WO2018008902A1 - 건선 유발 동물 모델 및 이의 용도 - Google Patents
건선 유발 동물 모델 및 이의 용도 Download PDFInfo
- Publication number
- WO2018008902A1 WO2018008902A1 PCT/KR2017/006962 KR2017006962W WO2018008902A1 WO 2018008902 A1 WO2018008902 A1 WO 2018008902A1 KR 2017006962 W KR2017006962 W KR 2017006962W WO 2018008902 A1 WO2018008902 A1 WO 2018008902A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peli1
- psoriasis
- protein
- peptide
- mice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/07—Tetrapeptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/10—Tetrapeptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
Definitions
- the present invention relates to a psoriasis-induced animal model and its use, and more particularly, to a psoriasis-induced animal model and its use transformed to overexpress Peli1 (Pellino homolog 1) gene upon administration of doxycycline.
- Psoriasis is a typical chronic skin disease that usually lasts for 10-20 years after onset and should live with the possibility of lifelong recurrence even if temporarily improved due to treatment.
- Psoriasis is characterized by erythematous skin lesions covered with clear white-white scales, which occur mainly in the elbow, knee, hip, and scalp.
- psoriasis can develop many complications. Among them is psoriatic arthritis, a specific arthritis that occurs in psoriasis patients. There is no direct way to prevent such psoriasis, and the best way to prevent exacerbation is to prevent it.
- the number of patients diagnosed with psoriasis is about 3% in the world, about 1-2% in Korea, and about one third of them are severe psoriasis patients that are almost impossible to cure.
- 16,936 people in Korea were treated with psoriasis during 2013.
- T cells T cells
- cytokines secreted by T cells stimulate epidermal cells, causing excessive proliferation and inflammation of epidermal cells.
- Immunological abnormalities and mutations in genes are emerging as a major research area.
- environmental factors, drugs, persistent skin irritation, dry skin, upper respiratory tract inflammation, and mental stress have been shown to cause or worsen psoriasis.
- the present invention has been made to solve the above problems, the inventors have confirmed that the mice transformed to overexpress the Peli1 gene upon doxycycline administration can be used as an animal model for the treatment of severe psoriasis, Peli1 protein expression or activity inhibitors can prevent, ameliorate, inhibit or treat psoriasis by identifying the possibility of psoriasis induced by overexpression of Peli1 protein, and Peli1 peptide derived from Peli1 FHA domain that targets the FHA binding motif of matrix proteins By interfering with normal substrate binding of the protein, it was confirmed that it can be used as a new therapeutic agent, and based on this, the present invention was completed.
- an object of the present invention is to provide a psoriasis-induced animal model and a method for producing the psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene.
- Another object of the present invention to provide a method for screening a psoriasis treatment using the animal model.
- Peli1 is provided as a therapeutic target for the development of psoriasis treatment. .
- Another object of the present invention is to provide a pharmaceutical composition for preventing or treating psoriasis comprising a peptide and any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 as an active ingredient. It is.
- another object of the present invention is a Peli1 binding activity inhibitory peptide, characterized in that the cell-penetrating peptide and a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 is linked and It is to provide a pharmaceutical composition for preventing or treating psoriasis comprising Peli1 binding activity inhibitory peptide as an active ingredient.
- Another object of the present invention is to provide a psoriasis diagnostic composition comprising an agent for measuring the expression level of Peli1 protein.
- the present invention provides a psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene.
- the Peli1 gene may be overexpressed upon administration of doxycycline.
- the Peli1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.
- the present invention provides a method for producing a psoriasis-induced animal model comprising the following steps:
- the present invention also provides a method for screening a psoriasis treatment comprising the following steps:
- the present invention provides a pharmaceutical composition for preventing or treating psoriasis, comprising an inhibitor of Peli1 (Pellino homolog 1) protein expression or activity as an active ingredient.
- the Peli1 protein may be encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.
- the Peli1 protein may be composed of the amino acid sequence of SEQ ID NO: 2.
- the expression inhibitor of the Peli1 protein is antisense nucleotides, complementary binding to the mRNA of the Peli1 gene, short interfering RNA (short interfering RNA), short hairpin RNA (Short hairpin RNA) and ribozyme ( ribozyme) can be any one selected from the group consisting of.
- the activity inhibitor of the Peli1 protein is any one selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers and antibodies that complementarily bind the Peli1 protein. Can be.
- the present invention also provides a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11.
- the peptide may inhibit the binding of the Peli1 protein and the matrix protein.
- the present invention provides a Peli1 binding activity inhibitory peptide, characterized in that the cell permeable peptide and the peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 is linked.
- the Peli1 binding activity inhibitory peptide may be linked by GS linker.
- the cell permeable peptide is polyarginine (Polyarginines), Tat 49 -57 , Pentratratin (Penetratin), Pep-1, Transportan, NLS (Nuclear localization sequence) and HP4 It may be any one selected from the group consisting of.
- the present invention also provides a pharmaceutical composition for preventing or treating psoriasis, comprising the peptide or Peli1 binding activity inhibitory peptide as an active ingredient.
- the present invention also provides a method for treating psoriasis comprising administering the pharmaceutical composition to a subject.
- the present invention provides a psoriasis prevention or treatment of the pharmaceutical composition.
- the present invention also provides a novel use of the gene encoding Peli1 (Pellino homolog 1) protein for the production of a composition for treating psoriasis.
- the present invention also provides a composition for diagnosing psoriasis comprising an agent for measuring the expression level of Peli1 protein.
- the present invention also provides a method for detecting Peli1 protein from a subject's sample in order to provide the information needed to diagnose psoriasis.
- the present invention also provides a diagnostic use of psoriasis of the Peli1 protein.
- the transgenic animal model according to the present invention was found to overexpress the Peli1 (Pellino homolog 1) gene following administration of doxycycline, and showed similarity with the phenotype seen in psoriasis patients. For this purpose, it is possible to design animal models and be useful for clinical research such as screening candidate drugs for psoriasis treatment.
- Peli1 FHA domain targeting the FHA binding motif that interferes with the normal substrate binding of the substrate protein and Peli1 protein The derived peptide is expected to be useful for the development of new drugs for psoriasis-related diseases.
- Peli1 protein by confirming the expression level of the Peli1 protein, it is expected that it can be usefully used to evaluate the disease level of psoriasis patients.
- Figure 1a is a schematic diagram showing the manufacturing process of the Delicycline inducible Peli1 transgenic mice Peli1 overexpression according to doxycycline administration.
- Figure 1b is a result confirmed by PCR whether or not transformed to overexpress Peli1 upon doxycycline administration.
- Figure 2 shows the results confirmed by Western blotting Peli1 protein expression in each tissue of Peli1 induced expression mice following doxycycline administration.
- Figure 3a is a visual comparison of spontaneous lesion induction following doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- FIG. 3B is a result of calculating the ratio of mice in which the phenotype as shown in FIG. 3A is shown.
- Figure 3c is the result of scoring the lesion level according to doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 4a is a result of comparing the structure of the skin layer through H & E staining to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Peli1 antibody and Psoriasin antibody which is a psoriasis disease marker protein, to identify cells inducing overexpression of Peli1 following doxycycline administration in induced Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). Is the result.
- Figure 4c is to determine whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA), K14 in the base layer, K10 in the polar layer, Loricrin in the granule layer Immunostaining was performed using an antibody against the skin layer to compare developmental changes.
- Figure 4d shows the proliferation capacity of the basal layer cells by immunostaining using antibodies against Ki67 and K14 to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA) Is the result of comparing.
- Figure 4e is a result of comparing the changes in angiogenesis by immunostaining using CD31 antibody in order to determine whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- FIG. 4F is a comparison of T cell invasion changes by immunostaining using CD3 antibody to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). to be.
- Figure 4g and 4h is a result of comparing the lymph node changes around the skin lesion to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 4i is a result of comparing the activation of immune cells in lymph nodes using flow cytometry to verify whether peliosis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- 4J and 4K are graphs of the results of FIG. 4I.
- FIG. 4L compares the percentage of T cells activated in the results of FIG. 4I according to doxycycline administration.
- FIG. 5A illustrates IFN ⁇ , IL-4, and IL- using cDNA of CD3 + T cells in lymph nodes to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). 22, cytokine levels such as IL-23 using a quantitative reverse transcriptase chain reaction.
- 5b is a result of immunostaining using an antibody against IL-17 to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 5c is the result of immunostaining using an antibody against IL-23 to verify whether peliosis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 6a is a visual comparison of the spontaneous lesion induction following doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 6b is a result of scoring the lesion level according to doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- Figure 6c is a result of comparing the structure of the skin layer through H & E staining to verify whether psoriasis induced by doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- FIG. 7A is a schematic diagram of applying an imiquimod induced psoriasis model to normal mice (WT) and Peli1 expression inhibiting mice (Peli1 KO) to confirm whether psoriasis induction is inhibited when expression of Peli1 protein is inhibited.
- Figure 7c is the result of scoring the level of psoriasis lesions following imiquimod treatment in normal mice (WT) and Peli1 expression inhibited mice (Peli1 KO).
- Figure 7d is a graph showing the result of measuring the thickness of the skin according to the imiquimod treatment in normal mice (WT) and Peli1 expression suppression mice (Peli1 KO).
- Figure 7e is a result of comparing the structure of the skin layer through H & E staining to verify the level of psoriasis lesions after four treatments of imiquimod in normal mice (WT) and Peli1 expression inhibiting mice (Peli1 KO).
- FIG. 8A shows doxycycline for 12 weeks in Peli1 induced expressing mice (rtTA-Peli1) and control mice (rtTA) for validation as a preclinical animal model for evaluating drug efficacy of Peli1 induced expressing mice (rtTA-Peli1).
- FIG. 8B shows psoriasis lesions after intraperitoneal injection of cyclosporine (CsA) and mesotrexate (MTX) for 12 weeks after doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
- CsA cyclosporine
- MTX mesotrexate
- 8c shows psoriasis lesions after 12 weeks of doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA) after intraperitoneal injection of the immunosuppressive cyclosporine (CsA) and mesotrexate (MTX) This is the result of scoring the level of.
- FIG. 8D shows the skin after intraperitoneal injection of cyclosporine (CsA) and mesotrexate (MTX), which are immunosuppressive agents, for 12 weeks after doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). It is the result which measured and measured by thickness.
- CsA cyclosporine
- MTX mesotrexate
- Figure 9a schematically shows the process of identifying the target mRNA sequence and producing shRNA for it to inhibit the synthesis of protein in Peli1 mRNA.
- Figure 9b is a result of Western blot to confirm whether the expression of the Peli1 protein is inhibited by injecting the shRNA produced through the 7a into the cell.
- FIG. 10 schematically shows the preparation of a peptide that inhibits the binding activity of Peli1 and the process by which the peptide inhibits the binding activity of Peli1.
- Figure 11a schematically shows the manufacturing process of peptides that inhibit the binding activity of Peli1.
- Figure 11b is a result of confirming the cell penetration of the peptide inhibiting the binding activity of Peli1 bound to the cell permeation enhancement peptide to increase the cell penetration through fluorescence staining.
- Figure 11c is a result of comparing the toll-like receptor (TLR) signaling activation after treatment with Peli1 binding activity inhibitory peptide by Western blotting.
- TLR toll-like receptor
- the present inventors studied to develop an animal model suitable for use in the research and development of psoriasis treatments, and confirmed that the mice transformed with the Peli1 gene overexpression following doxycycline administration showed similarity to the phenotype seen in psoriasis patients. Based on this, the present invention has been completed.
- the present invention provides a psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene upon administration of doxycycline.
- the present invention also provides a method for preparing a psoriasis-induced animal model, comprising the following steps:
- Peli1 (pellino homolog 1) gene of the present invention means a gene encoding the pellino homolog 1 protein known as E3 ubiquitin zygotease, which is present on chromosome 2 in humans, and chromosome 11 in mice.
- E3 ubiquitin zygotease E3 ubiquitin zygotease
- chromosome 2 chromosome 2 in humans
- chromosome 11 chromosome 11 in mice.
- NCBI NCBI Reference Sequence: NP_065702, NM_020651
- the polynucleotide of SEQ ID NO: 1 was used as the Peli1 gene.
- the animal may be a mouse, a rat, a cow, a horse, a pig, a monkey, a duck, a dog, a cat, or the like, and is preferably a mouse, but is not limited thereto.
- a transgenic animal model in which the Peli1 gene is overexpressed according to administration of doxycycline (see Example 1), and verified whether the spontaneous lesion induction by doxycycline administration in the animal model, the control group Compared to the continuous administration of doxycycline it was confirmed that the lesion appears spontaneously. In particular, it was confirmed that the gloss of hair disappeared, hair loss progressed, and abnormal findings of the skin appeared (see Example 4).
- CsA cyclosporin
- MTX mesotrexate
- the animal model according to the present invention can be usefully used for the treatment and research of psoriasis.
- the present invention provides a method for screening a psoriasis therapeutic agent using the animal model produced by the above method.
