WO2017222317A1 - 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물 - Google Patents

이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물 Download PDF

Info

Publication number
WO2017222317A1
WO2017222317A1 PCT/KR2017/006574 KR2017006574W WO2017222317A1 WO 2017222317 A1 WO2017222317 A1 WO 2017222317A1 KR 2017006574 W KR2017006574 W KR 2017006574W WO 2017222317 A1 WO2017222317 A1 WO 2017222317A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
ionone
improving skin
composition
improving
Prior art date
Application number
PCT/KR2017/006574
Other languages
English (en)
French (fr)
Inventor
박태선
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to CN201780038940.1A priority Critical patent/CN109348703A/zh
Publication of WO2017222317A1 publication Critical patent/WO2017222317A1/ko

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/35Ketones, e.g. benzophenone
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/15Vitamins
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • A23L33/18Peptides; Protein hydrolysates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36Carboxylic acids; Salts or anhydrides thereof
    • A61K8/361Carboxylic acids having more than seven carbon atoms in an unbroken chain; Salts or anhydrides thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/67Vitamins
    • A61K8/676Ascorbic acid, i.e. vitamin C
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9706Algae
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/007Preparations for dry skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/20Chemical, physico-chemical or functional or structural properties of the composition as a whole
    • A61K2800/28Rubbing or scrubbing compositions; Peeling or abrasive compositions; Containing exfoliants

Definitions

  • the present invention relates to a composition containing ionone or a salt thereof as an active ingredient, and more particularly, to enhance skin moisture content, reduce skin moisture evaporation amount, increase procollagen secretion amount, promote collagen biosynthesis, inhibit collagen fiber damage, and break down collagen fiber.
  • Cosmetic composition having the effect of improving skin moisturizing, removing dead skin cells, enhancing skin elasticity, inhibiting erythema, improving skin wrinkles and / or improving skin photoaging by using ionone or a salt thereof that inhibits, inhibits erythema and thickens the skin epidermal layer.
  • Dietary supplements, pharmaceuticals and quasi-drug compositions can be provided.
  • the skin is composed of three layers: epidermis, dermis, and hypodermis.
  • the epidermis especially the stratum corneum, the outermost layer of the epidermis, acts as a barrier to the skin to lose water and electrolytes.
  • the dermal layer plays a role in maintaining the elasticity of the skin and supporting the structure through collagen and elastin synthesis.
  • collagen and elastin are major proteins produced in fibroblasts and are involved in skin mechanical firmness, tissue binding strength and elasticity.
  • Collagen forms various isoforms according to its shape and structural features, and there are a total of 28 collagen isotypes in human tissues, of which collagen is present in Type 1, 3. 4. 6. 13, 14, 17 and the like are known.
  • Collagen types 1 and 3 make up the interstitial components of the dermal layer
  • collagen type 7 is the major component of the dermal and epidermal junctions.
  • Type I collagen is the largest amount of extracellular matrix protein in the skin connective tissue, and there are other proteins such as elastin, fibronectin, integrin, fibrillin, and proteoglycan.
  • the newly synthesized procollagen is secreted into the extracellular space of skin cells through an enzymatic reaction to form a microfibril of triple helix configuration, and the microfibrils are leucine-rich small proteoglycans (leucine). It combines with rich small proteoglycans to form fibrils. As a result, the fibrils thus formed form collagen fibers that provide skin binding and elasticity.
  • Skin aging is known to decrease collagen content, a protein that accounts for most of the collagen of skin dermis. Collagen decreases the skin's tension and strength. have.
  • Skin aging is largely divided into endogenous aging due to physiological aging and photoaging caused by continuous ultraviolet radiation (UV) exposure. Repeated ultraviolet exposure results in increased collagen degrading enzymes and causing denaturation and destruction of collagen fibers, reducing the elasticity of the skin and promoting the production of wrinkles. That is, the generation of reactive oxygen species (ROS) is increased in skin tissues exposed to ultraviolet rays continuously, and the latter has a signaling system mediated by growth factor receptor (EGF-R), tumor necrosis factor (TNF) -receptor, etc. It promotes proinflammatory cytokine production.
  • EGF-R growth factor receptor
  • TNF tumor necrosis factor
  • Activation of these receptors consists of continuous phosphorylation that activates downstream signaling mediators, including mitogen-activated protein kinase (MAPK), resulting in activator protein-1 (AP-1). And activating transcription factors such as nuclear factor ⁇ B (NF- ⁇ B) to induce an inflammatory response and to promote the activity of collagenase such as matrix metalloproteinases (MMPs) to reduce skin elasticity and promote wrinkle formation do.
  • AP-1 regulates the expression of numerous genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs.
  • MMP-1 is known as collagenase 1, and is based on type 1 and 3 collagen.
  • ionone is Rubus idaeus (Raspberry), Daucus carota subsp. Sativus (Carrot, Carrot), Prunus This fragrance is mainly contained in dulcis (Almond) and Menta (Herb). Ionone is mainly used as a component of shampoos, soaps, cleaning products, body lotions, cosmetics, shower gels, and hair sprays, and is listed as a flavoring agent in the Korean KFDA and US FDA food additive databases. Used. In the research on the physiological activity of ionone, the only report is that ionone showed strong antimicrobial activity against microorganisms harmful to the human body, and no other biological activity has been reported at all.
  • the present inventors conducted research to develop a food or cosmetic material that is effective in reducing wrinkles by inhibiting the action of collagen degrading enzymes and promoting collagen synthesis in natural products with few side effects, and thus, ionone improves skin moisturization.
  • the present invention was completed by confirming that exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement were shown.
  • An object of the present invention is to provide a cosmetic composition having an effect of improving skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging.
  • Another object of the present invention is to provide a health functional food composition having an effect of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging.
  • Still another object of the present invention is to provide a pharmaceutical or quasi-drug composition having the effect of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging.
  • An object of the present invention is to provide a cosmetic composition having an effect of improving skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging.
  • Another object of the present invention is to provide a health functional food composition having an effect of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging.
  • Still another object of the present invention is to provide a pharmaceutical or quasi-drug composition having the effect of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging.
  • composition containing the ionone of the present invention or a salt thereof as an active ingredient improves skin moisture content, decreases skin evaporation amount, increases procollagen secretion, promotes collagen biosynthesis, inhibits collagen fiber damage, inhibits collagen fiber degradation, inhibits erythema and skin epidermal layer It has excellent thickening inhibitory activity, so it can be usefully used to improve skin moisturizing, skin exfoliation, skin elasticity improvement, erythema suppression, skin wrinkle improvement and / or skin photoaging.
  • the ionone of the present invention is a natural product, it is safe for the human body and has less side effects, and thus can be used in various materials such as cosmetics, health foods, medicines or quasi-drugs.
  • FIG. 1 is a graph showing the results of measuring procollagen secretion by ELISA analysis after irradiating UVB at 20 mJ / cm 2 to human skin fibroblasts for 24 hours with 100 ⁇ M of vitamin C or ⁇ -ionone (FIG. -UVB: UVB-treated normal group, + UVB: UVB-treated control group, IO: UVB-irradiated ⁇ ionone treated group, VitC: UVB-treated vitamin C-treated control group, IO + VitC : Experiment group treated with ⁇ -ionone and vitamin C after UVB irradiation).
  • Figure 2 is a graph showing the weight gain and dietary intake of mice fed the experimental diet having the composition of Table 1 (A: weight, B: weight gain, C and D: diet intake).
  • Figure 3 is a graph showing the water content (A), water evaporation (B), elasticity (C) and erythema index (D) of the skin tissue of mice fed the experimental diet having the composition of Table 1.
  • Figure 4 is a photograph showing the back skin tissue of each mouse fed the experimental diet having the composition of Table 1.
  • FIG. 5 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of the back skin tissue of the mouse fed the experimental diet having the composition of Table 1.
  • FIG. 6 is a graph (A) and skin epidermal layer photograph (B) of measuring skin thickness of mice fed an experimental diet having the composition of Table 1.
  • FIG. 6 is a graph (A) and skin epidermal layer photograph (B) of measuring skin thickness of mice fed an experimental diet having the composition of Table 1.
  • Figure 7 is a photograph observing the change in the amount and morphology of collagen fibers in mice fed an experimental diet having the composition of Table 1.
  • ionone is reported to exhibit strong antimicrobial activity against microorganisms harmful to the human body, and has not been specifically reported for other physiological activities.
  • the present inventors have identified a novel activity of ionone related to skin health, and developed a cosmetic composition, a nutraceutical composition, a medicine and a quasi-drug composition containing ionon or a salt thereof as an active ingredient.
  • the composition provided by the present invention has excellent skin hydration content, reduced skin moisture evaporation amount, increased procollagen secretion, increased collagen biosynthesis, inhibited collagen fiber damage, inhibited collagen fiber degradation, erythema suppression and thickening inhibitory effect of skin epidermal layer. It can be usefully used for improvement, skin moisturization improvement, skin exfoliation, skin elasticity improvement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.
  • the present invention is a cosmetic composition having an effect of improving skin moisturizing, skin exfoliation, skin elasticity, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement, containing ionone or a cosmetically acceptable salt thereof as an active ingredient.
  • Ionone is a ketone compound, the structural formula is C 13 H 20 O, and the molecular weight is 192.3 g / mol. Ionone has a total of three isomers and alpha-ionone, beta-ionone, and gamma-ionone represented by the following chemical formulas 1, 2, and 3, respectively, according to molecular structure Is called.
  • Alpha ionone is also called tinnitus such as (3E) -4- (2,6,6-trimethylcyclohex-2-en-1-yl) but-3-en-2-one, cyclocitrylideneacetone, irisone and jonon.
  • Alphaionone is a pale yellow transparent liquid with a melting point of -49 ° C and a boiling point of 126-128 ° C.
  • Ionone is Rubus idaeus (Raspberry), Daucus carota subsp. Sativus (Carrot, Carrot), Prunus This fragrance is mainly contained in dulcis (Almond) and Menta (Herb).
  • the method for obtaining the ionone of the present invention is not particularly limited, and may be isolated from the plant containing the ionone, chemically synthesized using a known manufacturing method, or commercially available.
  • ADI Acceptable daily intake
  • ionone at 0.0002 mg / kg to 1500 mg / kg, preferably 0.1 mg / kg to 1,000 mg / kg is very minimal or no toxicity, so ionon is administered within the above concentration range.
  • it can be used in cosmetic compositions, health functional food compositions, pharmaceuticals or quasi-drug compositions and the like at an appropriate concentration.
  • the ionone may include alpha ionone ( ⁇ -ionone), beta ionone ( ⁇ -ionone) or gamma ionone ( ⁇ -ionone) without limitation, the range having the same efficacy as the ionone Ionone hydrates, ionon derivatives, and the like may be included in the compound, and solvates or stereoisomers thereof may also be included.
  • the term "improve skin wrinkles” means maintaining or enhancing the ability to be associated with wrinkles and elasticity of the skin.
  • Collagen (collagen) and elastic fiber elastin (collagen) in the dermal layer of the skin is the main protein that plays a role in the skin elasticity, collagen biosynthesis is affected by the internal and external skin.
  • the skin cells are reduced in cell activity due to natural aging, the collagen fibers are reduced, or the active oxygen produced by excessive irradiation of ultraviolet rays or stress as an external factor, the thiol group of the protein (thiol: -SH)
  • the enzyme activity or by increasing the expression of degradation enzymes, such as collagen, elastin, increase the wrinkles of the skin and decrease the elasticity, the skin aging progresses.
  • the terms "cosmetic acceptable salt”, “food acceptable salt”, “pharmaceutically acceptable salt” or “salt thereof” may be an acid addition salt formed by free acid.
  • Acid addition salts can be prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • equimolar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • an inorganic acid or an organic acid may be used as the free acid.
  • the inorganic acid may be hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like, which may be used alone or in combination of two or more.
  • Non-limiting examples of the organic acid are methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid (propionic acid).
