performed using a 7300 Real-Time PCR system (Applied Biosystems). Each ΙΟ-μί PCR included 1 μΕ of cDNA (taken directly from the RT reaction in the case of stem, or diluted 50% [v/v] with water for bud, leaf and root), 300 nM forward and reverse primers, and lx Power SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences are listed in Table 4. Reactions were subjected to 40 cycles of template denaturation, primer annealing and primer extension. To evaluate qPCR specificity, the amplicons of all primer pairs were subjected to melt-curve analysis using the dissociation method suggested by the instrument manufacturer (Applied Biosystems).

EXAMPLE 2 - RESULTS

Microarray analysis identifies a 20D/Fe(II)dependent dioxygenase. Reciprocal crosses were generated between T and the high-morphine cultivars 1 1 and 40 in order to determine the mode of inheritance underlying the alkaloid phenotype (i.e., high- thebaine/oripavine, morphine/codeine-free) of variety T. Phenotypic screening for the T phenotype among F2 and backcross progeny supported Mendelian inheritance as a single, recessive locus (Table 3). The stem transcriptome of T was then independently compared with the stem transcriptomes of three morphine- accumulating varieties (i.e. , L, 1 1 , and 40) using a custom-made, cDNA fragment-based, 23,000-element microarray. Results for all three pair- wise comparisons were integrated and differentially expressed genes were identified based on an intensity ratio cut-off of 1.8. Only eight candidate cDNAs exhibited lower transcript levels in T compared with at least two of the highmorphine varieties. Among these, only one was associated with transcript levels that were lower in T compared with all three high-morphine varieties. This cDNA encoded a 20D/Fe(II)-dependent dioxygenase (designated DIOXl ), which was intriguing because treatment of opium poppy with the dioxygenase inhibitor acylcyclohexanedione was reported to increase thebaine accumulation and reduce morphine levels 18. Since this was also the only candidate gene putatively capable of catalyzing O- demethylation, DIOXl was selected for further characterization.

Querying EST libraries identifies two highly related dioxygenases. Using the

DIOXl amino acid sequence to query the inventors' opium poppy EST database led to the identification of two highly conserved homologues (designated DIOX2 and DIOX3). A phylogenetic tree was constructed to compare the three DIOX sequences with other plant 20G/Fe(II)-dependent dioxygenases (FIG. 2). High bootstrap support indicated a monophyletic clade containing DIOX1, DIOX2 and DIOX3, with the nearest-neighbor clade containing uncharacterized putative dioxygenases and the translation product of the Arabidopsis thaliana senescence-related gene 1 (AtSRGl) (Callard et al, 1996). Although substantial (~40%) amino acid sequence identity was observed between the DIOX sequences and a putative norcoclaurine synthase from Coptis japonica (CjNCS) (Minami et al, 2007), monophylogeny with other plant alkaloid biosynthetic enzymes {i.e., desacetoxyvindoline 4- hydroxylase (Vazquez-Flota et al, 1997) and hyoscyamine 6 -hydroxylase (Hashimoto et al, 1991)) was not supported. Aligning the deduced amino acid sequences of opium poppy DIOX enzymes with those of other plant 20D/Fe(II)-dependent dioxygenases revealed a conserved HXDXnH motif (beginning with His238 in DIOX1) which likely serves to coordinate Fe(II)23 (FIG. 14). Additionally, a conserved arginine occurring as an RXS motif (beginning with Arg305 in DIOX1) represents a candidate binding-site for the 20G side-chain carboxylate.

T60DM and CODM are regio-specific <?-demethylases. The biochemical functions of DIOX 1, DIOX2 and DIOX3 were determined using recombinant, His6-tagged proteins produced in Escherichia coli and purified by cobalt-affinity chromatography. Purified enzymes were tested for 20G/Fe(II)-dependent (3-demethylase activity using thebaine, oripavine or codeine as substrates. Assays consisted of Fe(II) and ascorbate as cofactors, 20G and a morphinan alkaloid as substrates, and a recombinant DIOX enzyme. After incubation at 30°C for up to 4 hours, the reactions were quenched and analyzed using liquid chromatography-tandem mass spectrometry (FIG. 3). Reaction products were unambiguously identified using collision-induced dissociation (CID) analysis, and the resulting daughter ion mass spectra are shown in FIG. 4. DIOX1 catalyzed the 6-O-demefhylation of thebaine and oripavine, yielding codeinone (FIG. 3 A) and morphinone (FIG. 3B), respectively. Conversely, DIOX3 catalyzed the 3-C-demethylation of codeine (FIG. 3C) and thebaine (FIG. 3D), yielding morphine and oripavine, respectively. As such, DIOX1 and DIOX 3 were renamed thebaine 6-O-demethylase (T60DM) and codeine O-demethylase (CODM), respectively. DIOX2 did not accept any available morphinan alkaloid as a substrate. The enzymatic synthesis of codeinone and morphinone was accompanied by the spontaneous formation of several higher molecular weight adducts. The general instability of codeinone and morphinone in aqueous solutions (Lister et al, 1999; Craig et al, 1998) and their reactivity with thiol-containing agents such as the 2-mercaptoethanol (Ishida et al, 1991) in the assay mixture is well-documented. The substrate specificity and kinetic parameters of T60DM and CODM were measured using an assay based on the O-demethylation-coupled decarboxylation of [l-¹⁴C]2-oxoglutarate (Supplementary Methods). Beyond the regio-specific attacks of T60DM and CODM on thebaine, oripavine and/or codeine, all three DIOX enzymes accepted the protoberberine alkaloid (5)-scoulerine (FIG. 5). Benzylisoquinoline alkaloids with different skeletal arrangements were tested as potential substrates, including the simple benzylisoquinolines (5)-reticuline and papaverine, the pthalideisoquinoline noscapine, (±)- pavine, the aporphine (S)-corytuberine and the promorphinan salutaridine. Although all of these compounds possess O-linked methyl groups, none were accepted as substrates. Recombinant T60DM and CODM were subjected to enzyme kinetic analyses using thebaine, oripavine, codeine and 20G substrates (Table 2). T60DM produced Km values for thebaine and oripavine of 20 ± 7 and 15 ± 3 μΜ, respectively, whereas CODM exhibited Km values of 21 ± 8 and 42 ± 8 μΜ for codeine and thebaine, respectively. The catalytic efficiency of CODM was relatively low with thebaine (kcat/Km = 235 s^M^"1) compared with codeine kcQtlKm = 785 s^M^"1) as the substrate, and CODM was generally less catalytically efficient than T60DM. These results supported the pathway through codeinone as the preferred route in morphine biosynthesis6 (FIG. 1). The Km values of T60DM and CODM for 2- oxoglutarate were similar to those described for other plant 20G/Fe(II)-dependent dioxygenases (De Carolis and De Luca, 1994). Curve- fitting the kinetic data revealed moderate substrate inhibition for T60DM and CODM using thebaine and codeine substrates, respectively (FIGS. 16A-B); thus, optimal velocity ( opt) and inhibition (Ki) constants were also calculated.