- the screening method comprises the steps of: a) treating a candidate material with the animal model; And b) identifying the prognosis while breeding the animal model treated with the candidate substance, wherein the candidate substance is a natural compound, a synthetic compound, RNA, DNA, polypeptide, enzyme, protein, ligand, antibody, antigen. Is preferably any one selected from the group consisting of bacterial or fungal metabolites and bioactive molecules, but is not limited thereto.
- Peli1 protein expression or activity inhibitors can be used as an active ingredient of a composition useful for preventing, improving, inhibiting or treating psoriasis .
- the present invention provides a pharmaceutical composition for preventing or treating psoriasis and a method for treating psoriasis using the same, comprising an inhibitor of the expression or activity of Peli1 (Pellino homolog 1) protein as an active ingredient.
- the Peli1 protein in the present invention may be composed of the amino acid sequence of SEQ ID NO: 2.
- prevention means any action that inhibits psoriasis or delays the onset by administration of a pharmaceutical composition according to the invention.
- treatment means any action that improves or advantageously changes the symptoms of psoriasis by the administration of the pharmaceutical composition according to the present invention.
- the expression inhibitor of Peli1 protein may be selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and ribozymes that complementarily bind to mRNA of Peli1 gene, but are not limited thereto.
- the activity inhibitor of Peli1 protein is preferably made by any one selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that complementarily bind the Peli1 protein. It is not limited to, and any drug that inhibits Peli1 protein activity may be used.
- Peptide Mimetics is to inhibit the activity of Peli1 protein by inhibiting the binding domain of the Peli1 protein
- the peptide mimetics may be peptide or non-peptide, such as psi binding, It may also consist of amino acids bound by non-peptide bonds.
- aptamer is a single-chain DNA or RNA molecule, specific chemical or biological molecule by an evolutionary method using an oligonucleotide library called systemic evolution of ligands by exponential enrichment (SELEX). It can be obtained by separating the oligomers having high affinity and selectivity for binding. Aptamers can specifically bind to targets and modulate the activity of the targets, such as by blocking the ability of the targets to function through binding.
- the "antibody” may specifically and directly bind to Peli1 protein, thereby effectively inhibiting the activity of Peli1 protein.
- the antibody specifically binding to the Peli1 protein it is preferable to use a polyclonal antibody or a monoclonal antibody.
- Antibodies that specifically bind to the Peli1 protein may be prepared by known methods known to those skilled in the art, and commercially known Peli1 protein antibodies may be purchased and used.
- the Peli1 protein acts as an E3 ubiquitin conjugatease by having a RING-like domain.
- the Peli1 protein is activated through various posttranslational modification of proteins, acting as an E3 ubiquitin conjugation enzyme, and binding to the target protein through the FHA domain.
- peptides derived from Peli1 FHA domain that target the FHA binding motif of substrate proteins can be used as novel therapeutics by interfering with normal substrate binding of Peli1 proteins.
- the present invention provides a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NOs: 5 to 11 and a pharmaceutical composition for preventing or treating psoriasis comprising the peptide. .
- the peptide may inhibit binding of Peli1 protein and substrate protein by targeting the FHA binding motif, and the peptide may also be a cell-penetrating peptide for facilitating intracellular penetration. May be connected.
- the cell-penetrating peptide may be any one selected from the group consisting of Polyarginines, Tat49-57, Penetratin, Pep-1, Transportan, Nuclear localization sequence and HP4, preferably HP4, It is not limited.
- gDNA genomic DNA
- PCR polymerase chain reaction
- TetO & Peli1 using gDNA as a template, four times of TetO & Peli1 were performed at 95 ° C 30 seconds, 55 ° C 30 seconds, and 72 ° C for 1 minute, followed by 95 ° C 30 seconds, 58 ° C 1 minute, 72 A total of 34 RT-PCRs were performed at 1 ° C.
- R26 and rtTA PCR was performed a total of 34 times at 95 ° C 30 seconds, 65 ° C 1 minute, and 72 ° C 1 minute, and specific sequences of the primers used were as follows:
- TetO & Peli1 primer sequences forward primer (cmv TetO-1) 5'-AAG TGA AAG TCG AGC TCG-3 '(SEQ ID NO: 12), reverse primer (Peli1 1/3 length) 5'-TGA TAT CGT GTG CTG GTC TTT G -3 '(SEQ ID NO: 13)
- R26 & rtTA primer sequences (1) normal mouse (WT)-R26 (F) and R26 (R); Forward primer 5'- AAA GTC GCT CTG AGT TGT TAT-3 '(SEQ ID NO: 14), reverse primer 5'- GGA GCG GGA GAA ATG GAT ATG -3' (SEQ ID NO: 15) (2) Transgenic Mouse (Tg) R26 (F) and rtTA (R); Forward primer 5'- AAA GTC GCT CTG AGT TGT TAT -3 '(SEQ ID NO: 16), reverse primer 5'- GCG AAG AGT TTG TCC TCA ACC -3' (SEQ ID NO: 17)
- Lysis buffer 150 mM NaCl, 20 mM HEPES, 5 mM EDTA, 0.5% Nonidet P-40, 1 mM phenylmethanesulfonyl fluoride, 10 mM NaF, 1 mM Na 3 Vo 4 , 1 mM dithiothreitol, and Protease inhibitor cocktail
- a homogenizer 14,000 rpm, 30min, 4 °C. After obtaining the extract of the supernatant, the protein was quantified by Bradford quantitation method.
- TBS-T buffer 100Mm NaCl, 20Mm Tris-HCl pH7.4, 0.05% Tween-20
- transfer using nitrocellulose membraine
- 5% skin milk After blocking with anti-Myc (Roche; 1: 2,000 dilution), anti-Peli1 (Santa Cruz; 1: 2,000 dilution) or anti- in 3% BSA (containing a solution of TBS-T) HRP-attached secondary antibody after ⁇ -actin (Sigma; 1: 4,000 dilution) antibody was reacted at 4 ° C.
- Tissues of the mice were fixed with 10% neutral buffered formalin and paraffin blocks were prepared. Sections of 3 ⁇ m thickness were obtained from the paraffin block, followed by hematoxylin & eosin (H & E) staining. In the case of immunohistochemistry, staining was performed using anti-K14 antibody, anti-Ki67 antibody, anti-CD31 antibody, and anti-CD3 antibody, and then stained and encapsulated using an encapsulant containing DAPI reagent. Stained tissue samples were stained using a microscope [AxioCam digital microscope camera and AxioVision image processing software (Carl Zeiss)].
- a transgenic animal model in which the Peli1 (Pellino homolog 1) gene is overexpressed upon administration of doxycycline was prepared as follows, and a schematic diagram of the manufacturing method is shown in FIG. 1A.
- transgenic mice were prepared by microinjecting a vector cloned with the human Peli1 gene tagged Myc epitope (see FIG. 1A) into a 1-cell embryo. After microinjection, TetO (tetracycline-responsive element) Myc-Peli1 transgenic mice were selected through the genotyping method described in Example 1-2. Selected mice were crossed with a reverse tetracycline transactivator (R26-rtTA) mouse to obtain a doxycycline inducible TetO-Myc-Peli1 transgenic mice, and the transformation of the polymerase chain reaction described in Example 1-2 above was performed. It was confirmed through (polymerase chain reaction, PCR).
- R26-rtTA reverse tetracycline transactivator
- mice Intestine, Epidymis, Colon, Kidney, Skin, Testis, Prostate, Pancreas, Liver, Spleen, Lymph Node ( The expression of Myc-Peli1 in Lymphnodes, Bone marrow was confirmed by Western blotting described in Examples 1-3 above.
- the lung, thymus, stomach, epididymis, colon, kidney, prostate pancreas, liver It was confirmed that the expression of Myc-Peli1 was high in the liver, spleen, lymph nodes, bone marrow, and the like.
- doxycycline (2mg / ml) was administered to drinking water (Drinking water) for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, and then the lesions were visually confirmed.
- rtTA control mice
- rtTA-Peli1 experimental mice
- the lesions were visually confirmed.
- Figure 3a it was confirmed that the lesion appears spontaneously when doxycycline is continuously administered to Peli1 induced expression mice (rtTA-Peli1).
- the gloss of hair disappeared, hair loss progressed, and abnormal skin was observed.
- doxycycline was administered to control (rtTA) mice and experimental (rtTA-Peli1) mice for 24 weeks, followed by scoring phenotypic changes which were scored based on the criteria described in Table 1 below. As a result, as shown in Figure 3c, it was confirmed that the score continues to increase along the doxycycline administration period.
- doxycycline (2mg / ml) was administered to drinking and drinking water for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, followed by hematoxylin & eosin (Example 1-5).
- H & E confirmed the structure of the skin layer by staining.
- the normal skin layer was formed in the control (rtTA) mice, while abnormal lesions were observed in the experimental group (rtTA-Peli1) mice.
- the layers of epidermal cells are greatly increased, as well as Parakeratosis, Hyperkeratosis, Rete ridge, and microabscess, which are commonly found in the skin layer structure of psoriasis patients. Phenotype of was observed. From the above results, it was confirmed that the phenotype of psoriasis was observed in Peli1 induced expression mice.
- doxycycline (2mg / ml) was administered in drinking water for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, and then Peli1 antibody was used to confirm that Peli1 protein was overexpressed in the skin layer. Tissue immunostaining was performed.
- psoriasis is active infiltration of immune cells. Moreover, recent studies have shown that psoriasis is induced by abnormal activity of T cells, so that T cell infiltration is observed in the skin layer.
- lymph nodes around the skin lesion were confirmed. More specifically, the lymph nodes around the inguinal, axillary, brachial and cervical, which are located near the skin layer, are isolated and confirmed by H & E staining described in Example 1-5. It was. As a result, as shown in Figures 4g and 4h, it was confirmed that the lymph nodes that exist around the lesions in the experimental group (rtTA-Peli1) mice are larger than the control (rtTA) mice. In addition, it was confirmed that the lymph nodes turned black, which showed that the formation of sinus was abnormally increased by increasing the activity of immune cells.
- lymph nodes around the skin lesions were enlarged through the results of FIGS. 4G and 4H.
- the activation of immune cells in these lymph nodes was confirmed using the flow cytometry described in Example 1-4.
- FIG. 4I the results of FIG. 4I were analyzed.
- FIG. 4J the difference in the proportion of T cells constituting the lymph nodes could not be observed, but compared with the number of cells.
- rtTA-Peli1 not only the number of immune cells in total but also the number of CD3 + , CD4 + , and CD8 + T cells were significantly increased.
- cytokines such as IFN ⁇ , IL-4, IL-22, and IL-23 were compared using quantitative reverse transcriptase chain reaction using cDNA of CD3 + T cells of lymph nodes.
- FIG. 5A it was confirmed that IFN ⁇ , a cytokine secreted by type 1 helper T reaction, and IL-22 and IL-23, cytokines secreted by type 17 helper T reaction, were significantly increased.
- Examples 5-1 to 5-4 were used to compare the phenotype and similarity of psoriasis patients based on the analysis of various lesions in Peli1-induced mice (rtTA-Peli1). As a result, as shown in Table 2 below, it was confirmed that the phenotype of psoriasis patients and the phenotype of Peli1 induced expression mouse (rtTA-Peli1) according to the present invention are very similar.
- Psoriasis phenotype was analyzed when Peli1 expression was lowered to normal level by removing Doxycycline when control group (rtTA) and experimental group mice (rtTA-Peli1) showed a psoriasis phenotype after Doxycycline administration for a certain period of time. .
- rtTA-Peli1 Peli1-induced mice (rtTA-Peli1) showed a psoriasis phenotype when continuous Doxycycline was administered for 5 months, whereas psoriasis was removed after Doxycyline was administered for 3 months. The phenotype of disappeared and was confirmed to be similar to the control mouse (rtTA).
- control group (rtTA) mice and experimental group (rtTA-Peli1) mice were dosed with doxycycline for 12 weeks, and then scored for phenotypic changes appearing with doxycycline administration and removal. As a result, as shown in Figure 6b, it was confirmed that the score continues to increase and decrease along the period of doxycycline administration and removal.
- hematoxylin & eosin (H & E) staining described in Example 1-5 was performed.
- the layer of epidermal cells of Peli1-induced mice (rtTA-Peli1) is greatly increased according to the administration of Doxycycline, as well as the illusions commonly found in the skin layer structure of psoriasis patients. Phenotypes of Parakeratosis, Hyperkeratosis, Rete Ridge, and Microabscess were observed.
- Peli1 abnormally increased expression of Peli1 may lead to the development of psoriasis, and when the expression of Peli1 is lowered back to normal levels, the expression of Peli1 as a new psoriasis treatment target is confirmed. The possibility was confirmed.
- hematoxylin & eosin (H & E) staining described in Example 1-5 was performed.
- the skin thickness of the normal mouse (WT) increases with the treatment of imiquimod, but the skin thickness of the Peli1 expression inhibiting mouse (Peli1 KO) is less than that of the normal mouse. It was confirmed to increase.
- the depth of the epidermis (Rete ridge) was found to be shorter in the Peli1 expression inhibiting mouse (Peli1 KO) than in the normal mouse (WT). Hyperkeratosis was also observed in the Peli1 expression inhibiting mouse (Peli1 KO) in the normal mouse (WT). It confirmed that it was relaxed compared with.