  • acid citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid (glucuronic acid), aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid and the like can be used. These may be used alone or in combination of two or more thereof.
  • the ionone may use a base to make a cosmetically or food acceptable metal salt.
  • Alkali metal or alkaline earth metal salts can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compounds salt, and then evaporating and drying the filtrate.
  • the metal salt it is particularly preferable to prepare sodium, potassium or calcium salts, but is not limited thereto.
  • Corresponding silver salts can also be obtained by reacting an alkali or alkaline earth metal salt with a suitable silver salt (eg silver nitrate).
  • Salts of the ionone may include all salts of acidic or basic groups which may be present in the compound of the ionon, unless otherwise indicated.
  • the salt of the ionone may include sodium, calcium and potassium salts of the hydroxy group, and other cosmetically acceptable salts of the amino group include hardbromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like. It can be prepared through the method.
  • the effective amount of ionone or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited and may be included in 0.0001 to 20% by weight based on the total weight of the composition. Less than 0.0001% by weight of ionone or its salt in the cosmetics may have a small amount of anti-wrinkle effect, and more than 20% by weight of ionone or its salt may exhibit known toxicity.
  • FIG. 4 The thickness of the epidermal layer thickened by irradiation was also significantly reduced (FIG. 6), and the effect of densifying collagen fibers and maintaining the arrangement regularly (FIG. 7), and the expression of collagen types 1 ⁇ 1, 1 ⁇ 2 and 3 ⁇ 1 Significantly increased and significantly reduced the expression of MMP-1a, MMP-1b, MMP-3, and MMP-9 genes to increase the synthesis of collagen protein and inhibit the degradation of collagen fibers, effectively reducing wrinkles by UV irradiation. It was confirmed that inhibition (Fig. 8).
  • the composition comprising the ionone of the present invention or a salt thereof is a functional cosmetic that provides an effect of improving skin wrinkles, improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, improving skin wrinkles, inhibiting erythema and / or improving skin photoaging, It can be usefully used as a material for health functional food, medicine or quasi-drugs.
  • the term "cosmetic composition” is a composition comprising the compound, the formulation may be in any form.
  • the cosmetic preparation prepared using the composition may be a nourishing cream, eye cream, massage cream, cream such as cleansing cream, pack, lotion such as nutrient lotion, essence, softening lotion, and lotion such as nourishing lotion.
  • Powders, foundations, makeup bases, and the like and may be prepared and commercialized in any of these formulations to achieve the object of the present invention, and are not limited to the above examples.
  • the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method.
  • the cosmetics of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet It may have one of the formulations selected from the group consisting of exfoliants, soaps, shampoos, cleansing foams, cleansing lotions, cleansing creams, body lotions, body cleansers, emulsions, press powders, loose powders and eye shadows.
  • the cosmetic composition of the present invention may include other additives such as excipients, carriers, etc., in addition to ionone or salts thereof, and it is possible to apply and blend as needed the usual ingredients formulated into general skin cosmetics.
  • the cosmetic composition of the present invention may further include a transdermal penetration enhancer.
  • transdermal penetration enhancer is a composition that allows a desired component to penetrate into the blood vessel cells of the skin at a high absorption rate.
  • phospholipid components, liposome components and the like used in lecithin cosmetics are included, but are not limited to these.
  • oil which can be mainly used as an oil phase component
  • one or more selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis binifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dimethicone Chicon, cyclopentasiloxane, sunflower seed oil and the like can be used.
  • a surfactant may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, and the like, specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate / sucrosecoate, glyceryl stearate / polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside, polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, etc.
  • surfactants may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric
  • alcohols having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in combination of one or more thereof.
  • the aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.
  • thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.
  • the cosmetic composition of the present invention if necessary, active ingredients such as higher fatty acids, vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elixolic acid, tocopheryl acetate, butylated hydroxy) Toluene), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malic acid, fmaric acid, sodium pramate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc., moisturizers (glycerine, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycerin-26, methylgluse-20 and the like), lubric acid,
  • the cosmetic composition of the present invention further comprises a substance capable of auxiliaryly providing essential nutrients to the skin, and may preferably contain auxiliary agents including, but not limited to, natural flavors, cosmetic flavors, or herbal medicines. have.
  • the cosmetic composition of the present invention may further comprise a skin wrinkle improvement component or skin elasticity enhancing component.
  • the specific skin wrinkle improving component or skin elasticity enhancing component may be any one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, most preferably Vitamin C.
  • the amount of collagen is measured to a higher value than when treated with ⁇ -ionone or vitamin C alone It was confirmed that the synergy effect (Fig. 1).
  • the present invention also provides a health function having an effect of improving skin moisturizing, removing skin exfoliation, enhancing skin elasticity, inhibiting erythema, improving skin wrinkles and / or improving skin photoaging, containing ionone or a food acceptable salt thereof as an active ingredient.
  • a health function having an effect of improving skin moisturizing, removing skin exfoliation, enhancing skin elasticity, inhibiting erythema, improving skin wrinkles and / or improving skin photoaging, containing ionone or a food acceptable salt thereof as an active ingredient.
  • the term "health functional food” refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. Means to obtain a useful effect for health purposes, such as nutrient control or physiological action on the structure and function of the human body, etc.
  • the health functional food of the present invention can be prepared by methods commonly used in the art, In the preparation, it can be prepared by adding raw materials and ingredients conventionally added in the art, and the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food.
  • food compositions have the advantage of being free from side effects that can occur when taking long-term use of foods. And, excellent in portability, it is possible to consume as adjuvants to promote improved skin moisturizing, skin exfoliation, promoting skin elasticity, erythema inhibition and improve skin wrinkles and / or skin photo aging effect.
  • the dietary supplement composition of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.
  • Health functional food composition according to the present invention may be formulated in the form of powder, liquid, tablets, soft capsules, granules, tea bags, instant tea or drink by including ionone as an active ingredient.
  • the content of ionone as an active ingredient can be suitably determined according to the purpose of use (prevention or improvement).
  • the amount of ionone contained in the nutraceutical composition may be added at 0.1 to 90% by weight of the total food weight. However, in the case of prolonged intake for health and hygiene purposes or health control purposes, the amount may be below the above range.
  • the health functional food composition according to the present invention in addition to ionone, other ingredients that can give a synergistic effect to the main effect, preferably within the range that does not impair the main effect of the present invention, for example, vitamin C and It may contain such compounds for improving wrinkles or natural products, such as green tea extract, mulberry extract, licorice extract, lettuce extract, betel nut extract, golden extract, wild ginseng extract.
  • the dietary supplement composition formulated in the form as described above may be added to the food as it is or used with other foods or food ingredients, and may be appropriately used according to conventional methods.
  • foods include drinks, meats, sausages, breads, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, dairy products including other noodles, gums, ice creams, various soups, beverages, alcoholic beverages and vitamin complexes. , Dairy products and dairy products, and all functional foods in the conventional sense.
  • the health functional food composition of the present invention when the health functional food composition of the present invention is a drink, it contains ionone as an essential ingredient in the ratio indicated, and there are no particular limitations on other ingredients used for the purpose of preparing other drinks, and various flavoring agents such as ordinary drinks.
  • natural carbohydrate or the like as an additional component.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • a natural flavoring agent such as a natural flavoring agent, a synthetic flavoring agent, etc.
  • the proportion of such natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.
  • the nutraceutical composition of the present invention is a variety of nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid And salts thereof, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the food composition of the present invention may contain a pulp for producing natural fruit juice and fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of ionone of the present invention.
  • the present invention also provides a quasi-drug or pharmaceutical composition having the effect of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, inhibiting erythema, improving skin wrinkles and / or improving skin photoaging, containing ionone or a salt thereof as an active ingredient. .
  • the ionone of the present invention or a pharmaceutically acceptable salt thereof may further contain one or more active ingredients exhibiting the same or similar functions.
  • it may include known skin wrinkle improving ingredients or elasticity enhancing ingredients.
  • additional skin wrinkle improving component and elasticity enhancing component By including additional skin wrinkle improving component and elasticity enhancing component, the wrinkle improvement and elasticity enhancing effect of the composition of the present invention can be further enhanced.
  • the pharmaceutical composition is a wrinkle improving component known in the art, any one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract It may further comprise a skin wrinkle improving ingredient.
  • the additional skin wrinkle improving component may be included in 0.0001 to 10% by weight relative to the total weight of the composition, the content range is based on requirements such as collagen synthesis promoting activity, skin safety, ease of formulation of the compound of Formula 1 Can be adjusted accordingly.
  • composition for improving skin wrinkles and elasticity of the present invention may further comprise a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may contain various components such as buffers, sterile water for injection, general saline or phosphate buffered saline, sucrose, histidine, salts, polysorbates and the like.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and may be administered in the form of a general pharmaceutical preparation, for example, in various formulations, orally and parenterally, in the case of clinical administration.
  • Diluents or excipients such as extenders, binders, wetting agents, disintegrants, surfactants and the like.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the pharmaceutical composition of the present invention, for example, starch, calcium carbonate, It may be prepared by mixing sucrose or lactose, gelatin and the like.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. .
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the pharmaceutical composition of the present invention may provide a desirable skin moisturizing improvement, skin exfoliation, skin elasticity improvement, erythema suppression, wrinkle improvement or skin photoaging improvement effect when an effective amount of ionone or a pharmaceutically acceptable salt thereof is included.
  • the term 'effective amount' means an amount of a compound capable of inhibiting or inhibiting generation of wrinkles on the skin or alleviating wrinkles already produced.
  • the effective amount of ionone or a pharmaceutically acceptable salt thereof contained in the composition of the present invention will vary depending on the form in which the composition is commercialized, the method by which the compound is applied to the skin and the time it stays on the skin.
  • composition when the composition is commercialized as a medicament for dermatological treatment due to wrinkle formation, elasticity reduction, and blemishes of the skin, ionon or its pharmaceutical agent is present at a higher concentration than when it is commercialized as a cosmetic product that is routinely applied to the skin. It may include an acceptable salt.
  • the term "quasi drug” used in the present invention refers to articles that have a lesser action than drugs among those used for the purpose of diagnosing, treating, ameliorating, alleviating, treating or preventing diseases of humans or animals.
  • the drug is used for the purpose of medicine, and it includes a product used for the treatment or prevention of diseases of humans and animals, and a product having a slight or no direct action on the human body.
  • the quasi-drug composition of the present invention is used for the purpose of improving skin moisturizing, removing skin dead skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging, and is not particularly limited in the formulation thereof.
  • It may be a cosmetic composition having a formulation of a flexible cosmetics, nourishing cosmetics, massage creams, nutrition creams, packs, mask packs, mask sheets, gels or skin adhesive cosmetics, and also lotions, ointments, gels, creams, patches or sprays.
  • It may be a transdermal dosage form such as
  • the quasi-drug composition may be optionally selected and blended with other ingredients according to the formulation or purpose of use of other quasi-drugs.
  • the mixed amount of the active ingredient can be suitably determined depending on the purpose of use (inhibition or relaxation).
  • it may include conventional adjuvants such as thickeners, stabilizers, solubilizers, vitamins, pigments and flavorings, carriers and the like.
  • the content of the ionone or salt thereof of the present invention is preferably 0.0001 to 20% by weight, respectively, based on the total weight of the quasi-drug composition. If the content exceeds 20% by weight, the color and stability of the composition are inferior. If the content is less than 0.0001%, the effect is minimal.
  • Primary dermal fibroblasts (normal, human, neonatal, ATCC No. PCS-201-010) were purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were cultured in a 37, 5% CO 2 incubator using a fibroblast growth medium (Promo Cell, Heidelberg) was used for the experiment.
