WO2018008902A1 - Modèle animal induit par le psoriasis et son utilisation - Google Patents

Modèle animal induit par le psoriasis et son utilisation Download PDF

Info

Publication number
WO2018008902A1
WO2018008902A1 PCT/KR2017/006962 KR2017006962W WO2018008902A1 WO 2018008902 A1 WO2018008902 A1 WO 2018008902A1 KR 2017006962 W KR2017006962 W KR 2017006962W WO 2018008902 A1 WO2018008902 A1 WO 2018008902A1
Authority
WO
WIPO (PCT)
Prior art keywords
peli1
psoriasis
protein
peptide
mice
Prior art date
Application number
PCT/KR2017/006962
Other languages
English (en)
Korean (ko)
Inventor
이창우
고현정
김수현
배서윤
Original Assignee
성균관대학교산학협력단
재단법인 아산사회복지재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020170082620A external-priority patent/KR102033215B1/ko
Application filed by 성균관대학교산학협력단, 재단법인 아산사회복지재단 filed Critical 성균관대학교산학협력단
Priority to CN201780042264.5A priority Critical patent/CN109475108A/zh
Priority to US16/315,687 priority patent/US20190281797A1/en
Publication of WO2018008902A1 publication Critical patent/WO2018008902A1/fr
Priority to US17/014,113 priority patent/US20200396973A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07—Tetrapeptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10—Tetrapeptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present invention relates to a psoriasis-induced animal model and its use, and more particularly, to a psoriasis-induced animal model and its use transformed to overexpress Peli1 (Pellino homolog 1) gene upon administration of doxycycline.
  • Psoriasis is a typical chronic skin disease that usually lasts for 10-20 years after onset and should live with the possibility of lifelong recurrence even if temporarily improved due to treatment.
  • Psoriasis is characterized by erythematous skin lesions covered with clear white-white scales, which occur mainly in the elbow, knee, hip, and scalp.
  • psoriasis can develop many complications. Among them is psoriatic arthritis, a specific arthritis that occurs in psoriasis patients. There is no direct way to prevent such psoriasis, and the best way to prevent exacerbation is to prevent it.
  • the number of patients diagnosed with psoriasis is about 3% in the world, about 1-2% in Korea, and about one third of them are severe psoriasis patients that are almost impossible to cure.
  • 16,936 people in Korea were treated with psoriasis during 2013.
  • T cells T cells
  • cytokines secreted by T cells stimulate epidermal cells, causing excessive proliferation and inflammation of epidermal cells.
  • Immunological abnormalities and mutations in genes are emerging as a major research area.
  • environmental factors, drugs, persistent skin irritation, dry skin, upper respiratory tract inflammation, and mental stress have been shown to cause or worsen psoriasis.
  • the present invention has been made to solve the above problems, the inventors have confirmed that the mice transformed to overexpress the Peli1 gene upon doxycycline administration can be used as an animal model for the treatment of severe psoriasis, Peli1 protein expression or activity inhibitors can prevent, ameliorate, inhibit or treat psoriasis by identifying the possibility of psoriasis induced by overexpression of Peli1 protein, and Peli1 peptide derived from Peli1 FHA domain that targets the FHA binding motif of matrix proteins By interfering with normal substrate binding of the protein, it was confirmed that it can be used as a new therapeutic agent, and based on this, the present invention was completed.
  • an object of the present invention is to provide a psoriasis-induced animal model and a method for producing the psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene.
  • Another object of the present invention to provide a method for screening a psoriasis treatment using the animal model.
  • Peli1 is provided as a therapeutic target for the development of psoriasis treatment. .
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating psoriasis comprising a peptide and any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 as an active ingredient. It is.
  • another object of the present invention is a Peli1 binding activity inhibitory peptide, characterized in that the cell-penetrating peptide and a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 is linked and It is to provide a pharmaceutical composition for preventing or treating psoriasis comprising Peli1 binding activity inhibitory peptide as an active ingredient.
  • Another object of the present invention is to provide a psoriasis diagnostic composition comprising an agent for measuring the expression level of Peli1 protein.
  • the present invention provides a psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene.
  • the Peli1 gene may be overexpressed upon administration of doxycycline.
  • the Peli1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.
  • the present invention provides a method for producing a psoriasis-induced animal model comprising the following steps:
  • the present invention also provides a method for screening a psoriasis treatment comprising the following steps:
  • the present invention provides a pharmaceutical composition for preventing or treating psoriasis, comprising an inhibitor of Peli1 (Pellino homolog 1) protein expression or activity as an active ingredient.