Table 2 - Kinetic data for purified T60DM and CODM recombinant enzymes Enzyme/Substrate Km Ki Vmax Kcat

Kcat/Km

T60DM/Thebaine 20.3±7.1 518±237 2.09±0.33 0.0170±0.0027 837.1

T60DM/Oripavine 15.4±2.7 - 2.35±0.09 0.0191±0.0007 1242.6 T60DM/2-Oxoglutarate 16.4±5.3 - 1.00±0.07 0.008 0.0006 492.9

CODM/Codeine 20.5±8.0 642±409 1.97±0.35 0.0161±0.0029 785.4

CODM/Thebaine 41.9±8.0 - 1.2 0.06 0.0099±0.0005 235.2

CODM/2-Oxoglutarate 19.0±3.3 _ 1.35±0.05 0.0110±0.0004 578.9 Table 3 - Genetic inheritance of the chemotype in opium poppy variety T

Table 4 - PCR primers used for assembly of expression vectors, virus-induced g silencing constructs and real-time quantitative PCR (RT-qPCR) analysis

Protein Expression - Primers used to amplify ORFs for ligation to pQE30

ORF Forward primer Reverse primer

DIOXl GCGCGGATCCATGGAGAAAGCAAAACTT GCGCCTGCAGCACAACGCACTTTCGAGA

(T60DM) (SEQ ID NO:5) (SEQ ID NO:6)

GCGCGGATCCATGGAGACAGCAAAACTT GCGCCTGCAGAGAGTCAAAAAGCAATGA

DIOX2 (SEQ ID NO:7) (SEQ ID NO:8)

DIOX3 GCGCGGATCCATGGAGACACCAATACTT GCGCCTGCAGGCACCATATGAATTCTTC

(CODM) (SEQ ID NO:9) (SEQ ID NO: 10)

Virus-induced gene silencing - Primers used in sequence amplification for ligation to TRV2

Sequence Forward primer Reverse primer

GCGCGGATCCCCTTGTCCTCAACCAAAT GCGCCTCGAGTCCACTTTTAAACAAAGC

DIOX-a (SEQ ID NO: 11) (SEQ ID NO: 12)

GCGCGGATCCCGACGTGATTGCATGTCA GCGCCTCGAGCACAACGCACTTTCGAGA

DIOX-b (SEQ ID NO: 13) (SEQ ID NO: 14)

GCGCGGATCCTTGATTCGATGAGGATG GCGCCTCGAGCTTGAGAAAAGTTTTATT

DIOX-c (SEQ ID NO: 15) (SEQ ID NO: 16)

GCGCGGATCCGTGAGAAAGTGTGAACAT GCGCCTCGAGCAATCCAATACATTATTT

DIOX-d (SEQ ID NO: 17) (SEQ ID NO: 18)

RT-qPCR - Primers used to examine gene-specific transcript abundance

Gene Forward primer Reverse primer

DIOXl TTGAGGCACAAATGAGAAAATTGA CACAACGCACTTTCGAGAAATTAC

(T60DM) (SEQ ID NO: 19) (SEQ ID NO:20)

TGTGAGAAACTGAAGAACACCCAAT AAGGACTCAAACCACTGAAAGACG

DIOXl (SEQ ID NO:21) (SEQ ID NO:22)

DIOX3 TTGTGCTTAAATTTCGTGGATGAC TGATTACATCACTTGACCCAAACAG

(CODM) (SEQ ID NO:23) (SEQ ID NO:24) Silencing T60DM and CODM profoundly alters opium poppy alkaloid profiles.

The metabolic functions of T60DM and CODM were investigated in planta using virus- induced gene silencing (VIGS), which has been demonstrated as an effective method for the transient knockdown of specific genes based on RNA interference in opium poppy (Hileman et al., 2005). Fragments of T60DM, DIOX2 and CODM cDNAs were introduced systemically into opium poppy using the tobacco rattle virus (TRV) as a vector. One pTRV2- based construct (DIOX-a) contained a conserved sequence from the coding region of T60DM and was designed to simultaneously silence the expression of T60DM, DIOX2 and CODM. In contrast, DIOX-b, DIOX-c and DIOX-d contained unique sequences from the 3 '-untranslated regions (UTRs) of T60DM, D10X2 and CODM, respectively, and were designed to individually silence each gene. Emerging first leaves of 2-3 weeks old opium poppy seedlings were infiltrated with Agrobacterium tumefaciens harboring one of these four constructs or the empty vector (pTRV2) as a control. The alkaloid content of the latex and the relative abundance of T60DM, DIOX2 and CODM transcripts in the stem of infected plants were determined immediately prior to anthesis (FIG. 6). The opium poppy variety used for the VIGS experiments accumulates a relative abundance of morphine, lower levels of codeine and thebaine, trace quantities of oripavine, and substantial amounts of noscapine and papaverine. Plants treated with the empty pTRV2 vector displayed a wild-type alkaloid profile (FIGS. 6A- B). In contrast, silencing with the general DIOX-a and 7i50Z -specific DIOX-b constructs resulted in a nearly complete metabolic block at thebaine. The CQ -specific DIOX-d construct caused a dramatic increase in the relative abundance of codeine compared with morphine. Oripavine was not detected in plants infiltrated with A. tumefaciens harbouring the DIOX-a or DIOX-d constructs owing to the silencing of CODM, the gene product of which converts thebaine to oripavine. The silencing of DIOX2 had no detectable effect on alkaloid content. Real-time quantitative PCR (RT-qPCR) confirmed the gene-specific silencing of T60DM, DIOX2 and/or CODM (FIG. 6C). The DIOX2 cDNA is 85% identical to that of T60DM and possesses a short 3 'UTR relative to those in T60DM and CODM, which precluded the use of a longer gene-silencing fragment (FIGS. 1 1 -13). Only partial reduction of DIOX2 transcript levels was achieved using VIGS, perhaps owing to the use of this relatively short 3 '-UTR fragment in the DIOX-c construct. Since the efficiency of gene silencing in opium poppy using TRV-mediated VIGS varies between individuals, and even within individuals (resulting in chimeras) (Hileman et al, 2005), three stem segments from each of three individual plants were analyzed for each infiltrated construct. Alkaloid analysis showed that plants exhibiting even a modest reduction in T60DM or CODM transcript levels displayed a metabolic block at thebaine or codeine, respectively (FIG. 6A-B).

Biochemical basis for topi phenotype. The discovery of T60DM prompted a closer examination of the T variety to better understand the biochemical basis underlying the morphine-free, thebaine/oripavine-accumulating phenotype. Aerial and root tissues were subjected to RT-qPCR analysis in order to determine the relative transcript abundance of T60DM, DIOX2 and CODM (FIG. 7). A dramatic reduction in T60DM transcript levels was detected in the stem, leaf and flower buds of T compared with the high-morphine varieties L, 1 1 and 40. The relative abundance of T60DM transcripts in root was low, and did not show a detectable difference in T compared with the other varieties. No differences were detected in the relative abundance of DIOX2 or CODM transcripts in T compared with the high-morphine varieties. Transcripts encoding DIOX2 and CODM were not detected in roots. Dissociation analysis confirmed that a single amplicon with the expected melting temperature was obtained after RT-qPCR using primers specific for the 3'UTR of each gene (Table 3).

Nevertheless, the possibility that non-specific amplification was responsible for the low levels of T60DM transcripts detected in variety T was examined based on 454- pyrosequencing data of stem cDNA libraries. No T60DM transcripts were detected among 309,102 reads (averaging 397 base pairs in length) from a stem cDNA library for variety T. In contrast, reads matching the T60DM sequence were detected in the stem cDNA libraries of several other morphine-producing opium poppy varieties. Transcripts encoding CODM and DIOX2 were detected in stem cDNA libraries of all varieties, including T, in agreement with the RT-qPCR results (FIG. 7).

O-Demethylation is a common, yet novel reaction in benzylisoquinoline alkaloid

(BIA) metabolism indicated by the occurrence in plants of compounds with different backbone structures lacking the O-linked methyl groups added in the early steps of the pathway at the 6 and 4' positions (FIGS. 17A-B). In addition to the 3-(9-demethylation of the morphinan alkaloids codeine and thebaine, codeine demethylase (CODM) catalyzes the regiospecific 3-O-demethylation of BIAs with the protoberberine backbone, such as scoulerine and tetrahydrocolumbamine (FIGS. 18A-B).