  • human fibroblasts were dispensed in 12 well-plates at 1.0 ⁇ 10 6 cells / well, and ⁇ -ionone and vitamin C were added at a concentration of 100 ⁇ M, respectively. Incubated in 2 incubators. After removing the medium of each well, washed once with PBS, and again put 1 ml of PBS was irradiated with ultraviolet B (UVB) at 20 mJ / cm 2 conditions. PBS of each well was replaced with medium again and cultured for 24 hours, and then the amount of procollagen secreted into the medium was measured using a procollagen type C-peptide EIA kit (Takara Bio, Japan). The standard solution included in the collagen measurement kit was diluted by concentration, and the absorbance was measured at 450 nm to prepare a standard concentration curve and calculate the amount of collagen produced.
  • UVB ultraviolet B
  • Collagen the main protein constituting the skin, is synthesized in the form of procollagen from fibroblasts present in the dermis and then secreted into the extracellular matrix. Procollagen secreted into the extracellular matrix is decomposed by the procollagen peptidase on the cell surface and formed into active collagen. Therefore, the activated collagen content can be determined by measuring the C-peptide content.
  • FIG. 1 represents the means ⁇ SEM of three measurements from three independent wells. Mean values in other alphabets indicate statistical significance (p ⁇ 0.05).
  • Example 2 Evaluation of skin wrinkle improvement, moisturizing and elasticity enhancing efficacy of ⁇ -ionone using mouse
  • mice The five-week-old female albino hairless mice (Skh-1) used in this example were purchased from Orient Bio (Gyeonggi-do, Korea) and subjected to a one-week adaptation period as a solid feed. Experimental animals were divided into 4 groups and 5 animals were assigned to each group and used for the experiment. All experimental groups were divided into the normal control group (-UVB), the UV irradiation group (+ UVB), and the UV-irradiated group which ingested ⁇ -ionone ( ⁇ IO) or vitamin C (VitC). Feed and water were freely ingested during the breeding period, and the temperature was maintained at 22 ⁇ 1 °C and humidity at 60 ⁇ 5%, and the photoperiod and dark cycle were adjusted to 12 hours daily.
  • -UVB normal control group
  • ⁇ IO ⁇ -ionone
  • VitC vitamin C
  • the -UVB and + UVB groups consumed tablets prepared according to the AIN-93 rodent diet (Ree ves, PG et al., J Nutr, 123: 1939-1951, 1993).
  • the composition of the detailed experimental diet is shown in Table 1 below. The diet was fed with water between 10 am and 11 am daily, and dietary intake was measured daily.
  • UVB ultraviolet B
  • the UV irradiation dose was 73 mJ / cm 2 for the first week, 146 mJ / cm 2 for the second week, and from 3 to 10 weeks. Irradiation at 219 mJ / cm 2 .
  • body weight and skin thickness were measured every week, and photographs of the back skin were taken. Skin thickness was measured in the hip region of hairless mice using a digital micro caliper (Marathon Watch Company Ltd, Ontario, Canada). The caliper used in the measurement was able to measure up to 0.01 mm, and it has a control function to apply a constant force to the thickness, so that the thickness of the skin was measured under the same force.
  • the skin of hairless mice subjected to UV irradiation for 10 weeks was made of silicone rubber to measure the extent of wrinkle formation. Attach a disk with a circular hole with a diameter of 1 cm to the back of the hairless mouse, mix the reagent for making a replica, thinly spread it on the back of the hairless mouse, dry it completely, and carefully remove the disk. was produced. Fabrication temperature of the replica plate was carried out in a constant temperature and humidity condition of 20 ⁇ 23 °C, humidity 45 ⁇ 50%, was used a silicon plate rubber impression material (Epigem, Seoul, Korea) for the production. Analysis of the simulated platen was performed using a computer image analyzer (Visioline VL650, CK electronic GmbH, Germany) for total wrinkle area, maximum wrinkle depth, mean depth and mean wrinkles. Four wrinkle indicator items such as mean length were analyzed.
  • mice The back skin tissue of hairless mice was extracted and fixed in 10% formalin. Then, Hema toxylin and eosin (H & E) and Masson's trichrome (M & T) staining were performed by Korean CFC (Gyeonggi-do, Korea), followed by optical microscope (IX71, Olympus, After observing using JPN, pictures were taken using a digital camera (DP71, Olympus, JPN).
  • Tissue was ground by adding 1 ml of Trizol solution per 0.1 g of back skin tissue, and then centrifuged at 4, 12,000 ⁇ g for 10 minutes. The supernatant was transferred to a new tube and 200 ⁇ l of chloroform was added and vortexed. After repeating this process twice, the supernatant was transferred to a new tube and isoprophanol and supernatant were added at a 1: 1 ratio. After shaking vigorously 10 times and left at room temperature for 15 minutes, centrifugation was performed at 12,000 xg and 4 minutes for 10 minutes, the supernatant was removed, and 1 ml of 70% ethanol was added to the remaining precipitate. Centrifugation during.
  • RNA pellet was dissolved using nuclease free water.
  • UV / VIS spectrophotometer Beckman coulter, DU730 was measured the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and the integrity of the RNA samples were confirmed by agarose gel electrophoresis.
  • CDNA was synthesized by reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) on RNA samples extracted from the back skin tissue. PCR was performed using 5 'and 3' flanking sequences of the gene cDNA to be amplified as a template and cDNA obtained through reverse transcription. The primer sequences used are shown in [Table 2]. 1 ⁇ l of the amplified PCR product was electrophoresed on 1% agarose gel to confirm DNA band.
  • UV irradiation, ⁇ -ionone and vitamin C intake did not significantly affect the body weight and dietary intake of hairless mice (FIG. 2).
  • the values in FIG. 2 are mean ⁇ SEM of 5 mice.
  • moisture content and elasticity were significantly increased by 78% and 77%, respectively, compared to the + UVB control group. 46% and 26%, respectively, were found to decrease significantly.
  • the + UVB control group was thicker and deeper than the normal UV-irradiated group (-UVB). Fine wrinkles were formed along with the wrinkles, and the ⁇ -ionone-intake group showed a significant improvement in the thickness and depth of the wrinkles, despite the fact that UV rays of the same intensity were irradiated with the deep wrinkles almost disappearing compared to the + UVB control group. It was confirmed (FIG. 5A).
  • the IO group had 60% total wrinkle area, maximum wrinkle depth 49%, average wrinkle depth 39%, and average wrinkle compared with + UVB group.
  • the length was significantly reduced by 68%, and the antiwrinkle effect of ⁇ -ionone was similar to the antiwrinkle effect observed in vitamin C (FIG. 5B).
  • the values in FIG. 5B are mean ⁇ SEM of 5 mice, and the alphabet above the bar represents a significant difference by one-way ANOVA followed by Duncan's multiple range test (p ⁇ 0.05). Therefore, it can be seen that the intake of ⁇ -ionone significantly inhibits wrinkle formation by ultraviolet irradiation.
  • the + UVB control group significantly increased the skin thickness compared to the normal group (-UVB) that was not irradiated with ultraviolet rays and ingested ⁇ -ionone.
  • the group was found to have a 19% significant reduction in skin thickness compared to the + UVB control (FIG. 6A).
  • the values in FIG. 6A are mean ⁇ SEM of 5 mice, with the alphabet above the bar representing a significant difference by one-way ANOVA followed by Duncan's multiple range test (p ⁇ 0.05).
  • the skin epidermal layer thickness of hairless mice was observed by H & E staining of the skin tissue, and the + UVB control group showed a thickening of the skin epidermal layer compared to the normal group (-UVB) without UV irradiation. It was confirmed that the thickness of the epidermal layer thickened by ultraviolet irradiation was significantly reduced (FIG. 6B).
  • Collagen types 1 and 3 are proteins that constitute the cytoplasmic components of the dermal layer, and in particular, type 1 collagen is present in the largest amount of extracellular matrix proteins present in skin connective tissue.
  • MMPs that catalyze collagen degradation
  • MMP types known to increase by UV rays are known as Nos. 1, 3, and 9.
  • MMP-1 is known to cut the middle of collagen fibers
  • MMP-3 and MMP-9 are known to play a role in subdividing and cutting the cut collagen fibers (Quan T. et al. Elevated matrix metalloproteinases and collagen fragmentation).
  • collagen type 1 ⁇ 1 and ⁇ 2 and collagen type 3 ⁇ 1 of + UVB control group were compared with normal group (-UVB) without UV irradiation.
  • the expression of MMP-1a and -1b, MMP-3, and MMP-9 genes were significantly increased.
  • the expression of collagen type 1 ⁇ 1 and ⁇ 2 and collagen type 3 ⁇ 1 was significantly increased in the ⁇ -ionone intake group compared to the + UVB control group, and the expression of MMP-1a and -1b, MMP-3, and MMP-9 genes was increased.
  • Significantly decreased (FIG. 8). Therefore, ⁇ -ionone increased the collagen protein synthesis of skin tissue and inhibited the breakdown of collagen fibers, thereby inhibiting wrinkle formation by UV irradiation.
  • ⁇ -ionone can prevent or alleviate skin wrinkles caused by UV rays, which may be useful for functional cosmetics, health functional foods, medicines or quasi-drugs. .
  • components 1 to 8 are first dissolved by heating at a temperature of 70 ° C., and components 9 to 13 are dissolved and dispersed in component 14, and emulsified by heating to 70 ° C. Thereafter, the emulsified product was cooled to a temperature of 56 ° C., and then component 15 dissolved in the fractionated component 9 was added thereto, stirred, and cooled to room temperature to prepare.
  • the cosmetic composition containing the ionone of the present invention or its cosmetically acceptable salt as an active ingredient has no skin side effects, improves wrinkles, increases the synthesis of collagen protein, and inhibits the degradation of collagen fibers. Excellent for wrinkle improvement
  • the skin moisture content was measured using a Koniometer in a constant temperature and humidity room at room temperature 25 ° C. and relative humidity 45% before application, and the Experimental Example 1 and Comparative Example 1 formulations of Table 3 were respectively left and right of the face. After 10 minutes of application, the skin was rested for 12 hours after application and 24 hours after application.
  • the measuring device measured the moisture content of the skin using a moisture content meter (coneometer; CM820, Courage Khazaka electronic GmbH, Germany) that measures the moisturizing power by measuring the electric capacity of the skin according to the moisture content of the skin.
  • the conniometer measures the moisture level by measuring the amount of moisture by measuring the amount of water ions using a sensor and measuring the amount of moisture present in the skin epidermis, and the measuring method is as follows.
  • the sensor was wiped with a tissue such as Kimwipe and then measured again.
  • the measurement of the skin angular mass was measured by using Charm view (Moritex, Japan) in a constant temperature and humidity room at room temperature 25 °C and relative humidity 45% before application, Experimental Example 1 and Comparative Example 1 of Table 3 The formulations were applied to the left and right sides of the face, respectively, and then the skin angular mass after 24 hours was measured and the amount of skin keratin reduction was calculated. Each value is shown in Table 6 below as an average value.
  • Vitamin A Acetate 1.0 mg Vitamin E 0.13 mg Vitamin B1 0.15 mg Vitamin B2 0.5 mg Vitamin B6 0.2 ⁇ g Vitamin B12 10 mg Vitamin c 10 ⁇ g Biotin 1.7 mg Nicotinic acid amide 50 ⁇ g Folic acid 0.5 mg Calcium Pantothenate Quantity Mineral mixture Quantity Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium phosphate monobasic 15 mg Dibasic Potassium Phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg
  • composition ratio of the vitamin and mineral mixture is a composition that is relatively suitable for the health functional food is mixed in a preferred embodiment
  • the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health functional food manufacturing method.
  • the granules may be prepared and used for preparing the nutraceutical composition according to a conventional method.
  • the solution prepared by stirring and heating at 85 ° C. for about 1 hour is obtained by filtration in 21 sterilized containers, sealed sterilization and refrigerated and then stored in the present invention. Used to prepare healthy beverage compositions.
  • the composition ratio is a composition that is relatively suitable for the preferred beverage in a preferred embodiment, the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.
  • the tablet containing the ⁇ -ionone was prepared according to a conventional tablet production method.