  • the Peli1 protein may be encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.
  • the Peli1 protein may be composed of the amino acid sequence of SEQ ID NO: 2.
  • the expression inhibitor of the Peli1 protein is antisense nucleotides, complementary binding to the mRNA of the Peli1 gene, short interfering RNA (short interfering RNA), short hairpin RNA (Short hairpin RNA) and ribozyme ( ribozyme) can be any one selected from the group consisting of.
  • the activity inhibitor of the Peli1 protein is any one selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers and antibodies that complementarily bind the Peli1 protein. Can be.
  • the present invention also provides a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11.
  • the peptide may inhibit the binding of the Peli1 protein and the matrix protein.
  • the present invention provides a Peli1 binding activity inhibitory peptide, characterized in that the cell permeable peptide and the peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 11 is linked.
  • the Peli1 binding activity inhibitory peptide may be linked by GS linker.
  • the cell permeable peptide is polyarginine (Polyarginines), Tat 49 -57 , Pentratratin (Penetratin), Pep-1, Transportan, NLS (Nuclear localization sequence) and HP4 It may be any one selected from the group consisting of.
  • the present invention also provides a pharmaceutical composition for preventing or treating psoriasis, comprising the peptide or Peli1 binding activity inhibitory peptide as an active ingredient.
  • the present invention also provides a method for treating psoriasis comprising administering the pharmaceutical composition to a subject.
  • the present invention provides a psoriasis prevention or treatment of the pharmaceutical composition.
  • the present invention also provides a novel use of the gene encoding Peli1 (Pellino homolog 1) protein for the production of a composition for treating psoriasis.
  • the present invention also provides a composition for diagnosing psoriasis comprising an agent for measuring the expression level of Peli1 protein.
  • the present invention also provides a method for detecting Peli1 protein from a subject's sample in order to provide the information needed to diagnose psoriasis.
  • the present invention also provides a diagnostic use of psoriasis of the Peli1 protein.
  • the transgenic animal model according to the present invention was found to overexpress the Peli1 (Pellino homolog 1) gene following administration of doxycycline, and showed similarity with the phenotype seen in psoriasis patients. For this purpose, it is possible to design animal models and be useful for clinical research such as screening candidate drugs for psoriasis treatment.
  • Peli1 FHA domain targeting the FHA binding motif that interferes with the normal substrate binding of the substrate protein and Peli1 protein The derived peptide is expected to be useful for the development of new drugs for psoriasis-related diseases.
  • Peli1 protein by confirming the expression level of the Peli1 protein, it is expected that it can be usefully used to evaluate the disease level of psoriasis patients.
  • Figure 1a is a schematic diagram showing the manufacturing process of the Delicycline inducible Peli1 transgenic mice Peli1 overexpression according to doxycycline administration.
  • Figure 1b is a result confirmed by PCR whether or not transformed to overexpress Peli1 upon doxycycline administration.
  • Figure 2 shows the results confirmed by Western blotting Peli1 protein expression in each tissue of Peli1 induced expression mice following doxycycline administration.
  • Figure 3a is a visual comparison of spontaneous lesion induction following doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • FIG. 3B is a result of calculating the ratio of mice in which the phenotype as shown in FIG. 3A is shown.
  • Figure 3c is the result of scoring the lesion level according to doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 4a is a result of comparing the structure of the skin layer through H & E staining to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Peli1 antibody and Psoriasin antibody which is a psoriasis disease marker protein, to identify cells inducing overexpression of Peli1 following doxycycline administration in induced Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). Is the result.
  • Figure 4c is to determine whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA), K14 in the base layer, K10 in the polar layer, Loricrin in the granule layer Immunostaining was performed using an antibody against the skin layer to compare developmental changes.
  • Figure 4d shows the proliferation capacity of the basal layer cells by immunostaining using antibodies against Ki67 and K14 to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA) Is the result of comparing.
  • Figure 4e is a result of comparing the changes in angiogenesis by immunostaining using CD31 antibody in order to determine whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • FIG. 4F is a comparison of T cell invasion changes by immunostaining using CD3 antibody to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). to be.