The enzyme formerly known as DIOX2 has been identified as protoberberine 10-O- demethylase (P10ODM), which catakyzes the regiospecific 10-0-demethylation of protoberberine alkaloids, such as tetrahydropalmatine and tetrahydrocolumbamine (FIGS. 19A-B and FIG. 12). The occurrence of enzymes capable of the regiospecific O- demethylation of morphinan alkaloids at the 6 and 3 positions {i.e., T60DM and CODM, respectively) and protoberberine alkaloids at the 3 and 10 positions {i.e., CODM and PI 0ODM) validates the widespread occurrence of O-demethylation in BIA metabolism. The reaction mechanism for all O-demethylases in BIA metabolism is conserved (FIGS. 20A-C).

T60DM and CODM from opium poppy are essential components for the reconstitution of the plant biosynthetic pathway in microorganisms such as yeast. Assembly of the pathway in yeast is being achieved via the reconstitution of 5 sequential blocks. Block 5 consists of T60DM, codeinone reductase (COR) and CODM and targets the conversion of thebaine to codeine and, subsequently, morphine (FIGS. 21-25). Genes encoding most enzymes in the pathway have been identified, and the missing genes are presently under investigation.

Silencing of T60DM, CODM or other genes in the branch pathway leading to codeine and morphine result in profound alterations to the BIA profile in opium poppy plants relative to the wild type (empty vector) phenotype. In general, silencing of salutaridine synthase (SalSyn) leads to a decrease in morphinan alkaloids and an increase in the precursor reticuline. Silencing of salutaridine reductase (SalR) leads to a decrease in morphinan alkaloids and an increase in the intermediate salutaridine. Silencing of salutaridinol acetyltransferase (SalAT) leads to a decrease in morphinan alkaloids. Silencing of T60DM leads to a profound decrease in codeine and morphine, and a substantial increase in thebaine. Silencing or COR leads to a decrease in morphine and codeine, and a minor increase in upstream intermediates. Silencing of CODM leads to a decrease in morphine and a substantial increase in codeine (FIG. 26).

EXAMPLE 3 - DISCUSSION

A functional genomics approach was used to isolate cognate cDNAs encoding two highly related enzymes, thebaine 6-0-demethylase (T60DM) and codeine O-demethylase (CODM), that are regiospecific for O-linked methyl groups at positions 6 and 3, respectively, of morphinan alkaloids. In contrast with animals, opium poppy relies on novel 2-oxoglutarate (20G)/Fe(II)-dependent dioxygenases for the ( -demethylation of thebaine and codeine. In humans, cytochrome P450 (CYP)2D6, a highly versatile enzyme responsible for detoxifying up to 25% of several commonly used pharmaceuticals catalyzes the 3-0-demethylation of thebaine to oripavine, and codeine to morphine (Mikus et al, 1991 ; Dayer et al, 1988). Additionally, CYP2D6 carries out other reactions within the proposed pathway leading from L-tyrosine to morphine, including the phenol coupling of (i?)-reticuline to salutaridine (Grobe et al, 2009). An animal enzyme catalyzing the 6-O-demethylation of thebaine or oripavine has not been identified. The discovery that 20G/Fe(II)-dependent dioxygenases catalyze the final oxidative steps of morphine biosynthesis in opium poppy was unexpected partly because upstream reactions are catalyzed by cytochromes P450. Two different CYP families have been implicated in the metabolism of BIAs in plants: CYP80 {e.g., N-methylcoclaurine 3'- hydroxylase, NMCH) and CYP719 (e.g., salutaridine synthase; SalSyn). The recruitment of 20G/Fe(II)-dependent dioxygenases, rather than cytochromes P450, for the (9-demethylation of morphinan alkaloid intermediates in opium poppy supports the independent evolution of this pathway in plants and humans.

Although approximately 2,500 structurally diverse BIAs occur naturally in members of several plant families, only opium poppy produces morphine and codeine. The recruitment of T60DM and CODM from an ancestral 20G/Fe(II)-dependent dioxygenase was an isolated yet profound evolutionary event that continues to exert both positive and negative consequences on humankind. 2-oxoglutarate/Fe(II)-dependent dioxygenases have previously not been implicated in BIA metabolism, although additional oxidative conversions remain uncharacterized (Ziegler and Facchini, 2008). The participation of T60DM and CODM in the morphinan branch pathway provides a biochemical prospectus for the putative involvement of 20G/Fe(II)-dependent dioxygenases in the biosynthesis of BIAs with different backbone structures, including the protoberberine alkaloids. This hypothesis is supported by the acceptance of (5)-scoulerine as a substrate by T60DM, DIOX2 and CODM. Although the oxidation products were not identified, these enzymes ostensibly catalyze the O- demethylation of one of two positions in (5)-scoulerine (FIG. 5). The flexibility of DIOX enzymes in accepting alkaloid substrates with two substantially different skeletal arrangements suggests that T60DM and CODM were substantially different skeletal arrangements suggests that T60DM and CODM were recruited from enzymes involved in protoberberine metabolism. Genes involved in BIA biosynthesis are likely of monophyletic origin in angiosperms (Liscombe et al, 2005); thus, 20G/Fe(II)-dependent dioxygenases involved in protoberberine metabolism are predicted to occur in plant species related to opium poppy.

2-oxoglutarate-dependent dioxygenases have been implicated in the biosynthesis of other plant natural products, including the pharmaceutical alkaloids vinblastine and scopolamine (Hausinger, 2004). Desacetoxyvindoline 4-hydroxylase (D4H) catalyzes the penultimate step in vindoline biosynthesis en route to the monoterpenoid indole alkaloid vinblastine in Catharanthus roseus ((Vazquez-Flota et al, 1997), whereas hyoscyamine 6β- hydroxylase (H6H) catalyzes the ultimate step in the formation of the tropane alkaloid scopolamine (Hashimoto et al, 1991). Phylogenetic analysis did not support monophylogeny between opium poppy dioxygenases and either D4H or H6H (FIG. 2), which is consistent with the independent evolutionary origins of different alkaloid categories in plants (Ziegler and Facchini, 2008). The more substantial sequence identity between a CjNCS from Coptis japonica and the DIOX enzymes in opium poppy suggests a more recent ancestral link. CjNCSl was reported to catalyze the formation of (5)-norcoclaurine via the Pictet-Spengler condensation of dopamine and 4-HPAA20. In opium poppy, this reaction is catalyzed by unique members of the pathogenesis-related (PR) 10 protein family (PsNCSl and PsNCS2) that display no amino acid sequence identity with 20G/Fe(II)-dependent dioxygenases (Samanani et al, 2004). The potential formation of (5)-norcoclaurine by two different enzymes would be a rare feature in plant natural product metabolism. However, the substantial similarity with the DIOX enzymes in opium poppy suggests that CjNCS might possess alternative functions in BIA metabolism.

Compared with T60DM and CODM, anthocyanidin synthase (AS) is the most similar enzyme, in terms of amino acid sequence identity (FIG. 2), for which a three-dimensional X- ray crystallographic structure has been determined (Wilmouth et al, 2002). All three DIOX enzymes possess the canonical HXDXnH motif required for Fe(II) coordination, upstream of a conserved RXS motif and downstream of a conserved N-terminal tyrosine residue. The arginine (Arg305 in T60DM) in the RXS sequence and the upstream tyrosine (Tyr223 in T60DM) purportedly stabilize the C-5 carboxylate of 20G. Although the catalytic residues and functional domains of AS and opium poppy DIOX enzymes appear highly conserved, and the overall structure is likely similar, understanding the biochemical basis for the substrate selectivity and regiospecificity of T60DM and CODM will require an empirical model of each enzyme.