  • the capsule containing the ⁇ -ionone was prepared by filling the gelatin capsule in accordance with a conventional capsule preparation method.
  • the ring was prepared so as to be 4 g per ring according to a conventional ring production method.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Food Science & Technology (AREA)
  • Dermatology (AREA)
  • Emergency Medicine (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Botany (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Cosmetics (AREA)

Abstract

본 발명은 이오논 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 피부보습 개선, 피부각질제거, 피부탄력 증진, 피부주름 개선, 홍반 억제 및 피부광노화 개선 효과를 갖는 화장료 조성물, 건강기능식품 조 성물, 의약품 및 의약외품 조성물에 관한 것으로, 본 발명의 이오논 또는 이의 염은 피부수분 함유량 증진, 피부수분 증발량 감소, 프로콜라겐 분비량 증가, 콜라겐 생합성 촉진, 콜라겐 섬유 손상 억제, 콜라겐 섬유 분해 억제, 홍반 억제 및 피부 표피층의 비후 억제 활성을 나타내므로, 피부보습 개선, 피부각질 제거, 피부탄력 증진, 피부주름 개선, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 제공하는 기능성 화장품, 건강기능식품, 의약품 또는 의약외품 등의 소재로 유용하게 활용될 수 있다.

Description

이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
본 출원은 2016년 06월 22일 출원된 대한민국 특허출원 제10-2016-0077927호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 이오논 또는 이의 염을 유효성분으로 함유하는 조성물에 관한 것으로, 보다 상세하게는 피부수분 함유량 증진, 피부수분 증발량 감소, 프로콜라겐 분비량 증가, 콜라겐 생합성 촉진, 콜라겐 섬유 손상 억제, 콜라겐 섬유 분해 억제, 홍반 억제 및 피부 표피층의 비후 억제 활성을 나타내는 이오논 또는 이의 염을 이용하여 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 화장료 조성물, 건강기능식품 조성물, 의약품 및 의약외품 조성물을 제공할 수 있다.
최근 의료기술의 발달로 평균수명이 연장되고 삶의 질 향상과 건강하고 아름다운 삶에 대한 욕구가 증가함에 따라 피부미용 및 건강에 대한 관심이 확대되고 있다. 이에 건강한 피부를 유지하고자 하는 목적에 따라 다양한 미용 기능성 화장품이 개발되었으며, 특히 피부 주름형성 예방, 완화와 개선을 위한 연구가 활발히 진행되고 있다. 아울러 최근 화장품의 성분이 피부진피에 도달하여 영양분을 공급하는데 한계가 있고, 식품으로 섭취하여 피부에 영양분 또는 기능성분을 공급하여 피부미용증진 효과를 나타낼 수 있다는 인식의 변화가 일어남에 따라 이너뷰티 식품소재들을 발굴하는 연구 또한 활발히 진행되고 있다.
피부는 크게 표피(epidermis), 진피(dermis), 피하지방(hypodermis)의 세층으로 구성되어 있다, 표피, 특히 표피의 가장 외층인 각질층은 피부장벽의 역할을 함으로써 피부로부터 수분과 전해질이 손실되는 것을 억제하는 한편, 진피층은 콜라겐과 엘라스틴 합성을 통하여 피부의 탄력을 유지하고 구조를 지지하는 역할을 한다. 즉, 콜라겐과 엘라스틴은 섬유아세포에서 생성되는 주요 단백질로서 피부의 기계적 견고성, 조직의 결합력 및 탄력성 등에 관여한다. 콜라겐은 형태와 구조적 특징에 따라 다양한 이소폼(isoform)을 구성하며, 사람의 조직에는 총 28가지 콜라겐 이소타입(isotype)이 존재하는데, 이중 피부조직에 존재하는 콜라겐은 타입 1, 3. 4. 6. 7. 13, 14, 17 등이 알려져 있다. 콜라겐 타입 1과 3은 진피층의 세포간질 구성성분을 이루고, 콜라겐 타입 7은 표피와 진피를 연결부위(dermal and epidermal junction)의 주요 구성물질이 된다.
피부결합조직에는 세포외기질 단백질 중 타입 I 콜라겐이 가장 많은 양으로 존재하며, 그 밖에 엘라스틴, 피브로넥틴(fibronectin), 인테그린(integrin), 피브릴린(fibrillin), 프로테오글리칸 등의 단백질들이 존재한다. 새로이 합성된 프로콜라겐은 효소반응을 거쳐 피부세포의 세포외 공간으로 분비된 후 삼중나선구조(triple helix configuration)의 마이크로피브릴(microfibril)을 형성하고, 마이크로피브릴들은 류신-리치 스몰 프로테오글리칸(leucine-rich small proteoglycans)과 결합하여 피브릴(fibril)을 형성한다. 결과적으로 이렇게 만들어진 피브릴들이 모여 피부의 결합력과 탄력성을 제공하는 콜라겐 섬유를 형성하게 된다.
피부노화는 피부 진피조직의 교원질 중 대부분을 차지하는 단백질인 콜라겐 함량이 감소하기 때문으로 알려져 있고, 콜라겐은 피부의 장력과 강도를 부여하기 때문에 콜라겐의 감소는 피부노화 및 주름생성과 매우 깊은 관계를 가지고 있다. 피부노화는 크게 생리학적 노화에 의한 내인성 노화, 그리고 지속적인 자외선(ultraviolet radiation, UV) 노출에 의해 일어나는 광노화로 구분된다. 반복적인 자외선 노출은 콜라겐 분해효소를 증가시키고 콜라겐 섬유의 변성 및 파괴를 유발하여 피부의 탄력을 감소시키고 주름의 생성을 촉진하는 결과를 초래한다. 즉, 지속적으로 자외선에 노출된 피부조직에는 활성산소종(ROS)의 발생이 증가하고, 후자는 growth factor receptor (EGF-R), tumor necrosis factor (TNF)-receptor 등에 의해 매개되는 신호전달체계를 통해 전염증성 사이토카인 생성을 촉진시키게 된다. 이들 수용체의 활성화는 결과적으로 MAPK(mitogen-activated protein kinase)를 포함하는 다운스트림(downstream)의 신호전달을 매개하는 단백질들을 활성화시키는 연속적인 인산화로 이루어지고, 결과적으로 activator protein-1(AP-1)과 nuclear factor κB(NF-κB)와 같은 전사인자를 활성화시켜 염증반응을 유발하고 matrix metalloproteinase(MMPs)와 같은 콜라겐 분해효소(collagenase)의 활성을 촉진시킴으로써 피부탄력을 감소시키고 주름생성을 촉진시키게 된다. AP-1은 세포의 성장과 분화에 관련되는 수많은 유전자의 발현을 조절하고 일부 MMPs의 발현을 강력히 조절한다. AP-1에 의해 발현이 조절되는 MMP 중 MMP-1은 collagenase 1으로 알려져 있으며, 타입 1과 3 콜라겐을 기질로 한다.
한편, 이오논(ionone)은 Rubus idaeus(Raspberry, 라즈베리), Daucus carota subsp. Sativus(Carrot, 당근), Prunus dulcis(Almond, 아몬드), Menta(Herb, 허브)에 주로 함유되어 있는 향기 성분으로 주로 꽃향기를 낸다. 이오논은 주로 샴푸, 비누, 청소용품, 바디 로션, 화장품, 샤워젤, 헤어 스프레이의 성분으로 이용되고, 한국 KFDA 및 미국 FDA 식품첨가물 데이터베이스에 착향료로 등재되어 있으며, 청량음료, 아이스크림, 츄잉껌 등에 주로 사용된다. 이오논의 생리활성에 관한 연구로는 인체에 해로운 미생물균에 대해 이오논이 강력한 항균활성을 나타낸 것이 유일한 보고일 뿐, 다른 생리활성은 전혀 보고된 바가 없다.
본 발명자들은 부작용이 적은 천연물에서 콜라겐 분해효소의 작용을 억제하고 콜라겐의 합성을 촉진시킴으로써 주름 개선에 효과가 있는 식품 또는 화장품 소재를 개발하는 연구를 진행한 결과, 이오논(ionone)이 피부보습 개선, 피부각질제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 나타내는 것을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 화장료 조성물을 제공하는데 있다.
본 발명의 다른 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 건강기능식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 의약품 또는 의약외품 조성물을 제공하는 것이다.
본 발명의 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 화장료 조성물을 제공하는데 있다.
본 발명의 다른 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 건강기능식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 의약품 또는 의약외품 조성물을 제공하는 것이다.
본 발명의 이오논 또는 이의 염을 유효성분으로 함유하는 조성물은 피부수분 함유량 증진, 피부수분 증발량 감소, 프로콜라겐 분비량 증가, 콜라겐 생합성 촉진, 콜라겐 섬유 손상 억제, 콜라겐 섬유 분해 억제, 홍반 억제 및 피부 표피층의 비후 억제 활성이 우수하여 피부보습 개선, 피부각질제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선에 유용하게 활용될 수 있다. 또한, 본 발명의 이오논은 천연물이므로, 인체에 안전하고 부작용이 적어 화장품, 건강기능식품, 의약품 또는 의약외품 등의 소재로 다양하게 사용될 수 있다.
도 1은 사람 피부섬유아세포에 20 mJ/㎠로 UVB를 조사한 후, 100 μM의 비타민 C 또는 α-이오논을 24시간 동안 처리한 다음 ELISA 분석으로 프로콜라겐 분비량을 측정한 결과를 나타낸 그래프이다(-UVB: UVB를 처리하지 않은 정상군, +UVB : UVB를 처리한 대조군, IO : UVB를 조사한 후 α이오논을 처리한 실험군, VitC : UVB를 조사한 후 비타민 C를 처리한 대조군, IO+VitC : UVB를 조사한 후 α-이오논과 비타민 C를 함께 처리한 실험군).
도 2는 표 1의 조성을 갖는 실험식이를 섭취한 마우스의 체중증가량 및 식이섭취량을 나타낸 그래프이다(A: 체중, B: 체중증가량, C 및 D: 식이섭취량).
도 3은 표 1의 조성을 갖는 실험식이를 섭취한 마우스의 피부조직의 수분함유량(A), 수분증발량(B), 탄력성(C) 및 홍반지수(D)를 나타낸 그래프이다.
도 4는 표 1의 조성을 갖는 실험식이를 섭취한 마우스 각각의 등피부조직을 보여주는 사진이다.
도 5는 표 1의 조성을 갖는 실험식이를 섭취한 마우스의 등 피부조직의 주름 형성 정도를 나타낸 사진(A) 및 그래프(B)이다.
도 6은 표 1의 조성을 갖는 실험식이를 섭취한 마우스의 피부 두께를 측정한 그래프(A) 및 피부 표피층 사진(B)이다.
도 7은 표 1의 조성을 갖는 실험식이를 섭취한 마우스의 콜라겐 섬유의 양과 형태 변화를 관찰한 사진이다.
도 8은 α-이오논을 처리한 무모 마우스 등조직에서 콜라겐 및 MMP 유전자들의 발현 변화를 RT-PCR로 측정한 결과를 나타낸 것이다.
이하, 본 발명을 보다 상세히 설명한다.
상술한 바와 같이, 이오논은 인체에 해로운 미생물균에 대해 강력한 항균활성을 나타내는 것으로 보고되고 있을 뿐, 그 외 다른 생리활성에 대해서는 특별히 보고된 바가 없다.
이러한 배경 하에, 본 발명자들은 피부건강과 관련된 이오논의 신규 활성을 확인하고, 이오논 또는 이의 염을 유효성분으로 함유하는 화장료 조성물, 건강기능식품 조성물, 의약품 및 의약외품 조성물을 개발하였다.
본 발명에서 제공하는 조성물은 피부수분 함유량 증진, 피부수분 증발량 감소, 프로콜라겐 분비량 증가, 콜라겐 생합성 촉진, 콜라겐 섬유 손상 억제, 콜라겐 섬유 분해 억제, 홍반 억제 및 피부 표피층의 비후 억제 활성이 우수하여 피부주름 개선, 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선에 유용하게 활용될 수 있다.