  • Figure 4g and 4h is a result of comparing the lymph node changes around the skin lesion to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 4i is a result of comparing the activation of immune cells in lymph nodes using flow cytometry to verify whether peliosis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • 4J and 4K are graphs of the results of FIG. 4I.
  • FIG. 4L compares the percentage of T cells activated in the results of FIG. 4I according to doxycycline administration.
  • FIG. 5A illustrates IFN ⁇ , IL-4, and IL- using cDNA of CD3 + T cells in lymph nodes to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). 22, cytokine levels such as IL-23 using a quantitative reverse transcriptase chain reaction.
  • 5b is a result of immunostaining using an antibody against IL-17 to verify whether psoriasis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 5c is the result of immunostaining using an antibody against IL-23 to verify whether peliosis induced by doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 6a is a visual comparison of the spontaneous lesion induction following doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 6b is a result of scoring the lesion level according to doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • Figure 6c is a result of comparing the structure of the skin layer through H & E staining to verify whether psoriasis induced by doxycycline administration and removal in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • FIG. 7A is a schematic diagram of applying an imiquimod induced psoriasis model to normal mice (WT) and Peli1 expression inhibiting mice (Peli1 KO) to confirm whether psoriasis induction is inhibited when expression of Peli1 protein is inhibited.
  • Figure 7c is the result of scoring the level of psoriasis lesions following imiquimod treatment in normal mice (WT) and Peli1 expression inhibited mice (Peli1 KO).
  • Figure 7d is a graph showing the result of measuring the thickness of the skin according to the imiquimod treatment in normal mice (WT) and Peli1 expression suppression mice (Peli1 KO).
  • Figure 7e is a result of comparing the structure of the skin layer through H & E staining to verify the level of psoriasis lesions after four treatments of imiquimod in normal mice (WT) and Peli1 expression inhibiting mice (Peli1 KO).
  • FIG. 8A shows doxycycline for 12 weeks in Peli1 induced expressing mice (rtTA-Peli1) and control mice (rtTA) for validation as a preclinical animal model for evaluating drug efficacy of Peli1 induced expressing mice (rtTA-Peli1).
  • FIG. 8B shows psoriasis lesions after intraperitoneal injection of cyclosporine (CsA) and mesotrexate (MTX) for 12 weeks after doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA).
  • CsA cyclosporine
  • MTX mesotrexate
  • 8c shows psoriasis lesions after 12 weeks of doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA) after intraperitoneal injection of the immunosuppressive cyclosporine (CsA) and mesotrexate (MTX) This is the result of scoring the level of.
  • FIG. 8D shows the skin after intraperitoneal injection of cyclosporine (CsA) and mesotrexate (MTX), which are immunosuppressive agents, for 12 weeks after doxycycline administration in Peli1 induced expression mice (rtTA-Peli1) and control mice (rtTA). It is the result which measured and measured by thickness.
  • CsA cyclosporine
  • MTX mesotrexate
  • Figure 9a schematically shows the process of identifying the target mRNA sequence and producing shRNA for it to inhibit the synthesis of protein in Peli1 mRNA.
  • Figure 9b is a result of Western blot to confirm whether the expression of the Peli1 protein is inhibited by injecting the shRNA produced through the 7a into the cell.
  • FIG. 10 schematically shows the preparation of a peptide that inhibits the binding activity of Peli1 and the process by which the peptide inhibits the binding activity of Peli1.
  • Figure 11a schematically shows the manufacturing process of peptides that inhibit the binding activity of Peli1.
  • Figure 11b is a result of confirming the cell penetration of the peptide inhibiting the binding activity of Peli1 bound to the cell permeation enhancement peptide to increase the cell penetration through fluorescence staining.
  • Figure 11c is a result of comparing the toll-like receptor (TLR) signaling activation after treatment with Peli1 binding activity inhibitory peptide by Western blotting.
  • TLR toll-like receptor
  • the present inventors studied to develop an animal model suitable for use in the research and development of psoriasis treatments, and confirmed that the mice transformed with the Peli1 gene overexpression following doxycycline administration showed similarity to the phenotype seen in psoriasis patients. Based on this, the present invention has been completed.
  • the present invention provides a psoriasis-induced animal model transformed to overexpress Peli1 (Pellino homolog 1) gene upon administration of doxycycline.
  • the present invention also provides a method for preparing a psoriasis-induced animal model, comprising the following steps:
  • Peli1 (pellino homolog 1) gene of the present invention means a gene encoding the pellino homolog 1 protein known as E3 ubiquitin zygotease, which is present on chromosome 2 in humans, and chromosome 11 in mice.
  • E3 ubiquitin zygotease E3 ubiquitin zygotease
  • chromosome 2 chromosome 2 in humans
  • chromosome 11 chromosome 11 in mice.
  • NCBI NCBI Reference Sequence: NP_065702, NM_020651
  • the polynucleotide of SEQ ID NO: 1 was used as the Peli1 gene.
  • the animal may be a mouse, a rat, a cow, a horse, a pig, a monkey, a duck, a dog, a cat, or the like, and is preferably a mouse, but is not limited thereto.
  • a transgenic animal model in which the Peli1 gene is overexpressed according to administration of doxycycline (see Example 1), and verified whether the spontaneous lesion induction by doxycycline administration in the animal model, the control group Compared to the continuous administration of doxycycline it was confirmed that the lesion appears spontaneously. In particular, it was confirmed that the gloss of hair disappeared, hair loss progressed, and abnormal findings of the skin appeared (see Example 4).
  • CsA cyclosporin
  • MTX mesotrexate
  • the animal model according to the present invention can be usefully used for the treatment and research of psoriasis.
  • the present invention provides a method for screening a psoriasis therapeutic agent using the animal model produced by the above method.
  • the screening method comprises the steps of: a) treating a candidate material with the animal model; And b) identifying the prognosis while breeding the animal model treated with the candidate substance, wherein the candidate substance is a natural compound, a synthetic compound, RNA, DNA, polypeptide, enzyme, protein, ligand, antibody, antigen. Is preferably any one selected from the group consisting of bacterial or fungal metabolites and bioactive molecules, but is not limited thereto.
  • Peli1 protein expression or activity inhibitors can be used as an active ingredient of a composition useful for preventing, improving, inhibiting or treating psoriasis .
  • the present invention provides a pharmaceutical composition for preventing or treating psoriasis and a method for treating psoriasis using the same, comprising an inhibitor of the expression or activity of Peli1 (Pellino homolog 1) protein as an active ingredient.
  • the Peli1 protein in the present invention may be composed of the amino acid sequence of SEQ ID NO: 2.
  • prevention means any action that inhibits psoriasis or delays the onset by administration of a pharmaceutical composition according to the invention.
  • treatment means any action that improves or advantageously changes the symptoms of psoriasis by the administration of the pharmaceutical composition according to the present invention.
  • the expression inhibitor of Peli1 protein may be selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and ribozymes that complementarily bind to mRNA of Peli1 gene, but are not limited thereto.
  • the activity inhibitor of Peli1 protein is preferably made by any one selected from the group consisting of compounds, peptides, peptide mimetics, matrix analogs, aptamers, and antibodies that complementarily bind the Peli1 protein. It is not limited to, and any drug that inhibits Peli1 protein activity may be used.
  • Peptide Mimetics is to inhibit the activity of Peli1 protein by inhibiting the binding domain of the Peli1 protein
  • the peptide mimetics may be peptide or non-peptide, such as psi binding, It may also consist of amino acids bound by non-peptide bonds.
  • aptamer is a single-chain DNA or RNA molecule, specific chemical or biological molecule by an evolutionary method using an oligonucleotide library called systemic evolution of ligands by exponential enrichment (SELEX). It can be obtained by separating the oligomers having high affinity and selectivity for binding. Aptamers can specifically bind to targets and modulate the activity of the targets, such as by blocking the ability of the targets to function through binding.
  • the "antibody” may specifically and directly bind to Peli1 protein, thereby effectively inhibiting the activity of Peli1 protein.
  • the antibody specifically binding to the Peli1 protein it is preferable to use a polyclonal antibody or a monoclonal antibody.
  • Antibodies that specifically bind to the Peli1 protein may be prepared by known methods known to those skilled in the art, and commercially known Peli1 protein antibodies may be purchased and used.
  • the Peli1 protein acts as an E3 ubiquitin conjugatease by having a RING-like domain.
  • the Peli1 protein is activated through various posttranslational modification of proteins, acting as an E3 ubiquitin conjugation enzyme, and binding to the target protein through the FHA domain.
  • peptides derived from Peli1 FHA domain that target the FHA binding motif of substrate proteins can be used as novel therapeutics by interfering with normal substrate binding of Peli1 proteins.
  • the present invention provides a peptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NOs: 5 to 11 and a pharmaceutical composition for preventing or treating psoriasis comprising the peptide. .
  • the peptide may inhibit binding of Peli1 protein and substrate protein by targeting the FHA binding motif, and the peptide may also be a cell-penetrating peptide for facilitating intracellular penetration. May be connected.