- CsA cyclosporine
- MTX mesotrexate
- mesotrexate inhibits hyperdividing of epithelial cells, inducing apoptosis of active T cells, chemotaxis of neutrophils and secretion of specific cytokines.
- CsA cyclosporine
- MTX mesotrexate
- cyclosporine (CsA) was administered six times a week when a phenotype of psoriasis appeared through administration of Doxycycline for a period of time (12 weeks) in control mice (rtTA) and experimental mice (rtTA-Peli1).
- Mesotrexate (MTX) was administered four times a week by intraperitoneal injection, and then analyzed the phenotype of psoriasis, and hematoxylin & eosin (H & E) staining described in Example 1-5 was performed to confirm the structure of the skin layer. It was.
- cyclosporin the phenotype of Paratratosis, Hyperkeratosis, Rete ridge, and microabscess of Peli1-induced mice (rtTA-Peli1) is an immunosuppressive agent.
- rtTA-Peli1 Peli1-induced mice
- CsA cyclosporine
- rtTA control mice
- rtTA-Peli1 experimental mice
- MTX Mesotrexate
- Peli1-induced mice expressing psoriasis phenotype following Doxycycline administration confirmed the effectiveness of psoriasis treatment, and confirmed that the psoriasis disease phenotype is reduced.
- the potential as a preclinical animal model could be verified.
- Example 6 Based on the results of Example 6 confirmed the possibility of treatment of psoriasis disease by inhibiting the expression of Peli1 protein, in order to inhibit the synthesis of the protein in Peli1 mRNA to identify the target mRNA sequence (see Figure 9a), based on this As described below, shRNA and siRNA were prepared.
- Target mRNA sequence # 1 GGGTTCAACACACTAGCAT (SEQ ID NO: 3)
- Target mRNA sequence # 2 GCTCCTTTGGATATGCAATTT (SEQ ID NO: 4)
- the prepared shRNA was injected into the cells, and the expression of Peli1 protein was confirmed by Western blotting as described in Examples 1-3. As shown in FIG. 9B, shRNA targeting the mRNA of Peli1 was injected into the cells. When injected, it was confirmed that the expression of Peli1 protein was effectively suppressed.
- Peli1 is an E3 ubiquitin zygote, which acts as a zygote through a RING-like domain and binds to the target protein via the FHA domain.
- a peptide derived from the FHA domain of Peli1 protein was prepared.
- FHA domain-derived peptide sequence 95-114 SNTDMFQIGRSTESPIDFVV 101-116 QIGRSTESPIDFVVTD 109-124 PIDFVVTDTVPGSQSN 117-132 TVPGSQSNSDTQSVQS 125-140 SDTQSVQSTISRFACR 133-149 TISRFACRIICERNPP 177-196 DGQMDGLTTNGVLVMHPRNG
- cell permeation enhancing peptides Cell-penetrating peptides
- the cell permeation enhancing peptides used were as follows (see FIG. 10):
- a Peli1 binding activity inhibitory peptide of Peli1 was prepared using a GS linker sequence linking two peptides with HP4, a cell permeation enhancing peptide, as shown in FIG. 11A.
- the cell culture was treated with Peli1 binding activity inhibitory peptide, and then the cell penetration was confirmed by fluorescence staining.
- the transgenic animal model according to the present invention is expected to be useful for clinical studies such as screening candidate drugs for psoriasis treatment.
- Peli1 FHA domain-derived peptides targeting FHA binding motifs that interfere with normal matrix binding of matrix proteins and Peli1 proteins could be useful in the development of new drugs for psoriasis-related diseases.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Behavior & Ethology (AREA)
- Environmental Sciences (AREA)
- Biomedical Technology (AREA)
- General Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Biotechnology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 건선 유발 동물 모델 및 이의 용도에 관한 것으로서, 보다 구체적으로는 독시사이클린의 투여에 따라 Peli1 (Pellino homolog 1) 유전자를 과발현하도록 형질전환된 건선 유발 동물 모델 및 이의 용도에 관한 것이다. 본 발명에 따른 형질전환 동물 모델은 독시사이클린의 투여에 따라 Peli1(Pellino homolog 1) 유전자를 과발현되어 건선 환자에게서 나타나는 표현형과 유사성을 나타냄을 확인하였는바, 건선 치료를 위한 후보약물 스크리닝 등의 임상적 연구에 유용하게 사용될 수 있을 것으로 기대된다. 또한, 기질 단백질과 Peli1 단백질의 정상적 기질 결합을 방해하는 FHA 결합 모티브를 표적으로 하는 Peli1 FHA 도메인 유래 펩타이드를 통해 건선 관련 질병의 신약 개발에 유용하게 활용될 수 있을 것으로 기대되며, 이에 더하여, 상기 Peli1 단백질의 발현수준을 확인함으로써, 건선 환자의 질병 정도를 평가하는데 유용하게 사용될 수 있을 것으로 기대된다.
Description
본 발명은 건선 유발 동물 모델 및 이의 용도에 관한 것으로서, 보다 구체적으로는 독시사이클린의 투여에 따라 Peli1(Pellino homolog 1) 유전자를 과발현하도록 형질전환된 건선 유발 동물 모델 및 이의 용도에 관한 것이다.
건선은 대표적인 만성피부질환으로서 발병 후에는 10-20년은 지속되는 경우가 대부분이며 치료로 인하여 일시적으로 좋아지더라도 평생 재발에 대한 가능성을 안고 살아야 한다. 건선은 경계가 분명한 은백색의 인설로 덮여 있는 홍반성 피부 병변이 특징으로서 주로 자극을 많이 받는 부위인 팔꿈치, 무릎, 엉덩이, 두피 등에서 발생한다. 또한, 건선은 여러 가지 합병증을 통발 할 수 있다. 그 중 건선 환자들에게 발생하는 특이적 관절염인 건선 관절염이 있다. 이러한 건선은 발병을 직접적으로 예방할 수 있는 방법은 현재까지 없으며 악화를 예방하는 것이 최선의 방법이다. 여러 통계에 의하면 건선을 진단받은 환자의 수가 세계적으로는 약 3% 정도이며 국내에서는 약 1-2% 정도이며 이 중에서도 약 3분의 1 정도의 환자가 완치가 거의 불가한 중증 건선 환자이다. 특히, 건강보험심사평가원의 자료에 따르면 2013년 한 해 동안 국내에서 16만 3936명이 건선으로 치료를 받은 것으로 드러나 있다.
건선의 원인은 아직 정확하게 규명되어 있지 않지만 최근에는 피부에 있는 면역세포인 T세포의 활성이 증가되어 그 결과 T세포에 의해 분비된 사이토카인이 표피세포를 자극하여 표피세포의 과다한 증식과 염증을 일으키는 것으로 면역학적 이상과 유전자의 변이가 주된 연구 분야로 떠오르고 있다. 그 외에도 환경적 요인, 약물, 지속적인 피부자극, 피부 건조, 상기도 염증, 정신적 스트레스 등이 건선을 일으키거나 악화시키는 요인으로 증명되고 있다.
건선의 치료에는 다양한 방법들이 쓰이고 있고 더욱 효과적인 치료법을 찾기 위하여 여러 가지 방법들이 시도되고 있다. 약을 직접 피부에 바르는 국소치료, 광선을 이용한 광치료, 면역억제제나 스테로이드 제제의 약을 복용하는 전신치료로 나누어지며, 이러한 치료법들은 환자의 경우에 맞게 복합하여 복합치료를 하는 등 여러 방법이 있다. 건선의 심각도, 활성도, 병변의 형태와 상태, 발생 부위에 따라 치료방법이 결정되며 환자의 나이, 치료 접근 가능성과 정신적 상태도 매우 중요하다. 가벼운 경우에는 대개 바르는 약으로 치료를 시작하며, 중증이 되면 광치료나 먹는 약을 함께 사용하게 된다. 그리고 최근에는 다양한 연구를 통하여 개발된 생물학적 제제들이 임상 테스트를 통하여 안정성에 대해 검증 중에 있으며 실제로 환자들에게 생물학적 제제가 쓰이기도 한다. 그렇지만, 기존의 치료법들은 대부분 증세를 완화시키는 효과는 있으나 근본적인 치료법은 되지 못하며, 특히 건선의 환자 맞춤형 또는 표적치료법 아직 보고된 바 없다.
이에, 건선에 대한 효과적인 진단 및 치료에 대한 필요성이 요구되고 있으며, 건선의 메커니즘 연구와 치료법 연구를 위한 생체 시료 개발을 위하여 적합한 동물모델은 필수적인바, 이에 연구가 활발히 이루어지고 있으나(한국 공개특허 10-2010-0021561), 아직 미비한 실정이다.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로서, 본 발명자들은 독시사이클린 투여에 따라 Peli1 유전자가 과발현되도록 형질전환시킨 마우스를 중증 건선의 치료를 위한 동물모델로서 사용할 수 있음을 확인하였을 뿐만 아니라, Peli1 단백질의 과발현에 의한 건선의 유발 가능성을 확인하여, Peli1 단백질 발현 또는 활성 억제제가 건선을 예방, 개선, 억제 또는 치료할 수 있으며, 기질 단백질의 FHA 결합 모티브를 표적으로 하는 Peli1 FHA 도메인 유래 펩타이드가 Peli1 단백질의 정상적 기질 결합을 방해함으로써 새로운 치료제로 사용할 수 있음을 확인하고, 이에 기초하여 본 발명을 완성하게 되었다.
이에, 본 발명의 목적은 Peli1 (Pellino homolog 1) 유전자를 과발현하도록 형질전환된, 건선 유발 동물 모델 및 상기 건선 유발 동물 모델 제조방법을 제공하는 것이다.
또한, 본 발명의 다른 목적은 상기 동물모델을 이용한 건선 치료제의 스크리닝 방법을 제공하는 것이다.
또한, 가장 빈번하게 처방되고 있는 건선의 전신적 치료제인 면역억제제나 스테로이드 제제에 의해서 Peli1 단백질 과발현에 의해서 유도된 건선이 효율적으로 치료되기에 Peli1을 건선 치료제 개발의 치료 표적에 대한 활용 방법을 제공하는 것이다.
또한, 본 발명의 또 다른 목적은 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진, 펩타이드 및 상기 펩타이드를 유효성분으로 포함하는 건선 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한, 본 발명의 또 다른 목적은 세포 투과성 펩타이드와 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진 펩타이드가 연결되어 있는 것을 특징으로 하는 Peli1 결합 활성 저해 펩타이드 및 및 상기 Peli1 결합 활성 저해 펩타이드를 유효성분으로 포함하는 건선 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한, 본 발명의 또 다른 목적은 Peli1 단백질의 발현수준을 측정하는 제제를 포함하는 건선 진단용 조성물을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 Peli1 (Pellino homolog 1) 유전자를 과발현하도록 형질전환된, 건선 유발 동물 모델을 제공한다.
본 발명의 일 구현예로, 상기 Peli1 유전자는 독시사이클린의 투여에 따라 과발현될 수 있다.
본 발명의 다른 구현예로, 상기 Peli1 유전자는 서열번호 1의 염기서열로 이루어질 수 있다.
또한, 본 발명은 하기의 단계를 포함하는 건선 유발 동물 모델 제조방법을 제공한다:
(a) Peli1 (pellino homolog 1) 유전자를 포함하는 발현벡터를 숙주동물의 수정란에 도입하는 단계;
(b) 상기 도입된 수정란을 대리모의 자궁에 착상시키고 출산시켜서 1세대 후대동물을 수득하는 단계; 및
(c) 상기 수득한 1세대 후대동물과 rtTA (reverse tetracycline transactivator) 모델동물을 교배시켜서 2세대 후대동물을 수득하는 단계.
또한, 본 발명은 하기의 단계를 포함하는 건선 치료제의 스크리닝 방법을 제공한다:
a) 상기 동물모델에 후보물질을 처리하는 단계; 및
b) 상기 후보물질을 처리한 동물모델을 사육하면서 예후를 확인하는 단계.
또한, 본 발명은 Peli1 (Pellino homolog 1) 단백질의 발현 또는 활성 억제제를 유효성분으로 포함하는 건선 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예로, 상기 Peli1 단백질은 서열번호 1의 염기서열로 이루어지는 폴리뉴클레오티드로 코딩될 수 있다.
본 발명의 다른 구현예로, 상기 Peli1 단백질은 서열번호 2의 아미노산 서열로 이루어질 수 있다.
본 발명의 또 다른 구현예로, 상기 Peli1 단백질의 발현 억제제는 Peli1 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA (short interfering RNA), 짧은 헤어핀 RNA (Short hairpin RNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
본 발명의 또 다른 구현예로, 상기 Peli1 단백질의 활성 억제제는 상기 Peli1 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
또한, 본 발명은 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진, 펩타이드를 제공한다.
본 발명의 일 구현예로, 상기 펩타이드는 Peli1 단백질과 기질 단백질과의 결합을 억제할 수 있다.
또한, 본 발명은 세포 투과성 펩타이드와 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진 펩타이드가 연결되어 있는 것을 특징으로 하는, Peli1 결합 활성 저해 펩타이드를 제공한다.