따라서, 본 발명은 이오논 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 화장료 조성물을 제공한다.
이오논은 케톤(ketone)계 화합물로서, 구조식은 C13H20O, 그리고 분자량은 192.3 g/mol이다. 이오논은 총 3개의 이성질체를 가지며 분자구조에 따라 각각 하기 화학식 1, 2 및 3으로 표시되는 알파이오논(α-ionone), 베타이오논(β-ionone) 및 감마이오논(β-ionone)으로 불린다. 알파이오논은 (3E)-4-(2,6,6-trimethylcyclohex-2-en-1-yl)but-3-en-2-one, cyclocitrylideneacetone, irisone, jonon 등의 이명으로도 불리운다. 알파이오논은 옅은 황색의 투명한 액체성분이고 녹는점은 -49℃, 끓는점은 126-128℃이다.
[화학식 1]
Figure PCTKR2017006574-appb-I000001
[화학식 2]
Figure PCTKR2017006574-appb-I000002
[화학식 3]
Figure PCTKR2017006574-appb-I000003
이오논(ionone)은 Rubus idaeus(Raspberry, 라즈베리), Daucus carota subsp. Sativus(Carrot, 당근), Prunus dulcis(Almond, 아몬드), Menta(Herb, 허브)에 주로 함유되어 있는 향기 성분으로 주로 꽃향기를 낸다.
본 발명의 이오논의 수득 방법은 특별히 한정되지 않으며, 상기 이오논을 함유하고 있는 식물로부터 분리하거나, 공지된 제법을 사용하여 화학적으로 합성하거나, 시판되는 것을 사용할 수 있다.
이오논의 ADI(acceptable daily intake) 값은 0-0.1 mg/kg이고 (JECFA, Safety evaluation of certain food additives. WHO Food Additive Series 42: 335-352, 1999), LD50 값은 2 g/kg body weight이며, 하루 최대 피부 노출량은 0.0002-0.331 mg/kg/day이다.
또한, 32 마리의 랫트를 대상으로 이오논을 8주 동안 10 mg/day 용량으로 경구 섭취시켰을 때 독성이 나타나지 않았다는 보고가 있으며, 또 다른 연구에서는 72 마리의 랫트에게 2일에 한번씩 7주 동안 3 mg/mouse 용량의 이오논을 오일에 녹여 경구 섭취시켰을 때 독성이 나타나지 않았다는 보고가 있다.
따라서, 이오논을 0.0002 mg/kg 내지 1,500 mg/kg, 바람직하게는 0.1 mg/kg 내지 1,000 mg/kg으로 투여 하는 것은 독성이 아주 미미하거나 없으므로, 이오논은 상기 농도 범위 내에서 투여 방법 및 투여 목적에 따라 적절한 농도로 화장료 조성물, 건강기능식품 조성물, 의약품 또는 의약외품 조성물 등에 사용할 수 있다.
본 발명에서, 상기 이오논은 알파이오논(α-ionone), 베타이오논(β-ionone) 또는 감마이오논(γ-ionone)을 제한 없이 포함할 수 있으며, 상기 이오논과 동일한 효능을 갖는 범위 내에서 이오논 수화물, 이오논 유도체 등을 포함할 수 있고, 이의 용매화합물이나 입체 이성질체 또한 포함할 수 있다.
본 발명에서, 용어 "피부주름 개선"은 피부의 주름 및 탄력과 관련된 능력을 유지 또는 강화시키는 것을 의미한다. 피부 진피층의 교원섬유인 콜라겐(collagen)과 탄력섬유인 엘라스틴(elastin)이 그러한 역할을 하는 주요 단백질로서 피부 탄력을 주관하는데, 콜라겐의 생합성은 피부의 내, 외적 영향을 받게 된다. 구체적으로, 피부세포는 자연 노화로 인하여 세포 활성이 감소되면 콜라겐 섬유의 감소가 일어나거나, 또는 외적요인으로서 자외선의 과량 조사되거나 스트레스 등에 의해 생성된 활성 산소가 단백질의 티올기(thiol: -SH)와 반응하여 효소 활성을 저해하거나, 콜라겐, 엘라스틴 등의 분해 효소의 발현을 증가시켜 피부의 주름을 증가시키고 탄력을 감소시켜 피부 노화가 진행된다.
본 발명에서, 용어 "화장품학적으로 허용 가능한 염", "식품학적으로 허용 가능한 염", "약학적으로 허용 가능한 염" 또는 "이의 염"은 유리산(free acid)에 의해 형성된 산 부가염일 수 있다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들어 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 또한, 동 몰량의 화합물 및 물 중의 산 또는 알코올 (예를 들어, 글리콜 모노메틸 에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다.
상기 유리산으로는 무기산 또는 유기산을 사용할 수 있다. 상기 무기산의 비제한적인 예로는 염산, 인산, 황산, 질산, 주석산 등을 사용할 수 있으며, 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다. 상기 유기산의 비제한적인 예로는 메탄술폰산, p-톨루엔술폰산, 아세트산, 트리플루오로아세트산, 말레인산 (maleic acid), 숙신산, 옥살산, 벤조산, 타르타르산, 푸마르산 (fumaric acid), 만데르산, 프로피온산 (propionic acid), 구연산 (citric acid), 젖산 (lactic acid), 글리콜산 (glycollic acid), 글루콘산 (gluconic acid), 갈락투론산 (galacturonic acid), 글루탐산, 글루타르산 (glutaric acid), 글루쿠론산 (glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산, 하이드로아이오딕산 등을 사용할 수 있다. 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다.
또한, 상기 이오논은 염기를 사용하여 화장품학적으로 또는 식품학적으로 허용 가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은, 예를 들어 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해시키고, 비용해 화합물 염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 상기 금속염으로는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 바람직하나 이들에 제한되는 것은 아니다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염 (예를 들어, 질산은)과 반응시켜 얻을 수 있다.
상기 이오논의 염은, 달리 지시되지 않는 한, 상기 이오논의 화합물에 존재할 수 있는 산성 또는 염기성 기의 염을 모두 포함할 수 있다. 예를 들어 상기 이오논의 염으로는 하이드록시기의 나트륨, 칼슘 및 칼륨염 등이 포함될 수 있고, 아미노기의 기타 화장품학적으로 허용 가능한 염으로는 하드로브로마이드, 황산염, 수소 황산염, 인산염, 수소 인산염, 이수소 인산염, 아세테이트, 숙시네이트, 시트레이트, 타르트레이트, 락테이트, 만델레이트, 메탄술포네이트 (메실레이트) 및 p-톨루엔술포네이트 (토실레이트)염 등을 들 수 있으며 당업계에서 알려진 염의 제조 방법을 통하여 제조될 수 있다.
본 발명의 화장료 조성물에서 이오논 또는 이의 화장품학적으로 허용 가능한 염의 유효 함량은 특별히 제한되지 않으며, 조성물 전체 중량에 대하여 0.0001 내지 20 중량%로 포함되는 것일 수 있다. 화장료 내에 0.0001 중량% 미만의 이오논 또는 이의 염은 그 용량이 소량이어서 주름 개선 효과가 없을 수 있으며, 20 중량% 이상의 이오논 또는 이의 염은 기존에 알려진 독성을 나타낼 수 있다.
본 발명의 일실시예에서는 자외선을 조사한 사람 피부섬유아세포에 α-이오논을 처리한 경우 자외선만을 조사한 대조세포와 비교하여 procollagen type I C-peptide(PIP) 분비량이 증가함을 확인하였다(도 1).
본 발명의 다른 일실시예에서는 자외선 조사와 함께 α-이오논을 함유하는 표 1의 실험식이를 무모생쥐에게 10주간 공급하여, 실험동물의 피부 수분함유량, 수분증발량, 탄력성, 홍반지수, 등피부조직의 주름, 피부두께 변화, 교원섬유의 양과 형태 변화 및 피부조직의 콜라겐 타입 1α1, 1α2, 3α1의 발현과 MMP-1a, MMP-1b, MMP-3, MMP-9 유전자 발현을 측정하였다. 그 결과, α-이오논은 피부 수분함유량과 탄력성을 유의하게 증가시키고, 수분증발량과 홍반지수를 유의하게 감소시킴을 확인하였다(도 3). 또한, α-이오논은 실험동물의 등 피부조직 주름을 개선시키고(도 4), 피부주름 면적, 깊이 및 길이를 유의하게 감소시켜 주름생성을 현저하게 억제하는 효과가 있으며(도 5), 자외선 조사에 의해 비후해진 표피층의 두께 또한 현저하게 감소시키고(도 6), 교원섬유의 밀도를 조밀하게 하고 배열을 규칙적으로 유지시키는 효과를 가지며(도 7), 콜라겐 타입 1α1, 1α2 및 3α1의 발현을 유의하게 증가시키고, MMP-1a, MMP-1b, MMP-3, 및 MMP-9 유전자 발현을 유의하게 감소시킴으로써 콜라겐 단백질의 합성을 증가시키고 콜라겐 섬유의 분해를 저해하여 자외선 조사에 의한 주름형성을 효과적으로 억제함을 확인하였다(도 8).
따라서, 본 발명의 이오논 또는 이의 염을 포함하는 조성물은 피부주름 개선, 피부보습 개선, 피부각질 제거, 피부탄력 증진, 피부주름 개선, 홍반 억제 및/또는 피부광노화 개선 효과를 제공하는 기능성화장품, 건강기능식품, 의약품 또는 의약외품 등의 소재로 유용하게 활용될 수 있다.
본 발명에서 사용되는 용어, "화장료 조성물"은 상기 화합물을 포함하는 조성물로서 그 제형은 어떠한 형태라도 가능하다. 이러한 제형의 예를 들면 상기 조성물을 이용하여 제조된 화장료는 영양크림, 아이크림, 마사지크림, 클렌징 크림과 같은 크림류, 팩류, 영양로션과 같은 로션류, 에센스류, 유연화장수, 영양 화장수와 같은 화장수류, 파우더류, 파운데이션류 및 메이크업 베이스류 등이고, 본 발명의 목적을 달성하기 위하여 이러한 제형 중 어떠한 형태로도 제조되어 상용화될 수 있으며, 상기 예들에 한정되지 않는다. 또한, 본 발명에 따른 화장료 조성물에는 통상의 화장료 제조 방법으로 제형화할 수 있다.
구체적으로 본 발명의 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 각질제거제, 비누, 샴푸, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 구성된 그룹에서 선택된 어느 하나의 제형을 가지는 것일 수 있다.
본 발명의 화장료 조성물은 이오논 또는 이의 염에 더하여 부형제, 담체 등 기타 첨가제를 포함할 수 있으며, 일반 피부 화장료에 배합되는 보통의 성분을 필요한 만큼 적용 배합하는 것이 가능한다.
구체적으로, 본 발명의 화장료 조성물은 경피 침투 강화제를 추가로 포함할 수 있다. 본 발명에서 사용되는 용어, 경피 침투 강화제란 피부의 혈관세포 내로 원하는 성분이 높은 흡수율로 침투할 수 있게 해주는 조성물이다. 바람직하게는 레시틴 화장품에 사용되는 다른 인지질 성분, 리포좀 성분 등이 포함되지만 이에 국한되지는 않는다.
또한, 유상 성분으로서 주로 사용될 수 있는 오일로는 식물성 오일, 광물성 오일, 실리콘유 및 합성유 중에서 선택된 하나 이상을 사용할 수 있다. 보다 구체적으로, 미네랄오일, 사이크로메치콘, 스쿠알란, 옥틸도데실 미리스테이트, 올리브오일, 비티스 비니페라 씨드 오일, 마카다미아너트오일, 글리세릴옥타노에이트, 캐스터오일, 에칠헥실 이소노나노에이트, 디메치콘, 사이크로펜타실록산 및 선플라워씨드 오일 등을 사용할 수 있다.