  • the cell-penetrating peptide may be any one selected from the group consisting of Polyarginines, Tat49-57, Penetratin, Pep-1, Transportan, Nuclear localization sequence and HP4, preferably HP4, It is not limited.
  • gDNA genomic DNA
  • PCR polymerase chain reaction
  • TetO & Peli1 using gDNA as a template, four times of TetO & Peli1 were performed at 95 ° C 30 seconds, 55 ° C 30 seconds, and 72 ° C for 1 minute, followed by 95 ° C 30 seconds, 58 ° C 1 minute, 72 A total of 34 RT-PCRs were performed at 1 ° C.
  • R26 and rtTA PCR was performed a total of 34 times at 95 ° C 30 seconds, 65 ° C 1 minute, and 72 ° C 1 minute, and specific sequences of the primers used were as follows:
  • TetO & Peli1 primer sequences forward primer (cmv TetO-1) 5'-AAG TGA AAG TCG AGC TCG-3 '(SEQ ID NO: 12), reverse primer (Peli1 1/3 length) 5'-TGA TAT CGT GTG CTG GTC TTT G -3 '(SEQ ID NO: 13)
  • R26 & rtTA primer sequences (1) normal mouse (WT)-R26 (F) and R26 (R); Forward primer 5'- AAA GTC GCT CTG AGT TGT TAT-3 '(SEQ ID NO: 14), reverse primer 5'- GGA GCG GGA GAA ATG GAT ATG -3' (SEQ ID NO: 15) (2) Transgenic Mouse (Tg) R26 (F) and rtTA (R); Forward primer 5'- AAA GTC GCT CTG AGT TGT TAT -3 '(SEQ ID NO: 16), reverse primer 5'- GCG AAG AGT TTG TCC TCA ACC -3' (SEQ ID NO: 17)
  • Lysis buffer 150 mM NaCl, 20 mM HEPES, 5 mM EDTA, 0.5% Nonidet P-40, 1 mM phenylmethanesulfonyl fluoride, 10 mM NaF, 1 mM Na 3 Vo 4 , 1 mM dithiothreitol, and Protease inhibitor cocktail
  • a homogenizer 14,000 rpm, 30min, 4 °C. After obtaining the extract of the supernatant, the protein was quantified by Bradford quantitation method.
  • TBS-T buffer 100Mm NaCl, 20Mm Tris-HCl pH7.4, 0.05% Tween-20
  • transfer using nitrocellulose membraine
  • 5% skin milk After blocking with anti-Myc (Roche; 1: 2,000 dilution), anti-Peli1 (Santa Cruz; 1: 2,000 dilution) or anti- in 3% BSA (containing a solution of TBS-T) HRP-attached secondary antibody after ⁇ -actin (Sigma; 1: 4,000 dilution) antibody was reacted at 4 ° C.
  • Tissues of the mice were fixed with 10% neutral buffered formalin and paraffin blocks were prepared. Sections of 3 ⁇ m thickness were obtained from the paraffin block, followed by hematoxylin & eosin (H & E) staining. In the case of immunohistochemistry, staining was performed using anti-K14 antibody, anti-Ki67 antibody, anti-CD31 antibody, and anti-CD3 antibody, and then stained and encapsulated using an encapsulant containing DAPI reagent. Stained tissue samples were stained using a microscope [AxioCam digital microscope camera and AxioVision image processing software (Carl Zeiss)].
  • a transgenic animal model in which the Peli1 (Pellino homolog 1) gene is overexpressed upon administration of doxycycline was prepared as follows, and a schematic diagram of the manufacturing method is shown in FIG. 1A.
  • transgenic mice were prepared by microinjecting a vector cloned with the human Peli1 gene tagged Myc epitope (see FIG. 1A) into a 1-cell embryo. After microinjection, TetO (tetracycline-responsive element) Myc-Peli1 transgenic mice were selected through the genotyping method described in Example 1-2. Selected mice were crossed with a reverse tetracycline transactivator (R26-rtTA) mouse to obtain a doxycycline inducible TetO-Myc-Peli1 transgenic mice, and the transformation of the polymerase chain reaction described in Example 1-2 above was performed. It was confirmed through (polymerase chain reaction, PCR).
  • R26-rtTA reverse tetracycline transactivator
  • mice Intestine, Epidymis, Colon, Kidney, Skin, Testis, Prostate, Pancreas, Liver, Spleen, Lymph Node ( The expression of Myc-Peli1 in Lymphnodes, Bone marrow was confirmed by Western blotting described in Examples 1-3 above.
  • the lung, thymus, stomach, epididymis, colon, kidney, prostate pancreas, liver It was confirmed that the expression of Myc-Peli1 was high in the liver, spleen, lymph nodes, bone marrow, and the like.
  • doxycycline (2mg / ml) was administered to drinking water (Drinking water) for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, and then the lesions were visually confirmed.
  • rtTA control mice
  • rtTA-Peli1 experimental mice
  • the lesions were visually confirmed.
  • Figure 3a it was confirmed that the lesion appears spontaneously when doxycycline is continuously administered to Peli1 induced expression mice (rtTA-Peli1).
  • the gloss of hair disappeared, hair loss progressed, and abnormal skin was observed.
  • doxycycline was administered to control (rtTA) mice and experimental (rtTA-Peli1) mice for 24 weeks, followed by scoring phenotypic changes which were scored based on the criteria described in Table 1 below. As a result, as shown in Figure 3c, it was confirmed that the score continues to increase along the doxycycline administration period.
  • doxycycline (2mg / ml) was administered to drinking and drinking water for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, followed by hematoxylin & eosin (Example 1-5).
  • H & E confirmed the structure of the skin layer by staining.
  • the normal skin layer was formed in the control (rtTA) mice, while abnormal lesions were observed in the experimental group (rtTA-Peli1) mice.