Non-heme, Fe(II)-dependent oxygenases catalyze a wide variety of reactions, including aromatic ring hydroxylation, oxidative cyclization, C-C bond cleavage, desaturation and epimerization (Clifton et al, 2006). Members of this extended enzyme family have been implicated as N-demethylases in histone modification (Shi and Whetstine, 2009) and nucleic acid repair mechanisms (Sundheim et al, 2008). However, T60DM and CODM represent the first O-demethylases within this broad family. The most common type of reaction catalyzed by 20G/Fe(II)-dependent dioxygenases is the hydroxylation of alkyl moieties. For example, the N-demethylation of histones and nucleic acids proceeds via hydroxylation of the N-linked methyl group followed by formaldehyde elimination (Shi and Whetstine, 2009; Sundheim et al, 2008). T60DM and CODM could catalyze O-demethylation using a similar O-linked methyl group hydroxylation mechanism, although ring hydroxylation followed by methanol elimination cannot be ruled out. O-Dealkylation reactions of methyl ethers catalyzed by cytochromes P450 definitively result from a C-H bond hydroxylation, with the methyl group departing as formaldehyde (Meunier et al, 2004). Alternatively, horseradish peroxidase oxidizes methyl ether functions by an electron-transfer mechanism, and the methoxy group is released as methanol (Meunier and Meunier, 1985). Assuming that T60DM and CODM catalyze (2-demethylation via hydroxylation, the incorporation site could be easily determined

18 18

by feeding labeled dioxygen substrate (i.e., 0₂), in which case a lack of O-incorporation in the alkaloid product would support hydroxylation at the O-linked methyl group.

Studies of 20G/Fe(II)-dependent dioxygenases using substrate analogues have shown that the type of oxidative reaction catalyzed and, thus, the product selectivity can be modified. For example, proline 4-hydroxylase catalyzes epoxidation of 3,4-dehydroproline (Shibasaki et al,, 1999), and AS predominantly performs hydroxylation or desaturation reactions depending on the substitution pattern of the flavonoid substrate (Turnbull et al, 2004). Flexible product selectivity would be a highly desirable feature for enzymes involved in morphinan alkaloid metabolism as the synthesis of novel alkaloid analogues has application in the development of improved pharmaceuticals. Similarly, site-directed mutagenesis can be applied to enhance the selectivity toward unnatural substrate analogues, thereby improving the efficiency of precursor-directed biosynthesis (or 'mutasynthesis') of alkaloid derivative (Leonard et al, 2009). Several analogues of 20G have been shown to exhibit inhibitory activity toward 20G/Fe(II)-dependent dioxygenases. For example, acylcyclohexanedione derivatives competitively inhibit gibberellin 2p-hydroxylases (Griggs et al, 1991) and are used in agriculture as general growth retardants. The application of acylcyclohexanedione derivatives to opium poppy is a patented technology to specifically reduce morphine accumulation, and increase the thebaine and oripavine content of the plant (PCT WO 2005/107436).

Identification of T60DM as a 20G/Fe(II)- dependent dioxygenase reveals that acylcyclohexanedione derivatives block metabolism at thebaine and oripavine by acting as competitive inhibitors of the ( -demethylases in the morphinan alkaloid pathway. The VIGS- mediated, gene-specific silencing of T60DM and/or CODM profoundly altered the morphinan alkaloid profile in planta and corroborated the in vitro catalytic activity of these enzymes. A reduction in the abundance of T60DM transcripts resulted in a nearly complete block in morphine metabolism, and effectively recreated the T or topi phenotype. The effect on alkaloid phenotype of even a modest reduction in transcript level suggests that T60DM or CODM are not highly expressed genes. Indeed, the relative abundance of T60DM or CODM gene transcripts are among the lowest of all known BIA biosynthetic genes in opium poppy as determined by 454-pyrosequencing (data not shown). The genetic inheritance of the high fhebaine/oripavine, morphine-free phenotype in the T variety showed that the trait was governed by a single locus. Opium poppy mutants with this phenotype have been discovered in natural populations of plants with a high-morphine content, and induced mutagenesis has yielded lines with a similar alkaloid profile (PCT WO 2005/107436). The genetic basis for the knockout of T60DM gene expression in the T variety is not known. Although a mutation in promoter or even the coding region of T60DM is possible, the inactivation of a regulatory factor involved in the control of T60DM expression must also be considered.

Plants exhibiting high-codeine, morphine- free chemotypes have not been reported. A metabolic block at codeine would occur infrequently in natural or mutagenic populations if the phenotype Were governed by multiple loci. The possibility that CODM is encoded by more than one gene would complicate mutagenesis efforts aimed at breeding a high-codeine opium poppy variety. The silencing of CODM resulted in a substantial increase in the ratio of codeine to morphine, but unlike the silencing of T60DM, only caused a partial metabolic block (FIG. 6). Although differences in the gene silencing efficiency of the various VIGS constructs cannot be ruled out, it is also possible that the gene-specific 3'UTR region of CODM used in the DIOX-d construct is insufficiently identical to that of additional genes encoding CODM. Post-transcriptional gene silencing is generally effective in the silencing of gene families since it is possible to simultaneously silence the expression of all members using conserved regions. However, the T60DM and CODM cDNAs exhibit 67% nucleotide identity, which precludes the use of any sequence other than the 3'UTR to specifically silence CODM and avoid the concomitant silencing of T60DM. Nevertheless, VIGS provided an unambiguous confirmation of the physiological function of T60DM and CODM in morphinan alkaloid biosynthesis. Analysis of CYP80G2, a C-C phenol-coupling enzyme catalyzing the formation of (5)-corytuberine from (5)-reticuline in Coptis japonica, suggested 4'-<9-demethylase activity with the substrate codamine as a side reaction in vitro (Ikezawa et αί, 2008). However, the relevance of this activity in planta was not determined.

The discovery of the T60DM and CODM genes could have major industrial, pharmaceutical and socioeconomic implications. Global demand for opioid analgesics has increased more than 2.5-fold over the past decade, and codeine continues to be the most commonly used narcotic drug in the world (Intl. Narcotics Control Board, 2008). The extensive deployment of the topi variety in Australia underscores the growing demand for semisynthetic opiates, especially oxycodone, and demonstrates the commercial potential for opium poppy varieties with altered morphinan alkaloid profiles. Most of the licit morphine recovered from opium poppy is synthetically 3-O-methylated to produce codeine, which is more versatile as an analgesic and a cough suppressant. The development of an opium poppy variety blocked at CODM would facilitate the direct recovery of codeine from the plant, thus circumventing the chemical conversion step. Furthermore, the elimination of morphine biosynthesis in CODM-blocked plants would preclude the illicit synthesis of heroin, an acetylated morphine derivative. Morphinan alkaloid metabolism in opium poppy has long been a target for mutagenic and transgenic engineering aimed at increasing the accumulation of valuable metabolites. The RNAi-mediated replacement of morphine with non-narcotic (S)- reticuline highlighted the potential commercial value of metabolic engineering in opium poppy (Allen et al, 2004). A chimeric hairpin RNA construct designed to silence all members of the COR gene family unexpectedly resulted in the accumulation of (<S)-reticuline, which has purported pharmacological value as a hair-growth stimulant, an antimalarial drug and an anticancer agent. Conversely, overexpression of COR in transgenic opium poppy plants resulted in an overall increase in the accumulation of alkaloids, including morphine (Larkin et al, 2007).