본 발명의 또 다른 구현예로, 상기 Peli1 결합 활성 저해 펩타이드는 GS linker로 연결되어 있을 수 있다.
본 발명의 또 다른 구현예로, 상기 세포 투과성 펩타이드는 폴리아르기닌 (Polyarginines), Tat49
-57, 페너트라틴 (Penetratin), Pep-1, 트랜스포탄 (Transportan), NLS (Nuclear localization sequence) 및 HP4로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
또한, 본 발명은 상기 펩타이드 또는 Peli1 결합 활성 저해 펩타이드를 유효성분으로 포함하는, 건선 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 건선 치료방법을 제공한다.
또한, 본 발명은 상기 약학적 조성물의 건선 예방 또는 치료용도를 제공한다.
또한, 본 발명은 건선 치료용 조성물 제조를 위한 Peli1(Pellino homolog 1) 단백질을 코딩하는 유전자의 신규한 용도를 제공한다.
또한, 본 발명은 Peli1 단백질의 발현수준을 측정하는 제제를 포함하는 건선 진단용 조성물을 제공한다.
또한, 본 발명은 건선을 진단하는 데 필요한 정보를 제공하기 위하여, 개체의 시료로부터 Peli1 단백질을 검출하는 방법을 제공한다.
또한, 본 발명은 상기 Peli1 단백질의 건선의 진단용도를 제공한다.
본 발명에 따른 형질전환 동물 모델은 독시사이클린의 투여에 따라 Peli1 (Pellino homolog 1) 유전자를 과발현되어 건선 환자에서 나타나는 표현형과 유사성을 나타냄을 확인하였는바, 건선에 대한 효과적인 치료법 연구를 위한 생체 시료 개발을 위하여 동물 모델의 설계가 가능하며, 건선 치료를 위한 후보약물 스크리닝 등의 임상적 연구에 유용하게 사용될 수 있을 것으로 기대된다.
또한, Peli1 단백질의 발현 또는 활성을 억제를 통한 건선의 예방, 개선, 억제 또는 치료 가능성을 구체적으로 확인하였으며, 기질 단백질과 Peli1 단백질의 정상적 기질 결합을 방해하는 FHA 결합 모티브를 표적으로 하는 Peli1 FHA 도메인 유래 펩타이드를 통해 건선 관련 질병의 신약 개발에 유용하게 활용될 수 있을 것으로 기대된다.
이에 더하여, 상기 Peli1 단백질의 발현수준을 확인함으로써, 건선 환자의 질병 정도를 평가하는데 유용하게 사용될 수 있을 것으로 기대된다.
도 1a는 독시사이클린 투여에 따라 Peli1이 과발현되는 Peli1 유도발현 마우스(doxycycline inducible Peli1 transgenic mice)의 제작과정을 개략적으로 나타낸 모식도이다.
도 1b는 독시사이클린 투여에 따라 Peli1이 과발현되도록 형질전환 됐는지 여부를 PCR을 통해 확인한 결과이다.
도 2는 독시사이클린 투여에 따른 Peli1 유도발현 마우스의 각 조직에서 Peli1 단백질 발현을 웨스턴 블랏팅을 통해 확인한 결과이다.
도 3a는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 자발적 병변 유도를 육안으로 비교한 결과이다.
도 3b는 상기 도 3a와 같은 표현형이 나타난 마우스의 비율을 산출한 결과이다.
도 3c는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 병변 수준을 점수화하여 나타낸 결과이다.
도 4a는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, H&E 염색을 통해 피부층의 구조를 비교한 결과이다.
도 4b는 유도 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 Peli1의 과발현이 유도되는 세포를 확인하기 위해 Peli1 항체와 건선 질병 마커 단백질인 Psoriasin 항체를 이용하여 면역염색을 한 결과이다.
도 4c는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, 기저층의 마커인 K14, 유극층의 마커인 K10, 과립층의 마커인 Loricrin에 대한 항체를 이용하여 면역염색을 수행하여 피부층 발달 변화를 비교한 결과이다.
도 4d는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, Ki67와 K14에 대한 항체를 이용하여 면역염색을 수행하여 기저층 세포들의 증식능력을 비교한 결과이다.
도 4e는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, CD31 항체를 이용하여 면역염색을 수행하여 혈관 생성 변화를 비교한 결과이다.
도 4f는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, CD3 항체를 이용하여 면역염색을 수행하여 T 세포의 침윤 변화를 비교한 결과이다.
도 4g 및 4h는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, 피부병변 주변의 림프절 변화를 비교한 결과이다.
도 4i는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, 유세포 분석법를 이용하여 림프절에서 면역세포의 활성화를 비교한 결과이다.
도 4j와 도 4k는 상기 도 4i의 결과를 그래프로 나타낸 결과이다.
도 4l은 상기 도 4i의 결과에서 활성화 되어 있는 T 세포의 비율을 독시사이클린 투여에 따라 비교한 것이다.
도 5a는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, 림프절의 CD3+ T 세포의 cDNA를 이용하여 IFNγ, IL-4, IL-22, IL-23과 같은 사이토카인의 수준을 정량적 역전사 중합효소 연쇄반응을 이용하여 비교한 결과이다.
도 5b는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, IL-17에 대한 항체를 이용하여 면역염색을 수행한 결과이다.
도 5c는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여에 따른 건선 유발 여부를 검증하기 위해, IL-23에 대한 항체를 이용하여 면역염색을 수행한 결과이다.
도 6a는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여 및 제거에 따른 자발적 병변 유도를 육안으로 비교한 결과이다.
도 6b는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여 및 제거에 따른 병변 수준을 점수화하여 나타낸 결과이다.
도 6c는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 독시사이클린 투여 및 제거에 따른 건선 유발 여부를 검증하기 위해, H&E 염색을 통해 피부층의 구조를 비교한 결과이다.
도 7a는 Peli1 단백질의 발현이 억제되었을 때 건선 유발이 억제되는지 확인하기 위하여, 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에 이미퀴모드 유도 건선 모델을 적용한 모식도이다.
도 7b는 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에 이미퀴모드 (Imiquimod, toll-like receptor 7/9 작용제) 처리에 따라 발생한 건선 병변을 육안으로 비교한 결과이다.
도 7c는 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에서 이미퀴모드 처리에 따른 건선 병변 수준을 점수화하여 나타낸 결과이다.
도 7d는 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에서 이미퀴모드 처리에 따른 피부의 두께를 측정하여 그래프로 나타낸 결과이다.
도 7e는 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에서 이미퀴모드를 4번 처리한 후 건선 병변 수준을 검증하기 위해, H&E 염색을 통해 피부층의 구조를 비교한 결과이다.
도 8a는 Peli1 유도 발현 마우스(rtTA-Peli1)의 치료약 효능 평가를 위한 전 임상(Preclinical) 동물 모델로서 검증을 위해, Peli1 유도 발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 12주 동안 독시사이클린을 투여한 후에 기존 건선 전신치료제인 사이클로스포린 (cyclosporine, CsA)와 메소트렉세이트 (methotrexate, MTX)를 복강 주사 투여에 대한 모식도이다.
도 8b는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 12주 동안 독시사이클린 투여한 후에 면역억제제인 사이클로스포린 (CsA)와 메소트렉세이트 (MTX)를 일정 기간 동안 복강주사한 후 건선 병변의 수준을 비교하기 위해, H&E 염색을 통해 피부층의 구조를 비교한 결과이다.
도 8c는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 12주 동안 독시사이클린 투여한 후에 면역억제제인 사이클로스포린 (CsA)와 메소트렉세이트 (MTX)를 일정 기간 동안 복강주사한 후 건선 병변의 수준을 점수화하여 나타낸 결과이다.
도 8d는 Peli1 유도발현 마우스(rtTA-Peli1)와 대조군 마우스(rtTA)에서 12주 동안 독시사이클린 투여한 후에 면역억제제인 사이클로스포린 (CsA)와 메소트렉세이트 (MTX)를 일정 기간 동안 복강주사한 후 피부의 두께를 측정하여 그래프로 나타낸 결과이다.
도 9a는 Peli1 mRNA에서의 단백질의 합성을 저해하기 위하여 타겟 mRNA 서열을 확인하고 이에 대한 shRNA를 제작하는 과정을 개략적으로 도시한 것이다.
도 9b는 상기 7a를 통해 제작된 shRNA를 세포 내로 주입하여 Peli1 단백질의 발현이 억제되는지를 웨스턴 블랏팅을 통해 확인한 결과이다.
도 10은 Peli1의 결합 활성을 저해하는 펩타이드의 제작 및 상기 펩타이드가 Peli1의 결합 활성을 저해하는 과정을 개략적으로 나타낸 것이다.
도 11a는 Peli1의 결합 활성을 저해하는 펩타이드의 제작 과정을 개략적으로 나타낸 것이다.
도 11b는 세포 침투력을 높이기 위해 세포 투과 향상 펩타이드를 결합한 Peli1의 결합 활성 저해하는 펩타이드의 세포 침투력을 형광염색을 통해 확인한 결과이다.
도 11c는 Peli1의 결합 활성 저해 펩타이드를 처리한 후 toll-like receptor (TLR) 신호전달 활성화를 웨스턴 블랏팅을 통해 비교한 결과이다.
본 발명자들은 건선의 치료제를 연구 및 개발하는데 사용하기에 적합한 동물모델을 개발하고자 연구한 결과, 독시사이클린 투여에 따라 Peli1 유전자가 과발현되도록 형질전환시킨 마우스에서 건선 환자에서 나타나는 표현형과 유사성을 나타냄을 확인하고, 이에 기초하여 본 발명을 완성하게 되었다.
이하 본 발명을 상세히 설명한다.
본 발명은 독시사이클린의 투여에 따라 Peli1 (Pellino homolog 1) 유전자를 과발현하도록 형질전환된, 건선 유발 동물 모델을 제공한다.
또한, 본 발명은 하기의 단계를 포함하는, 건선 유발 동물 모델 제조방법을 제공한다:
(a) Peli1 (pellino homolog 1) 유전자를 포함하는 발현벡터를 숙주동물의 수정란에 도입하는 단계;
(b) 상기 도입된 수정란을 대리모의 자궁에 착상시키고 출산시켜서 1세대 후대동물을 수득하는 단계; 및
(c) 상기 수득한 1세대 후대동물과 rtTA (reverse tetracycline transactivator) 모델동물을 교배시켜서 2세대 후대동물을 수득하는 단계.
본 발명의 용어 "Peli1 (pellino homolog 1) 유전자"란, E3 유비퀴틴 접합효소로 알려진 pellino homolog 1 단백질을 코딩하는 유전자를 의미하고, 인간의 경우 2번 염색체에 존재하고, 마우스의 경우에는 11번 염색체에 존재한다. 상기 단백질 또는 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있다(NCBI Reference Sequence: NP_065702, NM_020651). 본 발명에서는 Peli1 유전자로서 서열번호 1의 폴리뉴클레오티드를 사용하였다.
본 발명에서, 상기 동물의 종류로는 마우스, 랫트(rat), 소, 말, 돼지, 원숭이, 오리, 개, 고양이 등이 될 수 있고, 마우스인 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에서는, 독시사이클린의 투여에 따라 Peli1 유전자가 과발현되는 형질전환 동물 모델을 제작하고(실시예 1 참조), 상기 동물 모델에서 독시사이클린 투여에 따른 자발적 병변 유도 여부를 검증한 결과, 대조군에 비하여 독시사이클린을 지속적으로 투여하였을 때 자발적으로 병변이 나타나는 것을 확인하였다. 특히 털의 윤기가 사라지고 탈모가 진행되며 피부의 비정상적이 소견이 나타남을 확인하였다(실시예 4 참조).
또한, 본 발명의 다른 실시예에서는, 제작된 동물 모델에서 건선 유발을 검증한 결과, 대조군에 비하여 독시사이클린을 지속적으로 투여하였을 때, 표피세포층이 두꺼워지며, 표피층의 혈관 생성이 증가하고, 피부층에 T 세포의 침윤이 증가하며, 피부병변 주변의 림프절에서 면역세포들이 비정상적인 활성화 및 도움 T (helper T 세포) 반응이 있음을 확인함으로써 건선의 표현형(phenotype)과 매우 유사한 것을 확인하였다(실시예 5 참조). 이러한 건선의 표현형은 독시사이클인의 투여를 멈추어 Peli1의 발현이 정상수준으로 낮아졌을 때와 정상적인 Peli1의 발현을 억제시켰을 때 사라지는 것을 확인하였다(실시예 6 참조). 또한 기존의 건선 전신 치료제로 사용되는 면역 억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 주기적으로 복강투여하였을 때 건선의 표현형이 완화되는 것을 확인함으로서 전 임상(Preclinical)동물 모델로서 검증하였다(실시예 7참조).
따라서, 본 발명에 따른 동물모델은 건선의 치료 및 연구에 유용하게 사용될 수 있다.
이에, 본 발명의 다른 양태로서, 본 발명은 상기 방법에 의해 제조된 동물모델을 이용한 건선 치료제의 스크리닝 방법을 제공한다.