  • the layers of epidermal cells are greatly increased, as well as Parakeratosis, Hyperkeratosis, Rete ridge, and microabscess, which are commonly found in the skin layer structure of psoriasis patients. Phenotype of was observed. From the above results, it was confirmed that the phenotype of psoriasis was observed in Peli1 induced expression mice.
  • doxycycline (2mg / ml) was administered in drinking water for 24 weeks in control (rtTA) mice and experimental (rtTA-Peli1) mice, and then Peli1 antibody was used to confirm that Peli1 protein was overexpressed in the skin layer. Tissue immunostaining was performed.
  • psoriasis is active infiltration of immune cells. Moreover, recent studies have shown that psoriasis is induced by abnormal activity of T cells, so that T cell infiltration is observed in the skin layer.
  • lymph nodes around the skin lesion were confirmed. More specifically, the lymph nodes around the inguinal, axillary, brachial and cervical, which are located near the skin layer, are isolated and confirmed by H & E staining described in Example 1-5. It was. As a result, as shown in Figures 4g and 4h, it was confirmed that the lymph nodes that exist around the lesions in the experimental group (rtTA-Peli1) mice are larger than the control (rtTA) mice. In addition, it was confirmed that the lymph nodes turned black, which showed that the formation of sinus was abnormally increased by increasing the activity of immune cells.
  • lymph nodes around the skin lesions were enlarged through the results of FIGS. 4G and 4H.
  • the activation of immune cells in these lymph nodes was confirmed using the flow cytometry described in Example 1-4.
  • FIG. 4I the results of FIG. 4I were analyzed.
  • FIG. 4J the difference in the proportion of T cells constituting the lymph nodes could not be observed, but compared with the number of cells.
  • rtTA-Peli1 not only the number of immune cells in total but also the number of CD3 + , CD4 + , and CD8 + T cells were significantly increased.
  • cytokines such as IFN ⁇ , IL-4, IL-22, and IL-23 were compared using quantitative reverse transcriptase chain reaction using cDNA of CD3 + T cells of lymph nodes.
  • FIG. 5A it was confirmed that IFN ⁇ , a cytokine secreted by type 1 helper T reaction, and IL-22 and IL-23, cytokines secreted by type 17 helper T reaction, were significantly increased.
  • Examples 5-1 to 5-4 were used to compare the phenotype and similarity of psoriasis patients based on the analysis of various lesions in Peli1-induced mice (rtTA-Peli1). As a result, as shown in Table 2 below, it was confirmed that the phenotype of psoriasis patients and the phenotype of Peli1 induced expression mouse (rtTA-Peli1) according to the present invention are very similar.
  • Psoriasis phenotype was analyzed when Peli1 expression was lowered to normal level by removing Doxycycline when control group (rtTA) and experimental group mice (rtTA-Peli1) showed a psoriasis phenotype after Doxycycline administration for a certain period of time. .
  • rtTA-Peli1 Peli1-induced mice (rtTA-Peli1) showed a psoriasis phenotype when continuous Doxycycline was administered for 5 months, whereas psoriasis was removed after Doxycyline was administered for 3 months. The phenotype of disappeared and was confirmed to be similar to the control mouse (rtTA).
  • control group (rtTA) mice and experimental group (rtTA-Peli1) mice were dosed with doxycycline for 12 weeks, and then scored for phenotypic changes appearing with doxycycline administration and removal. As a result, as shown in Figure 6b, it was confirmed that the score continues to increase and decrease along the period of doxycycline administration and removal.
  • hematoxylin & eosin (H & E) staining described in Example 1-5 was performed.
  • the layer of epidermal cells of Peli1-induced mice (rtTA-Peli1) is greatly increased according to the administration of Doxycycline, as well as the illusions commonly found in the skin layer structure of psoriasis patients. Phenotypes of Parakeratosis, Hyperkeratosis, Rete Ridge, and Microabscess were observed.
  • Peli1 abnormally increased expression of Peli1 may lead to the development of psoriasis, and when the expression of Peli1 is lowered back to normal levels, the expression of Peli1 as a new psoriasis treatment target is confirmed. The possibility was confirmed.
  • hematoxylin & eosin (H & E) staining described in Example 1-5 was performed.
  • the skin thickness of the normal mouse (WT) increases with the treatment of imiquimod, but the skin thickness of the Peli1 expression inhibiting mouse (Peli1 KO) is less than that of the normal mouse. It was confirmed to increase.
  • the depth of the epidermis (Rete ridge) was found to be shorter in the Peli1 expression inhibiting mouse (Peli1 KO) than in the normal mouse (WT). Hyperkeratosis was also observed in the Peli1 expression inhibiting mouse (Peli1 KO) in the normal mouse (WT). It confirmed that it was relaxed compared with.
  • CsA cyclosporine
  • MTX mesotrexate
  • mesotrexate inhibits hyperdividing of epithelial cells, inducing apoptosis of active T cells, chemotaxis of neutrophils and secretion of specific cytokines.
  • CsA cyclosporine
  • MTX mesotrexate