또한, 유화 능력을 보강하기 위하여 계면활성제, 고급 알콜 등을 0.1 내지 5 중량% 첨가할 수 있다. 이러한 계면 활성제로는 비이온 계면활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제, 인지질 등과 같은 통상적인 계면활성제를 사용할 수 있으며, 구체적으로, 소르비탄세스퀴놀리에이트, 폴리솔베이트 60, 글리세릴 스테아레이트, 친유형 글리세릴스테아레이트, 소르비탄 올리에이트, 소르비탄 스테아레이트, 디이에이-세틸포스페이트, 소르비탄스테아레이트/ 슈크로스코코에이트, 글리세릴스테아레이트/폴리에틸렌글라이콜-100 스테아레이트, 세테아레스-6 올리베이트, 아라키딜알코올/ 베헤닐알코올/아라키딜 글루코사이드, 폴리프로필렌글라이콜-26-부테스-26/ 폴리에틸렌글라이콜-40 하이드로제네이티드 캐스터오일 등을 사용할 수 있다. 고급 알콜로는 탄소수가 12 내지 20인 알코올, 예컨대 세틸알코올, 스테아릴 알코올, 옥틸도데칸올, 이소스테아릴 알코올 등을 단독으로 또는 1종 이상 혼합하여 사용할 수 있다.
수상 성분은 수상의 점도 또는 경도를 조절하기 위하여 카보머, 잔탄검, 벤토나이트, 마그네슘알루미늄실리케이트, 셀룰로오스검, 덱스트린 팔미테이트 등과 같은 1종 이상의 점증제를 0.001 내지 5 중량% 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물에는 필요에 따라 고급 지방산, 비타민 등의 약효 성분과 자외선 차단제, 산화 방지제(부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산, 토코페릴아세테이드, 부틸레이티드하이드록시톨루엔 등), 방부제(메칠파라벤, 부틸파라벤, 프로필파라벤, 페녹시에탄올, 이미다졸리디닐우레아, 클로르페네신 등), 착색제, pH 조절제(트리에탄올아민, 씨트릭애씨드, 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등), 보습제(글리세린, 솔비톨, 프로필렌 글라이콜, 부틸렌 글라이콜, 헥실렌 글라이콜, 디글리세린, 베타인, 글리세레스-26, 메칠글루세스-20 등), 윤활제 등의 성분을 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물은 피부에 필수 영양소를 보조적으로 제공할 수 있는 물질을 추가로 포함하는데, 바람직하게는 천연향, 화장품향, 또는 한약재가 포함되지만 이들에 국한되지 않는 보조제를 함유할 수 있다.
또한, 본 발명의 화장료 조성물은 피부 주름개선 성분 또는 피부탄력 증진 성분을 추가로 포함할 수 있다. 그 구체적인 피부 주름 개선 성분 또는 피부탄력 증진 성분으로는 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베툴린산 및 클로렐라 추출물로 구성되는 군으로부터 선택되는 어느 하나 이상인 것일 수 있으며, 가장 바람직하게는 비타민 C일 수 있다.
본 발명의 일실시예에서는 자외선을 조사한 사람피부섬유아세포에 α-이오논을 비타민 C와 함께 처리한 경우, α-이오논 또는 비타민 C를 단독으로 처리한 경우보다 콜라겐 양이 더 높은 수치로 측정되어 상승효과를 나타냄을 확인하였다(도 1).
본 발명은 또한, 이오논 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 건강기능식품 조성물을 제공한다.
상기 "이오논"과 "이의 식품학적으로 허용 가능한 염"에 대한 설명은 전술한 바와 같다.
본 발명에서 용어 "건강기능식품”은 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 '기능성'이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조 시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한없이 제조될 수 있다. 본 발명의 건강기능식품 조성물은 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
본 발명의 건강기능식품 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군으로부터 선택된 어느 하나의 제형으로 제조된 것일 수 있다.
본 발명에 따른 건강기능식품 조성물은 이오논을 유효성분으로 포함시켜 분말제, 액제, 정제, 연질캅셀제, 과립제, 티백차, 인스턴트 차 또는 드링크제 등의 형태로 제형화될 수 있다. 유효 성분으로서의 이오논의 함량은 그 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 건강기능식품 조성물 중에 포함되는 이오논의 양은 전체 식품 중량의 0.1 내지 90 중량%로 가할 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다. 또한, 본 발명에 따른 건강기능식품 조성물은 이오논 이외에 본 발명이 목적으로 하는 주효과를 손상시키지 않는 범위 내에서 바람직하게는 주효과에 상승효과를 줄 수 있는 다른 성분 예를 들면, 비타민 C와 같은 주름 개선용 화합물 또는 녹차 추출물, 닥나무 추출물, 감초추출물, 상백피 추출물, 빈랑자 추출물, 황금 추출물, 산삼 추출물 등의 천연물을 함유하는 것도 무방하다.
상기와 같은 형태로 제형화된 건강기능식품 조성물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 식품의 예로는 드링크제, 육류, 소시지, 빵, 비스킷, 떡, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 알코올 음료 및 비타민 복합제, 유제품 및 유가공 제품 등이 있으며, 통상적인 의미에서의 건강기능식품은 모두 포함한다.
본 발명의 건강기능식품 조성물이 드링크제인 경우는 지시된 비율로 필수성분으로서 이오논을 함유하며, 그 밖의 드링크제 제조를 목적으로 사용되는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제 및 합성 향미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다.
또한 본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에도 본 발명의 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 이오논 100 중량부 당 0.1 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명은 또한, 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 의약외품 또는 의약 조성물을 제공한다.
상기 "이오논"과 "이의 염"에 대한 설명은 전술한 바와 같다.
본 발명의 이오논 또는 이의 약학적으로 허용 가능한 염을 의약품으로 사용하는 경우, 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 예컨대, 공지의 피부 주름 개선 성분 또는 탄력 증진 성분을 포함할 수 있을 것이다. 추가적인 피부 주름 개선 성분 및 탄력 증진 성분을 포함하게 되면 본 발명의 조성물의 주름개선 및 탄력 증진 효과는 더욱 증진될 수 있다. 상기 성분 추가 시에는 복합 사용에 따른 피부 안전성, 제형화의 용이성, 유효성분들의 안정성을 고려할 수 있다. 본 발명의 일실시예에서, 상기 의약품 조성물은 당업계에 공지된 주름 개선 성분으로서, 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베툴린산 및 클로렐라 추출물로 이루어진 군으로부터 선택되는 어느 하나 이상의 피부 주름 개선 성분을 추가로 포함할 수 있다. 추가의 피부주름 개선 성분은 전체 조성물 중량에 대하여 0.0001 내지 10 중량%로 포함될 수 있을 것이며, 상기 함량 범위는 콜라겐 합성 촉진 활성, 피부 안전성, 상기 화학식 1의 화합물의 제형화 시의 용이성 등의 요건에 따라 조절될 수 있을 것이다.
또한, 본 발명의 피부 주름 개선 및 탄력 증진용 약학적 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다.
약학적으로 허용되는 담체는 완충액, 주사용 멸균수, 일반 식염수 또는 인산염 완충 식염수, 슈크로스, 히스티딘, 염 및 폴리솔베이트 등과 같은 여러 성분을 함유할 수 있다.
본 발명의 약학적 조성물은 경구 또는 비경구로 투여할 수 있으며, 일반 의약품 제제의 형태, 예를 들어, 임상투여 시 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학적 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제될 수 있다.
단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌 글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 의약품 조성물은 유효량의 이오논 또는 이의 약학적으로 허용 가능한 염을 포함할 때 바람직한 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 제공할 수 있다. 본 발명에 있어서, '유효량'이라 함은 피부의 주름이 생성되는 것을 억제 또는 저해하거나, 이미 생성된 주름을 완화시킬 수 있는 화합물의 양을 의미한다. 본 발명의 조성물에 포함되는 이오논 또는 이의 약학적으로 허용 가능한 염의 유효량은 조성물이 제품화되는 형태, 상기 화합물이 피부에 적용되는 방법 및 피부에 머무르는 시간 등에 따라 달라질 것이다. 예컨대, 상기 조성물이 피부의 주름 생성, 탄력 감소, 기미 등에 따른 피부과적 치료를 위한 의약품으로 제품화되는 경우에는 일상적으로 피부에 적용하게 되는 화장품으로 제품화되는 경우에 비해 높은 농도로 이오논 또는 이의 약학적으로 허용 가능한 염을 포함할 수 있을 것이다.
본 발명에서 사용되는 용어 "의약외품"은 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미하는 것으로, 예를 들어 약사법에 따르면 의약외품이란 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람ㆍ동물의 질병 치료나 예방에 쓰이는 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않는 제품 등이 포함된다.
본 발명의 의약외품 조성물은 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선을 목적으로 사용되는 것으로, 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 유연화장수, 영양화장수, 마사지크림, 영양크림, 팩, 마스크팩, 마스크시트, 젤 또는 피부 점착타입 화장료의 제형을 갖는 화장료 조성물일 수 있으며, 또한, 로션, 연고, 겔, 크림, 패취 또는 분무제와 같은 경피투여형 제형일 수 있다.
또한, 각 제형에 있어서 의약외품 조성물은 다른 성분들을 기타 의약외품의 제형 또는 사용목적 등에 따라 임의로 선정하여 배합할 수 있다. 유효 성분의 혼합양은 사용 목적(억제 또는 완화)에 따라 적합하게 결정될 수 있다. 예를 들어, 점증제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 및 담체 등을 포함할 수 있다.
본 발명의 이오논 또는 이의 염의 함량은 의약외품 조성물의 총 중량을 기준으로 각각 0.0001 내지 20 중량% 인 것이 바람직하다. 20 중량%를 초과하는 경우에는 조성물 제조시 색상 및 안정성이 떨어지며, 0.0001% 미만의 경우에는 그 작용효과가 미미하다.
또한, 각 제형의 의약외품 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 제형 또는 사용목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
[ 실시예 ]
1. 사람피부섬유아세포를 이용한 α-이오논의 주름개선 효능
1-1. 실험방법
1) 세포배양
사람피부섬유아세포(primary dermal fibroblast, nor mal, human, neonatal, ATCC No. PCS-201-010)를 ATCC사(Manassas, VA, USA)로부터 구매하여 사용하였다. 구입한 세포를 fibroblast growth medium(Promo Cell, Heidelberg)을 이용하여 37, 5% CO2 인큐베이터에서 배양하여 실험에 사용하였다.
2) Procollagen Type I C-peptide(PIP) 농도 측정
콜라겐 생합성능을 알아보기 위하여 사람섬유아세포를 12 웰-플레이트(well-plate)에 1.0×106 cells/well 씩 분주하여 α-이오논과 비타민 C를 각각 100 μM의 농도로 첨가하여 24시간 동안 CO2 배양기에서 배양하였다. 각 웰의 배지를 제거한 후 PBS로 1회 세척하고 다시 1 ml의 PBS를 넣은 후 20 mJ/cm2 조건으로 ultraviolet B(UVB)를 조사하였다. 각 웰의 PBS를 다시 배지로 교체하여 24시간 동안 배양한 후, procollagen type C-peptide EIA kit(Takara Bio, Japan)를 이용하여 배지로 분비된 프로콜라겐 양을 측정하였다. 콜라겐 측정 키트에 포함된 표준용액을 농도별로 희석하고 450 nm에서 흡광도를 측정하여 표준농도 곡선을 작성하고 콜라겐 생성량을 산정하였다.
1-2. 실험결과
1) 프로콜라겐 분비량 변화
피부를 구성하는 주 단백질인 콜라겐은 피부진피에 존재하는 섬유아세포에서 프로콜라겐의 형태로 합성된 후 세포외 기질로 분비된다. 세포외 기질로 분비된 프로콜라겐은 세포표면에 존재하는 procollagen peptidase에 의해 C-말단이 분해되고 활성형 콜라겐으로 형성되므로 C-peptide 함량을 측정하면 활성화된 콜라겐 함량을 측정할 수 있다. 도 1의 각각의 값은 3개의 독립적인 웰로부터 3회 측정의 means ± SEM을 나타낸다. 다른 알파벳으로 표시된 평균값은 통계적으로 유의함을 나타낸다(p < 0.05).