The reconstitution of the morphinan alkaloid pathway in microbes could provide a desirable alternative to conventional agriculture especially with respect to production costs and the regulation of controlled substances. The availability of T60DM and CODM will facilitate recent synthetic biology efforts aimed at producing opiate alkaloids in yeast and/or bacteria (Minami et al, 2008; Hawkins and Smolke, 2008) and provide a structural basis for the development of novel pharmaceuticals based on enzymatic processes (Leonard et al, 2009). Using a combination of plant and human genes expressed in yeast, low-level production of the promorphinan alkaloid salutaridine was reported (Hawkins and Smolke, 2008). Recently identified cDNAs encoding enzymes leading to thebaine (Gesell et al, 2009; Ziegler et al, 2006; Grobe et al, 2009) could facilitate extension of the pathway.

Indeed, cognate cDNAs encoding only three enzymes {i.e., 1,2-dehydroreticuline synthase, 1 ,2-dehydroreticuline reductase and thebaine synthase) out of 14 involved in the multistep conversion of dopamine and 4-HPAA to morphine have not been isolated (Ziegler and Facchini, 2008; Fisinger et al, 2007). The availability of dedicated plant enzymes rather than the use of surrogates from animal or microbial sources would appear crucial to the successful reconstitution of complex metabolic pathways in microorganisms. For example, T60DM represents the only known enzyme capable of catalyzing the 6-O-demethylation of thebaine and oripavine, which is essential for the production of codeine and morphine. Both CODM and mammalian CYP2D6 catalyze the final, 3-O-demethylation step in morphine biosynthesis. However, Km values using codeine as the substrate were more than 10- fold greater for CYP2D6 (250 μΜ) compared with CODM (21 μΜ) (Oscarson et al, 1997).

Opium poppy has had a profound influence on humankind owing to its unique ability among plants to produce the narcotic analgesics codeine and morphine. Despite more than a half-century of research on the anabolism of morphine in opium poppy, the ( -demethylases responsible for the antepenultimate and ultimate steps in the pathway have never been detected. The long-standing assumption that these ( -demethylases are cytochromes P450 was based on the involvement of such enzymes in human morphine metabolism. The use of nonbiased, comparative transcriptomics was central to the isolation of the genes encoding the plant O-demethylases. As members of the 20G/Fe(II)-dependent dioxygenase family, T60DM and CODM are unique in their ability to catalyze ( -demethylation. The recruitment of the genes encoding these two enzymes into the morphinan alkaloid pathway represents a landmark in plant evolution, without which the myriad benefits of opiate analgesics would likely have remained unknown for most of history. Future biotechnological applications of T60DM and CODM will undoubtedly expand a long relationship with opium poppy and its constituent alkaloids.

All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

X. References

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference:

U.S. Patent 4,554,101

U.S. Patent 4,683,202

U.S. Patent 4,693,976

U.S. Patent 4,693,976

U.S. Patent 4,940,838

U.S. Patent 5,129,645

U.S. Patent 5,464,763

U.S. Patent 5,565,347

U.S. Patent 5,635,381

U.S. Patent 5,731,179

U.S. Patent 5,837,504

U.S. Patent 5,922,928

U.S. Patent 5,925,565

U.S. Patent 5,928,906

U.S. Patent 5,935,819

U.S. Patent 5,981,840

U.S. Patent 6,051,757

U.S. Patent 6,162,965

U.S. Patent 6,165,780

U.S. Patent 6,255,559

U.S. Patent 6,265,638

U.S. Patent 6,300,545

U.S. Patent 6,323,396

U.S. Patent 6,455,761

U.S. Patent 6,603,061

U.S. Patent 6,664,108

U.S. Patent 6,696,622

U.S. Patent 6,759,573

U.S. Patent 6,822,144

U.S. Patent 7,029,908 U.S. Patent 7,122,716

U.S. Patent 7,126,041

U.S. Patent 7,153,966

U.S. Patent 7,179,599

U.S. Patent 7,276,374

U.S. Patent 7,279,336

U.S. Patent 7,285,705

U.S. Patent 7,569,746

U.S. Patent 7,598,430

Allen et a/., Nat. Biotech., 22:1559-1566, 2004.

Apuya et al., Plant Biotechnology Journal 6: 160-175, 2008.

Ausubel et al, In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, New York, 1994.

Barany and Merrifield, In: The Peptides, Gross and Meienhofer (Eds.), Academic Press, NY, 1-284, 1979.

Braus, Microbiological Rev., 55:349-70, 1991.

Brochmann-Hanssen, Planta Med., 50:343-345, 1984.

Callard et al, Plant Physiol, 1 12:705-715, 1996.

Capaldi et al, Biochem. Biophys. Res. Comm., 76:425, 1977.

Carbonelli et al. , FEMS Microbiol. Lett., 177(1 ):75-82, 1999.

Carothers et al, Curr. Opin. Biotech., 20:1-6, 2009.

Carter et al, Phy to chemistry, 64:425-433, 2003.

Chandler et al, Proc. Natl. Acad. Sci. USA, 94(8):3596-601, 1997.

Chavez-Bejar et al, Applied Environ. Microbiol, 74:3284-90, 2008.

Chenna et al, Nucleic Acids Res., 31 :3497-3500, 2003.

Chirgwin et al, Biochemistry, 18:5294-5299, 1979.

Chitty et al, Functional Plant Biol, 30: 1045-1058, 2003.

Chitty et al, Meth. Molec. Biol, 344:383-391, 2007.

Clifton et al, J. Inorg. Biochem., 100:644-669, 2006.

Cocea, Biotechniques, 23(5):814-816, 1997.

Craig et al, Biochemistry, 37:7598-7607, 1998.

Dayer et al, Biochem. Biophys. Res. Commun., 152:41 1-416, 1988.

De Carolis and De Luca, Phytochemistry, 36:1093-1107, 1994.

Dietrich et al, ACS Chem. Biol, 261-267, 2009. Dinesh-Kumar et al, Methods Mol. Biol, 236:287-294, 2003.

Dueber et al, Nature Biotech., 27:753-759, 2009.

Elleuch et al, Enzyme and Microbial Technology 28: 106-113, 2001.

Facchini et al, Plant Physiology 1 18: 69-81, 1998.

Facchini et al, Plant Cell Rep., 27(4) :719-727, 2008.

Fisinger et al., Nat. Prod. Commun., 2:249-253, 2007.

Frick et al, Metabolic Engin., 9:169-176, 2007.

Gesell et al, J. Biol. Chem., 284:24432-24442, 2009.

Griggs et al., Phytochemistry, 30:2513-2517, 1991.

Grill et al, "Viral vector expression of foreign proteins in plants." In: Plants as Factories for Protein Production, Eds. EE Hood & J A Howard, Kluwer Academic Publishers, 2002. Grobe et al, J. Biol. Chem., 284:24425-24431, 2009.

Grothe et al, J. Biol. Chem., 276:30717-30723, 2001.

Gruber & Crosby, "Vectors for plant transformation." In: Methods in Plant Molecular Biology and Biotechnology, Eds. BR Glick & Thompson JE. CRC Press, 1993.

Gutman and Hatfield, Proc. Natl. Acad. Sci. USA, 86:3699-3703, 1989.

Hagel et al, In: Biotechnology in Agriculture and Forestry: Tropical Crops II, Pua and Davey (Eds), Springer- Verlag, 169-187, 2007.

Hagel et al, Plant Physiol, 147:1805-1821, 2008.

Hashimoto et al, J. Biol. Chem., 266:4648-4653, 1991.

Hatfield and Roth, Biotechnol. Ann. Rev., 13:27-42, 2007.

Hausinger, Crit. Rev. Biochem. Mol, 39:21-68, 2004.

Hawkins and Smolke, Nat. Chem. Biol, 4:564-573, 2008.

Hileman et al, Plant J., 44:334-341 , 2005.

Ikeda, Applied Microbiol Biotech., 69:615-26, 2006.