  • cyclosporine (CsA) was administered six times a week when a phenotype of psoriasis appeared through administration of Doxycycline for a period of time (12 weeks) in control mice (rtTA) and experimental mice (rtTA-Peli1).
  • Mesotrexate (MTX) was administered four times a week by intraperitoneal injection, and then analyzed the phenotype of psoriasis, and hematoxylin & eosin (H & E) staining described in Example 1-5 was performed to confirm the structure of the skin layer. It was.
  • cyclosporin the phenotype of Paratratosis, Hyperkeratosis, Rete ridge, and microabscess of Peli1-induced mice (rtTA-Peli1) is an immunosuppressive agent.
  • rtTA-Peli1 Peli1-induced mice
  • CsA cyclosporine
  • rtTA control mice
  • rtTA-Peli1 experimental mice
  • MTX Mesotrexate
  • Peli1-induced mice expressing psoriasis phenotype following Doxycycline administration confirmed the effectiveness of psoriasis treatment, and confirmed that the psoriasis disease phenotype is reduced.
  • the potential as a preclinical animal model could be verified.
  • Example 6 Based on the results of Example 6 confirmed the possibility of treatment of psoriasis disease by inhibiting the expression of Peli1 protein, in order to inhibit the synthesis of the protein in Peli1 mRNA to identify the target mRNA sequence (see Figure 9a), based on this As described below, shRNA and siRNA were prepared.
  • Target mRNA sequence # 1 GGGTTCAACACACTAGCAT (SEQ ID NO: 3)
  • Target mRNA sequence # 2 GCTCCTTTGGATATGCAATTT (SEQ ID NO: 4)
  • the prepared shRNA was injected into the cells, and the expression of Peli1 protein was confirmed by Western blotting as described in Examples 1-3. As shown in FIG. 9B, shRNA targeting the mRNA of Peli1 was injected into the cells. When injected, it was confirmed that the expression of Peli1 protein was effectively suppressed.
  • Peli1 is an E3 ubiquitin zygote, which acts as a zygote through a RING-like domain and binds to the target protein via the FHA domain.
  • a peptide derived from the FHA domain of Peli1 protein was prepared.
  • FHA domain-derived peptide sequence 95-114 SNTDMFQIGRSTESPIDFVV 101-116 QIGRSTESPIDFVVTD 109-124 PIDFVVTDTVPGSQSN 117-132 TVPGSQSNSDTQSVQS 125-140 SDTQSVQSTISRFACR 133-149 TISRFACRIICERNPP 177-196 DGQMDGLTTNGVLVMHPRNG
  • cell permeation enhancing peptides Cell-penetrating peptides
  • the cell permeation enhancing peptides used were as follows (see FIG. 10):
  • a Peli1 binding activity inhibitory peptide of Peli1 was prepared using a GS linker sequence linking two peptides with HP4, a cell permeation enhancing peptide, as shown in FIG. 11A.
  • the cell culture was treated with Peli1 binding activity inhibitory peptide, and then the cell penetration was confirmed by fluorescence staining.
  • the transgenic animal model according to the present invention is expected to be useful for clinical studies such as screening candidate drugs for psoriasis treatment.
  • Peli1 FHA domain-derived peptides targeting FHA binding motifs that interfere with normal matrix binding of matrix proteins and Peli1 proteins could be useful in the development of new drugs for psoriasis-related diseases.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Environmental Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Biotechnology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un modèle animal induit par le psoriasis et son utilisation et, plus particulièrement : un modèle animal induit par le psoriasis transformé de telle sorte qu'un gène d'homologue 1 de Pellino (Peli1) est surexprimé selon l'administration de doxycycline ; et une utilisation de celui-ci. Le gène Peli1 est surexprimé selon l'administration de doxycycline dans le modèle animal transgénique de la présente invention et, ainsi, il est confirmé que le phénotype du modèle présente une similitude par rapport au phénotype présenté chez un patient souffrant de psoriasis. Pour cette raison, il est attendu que le modèle animal transgénique peut être utile en recherche clinique, telle que le criblage de médicaments candidats, pour le traitement du psoriasis. De plus, le modèle animal transgénique peut être utile dans le développement de nouveaux médicaments pour des maladies associées au psoriasis par le biais d'un peptide dérivé du domaine FHA de Peli1, qui interfère avec la liaison normale au substrat d'une protéine de substrat et d'une protéine Peli1 et cible le motif de liaison FHA. De plus, il est attendu que le modèle peut être utile dans l'évaluation de la gravité de la maladie de patients souffrant de psoriasis en identifiant le niveau d'expression de la protéine Peli1.
PCT/KR2017/006962 2016-07-05 2017-06-30 Modèle animal induit par le psoriasis et son utilisation WO2018008902A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201780042264.5A CN109475108A (zh) 2016-07-05 2017-06-30 诱发牛皮癣动物模型及其用途
US16/315,687 US20190281797A1 (en) 2016-07-05 2017-06-30 Psoriasis-induced animal model and use thereof
US17/014,113 US20200396973A1 (en) 2016-07-05 2020-09-08 Psoriasis-induced animal model and use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20160084594 2016-07-05
KR10-2016-0084594 2016-07-05
KR10-2017-0082620 2017-06-29
KR1020170082620A KR102033215B1 (ko) 2016-07-05 2017-06-29 건선 유발 동물 모델 및 이의 용도