사람피부섬유아세포에 자외선 조사와 함께 약물을 처리하여 세포외 기질로 분비된 프로콜라겐, procollagen type I C-peptide(PIP) 양을 측정한 결과, 자외선을 조사한 대조세포(+UVB)에서는 정상세포(-UVB)에 비해 프로콜라겐 분비량이 현저히 감소하였고, 자외선 조사와 함께 α-이오논을 처리한 세포(IO)에서는 자외선만 조사한 대조세포(+UVB)에 비해 콜라겐 양이 37% 유의하게 증가하였다. 한편 α-이오논을 비타민 C와 함께 처리한 세포(IO+VitC)에서는 자외선 조사 대조세포(+UVB)에 비해 콜라겐 양이 64% 유의하게 증가하였고, 이는 비타민C(+37%) 또는 α-이오논(+37%)을 단독으로 처리한 세포에서 관찰된 콜라겐 양보다 더 높은 수치이다(도 1). 이러한 결과를 콜비공식에 대입하여 보면, α-이오논과 비타민 C를 함께 처리할 때 상승효과를 나타낸다는 것을 확인할 수 있다. 따라서 α-이오논은 사람피부섬유아세포에서 활성화된 콜라겐 양을 증가시키고 이러한 콜라겐 증가효과는 비타민 C와 함께 사용 시 더 효과적으로 나타남을 알 수 있다.
실시예 2. 마우스를 이용한 α-이오논의 피부주름 개선, 보습 및 탄력증진 효능평가
2-1. 실험방법
1) 실험식이 제조, 실험 동물의 사육 및 자외선 조사
본 실시예에 사용한 5주령 암컷 알비노 무모 생쥐(Skh-1)는 오리엔트바이오 (Gyeonggi-do, Korea)에서 구입하여 고형사료로 1주일간 적응기간을 거쳤다. 실험동물은 4개 군으로 분류하여 군별로 5 마리씩 배정하여 실험에 사용하였다. 모든 실험군은 자외선을 조사하지 않은 정상 대조군(-UVB), 자외선 조사군(+UVB), 자외선조사와 함께 α-이오논(αIO) 또는 비타민 C(VitC)을 섭취시킨 군으로 나누었다. 사육 기간 동안 사료와 물을 자유로이 섭취하도록 하였으며, 온도는 22 ± 1℃, 습도는 60 ± 5%로 유지하고 매일 광주기와 암주기가 12시간이 되도록 조절하였다.
-UVB군과 +UVB군은 AIN-93 rodent diet 구성(Ree ves, PG et al., J Nutr, 123:1939-1951, 1993)에 준하여 조제된 정제식이를 섭취시켰고, αIO군은 AIN-93 정제식이에 0.2% α-이오논 (Sigma-Aldrich)을, 그리고 VitC군은 AIN-93 정제식이에 0.2% 비타민 C(Sigma-Aldrich)를 첨가하여 제조된 식이를 10주간 공급하였다. 자세한 실험식이의 조성은 하기 표 1과 같다. 식이는 매일 오전 10~11시 사이에 물과 함께 공급하였으며, 식이 섭취량은 매일 측정하였다.
실험식이 조성표
성분 AIN- 93G식이 (g/kg diet) α-이오논 보충식이 ( IO ) (g/kg diet) 비타민 C 보충식이 ( VitC ) (g/kg diet)
카제인 200 200 200
말토덱스트린 132 132 132
옥수수 전분 397.486 395.486 395.486
수크로오스 100 100 100
셀룰로오스 50 50 50
콩기름 70 70 70
비타민 복합물 10 10 10
미네랄 복합물 35 35 35
콜린 비타르트레이트 2.5 2.5 2.5
L-시스틴 3 3 3
Tert-부티하이드로퀴논 0.014 0.014 0.014
α-이오논 - 2 -
비타민 C - - 2
총합(g) 1,000 1,000 1,000
실험사육기간 동안 무모 생쥐의 등 부분에 ultraviolet B (UVB)를 주 3회 조사하였으며 자외선 조사량은 처음 1주 동안은 73 mJ/cm 2, 2주째는 146 mJ/cm2, 3주부터 10주까지는 219 mJ/cm2로 조사하였다. 사육하는 동안 매주 체중 및 피부두께를 측정하였고, 등 피부 부위의 사진촬영을 실시하였다. 피부두께는 디지털 마이크로 캘리퍼(Marathon Watch Company Ltd, Ontario, Canada)를 이용하여 무모생쥐의 엉덩이 부분에서 측정하였다. 측정할 때 사용된 캘리퍼는 0.01 mm 까지 측정 가능하며 두께에 일정한 힘을 가할 수 있는 조절기능을 갖추고 있어 같은 힘을 준 상태에서 피부의 두께 측정이 가능하였다.
실험사육 마지막 날 실험동물을 6시간 공복시키고 마취한 상태에서 혈액과 등 피부조직을 채취하였다. 혈액시료는 주사기로 복부 하대정맥에서 채취하여 EDTA가 코팅된 튜브에 담고 2,000×g에서 15분간 원심분리한 후 혈장을 분리하여 분석 시까지 -70℃에서 냉동보관하였다. 등 피부조직의 일부는 즉시 -70℃ 냉동고에 보관한 후 분자생물학적 검사에 사용하였고, 일부는 10% 포르말린 용액에 고정하여 면역조직화학적 염색에 사용하였다.
2) 피부 보습, 탄력성 및 홍반지수 측정
실험동물의 피부 수분함유량, 수분증발량, 탄력성 및 홍반지수 측정은 각각 Corneometer®, Tewameter®, Cutometer®, Mexameter® (CK Electronics GmbH)을 이용하여 실험 종료일에 1회 측정하였다. 측정 시 실험동물 등의 일정한 부분을 가볍게 눌러서 나타나는 수치를 기록하였다.
3) 등피부조직의 주름 측정
10주 동안 자외선 조사를 실시한 무모 생쥐의 피부를 실리콘 고무로 모사판을 제작하여 주름의 형성 정도를 측정하였다. 무모 생쥐의 등 부분에 지름이 1 cm가 되는 원모양의 구멍이 있는 디스크를 부착하고 모사판 제작용 시약을 혼합하여 무모 생쥐의 등 부분에 얇게 펴 바르고 완전히 말린 다음 디스크를 조심스럽게 떼어내어 모사판을 제작하였다. 모사판의 제작 온도는 20 ~ 23℃, 습도 45 ~ 50%의 항온항습 상태에서 실시하였으며, 모사판 제작용 실리판 고무 인상재(Epigem, Seoul, Korea)를 사용하였다. 제작한 모사판의 분석은 컴퓨터 영상분석기(Visioline VL650, CK electronic GmbH, Germany)을 사용하여 주름의 총면적(total wrinkle area), 최대 주름깊이(max wrinkle depth), 주름 평균깊이(mean depth) 및 평균 길이(mean length) 등의 4가지 주름지표 항목을 분석하였다.
4) 피부조직의 면역조직화학적 염색
무모생쥐의 등 피부 조직을 적출하고 10% 포르말린에 고정한 다음, 한국 CFC (경기도, 한국)에 의뢰하여 Hema toxylin and eosin(H&E)와 Masson's trichrome(M&T) 염색을 한 뒤 광학현미경 (IX71, Olympus, JPN)을 이용하여 관찰한 뒤, digital camera (DP71, Olympus, JPN)를 이용하여 사진을 촬영하였다.
5) RT- PCR 분석
등 피부조직 0.1 g 당 Trizol 용액 1 ml을 첨가하여 조직을 분쇄한 후, 4, 12,000 ×g에서 10분간 원심분리 하였다. 상층액을 새 튜브로 옮긴 후 chloroform 200 ㎕을 첨가하고, vortex하였다. 이 과정을 두 번 반복한 다음, 상층액을 새 튜브로 옮긴 후 isoprophanol과 상층액을 1:1 비율로 첨가하였다. 10회 세게 흔든 다음 실온에서 15분 동안 방치한 후, 12,000 xg, 4에서 10분간 원심분리 시킨 후 상층액을 제거하고, 남은 침전물에 70% ethanol 1 ml을 가한 후 7,500 ×g, 4에서 5분 동안 원심분리 하였다. 에탄올을 제거한 후 RNA 침전물이 담긴 튜브를 실온에서 15분 동안 건조시키고, nuclease free water를 사용하여 RNA pellet을 용해시켰다. UV/VIS spectrophotometer(Beckman coulter, DU730)를 이용하여 260 nm 및 280 nm 파장에서 추출된 RNA 시료의 농도를 측정하고, agarose gel electrophoresis를 실시하여 RNA 시료의 integrity를 확인하였다.
등 피부조직에서 추출된 RNA 시료를 대상으로 oligo dT primer와 superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA)을 이용하여 reverse transcription을 수행함으로써 cDNA를 합성하였다. Reverse transcription을 통해 얻은 cDNA를 template로 하고 증폭하고자 하는 유전자 cDNA의 5'과 3' flanking sequence를 primer로 사용하여 PCR을 수행하였으며, 이때 사용된 primer sequence는 [표 2]에 제시된 바와 같다. 증폭된 PCR 산물 1 ㎕를 1% agarose gel에 전기영동 하여 DNA band를 확인하였다.
RT-PCR에 사용된 프라이머 서열
유전자 프라이머 서열 (5'3') 어닐링온도() PCR 산물(bp)
Collagen type alpha1(Col1α1) F ggcaacagtcgcttcaccta(서열번호 1) 55 164
R agtccgaattcctggtctgg(서열번호 2)
Collagen type alpha2(Col1α2) F cggttctgttggtcctgttg(서열번호 3) 55 103
R acccctgtgccctttatcac(서열번호 4)
Collagen type alpha1(Col3α1) F taaccaaggctgcaagatgg(서열번호 5) 55 104
R accagtgcttacgtgggaca(서열번호 6)
Matrix metallopeptidase 1a(MMP-1a) F ccctgtgtttcacaacggag(서열번호 7) 55 133
R cctcagcttttcagccatca(서열번호 8)
Matrixmetallopeptidase 1b(MMP-1b) F tttgctcatgcttttctgcc(서열번호 9) 55 146
R gaatgggagagtccaaggga(서열번호 10)
Matrixmetallopeptidase 3(MMP-3) F tgctggtatggagcttctgc(서열번호 11) 55 142
R catctccaacccgaggaact(서열번호 12)
Matrix metallopeptidase 9(MMP-9) F gtggaccatgaggtgaacca(서열번호 13) 55 102
R actgcacggttgaagcaaag(서열번호 14)
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F ggagattgttgccatcaacg(서열번호 15) 55 122
R tgacaagcttcccattctcg(서열번호 16)
2-2. 실험결과
1) 무모 생쥐의 체중 및 식이섭취량
자외선조사, α-이오논 및 비타민C 섭취는 무모 생쥐 마우스의 체중 및 식이섭취량에 유의한 영향을 미치지 않았다(도 2). 도 2의 값들은 5마리 마우스의 mean ± SEM이다.
2) 자외선 조사 무모 생쥐 피부조직의 수분량, 탄력성 및 홍반지수 변화
10주 동안 자외선을 조사받은 +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부조직의 수분함유랑 및 탄력성은 유의하게 감소한 한편, 수분증발량 및 홍반지수는 유의하게 증가하였다(도 3). α-이오논을 섭취시킨 군(IO)의 경우 같은 세기의 UV가 조사되었음에도 불구하고 +UVB 대조군에 비해 수분함유랑 및 탄력성은 각기 78% 및 77% 유의하게 증가하였고, 수분증발량 및 홍반지수는 각각 46% 및 26% 유의하게 감소하였음이 확인되었다. 이와 같은 α-이오논의 수분함유량 및 탄력성 증진효능, 홍반지수 개선효능은 비타민에 의한 효과와 유사하였다(도 3). 도 3의 값들은 5마리 마우스의 mean ± SEM이며, 바(bar) 위의 알파벳은 Duncan's multiple range test가 뒤따르는 one-way ANOVA에 의한 유의적 차이를 나타낸다(p < 0.05).