상기 스크리닝 방법은 a) 상기 동물모델에 후보물질을 처리하는 단계; 및 b) 상기 후보물질을 처리한 동물모델을 사육하면서 예후를 확인하는 단계를 포함할 수 있으며, 상기 후보물질은 천연화합물, 합성화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또는 진균의 대사 산물 및 생활성 분자로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나, 이에 한정되지 않는다.
또한, 건선 유발 동물 모델 제작을 통해 Peli1 단백질의 과발현에 의한 건선의 유발 가능성을 확인하였는바, Peli1 단백질 발현 또는 활성 억제제가 건선을 예방, 개선, 억제 또는 치료에 유용한 조성물의 유효성분으로 사용될 수 있다.
이에, 본 발명의 또 다른 양태로서, 본 발명은 Peli1 (Pellino homolog 1) 단백질의 발현 또는 활성 억제제를 유효성분으로 포함하는, 건선 예방 또는 치료용 약학적 조성물 및 이를 이용한 건선 치료방법을 제공한다.
이 때, 본 발명에서 Peli1 단백질은 서열번호 2의 아미노산 서열로 이루어질 수 있다.
본 발명에서 사용되는 용어, "예방"이란 본 발명에 따른 약학적 조성물의 투여에 의해 건선을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 사용되는 용어, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 건선에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서, Peli1 단백질의 발현 억제제는 Peli1 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, siRNA, shRNA 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택될 수 있으나, 이것으로 제한되는 것은 아니다.
본 발명에서 Peli1 단백질의 활성 억제제는 상기 Peli1 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 기질유사체, 앱타머 및 항체로 구성된 군으로부터 선택되는 어느 하나에 의해 이루어지는 것이 바람직하지만, 이것으로 제한되는 것은 아니며, Peli1 단백질 활성을 저해하는 모든 약물을 사용하여도 무방하다.
본 발명에서, "펩티드 미메틱스(Peptide Mimetics)"는 Peli1 단백질의 결합 도메인을 억제하여 Peli1 단백질의 활성을 억제하는 것으로서, 상기 펩티드 미메틱스는 펩티드 또는 비펩티드일 수 있고, psi 결합과 같은, 비펩티드 결합에 의해 결합된 아미노산으로 구성될 수도 있다.
본 발명에서 "앱타머(aptamer)"는 단일 사슬 DNA 또는 RNA 분자로서, SELEX(systematic evolution of ligands by exponential enrichment)라 불리는 올리고뉴클레오타이드(oligonucleotide) 라이브러리를 이용한 진화적인 방법에 의해 특정 화학 분자나 생물학적 분자에 높은 친화력과 선별력을 갖고 결합하는 올리고머를 분리하여 수득할 수 있다. 앱타머는 표적에 특이적으로 결합하고 표적의 활성을 조정할 수 있는데, 예컨대, 결합을 통하여 표적이 기능하는 능력을 차단할 수 있다.
본 발명에서 "항체"는 Peli1 단백질에 특이적이고 직접적으로 결합하여 Peli1 단백질의 활성을 효과적으로 억제할 수 있다. 상기 Peli1 단백질에 특이적으로 결합하는 항체는 폴리크로널(polyclonal) 항체 또는 모노크로널(monoclonal) 항체를 사용하는 것이 바람직하다. 상기 Peli1 단백질에 특이적으로 결합하는 항체는 당업자에게 알려진 공지의 방법으로 제작하여도 무방하며, 상업적으로 알려진 Peli1 단백질 항체를 구입하여 사용할 수도 있다.
또한, Peli1 단백질은 RING-like 도메인을 가짐으로써 E3 유비퀴틴 접합효소로서 작용한다. 즉, Peli1 단백질은 다양한 단백질번역 후 변형(Posttranslational modification of protein)을 통하여 활성화 되어 E3 유비퀴틴 접합효소로서 작용하며, FHA 도메인을 통하여 타겟 단백질과의 결합이 일어난다. 따라서, 기질 단백질의 FHA 결합 모티브를 표적으로 하는 Peli1 FHA 도메인 유래 펩타이드는 Peli1 단백질의 정상적 기질 결합을 방해함으로써 새로운 치료제로 사용할 수 있다.
본 발명의 또 다른 실시예에서는, FHA 도메인을 통하여 타겟 단백질과의 결합이 일어나는 것을 확인하였으며, 이를 통해 Peli1 단백질과 타겟 단백질 사이의 결합을 저해하기 위하여 Peli1 단백질의 FHA 도메인 유래 펩타이드를 제작하였다 (실시예 9 참조).
이에, 본 발명의 또 다른 양태로서, 본 발명은 서열번호 5 내지 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진, 펩타이드및 상기 펩타이드를 포함하는 건선 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서 상기 펩타이드는 FHA 결합 모티브를 표적으로하여 Peli1 단백질과 기질 단백질과의 결합을 억제할 수 있고, 또한, 상기 펩타이드는 세포 내 침투를 용이하게 하기 위한 세포 투과 향상 펩타이드(Cell-penetrating peptide)가 연결될 수도 있다.
이 때, 상기 세포 투과성 펩타이드는 Polyarginines, Tat49-57, Penetratin, Pep-1, Transportan, Nuclear localization sequence 및 HP4로 이루어진 군으로부터 선택되는 어느 하나를 사용할 수 있으며, 바람직하게는 HP4를 사용할 수 있으나, 이에 제한되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험준비 및 실험방법
1-1. 동물 실험(Animal experiment)
모든 동물 실험은 성균관대학교 의과대학(Sungkyunkwan University School of Medicine; SUSM)에 있는 동물실험윤리위원회(The Institutional Animal Care and Use Committee; IACUC)에 의해 승인된 프로토콜 이용하여 실험을 진행하였다. 성균관대학교 의과대학(SUSM)는 국제 실험 동물 평가 관리인 인증 협회(Association for Assessment and Accreditation of Laboratory Animal Care International; AAALAC International)와 실험 동물 센터(the Institute of Laboratory Animal Resources; ILAR)의 가이드라인 (guidelines)에 따라 모든 동물 실험을 진행하였다.
1-2. 유전형 분석(genotyping)
Doxycyline 투여에 따라 Peli1이 유도되는 Peli1 유도 발현 마우스(doxycycline inducible Peli1 transgenic mice)의 꼬리에서 genomic DNA (gDNA)를 추출한 후, 형질전환 여부를 확인하기 위해 중합효소 연쇄반응(polymerase chain reaction, PCR)을 수행하였다.
gDNA를 주형으로 하여 프라이머를 사용하여 TetO & Peli1의 경우에는 95℃ 30초, 55℃ 30초, 72℃ 1분으로 하여 총 4회를 한 다음에, 95℃ 30초, 58℃ 1분, 72℃ 1분으로 하여 총 34회의 RT-PCR을 수행하였다. 또한 R26과 rtTA 의 경우에는 95℃ 30초, 65℃ 1분, 72℃ 1분으로 하여 총 34회를 PCR을 수행하였으며, 이때 사용된 프라이머의 구체적인 서열은 하기와 같다:
1) TetO & Peli1 primer sequences: 정방향 프라이머 (cmv TetO-1) 5'-AAG TGA AAG TCG AGC TCG-3'(서열번호 12), 역방향 프라이머 (Peli1 1/3 length) 5'-TGA TAT CGT GTG CTG GTC TTT G -3'(서열번호 13)
2) R26 & rtTA primer sequences: (1) 정상 마우스(WT) - R26(F)와 R26 (R); 정방향 프라이머 5'- AAA GTC GCT CTG AGT TGT TAT -3'(서열번호 14), 역방향 프라이머 5'- GGA GCG GGA GAA ATG GAT ATG -3'(서열번호 15) (2) 형질전환 마우스(Tg) - R26(F)와 rtTA (R); 정방향 프라이머 5'- AAA GTC GCT CTG AGT TGT TAT -3'(서열번호 16), 역방향 프라이머 5'- GCG AAG AGT TTG TCC TCA ACC -3'(서열번호 17)
PCR반응의 산물 중에 10μl를 취해 에티듐 브로마이드(etidium bromide) 존재 하에 1% 아가로즈 겔(agarose gel)에서 전기영동을 수행하여 밴드를 관찰하였다.
1-3. 웨스턴 블랏팅
Doxycycline의 투여에 따라 Myc-Peli1이 발현되는 마우스에서 Peli1 단백질의 발현을 확인하기 위해서, 대조군(-/rtTA) mice와 실험군(Myc-Peli1/rtTA) mice에 doxycycline (2mg/ml)을 2주 동안 먹인 후에 진행하였다. 각 장기 조각에 용해 완충액 (lysis buffer; 150 mM NaCl, 20 mM HEPES, 5 mM EDTA, 0.5% Nonidet P-40, 1 mM phenylmethanesulfonyl fluoride, 10 mM NaF, 1 mM Na3Vo4, 1 mM dithiothreitol, 및 protease inhibitor cocktail)을 넣고 조직분쇄기(Homogenizer)를 사용하여 균질화 한 후에, 초원심분리기 (14,000 rpm, 30min, 4℃)로 분리하였다. 상충액의 추출물을 얻은 후에 Bradford 정량 방법으로 단백질을 정량하였다. 50μg 장기 추출물을 8% SDS-PAGE에 전기영동을 하여 트랜스퍼(nitrocellulose membraine을 이용)와 5% skin milk가 섞인 TBS-T 완충액 (100Mm NaCl, 20Mm Tris-HCl pH7.4, 0.05% Tween-20)으로 블라킹(blocking)을 한 후에 3% BSA(TBS-T의 용액이 포함된)에 anti-Myc(Roche; 1:2,000 dilution), anti-Peli1(Santa Cruz; 1:2,000 dilution) 또는 anti-β-actin(Sigma; 1:4,000 dilution) 항체를 4℃에서 12시간 이상 반응하고, TBS-T완충액으로 3번의 세척 (Washing; 3 times, 10min, RT)을 거친 후에 HRP가 부착된 2차 항체를 블라킹 용액에 1:3,000으로 희석하여 상온에서 2시간 반응을 하고, TBS-T로 3번의 세척 (Washing; 3 times, 10min, RT)을 거친 후에 ECL 용액을 이용하여 발광을 유도하여 X-ray 필름에 감광하였다.
1-4. 유세포분석(Flow cytometry)
마우스의 림프절(lymph nodes)에서 세포를 얻고 적혈구(Erythrocytes)를 제거한 후에 다음의 항체를 이용하여 염색하였다. 보다 구체적으로, anti-CD3 Percp cy 5.5, anti-CD4 PE cy7, anti-CD8 PE, anti-CD122 APC, anti-CD44 FITC, anti-CD62L APC cy7을 이용하여 세포를 염색한 후 항체의 형광을 통해 유세포 분석 장비인 Canto II Flow cytometry (BD Bioscience)를 이용하여 분석하였다.
1-5.
조직병리
(
Histopathology
)
마우스의 조직들은 10% neutral buffered formalin을 이용하여 고정(Fixation)하였고 파라핀 블록(Paraffin block)을 제작하였다. 상기 파라핀 블록에서 3μm의 두께의 절편을 얻은 후 헤마톡실린&에오신 (H&E) 염색을 하였다. 면역조직화학법(Immunohistochemistry)의 경우 anti-K14 antibody, anti-Ki67 antibody, anti-CD31 antibody, anti-CD3 antibody를 이용하여 염색하였고, 염색한 후 DAPI 시약이 포함된 봉입제을 이용하여 봉입하였다. 염색한 조직 샘플은 현미경[AxioCam digital microscope camera 및 AxioVision image processing software (Carl Zeiss)]을 이용하여 염색된 이미지를 얻었다.
실시예 2. Peli1 유도발현 형질전환 마우스 제작
독시사이클린의 투여에 따라 Peli1 (Pellino homolog 1) 유전자가 과발현되는 형질전환 동물 모델을 하기와 같이 제조하였으며, 제작 방법의 개략적인 모식도를 도 1a에 나타내었다
보다 구체적으로, Myc epitope이 tagging되어 있는 human Peli1 유전자가 클로닝된 벡터(도 1a 참조)를 수정란(1-cell embryo)에 미세주입(microinjection) 하여 형질전환 마우스를 제작하였다. 미세주입 후 상기 실시예 1-2에 기재된 유전형 분석(genotyping) 방법을 통하여 TetO (tetracycline-responsive element) Myc-Peli1 형질전환 마우스를 선별하였다. 선별된 마우스는 R26-rtTA (reverse tetracycline transactivator) 마우스와 교배하여 후대 형질전환 마우스(doxycycline inducible TetO-Myc-Peli1 transgenic mice)를 얻었고, 형질전환 여부를 상기 실시예 1-2에 기재된 중합효소 연쇄반응 (polymerase chain reaction, PCR)을 통해 확인하였다.
그 결과, 도 1b에 나타낸 바와 같이, Myc-Peli1과 rtTA가 동시에 발현되는 형질전화 마우스를 얻음을 확인하였다.