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/315,687 A-371-Of-International US20190281797A1 (en) 2016-07-05 2017-06-30 Psoriasis-induced animal model and use thereof
US17/014,113 Division US20200396973A1 (en) 2016-07-05 2020-09-08 Psoriasis-induced animal model and use thereof

Publications (1)

Publication Number Publication Date
WO2018008902A1 true WO2018008902A1 (fr) 2018-01-11

Family

ID=60912963

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/006962 WO2018008902A1 (fr) 2016-07-05 2017-06-30 Modèle animal induit par le psoriasis et son utilisation

Country Status (1)

Country Link
WO (1) WO2018008902A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002531123A (ja) * 1998-12-09 2002-09-24 プロテイン デザイン ラブス インコーポレイティド ヒトの乾癬を予防及び治療するための乾癬モデル動物
US20060246452A1 (en) * 2003-03-28 2006-11-02 Gonda Thomas J Method for identifying nucleic acid molecules associated with angiogenesis
KR20160042266A (ko) * 2014-10-07 2016-04-19 성균관대학교산학협력단 림프종 모델동물 및 그의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002531123A (ja) * 1998-12-09 2002-09-24 プロテイン デザイン ラブス インコーポレイティド ヒトの乾癬を予防及び治療するための乾癬モデル動物
US20060246452A1 (en) * 2003-03-28 2006-11-02 Gonda Thomas J Method for identifying nucleic acid molecules associated with angiogenesis
KR20160042266A (ko) * 2014-10-07 2016-04-19 성균관대학교산학협력단 림프종 모델동물 및 그의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [O] 15 March 2015 (2015-03-15), XP055451813, Database accession no. NP_065702.2 *
DATABASE Nucleotide [O] 15 March 2015 (2015-03-15), XP055451808, Database accession no. NM_020651.3 *

Similar Documents

Publication Publication Date Title
WO2013169077A1 (fr) Composition pour la prévention ou le traitement de la cachexie
Costanza et al. Prolactin is not required for the development of severe chronic experimental autoimmune encephalomyelitis
WO2021201571A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer contenant un anticorps dirigé contre igsf1 en tant que principe actif, et méthode de traitement du cancer l'utilisant
Johnson et al. Silencing of the Fibroblast growth factor 21 gene is an underlying cause of acinar cell injury in mice lacking MIST1
KR102033215B1 (ko) 건선 유발 동물 모델 및 이의 용도
Tanner et al. Targeting KCa1. 1 channels with a scorpion venom peptide for the therapy of rat models of rheumatoid arthritis
WO2019194586A1 (fr) Nouvelle cible pour lutter contre le cancer et renforcer l'immunité
WO2021177518A1 (fr) Composition pharmaceutique pour abaisser le cholestérol sanguin, prévenir ou traiter des maladies cardiovasculaires et réduire l'inflammation
WO2021158091A2 (fr) Composition comprenant un inhibiteur de chimiokine, un inhibiteur de facteur de stimulation de colonie et un agent d'immunothérapie anticancéreuse pour la prévention ou le traitement du cancer et la polythérapie
WO2018008902A1 (fr) Modèle animal induit par le psoriasis et son utilisation
WO2022092915A1 (fr) Composition destinée à la prévention et au traitement de maladies immunitaires contenant du gdf15 en tant que principe actif
WO2010137770A1 (fr) Nouvelle protéine gpcr et son utilisation
WO2018203613A1 (fr) Peptide pour l'inhibition du récepteur de type toll (tlr) et composition pharmaceutique le comprenant
WO2023022271A1 (fr) Anticorps anti-igsf1 et son utilisation
WO2018208108A1 (fr) Protéine dkk1 présente spécifiquement dans des lymphocytes t régulateurs et son utilisation
WO2018212503A1 (fr) Protéine cotl1 impliquée dans le maintien de l'homéostasie d'une cellule souche hématopoïétique, et utilisation associée
US20160075753A1 (en) MODULATION OF REGULATORY T CELL FUNCTION VIA PROTEIN KINASE C-eta
Laldinsangi et al. Identification, cloning and expression profile of sycp3 during gonadal cycle and after siRNA silencing in catfish
WO2015182798A1 (fr) Composition pour inhiber des cellules suppressives dérivées de myéloïde (mdsc)
McRae et al. Downregulation of the GHRH/GH/IGF1 axis in a mouse model of Börjeson-Forssman-Lehman syndrome
WO2017164486A1 (fr) Composition pour inhiber la résistance à des agents anticancéreux, contenant un inhibiteur de tesk1, et procédé de criblage d'un inhibiteur de tesk1
WO2023153773A1 (fr) Vaccin anticancéreux comprenant un épitope de c-met et son utilisation
WO2022098080A1 (fr) Nouvel anticorps anti-tie2 ou fragment de liaison à l'antigène de celui-ci et son utilisation
WO2023153763A1 (fr) Vaccin contre le cancer comprenant un épitope de c-met et un épitope de hif1alpha, et son utilisation
WO2016159695A1 (fr) Composition pour la prévention ou le traitement de maladies auto-immunes, contenant ssu72 en tant que principe actif

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17824458

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17824458

Country of ref document: EP

Kind code of ref document: A1