Ikezawa et al, J. Biol. Chem., 283:8810-8821 , 2008.

Intl. Narcotics Control Board. Narcotic drugs: estimated world requirements for 2009

(Statistics for 2007), United Nations Publications, 2008.

Ishida et al, Drug Metab. Dispos., 19:895-899, 1991.

Johnson et al, IN: Biotechnology And Pharmacy, Pezzuto et al, (Eds.), Chapman and Hall, New York, 1993.

Kaminaga et al, J. Biolog. Chem., 281 :23357-66, 2006.

Keasling, ACS Chem. Biol, 3:64-76, 2008.

Kimchi-Sarfaty et al, Science, 315:525-8, 2007. omar et al, FEBS Letters, 462:387-91, 1999.

yte and Doolittle, J. Mol Biol, 157(1):105-132, 1982.

Laemmli, Nature, 227:680-685, 1970.

Larkin et al., Plant BiotechnoL J, 5:26-37, 2007.

Lenz and Zenk, Eur. J. Biochem., 233:132-139, 1995.

Leonard et al., Nat. Chem. Biol, 5:292-300, 2009.

Leonard et al, Trends Biotech., 26:674-681, 2008.

Levenson et al, Human Gene Therapy, 9:1233-1236, 1998.

Liscombe et al, Phytochemistry, 66:1374-1393, 2005.

Liscombe et al, Plant J., 2009 [Epub ahead of print.]

Lister et al, FEMS Microbiol. Lett., 181 :137-144, 1999.

Liu et al, Plant J., 30:415^*29, 2002.

Livak and Schmittgen, Methods, 25:402-408, 2001.

Louie et al, Biochemistry, 42:7509-17, 2003.

Lutke-Eversloh and Stephanopoulos, Applied Microbiol. Biotech., 75:103-10, 2007.

Luttik et al, Metabolic Engin., 10:141-53, 2008.

Macejak and Sarnow, Nature, 353:90-94, 1991.

Martin et al, Chem, Biol, 16:277-286, 2009.

Merrifield, Science, 232(4748):341-347 1986.

Meunier and Meunier, J. Biol Chem., 260:10576-10582, 1985.

Meunier et al, Chem. Rev., 104:3947-3980, 2004.

Mikus et al. , Xenobiotica, 21 :1.501 -1509, 1991.

Millgate et al, Nature, 431 :413-414, 2004.

Minami et al, J. Biol. Chem., 282:6274-6282, 2007.

Minami et al, Proc. Natl. Acad. Sci. USA, 105:7393-7398, 2008.

Muntendam et al, Appl Microbiol. BiotechnoL, 84(6): 1003-19, 2009.

Newman et al, BiotechnoL Bio engineering, 95:684-691 , 2006.

Nielsen et al, Planta Med., 48:205-206, 1983.

Nyman, Hereditas, 89:43-50, 1978.

Olson et al, Applied Microbiol. Biotech., 74:1031-40, 2007..

Oscarson et al, Mol. Pharmacol, 52:1034-1040, 1997.

Page, Comput. Appl. Biosci., 12:357-358, 1996.

Parker et al, J. Am. Chem. Soc, 94: 1276-1282, 1972.

Patnaik et al, BiotechnoL Bioengin., 99:741-52, 2008. PCT Appln. WO/2005/107436

Pelletier and Sonenberg, Nature, 334:320-325, 1988.

Picataggio, Curr. Opin. Biotech., 19:325-329, 2009.

Raith et aL, J. Am. Soc. Mass Spectrom., 14:1262-1269, 2003.

Ro et al., BMC Biotechnol, 8:83, 2008.

Ro et aL, Nature, 440:940-943, 2006.

Runguphan and O'Connor, Nature Chemical Biol., 5: 151 -153, 2009.

Runguphan et aL, Proc. Natl. Acad. Sci. USA, 106:13673-13678, 2009.

Saeed et a , Biotechniques, 34:374-378, 2003.

Samanani et al., Plant J., 40:302-313, 2004.

Sambrook et aL, In:Molecular Cloning: A Laboratory Manual, Vol. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (7)7: 19- 17.29, 1989.

Santos and Stephanopoulos, Curr. Opin. Chem. Biol., 12:168-176, 2008.

Schmidt et aL, Phytochemistry, 68: 189-202, 2007.

Shi and Whetstine, Mol. Cell, 25:1-14, 2009.

Shibasaki et al., Tetrahedron Lett., 40:5227-5230, 1999.

Smith, Arch. Neurol., 55(8):1061-1064, 1998 .

Sprenger, Applied Microbiol. Biotech., 75:739-49, 2007.

Stewart and Young, In: Solid Phase Peptide Synthesis, 2^nd Ed., Pierce Chemical Co., 1984. Sundheim, et aL, DNA Repair, 7:1916-1923, 2008.

Tam et a , J. Am. Chem. Soc, 105:6442, 1983.

Tiainen et al., J. Biol. Chem., 280: 1142-1 148, 2005.

Turnbull et aL, J. Biol. Chem., 279:1206-1216, 2004.

Unterlinner et aL, Plant J, 18:465-475, 1999.

Usera and O'Connor, Curr. Opin. Chem. Biol., 13:485-491, 2009.

Vazquez-Flota et aL, Plant Mol. Biol., 34:935-948, 1997.

Wheeler et al., J. Am. Chem. Soc, 89:4494-4501, 1967.

Wilmouthc et aL, Structure, 10:93-103, 2002.

Yoshikuni et al., Chem. Biol., 15:607-618, 2008.

Zhu, Med. Sci. Monitor, 14:SC15-18, 2008.

Ziegler and Facchini, Ann. Rev. Plant Biol., 59:735-69, 2008.

Ziegler et aL, J. Biol. Chem., 25:84: 26758-26767, 2009.

Ziegler et aL, Plant J., 48:177-192, 2006.

Zulak et al., Planta, 225:1085-1 106, 2007.

Claims

1. An isolated thebaine 6-O-demethylase having at least 90% sequence homology to SEQ ID NO: l .

2. The isolated thebaine 6-O-demethylase of claim 1, wherein the thebaine 6-O- demethylase is fused to a non-demethylase peptide or polypeptide sequence.

3. The isolated thebaine 6-O-demethylase of claim 1, wherein the thebaine 6-O- demethylase has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID NO: 1.

4. The isolated thebaine 6-O-demethylase of claim 1, wherein the thebaine 6-O- demethylase comprises the sequence of SEQ ID NO: 1.

5. The isolated thebaine 6-O-demethylase of claim 1, wherein the thebaine 6-O- demethylase consists of the sequence of SEQ ID NO:l .

6. An isolated nucleic acid encoding a thebaine 6-O-demethylase having the sequence to SEQ ID NO:l .

7. The isolated nucleic acid of claim 6, wherein the nucleic acid has at least 70% sequence homology to SEQ ID NO:2.

8. The isolated nucleic acid of claim 6, wherein the nucleic acid has at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% sequence homology to SEQ ID NO:2.

9. The isolated nucleic acid of claim 6, wherein the nucleic acid comprises the sequence of SEQ ID NO:2.

10. The isolated nucleic acid of claim 6, wherein the nucleic acid consists of the sequence of SEQ ID NO:2.

11. An expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO:l .

12. The expression cassette of claim 11 , wherein the promoter is a plant promoter.

13. The expression cassette of claim 11 , wherein the promoter is a bacterial promoter.

14. The expression cassette of claim 11 , wherein the promoter is a yeast promoter.

15. The expression cassette of claim 1 1, further comprising a transcription termination signal.

16. A vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO:l .

17. The vector of claim 16, wherein the promoter is a plant promoter.

18. The vector of claim 16, wherein the promoter is a bacterial promoter.

19. The vector of claim 16, wherein the promoter is a yeast promoter.

20. The vector of claim 16, wherein the vector is a transposon, a yeast artificial chromosome or a bacterial plasmid.

21. A recombinant cell comprising an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO: 1.

22. The recombinant cell of claim 21, wherein the cell is a plant cell, a bacterial cell or a yeast cell.

23. The recombinant cell of claim 21, wherein the promoter is heterologous to a native Papaver somniferum thebaine 6-0-demethylase gene.