실시예 3. Peli1 유도발현 형질전환 마우스에서 Peli1 발현수준 검증
상기 실시예 2를 통해 제작된 독시사이클린 투여에 따라 Peli1이 과발현되는 Peli1 유도발현 마우스의 조직에서 단백질 수준에서의 Myc-Peli1 발현을 확인하였다. 이를 위해, 대조군 (-/rtTA) 마우스와 실험군 (Myc-Peli1/rtTA) 마우스에 독시사이클린 (2mg/ml)을 2주 동안 먹인 후 여러 조직을 얻었다. 보다 구체적으로, 대조군 (-/rtTA) 마우스와 실험군(Myc-Peli1/rtTA) 마우스의 뇌(brain), 폐(lung), 심장(heart), 흉선(thymus), 위(Stomach), 소장(Small Intestine), 부고환(Epididymis), 대장(colon), 신장(Kidney), 피부(skin), 고환(testis), 전립선(Prostate), 췌장(Pancreas), 간(Liver), 비장(Spleen), 림프절(Lymphnodes), 골수(Bone marrow)에서 Myc-Peli1의 발현을 상기 실시예 1-3에 기재된 웨스턴 블랏팅(Western blotting)을 통해 확인하였다.
그 결과, 도 2에 나타낸 바와 같이, 폐(lung), 흉선(thymus), 위(Stomach), 부고환(Epididymis), 대장(colon), 신장(Kidney), 전립선(Prostate) 췌장(pancreas), 간(liver), 비장(Spleen), 림프절(Lymphnodes), 골수(Bone marrow) 등에서 Myc-Peli1의 발현이 높은 것을 확인하였다. 반면, 뇌(brain), 심장(heart), 소장(Small Intestine), 피부(skin), 고환(testis)등에서는 Myc-Peli1의 발현이 낮거나 거의 발현이 되지 않는 것을 확인하였다.
실시예
4.
Peli1
유도발현 형질전환 마우스에서
독시사이클린
투여에 따른 자발적 병변 유도 여부 검증
먼저, 대조군 (rtTA) 마우스와 실험군 (rtTA-Peli1) 마우스에 독시사이클린 (2mg/ml)을 24주 동안 음용수(Drinking water)로 투여한 후, 육안으로 병변 발생을 확인하였다. 그 결과, 도 3a에 나타낸 바와 같이, Peli1 유도 발현 마우스(rtTA-Peli1)에 독시사이클린을 지속적으로 투여하였을 때 자발적으로 병변이 나타나는 것을 확인하였다. 특히 털의 윤기가 사라지고 탈모가 진행되며 피부의 비정상적이 소견이 관찰되었다.
다음으로, 상기와 같은 표현형이 나타나는 마우스의 비율을 측정한 결과, 도 3b에 나타낸 바와 같이, 모든 마우스에서 Peli1이 독시사이클린의 투여에 따라 과발현되었을 때 상기와 같은 병변이 나타나는 것을 확인하였다.
다음으로, 대조군 (rtTA) 마우스와 실험군 (rtTA-Peli1) 마우스에 독시사이클린을 24주 동안 투여한 다음, 나타나는 표현형 변화를 점수화하였고, 이때 점수는 하기 표 1에 기재된 기준에 근거하여 점수화하였다. 그 결과, 도 3c에 나타낸 바와 같이, 독시사이클린 투여 기간을 따라 점수가 계속 증가하는 것을 확인하였다.
| 점수 | 표현형 |
| 0 | 정상 |
| 1 | 미미한 홍반과 각질이 나타나는 경우 |
| 2 | 홍반의 면적이 넓어 지고 각질이 보이며 피부층이 두꺼워 지기 시작한 경우 |
| 3 | 심각한 각질과 홍반이 나타나며 피부층이 정상보다 30%정도 두꺼워진 경우 |
| 4 | 심각한 각질과 홍반이 나타나며 피부층이 정상보다 60%이상 두꺼워진 경우 |
| 5 | 심각한 각질과 홍반과 피부의 탈락이 관찰되며 피부층이 정상보다 90%이상 두꺼워진 경우 |
상기 결과로부터, 상기와 같은 병변은 Peli1의 과발현에 의해서 자발적으로 유도된다는 것을 알 수 있었다.
실시예 5. Peli1 유도발현 형질전환 마우스의 건선 유발 검증
상기 실시예 2에서 제작된 Peli1 유도발현 형질전환 마우스에서 건선이 유발되었는지의 여부를 확인하기 위하여, 하기 실험을 수행하였다.
5-1. 표피세포층 변화 확인
먼저, 대조군(rtTA) 마우스와 실험군 (rtTA-Peli1) 마우스에 독시사이클린(2mg/ml)을 24주 동안 음용수(Drinking water)로 투여한 후, 상기 실시예 1-5에 기재된 헤마톡실린&에오신(H&E) 염색을 통하여 피부층의 구조를 확인하였다. 그 결과, 도 4a에 나타낸 바와 같이, 대조군 (rtTA) 마우스의 경우에는 정상적인 피부층이 형성된 반면, 실험군 (rtTA-Peli1) 마우스에서는 비정상적인 병변이 관찰되었다. 특히, 표피층 세포 (Epidermal cell)의 층이 매우 크게 증가되어 있는 것은 물론 건선 환자의 피부층 구조에서 흔히 발견되는 착각화증(Parakeratosis), 과각화증(Hyperkeratosis), 표피능(rete ridge), 미세고름(microabscess)의 표현형이 관찰되었다. 상기 결과로부터, Peli1 유도 발현 마우스에서 건선의 표현형(phenotype)이 관찰되는 것을 확인하였다. 또한 대조군(rtTA) 마우스와 실험군 (rtTA-Peli1) 마우스에 독시사이클린(2mg/ml)을 24주 동안 음용수(Drinking water)로 투여한 후, Peli1 단백질이 피부층에서 과발현되는지 확인하기 위하여 Peli1 항체를 이용하여 조직면역염색을 수행하였다. 그 결과, 도 4b에 나타낸 바와 같이 실험군 (rtTA-Peli1)마우스의 피부층에서 Peli1 단백질이 과발현되는 것을 확인하였다. 또한 건선 질병 마커 단백질인 Psoriasin 항체를 이용하여 조직면역염색을 수행한 결과 독시사이클린을 투여한 실험군 (rtTA-Peli1) 마우스에서 Psoriasin 발현이 강하게 유도되는 것을 관찰하였다.
다음으로, 상기 도 4a를 통해 Peli1 유도 발현 마우스에 독시사이클린을 지속적으로 투여한 경우 대조군과는 다르게 비정상적으로 표피세포층이 두꺼워지는 것을 확인하였는바, 상기 실시예 1-5에 기재된 방법에 따라 표피층을 구성하는 기저층의 마커인 K14, 유극층의 마커인 K10, 과립층의 마커인 Loricrin에 대한 항체를 이용하여 면역염색을 수행하고, 염색된 이미지를 확인하였다. 그 결과, 도 4c에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 표피층의 기저층과 유극층이 매우 증가되어 있는 것을 확인하였다.
추가적으로, Peli1 유도 발현 마우스에서 비정상적으로 증가되어 있는 기저세포들의 증식능력을 확인하기 위해, 상기 실시예 1-5에 기재된 방법에 따라 세포의 증식을 확인할 수 있는 마커인 Ki67을 함께 염색하고, 염색된 이미지를 확인하였다. 그 결과, 도 4d에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 증식중인 기저세포의 수가 증가되어 있는 것을 확인하였다. 상기 결과를 통해, Peli1 유도 발현 마우스(rtTA-Peli1)에서 증식중인 기저세포의 수가 비정상적으로 높아져 있으며 이에 따라 표피세포층이 두꺼워진다는 것을 확인하였다.
5-2. 표피층의 혈관 생성 변화 확인
건선 환자에서 나타나는 표현형 중 비정상적으로 표피층이 두꺼워지는 특징과 함께 비정상적으로 진피층 (Dermal layer)에 혈관 생성이 활발하게 일어나 있을 뿐만 아니라 혈관 확장이 일어나는 것이 있다. 이를 확인하기 위해, 먼저 상기 실시예 1-5에 기재된 방법에 따라 모세혈관의 마커인 CD31 항체를 이용하여 염색을 실시하였다. 그 결과, 도 4e에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 혈관의 생성이 활발하게 일어나 있을 뿐 만 아니라 혈관이 확장되어 있는 것을 확인하였다.
5-3. 면역세포 활성화 변화 확인
건선 환자에서 나타나는 표현형 중 하나로 면역세포들의 침윤이 활발하게 일어나 있다. 더욱이, 최근의 연구에 따르면 건선은 T 세포의 비정상적인 활성에 의해서 유도된다고 알려져 있고, 그리하여 피부층에 T 세포의 침윤이 관찰된다고 알려져 있다.
이를 확인하기 위해, 먼저 상기 실시예 1-5에 기재된 방법에 따라 T 세포의 마커인 CD3 항체로 염색을 실시하였다. 그 결과, 도 4f에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 피부층에 T 세포의 침윤이 증가되어 있는 것을 확인하였다.
다음으로, 상기 도 4f의 결과를 통하여 비정상적인 면역반응이 유도되고 있다는 것을 예상할 수 있었는바, 피부병변 주변의 림프절을 확인하였다. 보다 구체적으로, 피부층에 가까이에 존재하는 서혜부(Inguinal), 겨드랑이(Axillary), 팔(Brachial), 목(Cervical) 주변의 림프절을 분리하여 상기 실시예 1-5에 기재된 H&E 염색을 통하여 구조를 확인하였다. 그 결과, 도 4g 및 4h에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 병변 주변에 존재하는 림프절들이 커져있는 것을 확인하였다. 또한 림프절들이 검게 변해 있는 것도 확인하였는바, 이를 통해 면역 세포들의 활성 증가에 의해 비정상적으로 sinus의 형성이 증가되어 있음을 알 수 있었다.
다음으로, 상기 도 4g 및 4h의 결과를 통하여 피부 병변 주변의 림프절들이 커져있는 것을 확인하였는바, 이러한 림프절에서 면역세포의 활성화를 상기 실시예 1-4에 기재된 유세포 분석법를 이용하여 확인하였다.
보다 구체적으로, 림프절에서 면역세포를 분리하여 T 세포들 중 CD4+ T 세포의 활성을 CD44, CD62L, CD122 항체를 이용하여 확인하였다. 그 결과, 도 4i에 나타낸 바와 같이, 대조군 (rtTA) 마우스에 비하여 실험군 (rtTA-Peli1) 마우스에서 비활성화 (naive) T 세포(CD62L+/CD44-)의 비율은 감소되어 있고 활성화(activated) T 세포(CD62L+/CD44hi-low, CD62L-/CD44hi, CD122+/CD44+)의 비율은 증가되어 있음을 확인하였다.
추가적으로, 상기 도 4i의 결과를 그래프로 나타내어 분석한 결과, 도 4j에 나타낸 바와 같이, 림프절을 구성하고 있는 T 세포의 비율에서의 차이는 관찰할 수 없었지만 세포의 수로 비교해 본 결과 Peli1 유도 발현 마우스(rtTA-Peli1)에서 전체적인 면역세포의 수가 증가되어 있을 뿐 아니라 CD3+, CD4+,CD8+ T 세포의 수가 크게 증가되어 있는 것을 확인하였다.
또한, 활성화 되어 있는 T 세포의 비율과 수를 그래프를 이용하여 분석한 결과, 도 4k 및 도 4l에 나타낸 바와 같이, Peli1 유도 발현 마우스(rtTA-Peli1)의 림프절에서의 전체적인 면역세포의 수가 증가되어 있기 때문에 비활성화, 활성화 T 세포의 수는 증가하였지만 그 비율을 확인한 결과 비활성화 세포에 대한 활성화 세포의 비율이 증가되어 있음을 확인할 수 있었다. 이를 통하여 본 발명에 따른 Peli1 유도 발현 마우스(rtTA-Peli1)에서의 면역세포들은 비정상적으로 활성화되어 있음을 알 수 있었다.
5-4. T세포의 도움 T 반응 변화 확인
기존에 보고된 바에 의하면 건선 동물 모델 및 환자에서 비정상적인 도움 T 반응이 유도된다고 알려져 있다. 이에 림프절의 CD3+ T 세포의 cDNA를 이용하여 IFNγ, IL-4, IL-22, IL-23과 같은 사이토카인의 수준을 정량적 역전사 중합효소 연쇄반응을 이용하여 비교하였다. 그 결과, 도 5a에 나타난 바와 같이, 1형 도움 T 반응에서 분비되는 사이토카인인 IFNγ와 17형 도움 T 반응에서 분비되는 사이토카인인 IL-22, IL-23가 크게 증가한 것을 확인할 수 있었다.
또한, 비정상적인 도움 T 반응이 피부층에서도 또한 유도되고 있는지 확인하기 위하여 실시예 1-5에 기재된 면역염색법을 통하여 IL-17과 IL-23에 대한 항체를 이용하여 수행하였다. 그 결과, 도 5b와 도 5c에 나타난 바와 같이, 대조군 마우스(rtTA)에 비해서 Peli1 유도 발현 마우스(rtTA-Peli1)에서 IL-17 또는 IL-23에 대한 항체로 염색된 세포의 수가 크게 증가되어 있는 것을 확인할 수 있었다.
이는 건선에서 나타나는 표현형과 매우 유사하며 이를 통하여 본 발명에 따른 Peli1 유도 발현 마우스(rtTA-Peli1)에서의 면역세포는 비정상적으로 활성화되어 있을 뿐만 아니라 비정상적인 도움 T 반응을 확인할 수 있었다.
5-5. 건선 환자에서 나타나는 병변과의 유사성 비교
상기 실시예 5-1 내지 5-4을 통해 Peli1 유도 발현 마우스(rtTA-Peli1)에서 나타나는 다양한 병변들을 분석한 결과를 토대로 건선환자에서 나타나는 표현형과 유사성을 비교하였다. 그 결과 하기 표 2에 나타낸 바와 같이, 건선환자에서 나타나는 표현형과 본 발명에 따른 Peli1 유도 발현 마우스(rtTA-Peli1)에서 나타나는 표현형이 매우 유사한 것을 확인하였다.
실시예 6. 새로운 건선 치료 타겟으로서의 Peli1 가능성 검증
상기 실시예 4 및 실시예 5의 결과를 토대로 Peli1 단백질의 과발현에 의한 건선의 유발 가능성을 확인하였는바, Peli1 단백질 발현 억제에 의한 건선 질환의 치료 가능성을 확인하고자 하기 실험을 수행하였다.
6-1. Doxycycline 투여에 의한 건선 치료 가능성 확인
대조군 마우스(rtTA)와 실험군 마우스(rtTA-Peli1)에 일정기간 Doxycycline 투여를 통하여 건선의 표현형이 나타날 때 다시 Doxycycline의 투여를 제거함에 따라 Peli1의 발현이 정상 수준으로 낮아 졌을 때 건선의 표현형을 분석하였다. 그 결과, 도 6a에 나타난 바와 같이, 5개월 동안 계속해서 Doxycycline을 투여한 경우 Peli1 유도 발현 마우스(rtTA-Peli1)에서는 건선의 표현형이 나타나는 반면 3개월 동안 Doxycyline을 투여한 이후 Doxycyline을 제거하였을 때 건선의 표현형이 사라지고 대조군 마우스(rtTA)와 흡사한 표현형을 확인할 수 있었다.
다음으로, 대조군 (rtTA) 마우스와 실험군 (rtTA-Peli1) 마우스에 독시사이클린을 12주 동안 투여한 다음, 다시 독시사이클린을 투여 및 제거하면서 나타나는 표현형 변화를 점수화하였다. 그 결과, 도 6b에 나타낸 바와 같이, 독시사이클린 투여 및 제거기간을 따라 점수가 계속 증가 및 감소하는 것을 확인하였다.
상기 도 6a와 도 6b의 결과에 따라 피부층의 구조를 확인하기 위하여 상기 실시예 1-5에 기재된 헤마톡실린&에오신(H&E) 염색을 수행하였다. 그 결과, 도 6c에 나타낸 바와 같이, Doxycycline 투여에 따라 Peli1 유도 발현 마우스(rtTA-Peli1)의 피층 세포 (Epidermal cell)의 층이 매우 크게 증가되어 있는 것은 물론 건선 환자의 피부층 구조에서 흔히 발견되는 착각화증(Parakeratosis), 과각화증(Hyperkeratosis), 표피능(rete ridge), 미세고름(microabscess)의 표현형이 관찰되었다. 하지만 doxycyline을 투여한 후 제거한 Peli1 유도 발현 마우스(rtTA-Peli1)의 피부층의 구조에서 착각화증(Parakeratosis), 과각화증(Hyperkeratosis), 표피능(rete ridge)의 표현형 사라짐은 물론 대조군 마우스(rtTA)의 피부층 구조와 매우 유사한 것을 확인하였다.
상기로 부터, 비정상적으로 증가한 Peli1의 발현은 건선의 발병을 유도할 수 있으며 이러한 Peli1의 발현을 다시 정상수준으로 낮추어 주었을 때 정상과 매우 유사한 피부층의 표현형이 나타나는 것을 확인함으로써 새로운 건선 치료 타겟로서의 Peli1의 가능성을 확인할 수 있었다.
6-2. Peli1의 발현이 억제되었을 때 건선 유도에 따른 병변 수준 확인
상기 실시예 6-1에 따라 비정상적으로 증가한 Peli1의 발현을 정상수준으로 낮추어 주었을 때 건선 병변 수준이 정상 수준으로 낮아지는 것을 확인하였는바, 정상 수준에서 Peli1의 발현이 억제되었을 때 건선 유도에 따른 병변 수준을 확인하고자 하기 실험을 수행하였다.
구체적으로, 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에 TLR 7과 9의 작용제(agonist)인 이미퀴모드(IMQ)를 이용한 건선 동물 모델을 이용하여 매일 62.5mg의 이미퀴모드를 제모한 마우스의 등에 처리하는 실험을 진행하였다 (도 7a 참조).
그 결과, 도 7b에 나타낸 바와 같이, 정상 마우스(WT)의 경우 이미퀴모드 처리에 따라 홍반 및 각질과 같은 건선의 표현형이 나타나는 것을 확인 하였으나 Peli1 발현 억제 마우스(Peli1 KO)에서는 홍반은 나타나지만 정상 마우스(WT)에 비해 각질의 형성 수준이 낮은 것을 확인하였다.
다음으로, 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에 이미퀴모드를 처리한 다음, 건선 표현형 변화를 점수화하였다. 그 결과, 도 7c에 나타낸 바와 같이, 이미퀴모드 처리에 따라 정상 마우스(WT)의 경우 점수가 증가하는 것을 확인하였으며 그에 비해 Peli1 발현 억제 마우스(Peli1 KO)에서는 정상 마우스 보다 낮은 점수를 나타냄을 확인하였다.
상기 도 7b 및 도 7c의 결과에 따라 피부층의 구조를 확인하기 위하여 상기 실시예 1-5에 기재된 헤마톡실린&에오신(H&E) 염색을 수행하였다. 그 결과 도 7d와 도 7e에 나타낸 바와 같이, 이미퀴모드의 처리에 따라 정상 마우스(WT)의 피부 두께가 증가하는 것을 확인하였으나 Peli1 발현 억제 마우스(Peli1 KO)에서는 정상 마우스에 비해 피부 두께가 덜 증가하는 것을 확인하였다. 또한 표피능(Rete ridge)의 깊이가 Peli1 발현 억제 마우스(Peli1 KO)에서 정상 마우스(WT)에 비해 짧은 것을 확인으며 과각화증(Hyperkeratosis) 또한 Peli1 발현 억제 마우스(Peli1 KO)에서 정상 마우스(WT)에 비해 완화되어 있는 것을 확인하였다.
상기로부터, 기존의 이미퀴모드 처리에 의한 건선 동물 모델을 이용하여 정상 마우스(WT)와 Peli1 발현 억제 마우스(Peli1 KO)에서 건선 병변의 표현형이 비교한 결과, Peli1 발현이 억제 되었을 때 이미퀴모드 처리에 의한 건선 병변 수준이 정상에 비해 낮은 것을 확인함으로써 새로운 건선 치료의 타겟으로서의 Peli1의 가능성을 다시 확인할 수 있었다.
실시예 7. Peli1 유도 발현 마우스의 전임상 건선 동물 모델용도 검증
상기 실시예 4 및 실시예 5의 결과를 토대로 Peli1 유도 발현 마우스에 독시사이클린의 투여에 따른 Peli1 단백질의 과발현에 의한 건선의 유발 가능성을 확인하였는바, Peli1 유도 발현 마우스의 건선 치료제 스크리닝 및 효과 검증을 위한 전 임상(Preclinical) 건선 동물 모델로서 검증해 보고자 하였다.
이를 위해서, 기존의 강력한 면역억제제로서 건선질병을 완화시킴으로서, 건선 환자에 사용되는 전신 치료제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)의 작용기전은 사이클로스포린(CsA)의 경우 T 세포의 활성을 유도하는 calcineurin의 활성을 저해함으로써 NFAT의 기능을 저해하고 이로 인하여 특정 사이토카인의 분비를 감소시켜 T 세포의 활성을 억제한다.
또한, 메소트렉세이트(MTX)의 경우에는 상피세포의 과분열, 활성 T 세포의 세포자살 유도 및 호중구의 주화성(chemotaxis)과 특정 사이토카인의 분비를 저해한다.
상기에 따라, 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 투여하였을 때 Peli1 유도 발현 마우스의 건선 표현형을 완화시키는지, 또한 이에 전 임상(Preclinical) 동물 모델로서 적용이 가능한지 검증해 보고자 하였다.
이를 위해, 도 8a에 나타낸 바와 같이, 대조군 마우스(rtTA)와 실험군 마우스(rtTA-Peli1)에 일정기간(12주)동안 Doxycycline 투여를 통하여 건선의 표현형이 나타날 때 사이클로스포린(CsA)는 주 6회 투여하고 메소트렉세이트(MTX)는 주 4회 복강주사로 투여한 후 건선의 표현형을 분석하였으며, 피부층의 구조를 확인하기 위하여 상기 실시예 1-5에 기재된 헤마톡실린&에오신(H&E) 염색을 수행하였다.
그 결과, 도 8b에 나타낸 바와 같이, Peli1 유도 발현 마우스(rtTA-Peli1)의 착각화증(Parakeratosis), 과각화증(Hyperkeratosis), 표피능(rete ridge), 미세고름(microabscess)의 표현형이 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 투여한 후에 대부분 사라지는 것을 확인하였다. 하지만 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 투여한 후에도 표피층 세포(Epidermal cell)의 증식에 따른 피부 두께의 증가는 여전히 관찰됨을 확인하였다.
다음으로, 대조군 마우스(rtTA)와 실험군 마우스(rtTA-Peli1)에 일정기간 (12주)동안 Doxycycline 투여를 통하여 건선의 표현형이 나타날 때 기존의 환자에 사용되는 치료용 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 일정기간동안 복강주사로 투여한 후 건선 표현형을 점수화하였다.
그 결과, 도 8c에 나타낸 바와 같이, 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 일정기간동안 복강주사로 투여하였을 때 건선 표현형 점수가 감소하는 것을 확인하였다.
상기 도 8b의 결과에 따라 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 일정기간동안 복강주사로 투여한 후 대부분의 건선 표현형은 사라지나 표피층 세포(Epidermal cell)의 증식에 따른 피부 두께의 증가는 여전히 관찰됨을 확인한 바, 피부 두께 변화를 관찰하였다.
그 결과, 도 8d에 나타낸 바와 같이, Doxycycline 투여에 따라 건선의 표현형이 나타난 Peli1 유도 발현 마우스에 면역억제제인 사이클로스포린(CsA)와 메소트렉세이트(MTX)를 일정기간동안 복강주사로 투여한 후 피부의 두께가 절반 정도 감소하는 것을 확인하였다.
상기로부터, Doxycycline 투여에 따라 건선의 표현형을 나타내는 Peli1 유도 발현 마우스를 이용하여 건선 치료제를 이용하여 효과 검증을 확인한 결과 건선 질병 표현형이 감소하는 것을 확인함으로써 새로운 건선 치료제의 스크리닝 및 효과 검증을 위한 전 임상(Preclinical) 동물 모델로서의 가능성을 검증할 수 있었다.
실시예 8. Peli1 단백질 발현 억제제 제조
상기 실시예 6의 결과를 토대로 Peli1 단백질 발현 억제에 의한 건선 질환의 치료 가능성을 확인하였는바, Peli1 mRNA에서의 단백질의 합성을 저해하기 위하여 타겟 mRNA 서열을 확인하고(도 9a 참조), 이를 기반으로 하여 하기와 같이, shRNA 및 siRNA를 제작하였다.
Target mRNA sequence #1 : GGGTTCAACACACTAGCAT (서열번호 3)
Target mRNA sequence #2 : GCTCCTTTGGATATGCAATTT (서열번호 4)
다음으로, 제작된 shRNA를 세포 내로 주입하여 Peli1 단백질의 발현을 상기 실시예 1-3에 기재된 웨스턴 블랏팅을 통하여 확인한 결과, 도 9b에 나타낸 바와 같이, Peli1의 mRNA를 타겟으로 하는 shRNA가 세포 내로 주입된 경우에는 Peli1 단백질의 발현이 효과적으로 억제되는 것을 확인하였다.