24. The recombinant cell of claim 21, wherein the expression cassette is comprised in a transposon, a yeast artificial chromosome, or a bacterial plasmid.

25. The recombinant cell of claim 21, wherein the recombinant cell further comprises a heterologous selectable marker.

26. A transgenic Papaver somniferum plant, cells of which comprise a thebaine 6-O- demethylase gene with a heterologous nucleic acid inserted therein.

27. The transgenic plant of claim 26, wherein said heterologous nucleic acid results in premature termination of transcription or translation of thebaine 6-<9-demethylase.

28. Seed of the plant of claim 26.

29. Progeny of the plant of claim 26.

30. Seed of the progeny plant of claim 29.

31. A transgenic Papaver somniferum plant, cells of which comprises a heterologous expression cassette that encodes a thebaine 6-6>-demethylase inhibitory sequence.

32. The transgenic plant of claim 31, wherein the inhibitory sequence is an antisense sequence or a siRNA.

33. Seed of the plant of claim 31.

34. Progeny of the plant of claim 31.

Seed of the progeny plant of claim 34.

36. A method of producing thebaine comprising culturing the plant of claims 26 or 31.

37. A method of producing oripavine comprising culturing the plant of claims 26 or 31.

38. A method of producing morphinone comprising (a) contacting oripavine with an isolated Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO:l .

39. The method of claim 38, further comprising (b) contacting morphinone produced in step (a) with a codeinone reductase to produce morphine.

40. A method of producing neopinone and codeinone comprising (a) contacting thebaine with an isolated Papaver somniferum thebaine 6-O-demethylase having 90% sequence homology to SEQ ID NO: 1.

41. The method of claim 40, further comprising (b) contacting neopinone/codeinone produced in step (a) with a codeinone reductase to produce codeine.

42. A system comprising:

(a) a bacterial cell comprising a Papaver somniferum thebaine 6-O-demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O- demethylase; and

(b) a medium-containing vessel suitable for culturing the bacterial cell.

43. A system comprising:

(a) a yeast cell comprising a Papaver somniferum thebaine 6-O-demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O- demethylase; and

(b) a medium-containing vessel suitable for culturing the yeast cell.

44. A method for the recombinant production of an opiate comprising: (a) providing a bacterial cell comprising a Papaver somniferum thebaine 6-0- demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O-demethylase; and

(b) culturing the bacterial cell under conditions supporting the production of one or more opiates.

45. A method for the recombinant production of an opiate comprising:

(a) providing a yeast cell comprising a Papaver somniferum thebaine 6-0- demethylase, a Papaver somniferum codeinone reductase and a Papaver somniferum codeine O-demethylase; and

(b) culturing the yeast cell under conditions supporting the production of one or more opiates.

46. An isolated nucleic acid encoding a thebaine 6-O-demethylase that hybridizes under medium stringency conditions to SEQ ID NO:2.

47. The isolated nucleic acid of claim 46, wherein the nucleic acid hybridizes under high stringency conditions to SEQ ID NO:2.

48. The isolated nucleic acid of claim 46, wherein the nucleic acid encodes SEQ ID NO: 1.

49. An isolated nucleic acid encoding a thebaine 6-0-demethylase that has at least 90% sequence homology to to SEQ ID NO:2.

50. The isolated nucleic acid of claim 49, wherein the nucleic acid has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:2.

51. An oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:2.

52. The oligonucleotide of claim 51, wherein said oligonucleotide is 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length.

53. The oligonucleotide of claim 51, wherein said oligocomprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:2.

54. The oligonucleotide of claim 51 , wherein said oligonucleotide is RNA or DNA.

55. The oligonucleotide of claim 51 , wherein said oligonucleotide comprises at least one modified base.

56. The oligonucleotide of claim 55, wherein said modified base has comprises a 2'-0- methyl or 2'-fluoro modification.

57. The oligonucleotide of claim 51, wherein said oligonucleotide comprises a detectable marker.

58. The oligonucleotide of claim 57, wherein said detectable marker is sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic.

59. The oligonucleotide of claim 51, wherein said oligonucleotide comprises a non-Papaver sequence.

60. The oligonucleotide of claim 51 , wherein said oligonucleotide is single-stranded.

61. An isolated codeine (9-demethylase having 90% sequence homology to SEQ ID NO:3.

62. The isolated codeine (9-demethylase of claim 61 , wherein the codeine (9-demethylase is fused to a non-demethylase peptide or polypeptide sequence.

63. The isolated codeine (9-demethylase of claim 61, wherein the codeine (9-demethylase has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID NO:3.

64. The isolated codeine (9-demethylase of claim 61, wherein the codeine (9-demethylase comprises the sequence of SEQ ID NO:3.

65. The isolated codeine O-demethylase of claim 61 , wherein the codeine O-demethylase consists of the sequence of SEQ ID NO:3.

An isolated nucleic acid encoding a codeine O-demethylase having the sequence to SEQ ID NO:3.

67. The isolated nucleic acid of claim 66, wherein the nucleic acid has at least 70% sequence homology to SEQ ID NO:4.

68. The isolated nucleic acid of claim 66, wherein the nucleic acid has at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% sequence homology to SEQ ID NO:4.

69. The isolated nucleic acid of claim 66, wherein the nucleic acid comprises the sequence of SEQ ID NO:4.

70. The isolated nucleic acid of claim 66, wherein the nucleic acid consists of the sequence of SEQ ID NO:4.

71. An expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID ΝΟ:3.

72. The expression cassette of claim 71, wherein the promoter is a plant promoter.

73. The expression cassette of claim 71 , wherein the promoter is a bacterial promoter.

74. The expression cassette of claim 71 , wherein the promoter is a yeast promoter.

75. The expression cassette of claim 71, further comprising a transcription termination signal.

76. A vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID NO:3.

77. The vector of claim 76, wherein the promoter is a plant promoter.

78. The vector of claim 76, wherein the promoter is a bacterial promoter.

79. The vector of claim 76, wherein the promoter is a yeast promoter.

80. The vector of claim 76, wherein the vector is a transposon, a yeast artificial chromosome or a bacterial plasmid.

81. A recombinant cell comprising an expression cassette, comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID NO:3.

82. The recombinant cell of claim 81, wherein the cell is a plant cell, a bacterial cell or a yeast cell.

83. The recombinant cell of claim 81 , wherein the promoter is heterologous to a native Papaver somniferum codeine 0-demefhylase gene.

84. The recombinant cell of claim 81, wherein the expression cassette is comprised in a transposon, a yeast artificial chromosome, or a bacterial plasmid.

85. The recombinant cell of claim 81, wherein the cell further comprises a heterologous selectable marker.

86. A transgenic Papaver somniferum plant, cells of which comprise a codeine O- demethylase gene with a heterologous nucleic acid inserted therein.

87. The transgenic plant of claim 86, wherein said heterologous nucleic acid results in premature termination of transcription or translation of codeine ( -demethylase.

88. Seed of the plant of claim 86.

89. Progeny of the plant of claim 86.

90. Seed of the progeny plant of claim 89.

91. A transgenic Papaver somniferum plant, cells of which comprises a heterologous expression cassette the encodes an codeine Odemethylase inhibitory sequence.

92. The transgenic plant of claim 91, wherein the inhibitory sequence is an antisense sequence or an siRNA.

93. Seed of the plant of claim 91.

94. Progeny of the plant of claim 91.

95. Seed of the progeny plant of claim 94.

96. A method of producing thebaine comprising culturing the plant of claims 86 or 91.

97. A method of producing codeine comprising culturing the plant of claims 86 or 91.

98. A method of producing oripavine comprising (a) contacting thebaine with an isolated Papaver somniferum codeine < -demethylase having 90% sequence homology to SEQ ID NO:3.

99. The method of claim 98, further comprising (b) contacting oripavine produced in step (a) with a thebaine 6-O-demethylase to produce morphinone.

100. A method of producing morphine comprising contacting codeine with an isolated Papaver somniferum codeine O-demethylase having 90% sequence homology to SEQ ID NO:3.

101. An isolated nucleic acid encoding a codeine O-demethylase that hybridizes under medium stringency conditions to SEQ ID NO:4.

102. The isolated nucleic acid of claim 101, wherein the nucleic acid hybridizes under high stringency conditions to SEQ ID NO:4.

103. The isolated nucleic acid of claim 101, wherein the nucleic acid encodes SEQ ID NO:3.

104. An isolated nucleic acid encoding a codeine O-demethylase that has at least 90% sequence homology to to SEQ ID NO:4.

105. The isolated nucleic acid of claim 104, wherein the nucleic acid has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:4.

106. An oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:4.

107. The oligonucleotide of claim 106, wherein said oligonucleotide is 15, 16, 17, 18, 1 , 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length.

108. The oligonucleotide of claim 106, wherein said oligocomprises 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:4.

109. The oligonucleotide of claim 106, wherein said oligonucleotide is RNA or DNA.

110. The oligonucleotide of claim 106, wherein said oligonucleotide comprises at least one modified base.

11 1. The oligonucleotide of claim 110, wherein said modified base has comprises a 2'-0- methyl or 2'-fluoro modification.

1 12. The oligonucleotide of claim 106, wherein said oligonucleotide comprises a detectable marker.

113. The oligonucleotide of claim 112, wherein said detectable marker is sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic.

114. The oligonucleotide of claim 106, wherein said oligonucleotide comprises a non- Papaver sequence.

115. The oligonucleotide of claim 106, wherein said oligonucleotide is single-stranded.

116. An isolated protoberberine 10 (9-demethylase having 90% sequence homology to SEQ ID NO:25.

117. The isolated protoberberine 10 O-demethylase of claim 116, wherein the P10 O- demethylase is fused to a non-demethylase peptide or polypeptide sequence.

118. The isolated protoberberine 10 O-demethylase of claim 116, wherein the P10 O- demethylase has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to SEQ ID NO:25.

1 19. The isolated protoberberine 10 ( -demethylase of claim 116, wherein the P10 O- demethylase comprises the sequence of SEQ ID NO:25.

120. The isolated protoberberine 10 O-demethylase of claim 1 16, wherein the P10 O- demethylase consists of the sequence of SEQ ID NO:25.

121. An isolated nucleic acid encoding a protoberberine 10 O-demethylase having the sequence to SEQ ID NO:25.

122. The isolated nucleic acid of claim 121 , wherein the nucleic acid has at least 70% sequence homology to SEQ ID NO:26.

123. The isolated nucleic acid of claim 121, wherein the nucleic acid has at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% sequence homology to SEQ ID NO:26.

124. The isolated nucleic acid of claim 121, wherein the nucleic acid comprises the sequence of SEQ ID NO:26.

125. The isolated nucleic acid of claim 121, wherein the nucleic acid consists of the sequence of SEQ ID NO:26.

126. An expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 0-demethylase having 90% sequence homology to SEQ ID NO :25.

127. The expression cassette of claim 126, wherein the promoter is a plant promoter.

128. The expression cassette of claim 126, wherein the promoter is a bacterial promoter.

129. The expression cassette of claim 126, wherein the promoter is a yeast promoter.

130. The expression cassette of claim 126, further comprising a transcription termination signal.

131. A vector comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 O-demethylase having 90% sequence homology to SEQ ID NO:25.

132. The vector of claim 131 , wherein the promoter is a plant promoter.

133. The vector of claim 131, wherein the promoter is a bacterial promoter.

134. The vector of claim 131, wherein the promoter is a yeast promoter.

135. The vector of claim 131, wherein the vector is a transposon, a yeast artificial chromosome or a bacterial plasmid.

136. A recombinant cell comprising an expression cassette comprising a promoter operably linked to a nucleic acid encoding a Papaver somniferum protoberberine 10 O- demethylase having 90% sequence homology to SEQ ID NO:25.

137. ' The recombinant cell of claim 136, wherein the cell is a plant cell, a bacterial cell or a yeast cell.

138. The recombinant cell of claim 136, wherein the promoter is heterologous to a native Papaver somniferum protoberberine 10 O-demethylase gene.

139. The recombinant cell of claim 136, wherein the expression cassette is comprised in a transposon, a yeast artificial chromosome, or a bacterial plasmid.

140. The recombinant cell of claim 136, wherein the cell further comprises a heterologous selectable marker.

141. A transgenic Papaver somniferum plant, cells of which comprise a protoberberine 10 O- demethylase gene with a heterologous nucleic acid inserted therein.

142. The transgenic plant of claim 141 , wherein said heterologous nucleic acid results in premature termination of transcription or translation of protoberberine 10 O- demethylase.

143. Seed of the plant of claim 141.

144. Progeny of the plant of claim 141.

145. Seed of the progeny plant of claim 144.

146. A transgenic Papaver somniferum plant, cells of which comprises a heterologous expression cassette the encodes a protoberberine 10 O-demethylase inhibitory sequence.

147. The transgenic plant of claim 146, wherein the inhibitory sequence is an antisense sequence or an siRNA.

148. Seed of the plant of claim 146.

149. Progeny of the plant of claim 146.

150. Seed of the progeny plant of claim 149.

151. An isolated nucleic acid encoding a protoberberine 10 (9-demethylase that hybridizes under medium stringency conditions to SEQ ID NO:26.

152. The isolated nucleic acid of claim 151, wherein the nucleic acid hybridizes under high stringency conditions to SEQ ID NO:26.

153. The isolated nucleic acid of claim 151, wherein the nucleic acid encodes SEQ ID NO:26.

154. An isolated nucleic acid encoding a protoberberine 10 O-demethylase that has at least 90% sequence homology to to SEQ ID NO:26.

155. The isolated nucleic acid of claim 154, wherein the nucleic acid has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to SEQ ID NO:26.

156. An oligonucleotide of 15 to 100 bases and comprising at least 15 contiguous bases of SEQ ID NO:26.

157. The oligonucleotide of claim 156, wherein said oligonucleotide is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 bases in length.

158. The oligonucleotide of claim 156, wherein said oligo comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 contiguous bases of SEQ ID NO:26.

159. The oligonucleotide of claim 156, wherein said oligonucleotide is RNA or DNA.

160. The oligonucleotide of claim 156, wherein said oligonucleotide comprises at least one modified base.

161. The oligonucleotide of claim 160, wherein said modified base has comprises a 2'-0- methyl or 2'-fluoro modification.

162. The oligonucleotide of claim 156, wherein said oligonucleotide comprises a detectable marker.

163. The oligonucleotide of claim 162, wherein said detectable marker is sequential, radioactive, chemilluminescent, fluorescent, magnetic, colorimetric or enzymatic.

164. The oligonucleotide of claim 156, wherein said oligonucleotide comprises a non- Papaver sequence.

165. The oligonucleotide of claim 156, wherein said oligonucleotide is single-stranded.