실시예 9. Peli1의 결합 활성을 저해하는 펩타이드 제조
9-1. Peli1의 결합 활성 저해 펩타이드 제작
Peli1은 E3 유비퀴틴 접합효소로서 RING-like 도메인을 통하여 접합효소로서의 활성을 나타내며 FHA 도메인을 통하여 타겟 단백질과의 결합이 일어난다. 이에, Peli1 과 타겟 단백질 사이의 결합을 저해하기 위하여 Peli1 단백질의 FHA 도메인 유래 펩타이드를 제작하였다.
| FHA 도메인 유래 펩타이드 서열 | |
| 95-114 | SNTDMFQIGRSTESPIDFVV |
| 101-116 | QIGRSTESPIDFVVTD |
| 109-124 | PIDFVVTDTVPGSQSN |
| 117-132 | TVPGSQSNSDTQSVQS |
| 125-140 | SDTQSVQSTISRFACR |
| 133-149 | TISRFACRIICERNPP |
| 177-196 | DGQMDGLTTNGVLVMHPRNG |
또한, 제작된 펩타이드의 세포 내 침투를 용이하게 하기 위하여 세포 투과 향상 펩타이드(Cell-penetrating peptide)를 연결하였고, 이때 사용된 세포 투과 향상 펩타이드는 하기와 같다(도 10 참조):
i) Polyarginines(RRRRRRRRR)
ii) Tat49-57(RKKRRQRRR)
iii) Penetratin(RQIKIWFQNRRMKWKK)
iv) Pep-1(KETWWETWWTEWSQPKKKRKV)
v) Transportan(GWTLNSAGYLLGKINLKALAALAKKIL)
vi) Nuclear localization sequences (VQRKRQKLMP, SKKKKIKV, GRKRKKRT)
vii) HP4 (RRRRPRRRTTRRRR)
도 10을 토대로 Peli1의 결합 활성 저해 펩타이드를 제작하기 위해 도 11a에 나타낸 모식도와 같이 세포 투과 향상 펩타이드인 HP4와 두 펩타이드를 연결시켜주는 GS linker 서열을 이용하여 Peli1 결합 활성 저해 펩타이드를 제작하였다.
9-2. Peli1의 결합 활성 저해 펩타이드의 세포 침투력 확인
상기 실시예 9-1로부터 제작된 Peli1의 결합 활성 저해 펩타이드의 세포 침투력을 확인하가 위해서, 세포배양액에 Peli1 결합 활성 저해 펩타이드를 처리한 후, 형광 염색을 통하여 세포 침투 여부를 확인하였다.
그 결과, 도 11b에 나타난 바와 같이, 세포 투과 향상 펩타이드인 HP4가 결합된 경우 세포 침투력이 크게 향상되는 것을 확인하였다. 이에, 세포 투과 향상 펩타이드가 결합된 Peli1 결합 활성 저해 펩타이드가 세포 내로 침투되는 것을 확인하였다.
9-3. Peli1 결합 활성 저해 펩타이드의 기능 확인
다음으로, 상기 실시예 9-2에서 확인한 세포 내로 침투한 Peli1 결합 활성 저해 펩타이드에 대해서 그 기능을 확인하고자 하기와 같은 실험을 진행하였다.
구체적으로, 골수세포 유래의 대식세포를 이용하여 Peli1이 매개하는 TLR3 신호 전달 작용물질인 Poly(I:C)를 처리한 후, TLR3 신호전달의 활성화를 비교하였다.
그 결과, 도 11c에 나타낸 바와 같이, Peli1 결합 활성 저해 펩타이드의 세포 침투를 유도한 후 TLR3 신호 전달 작용물질인 Poly(I:C)를 처리하였을 때 신호 전달 활성이 저해되는 것을 구체적으로 확인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 형질전환 동물 모델은 건선 치료를 위한 후보약물 스크리닝 등의 임상적 연구에 유용하게 사용될 수 있을 것으로 기대된다. 또한, 기질 단백질과 Peli1 단백질의 정상적 기질 결합을 방해하는 FHA 결합 모티브를 표적으로 하는 Peli1 FHA 도메인 유래 펩타이드를 통해 건선 관련 질병의 신약 개발에 유용하게 활용될 수 있을 것으로 기대된다.
Claims (24)
- Peli1 (Pellino homolog 1) 유전자를 과발현하도록 형질전환된, 건선 유발 동물 모델.
- 제1항에 있어서, 상기 Peli1 유전자는 독시사이클린의 투여에 따라 과발현되는 것을 특징으로 하는, 건선 유발 동물 모델.
- 제1항에 있어서, 상기 Peli1 유전자는 서열번호 1의 염기서열로 이루어지는 것을 특징으로 하는, 건선 유발 동물 모델.
- 하기의 단계를 포함하는, 건선 유발 동물 모델 제조방법:(a) Peli1 (pellino homolog 1) 유전자를 포함하는 발현벡터를 숙주동물의 수정란에 도입하는 단계;(b) 상기 도입된 수정란을 대리모의 자궁에 착상시키고 출산시켜서 1세대 후대동물을 수득하는 단계; 및(c) 상기 수득한 1세대 후대동물과 rtTA (reverse tetracycline transactivator) 모델동물을 교배시켜서 2세대 후대동물을 수득하는 단계.
- 하기의 단계를 포함하는 건선 치료제의 스크리닝 방법:a) 상기 제1항의 동물모델에 후보물질을 처리하는 단계; 및b) 상기 후보물질을 처리한 동물모델을 사육하면서 예후를 확인하는 단계.
- Peli1(Pellino homolog 1) 단백질의 발현 또는 활성 억제제를 유효성분으로 포함하는, 건선 예방 또는 치료용 약학적 조성물.
- 제6항에 있어서, 상기 Peli1 단백질은 서열번호 1의 염기서열로 이루어지는 폴리뉴클레오티드로 코딩되는 것을 특징으로 하는, 약학적 조성물.
- 제6항에 있어서, 상기 Peli1 단백질은 서열번호 2의 아미노산 서열로 이루어지는 것을 특징으로 하는, 약학적 조성물.
- 제6항에 있어서, 상기 Peli1 단백질의 발현 억제제는 Peli1 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA (short interfering RNA), 짧은 헤어핀 RNA (Short hairpin RNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 약학적 조성물.
- 제6항에 있어서, 상기 Peli1 단백질의 활성 억제제는 상기 Peli1 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 약학적 조성물.
- 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진, 펩타이드.
- 제11항에 있어서, 상기 펩타이드는 Peli1 단백질과 기질 단백질과의 결합을 억제하는 것을 특징으로 하는, 펩타이드.
- 제11항 또는 제12항 중 어느 한 항의 펩타이드를 유효성분으로 포함하는, 건선 예방 또는 치료용 약학적 조성물.
- 세포 투과성 펩타이드와 서열번호 5 내지 서열번호 11로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열로 이루어진 펩타이드가 연결되어 있는 것을 특징으로 하는, Peli1 결합 활성 저해 펩타이드.
- 제14항에 있어서, 상기 Peli1 결합 활성 저해 펩타이드는 GS linker로 연결되어 있는 것을 특징으로 하는, Peli1 결합 활성 저해 펩타이드.
- 제14항에 있어서, 상기 세포 투과성 펩타이드는 폴리아르기닌 (Polyarginines), Tat49-57, 페너트라틴 (Penetratin), Pep-1, 트랜스포탄 (Transportan), NLS (Nuclear localization sequence) 및 HP4로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, Peli1 결합 활성 저해 펩타이드.
- 제14항 내지 제16항 중 어느 한 항의 Peli1 결합 활성 저해 펩타이드를 유효성분으로 포함하는, 건선 예방 또는 치료용 약학적 조성물.
- Peli1 단백질의 발현수준을 측정하는 제제를 포함하는 건선 진단용 조성물.
- 제18항에 있어서, 상기 Peli1 단백질은 서열번호 1의 염기서열로 이루어지는 폴리뉴클레오티드로 코딩되는 것을 특징으로 하는, 진단용 조성물.
- 제18항에 있어서, 상기 Peli1 단백질은 서열번호 2의 아미노산 서열로 이루어지는 것을 특징으로 하는, 진단용 조성물.
- 제6항, 제13항, 또는 제17항의 약학적 조성물을 개체에 투여하는 단계를 포함하는 건선 치료방법.
- 제6항, 제13항, 또는 제17항의 약학적 조성물의 건선 예방 또는 치료용도.
- Peli1 단백질의 발현수준을 측정하는 단계를 포함하는, 건선 진단방법.
- Peli1 단백질의 발현수준을 측정하는, 건선 진단용도.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201780042264.5A CN109475108A (zh) | 2016-07-05 | 2017-06-30 | 诱发牛皮癣动物模型及其用途 |
| US16/315,687 US20190281797A1 (en) | 2016-07-05 | 2017-06-30 | Psoriasis-induced animal model and use thereof |
| US17/014,113 US20200396973A1 (en) | 2016-07-05 | 2020-09-08 | Psoriasis-induced animal model and use thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20160084594 | 2016-07-05 | ||
| KR10-2016-0084594 | 2016-07-05 | ||
| KR1020170082620A KR102033215B1 (ko) | 2016-07-05 | 2017-06-29 | 건선 유발 동물 모델 및 이의 용도 |
| KR10-2017-0082620 | 2017-06-29 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/315,687 A-371-Of-International US20190281797A1 (en) | 2016-07-05 | 2017-06-30 | Psoriasis-induced animal model and use thereof |
| US17/014,113 Division US20200396973A1 (en) | 2016-07-05 | 2020-09-08 | Psoriasis-induced animal model and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018008902A1 true WO2018008902A1 (ko) | 2018-01-11 |
Family
ID=60912963
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/006962 Ceased WO2018008902A1 (ko) | 2016-07-05 | 2017-06-30 | 건선 유발 동물 모델 및 이의 용도 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018008902A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002531123A (ja) * | 1998-12-09 | 2002-09-24 | プロテイン デザイン ラブス インコーポレイティド | ヒトの乾癬を予防及び治療するための乾癬モデル動物 |
| US20060246452A1 (en) * | 2003-03-28 | 2006-11-02 | Gonda Thomas J | Method for identifying nucleic acid molecules associated with angiogenesis |
| KR20160042266A (ko) * | 2014-10-07 | 2016-04-19 | 성균관대학교산학협력단 | 림프종 모델동물 및 그의 용도 |
-
2017
- 2017-06-30 WO PCT/KR2017/006962 patent/WO2018008902A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002531123A (ja) * | 1998-12-09 | 2002-09-24 | プロテイン デザイン ラブス インコーポレイティド | ヒトの乾癬を予防及び治療するための乾癬モデル動物 |
| US20060246452A1 (en) * | 2003-03-28 | 2006-11-02 | Gonda Thomas J | Method for identifying nucleic acid molecules associated with angiogenesis |
| KR20160042266A (ko) * | 2014-10-07 | 2016-04-19 | 성균관대학교산학협력단 | 림프종 모델동물 및 그의 용도 |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE NCBI [O] 15 March 2015 (2015-03-15), XP055451813, Database accession no. NP_065702.2 * |
| DATABASE Nucleotide [O] 15 March 2015 (2015-03-15), XP055451808, Database accession no. NM_020651.3 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Eldershaw et al. | Expression and function of the autoimmune regulator (Aire) gene in non-thymic tissue | |
| WO2021201571A1 (ko) | Igsf1 에 대한 항체를 유효성분으로 포함하는 암 예방 또는 치료용 약학 조성물 및 이를 이용한 암 치료 방법 | |
| WO2013169077A1 (ko) | 악액질 예방 또는 치료용 조성물 | |
| Johnson et al. | Silencing of the Fibroblast growth factor 21 gene is an underlying cause of acinar cell injury in mice lacking MIST1 | |
| Costanza et al. | Prolactin is not required for the development of severe chronic experimental autoimmune encephalomyelitis | |
| KR102033215B1 (ko) | 건선 유발 동물 모델 및 이의 용도 | |
| WO2019194586A1 (en) | Novel target for anti-cancer and immune-enhancing | |
| WO2022216096A1 (ko) | 항암 및 면역증강용 신규 타겟 | |
| WO2023022271A1 (ko) | 항-igsf1 항체 및 이의 용도 | |
| WO2021158091A2 (ko) | 케모카인 억제제, 콜로니 자극 인자 억제제 및 면역항암제를 포함하는 암의 예방 또는 치료용 조성물 및 병용 요법 | |
| WO2022092915A1 (ko) | Gdf15를 유효성분으로 함유하는 면역질환의 예방 및 치료용 조성물 | |
| WO2018008902A1 (ko) | 건선 유발 동물 모델 및 이의 용도 | |
| WO2010137770A1 (ko) | 신규한 gpcr 단백질 및 이의 용도 | |
| WO2021177518A1 (ko) | 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물 | |
| WO2022025455A1 (ko) | 염증성 질환의 예방 또는 치료용 조성물 및 이의 용도 | |
| Matsubara et al. | Experimental allergic myositis in SJL/J mouse. Reappraisal of immune reaction based on changes after single immunization | |
| McRae et al. | Downregulation of the GHRH/GH/IGF1 axis in a mouse model of Börjeson-Forssman-Lehman syndrome | |
| WO2023153763A1 (ko) | C-met의 에피토프 및 hif1alpha의 에피토프를 포함하는 암 백신 및 이의 용도 | |
| WO2024063526A1 (ko) | 섬유화 질환의 예방 또는 치료용 신규 항체 | |
| WO2018203613A1 (ko) | 톨-유사 수용체(tlr) 억제를 위한 펩타이드 및 이를 포함하는 약학적 조성물 | |
| WO2022098080A1 (ko) | 신규 항-tie2 항체 또는 이의 항원 결합 단편, 및 이의 용도 | |
| US20160152704A1 (en) | Cadherin 15 agonists | |
| WO2020080656A1 (ko) | Fgf2 또는 api5 유래 펩타이드 및 그의 용도 | |
| Schwakopf | Characterization of Murine Thymic Adipocytes by Multiomic Sequencing During Thymic Involution | |
| WO2017164486A1 (ko) | Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17824458 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17824458 Country of ref document: EP Kind code of ref document: A1 |