3) 자외선 조사 무모 생쥐의 피부주름 생성변화
α-이오논 섭취가 피부주름의 형성정도에 미치는 영향을 평가하기 위하여 실험동물의 등피부 부위를 사진 촬영하였다. 10주 동안 UVB를 조사받은 +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 다수의 굵고 깊게 패인 주름과 함께 잔주름이 형성된 것을 육안 상으로 관찰할 수 있었으며, α-이오논 섭취군의 경우 +UVB 대조군에 비해 주름의 굵기와 깊이가 현저히 감소하여 자외선을 조사받지 않은 -UVB군에서 관찰된 피부상태와 유사하게 개선된 것을 확인하였다(도 4).
10주 동안 자외선을 조사받은 무모 생쥐의 등피부로부터 실리콘 고무로 모사판을 제작하여 주름의 형성 정도를 측정한 결과, +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 굵고 깊게 패인 주름과 함께 잔주름이 형성된 것을 관찰할 수 있었으며, α-이오논 섭취군은 같은 세기의 UV가 조사되었음에도 불구하고 +UVB 대조군에 비해 깊은 주름이 거의 사라지는 등, 주름의 굵기와 깊이가 현저히 개선된 것을 확인하였다(도 5A). 컴퓨터 영상분석기를 이용하여 모사판에서 주름형성 정도를 수치화 한 결과에서도 IO군의 경우 +UVB군에 비해 총주름면적이 60%, 최대 주름깊이가 49%, 평균 주름깊이가 39%, 그리고 평균 주름길이가 68% 유의하게 감소하였고, 이와 같은 α-이오논의 주름개선 효능은 비타민 C에서 관찰된 주름개선효능과 유사하였다(도 5B). 도 5B의 값들은 5마리 마우스의 mean ± SEM이며, 바(bar) 위의 알파벳은 Duncan's multiple range test가 뒤따르는 one-way ANOVA에 의한 유의적 차이를 나타낸다(p < 0.05). 따라서 α-이오논의 섭취는 자외선조사에 의한 주름생성을 현저히 억제하는 효과가 있음을 알 수 있다.
4) 자외선 조사 무모 생쥐의 피부두께 변화
자외선 등에 의한 광노화가 진행되면 피부 진피층을 보호하기 위해 각질층의 형성이 증가하여 피부가 두꺼워지고, 따라서 자외선 조사에 의해 피부 표피층의 두께가 두꺼워졌다는 것은 그만큼 광노화에 의한 피부손상이 크다는 것을 의미한다(Gail J Molecular mechanism of skin ageing Mech Ageing Dev 123: 801-810, 2002)
실험사육 마지막 날 디지털 마이크로 캘리퍼를 이용하여 등피부의 두께를 측정한 결과, +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부두께가 유의하게 증가하였고 α-이오논을 섭취시킨 군은 +UVB 대조군에 비해 피부두께가 19% 유의하게 감소하였음이 확인되었다(도 6A). 도 6A의 값들은 5마리 마우스의 mean ± SEM이며, 바(bar) 위의 알파벳은 Duncan's multiple range test가 뒤따르는 one-way ANOVA에 의한 유의적 차이를 나타낸다(p < 0.05).
피부조직의 H&E 염색을 통해 무모생쥐의 피부 표피층 두께를 관찰한 결과에서도 +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부 표피층이 비후해진 것이 관찰되었고, 한편, IO군의 경우 자외선 조사에 의해 비후해진 표피층의 두께가 현저히 감소되었음이 확인되었다(도 6B).
5) 자외선 조사 무모 생쥐의 진피층 내 교원섬유(collagen fiber)의 양과 형태 변화
자외선 조사에 의해 광노화가 진행된 피부의 경우 표피-진피 결합부위의 교원섬유망이 손상되고, 따라서 교원섬유의 양과 형태는 피부의 광노화 지표로 사용된다(Varani et al. "Inhibition of type I procollagen synthesis by damaged collagen in photoaged skin and by collagenase-degraded collagen in vitro." The American journal of pathology 158: 931-942, 2001). 자외선을 조사받은 무모 생쥐의 피부조직을 Masson's trichrome 염색을 시행하여 교원섬유(collagen fibers) 염색 정도를 관찰한 결과, -UVB군의 표피 밑의 진피층에는 aniline blue에 강하게 염색된 교원섬유가 관찰되었으나 UVB를 10주간 조사한 +UVB군의 교원섬유는 aniline blue에 의해 미약하게 염색되었다. UVB를 조사하면서 10주간 α-이오논을 섭취시킨 마우스의 경우 자외선만 조사한 대조군에 비하여 진피층 교원섬유의 밀도가 상대적으로 더 조밀하였고 배열이 규칙적이었으며, aniline blue에 의한 염색정도도 더 강하여 정상군(-UVB)에 가까운 양상을 보였다(도 7).
6) 자외선 조사 무모 생쥐 피부조직의 유전자발현 변화
콜라겐 타입 1과 3은 진피층의 세포간질 구성성분을 이루는 단백질이고, 특히 타입 1 콜라겐은 피부결합조직에 존재하는 세포외기질 단백질 중에서 가장 많은 양으로 존재한다. 한편, 콜라겐 분해를 촉매하는 MMPs는 포유류에서 23개의 타입이 존재하며 이중 자외선에 의해 증가하는 MMP 타입은 1, 3 및 9번으로 알려져 있고 이들 세가지 타입의 MMPs는 콜라겐 타입 1과 3을 분해하는 효소이다. MMP-1의 경우 콜라겐섬유의 중간을 절단하는 한편, MMP-3, MMP-9는 절단된 콜라겐섬유를 세분해서 절단하는 역할을 하는 것으로 알려져 있다(Quan T. et al. Elevated matrix metalloproteinases and collagen fragmentation in photodamaged human skin: impact of altered extracellular matrix microenvironment on dermal fibroblast function. J Investigative Dermatology, 133: 1362, 2013; Kondo S. The roles of cytokines in photoaging. J Dermatological Science 23: S30-S36, 2000).
피부조직을 대상으로 RT-PCR 분석에 의해 유전자발현 변화를 평가한 결과, +UVB 대조군의 경우 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부조직의 콜라겐 타입 1α1과 α2, 그리고 콜라겐 타입 3α1의 발현은 유의하게 감소하였고, MMP-1a 및 -1b, MMP-3, 그리고 MMP-9 유전자 발현은 유의하게 증가하였다. 한편, α-이오논 섭취군의 경우 +UVB 대조군에 비해 콜라겐 타입 1α1과 α2, 그리고 콜라겐 타입 3α1의 발현은 유의하게 증가하였고, MMP-1a 및 -1b, MMP-3, 그리고 MMP-9 유전자 발현은 유의하게 감소하였다(도 8). 따라서 α-이오논은 피부조직의 콜라겐 단백질 합성을 증가시키고 콜라겐 섬유의 분해를 저해함으로써 자외선조사에 의한 주름형성을 억제한 것으로 판단된다.
이상의 결과는 α-이오논이 자외선에 의한 피부주름을 예방하거나 완화할 수 있는 효과가 있다는 것을 제시하는 것으로 향후 기능성화장품, 건강기능식품, 의약품 또는 의약외품의 소재로 유용하게 활용될 수 있음을 시사한다.
실시예 3. 피부주름 개선, 피부자극 및 피부각질 제거 관능시험
3-1. α-이오논을 함유하는 영양 크림( 실험예 1)과 α-이오논을 함유하지 않는 영양 크림( 비교예 1)의 제조
번호 성분 실험예 1(중량%) 비교예 1(중량%)
1 세테아릴알코올 1.5 1.5
2 글리세릴스테아레이트 1 1
3 폴리소르베이트 60 1.2 1.2
4 소르비탄세스퀴올리에이트 0.3 0.3
5 세틸옥타노에이트 6 6
6 스쿠알란 8 8
7 아프리코드커넬오일 4 4
8 디메치콘 1 1
9 부틸렌글라이콜 5 5
10 글리세린 4 4
11 마그네슘알루미늄실리케이트 0.2 0.2
12 산탄검 0.05 0.05
13 방부제 미량 미량
14 정제수 잔량 잔량
15 α-이오논 1 -
상기 표 3의 각 성분번호로 구별된 성분 중에서, 먼저 성분 1 내지 8을 70℃의 온도에서 가열 용해시킨 다음, 성분 9 내지 13을 성분 14에 용해 분산시켜 70℃로 가열한 것에 유화한다. 이후, 상기 유화한 것을 56℃의 온도로 냉각한 후, 분취된 성분 9에 용해시킨 성분 15를 가하여 교반하고 실온에서 냉각하여 제조하였다.
상기 실험예 1에 대한 그 비교예 1은 성분 15인 α-이오논을 제외한 나머지 성분구성이나 제조방법은 동일하게 진행하여 제조한 것을 설정하였다.
3-2. 주름개선효과 및 피부자극 관능시험
본 발명에 따른 화장료 조성물의 피부 주름개선효과 및 피부자극을 평가하기 위하여, 상기 표 3의 실험예 1과 비교예 1에서 제조된 영양크림을 이용하여 관능시험을 실시하였다.
구체적으로, 표 3에 기재된 실험예 1과 비교예 1 제형의 영양크림을 피부에 각각 도포했을 때 피부의 주름개선효과를 측정하기 위하여 20대 내지 50대 연령층의 여성 20명에게 안면 왼쪽 부분에는 표 3의 실험예 1 영양크림(시험군)을, 안면 오른쪽 부분에는 표 3의 비교예 1 영양크림(대조군)을 1일 1회 12주간 지속적으로 사용하게 하였다.
관능시험에서 피부의 주름개선효과 항목에 대하여는 비교예의 영양크림을 기준으로 실험예 1의 영양크림이 나타내는 주름개선효과를 상대적으로 평가하게 하였고, 피부자극에 대한 관능평가는 피부의 가려움, 따가움 및 홍반 등의 현상을 평가하게 하였다. 평가는 매우 우수(5점), 우수(4점), 보통(3점), 나쁨(2점), 매우 나쁨(1점)의 오점법 기준에 의거하여 수행하였으며, 그 결과를 하기 표 4에 나타내었다. 표 4에서 피부자극은 점수가 높을수록 피부자극이 적은 것을 나타낸다.
번호 피부자극 주름개선
실험예 1 비교예 1 실험예 1 비교예 1
1 4 4 5 4
2 5 5 5 5
3 4 5 4 4
4 3 3 5 3
5 4 4 4 4
6 5 4 4 4
7 5 5 5 4
8 4 4 4 3
9 4 4 4 3
10 4 5 5 5
11 5 5 4 4
12 4 4 4 3
13 5 4 4 4
14 3 4 5 4
15 5 5 4 4
16 5 5 5 4
17 3 4 5 5
18 5 4 5 4
19 5 5 5 5
20 5 5 4 4
평균 4.35 4.4 4.5 4.0
상기 표 4에 나타난 바와 같이, α-이오논을 함유하는 실험예 1의 영양 크림 제형에 대한 피부자극 평가점수는 4.35점으로 매우 양호하게 평가되어, 4.4점을 받은 비교예 1의 영양 크림 제형과 유사하게 피부자극 정도가 낮아 피부 안전성이 우수함을 확인할 수 있었다.
또한, 비교예 1의 영양 크림 제형과 비교하여 α-이오논을 함유하는 실험예 1의 영양 크림 제형의 상대적인 피부주름 개선효과는 평가점수 4.5점으로 주름개선 정도 또한 매우 우수함을 알 수 있었다.
따라서, 본 발명의 이오논 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 함유하는 화장료 조성물은 피부 부작용이 없으며, 피부주름 개선효과, 콜라겐 단백질의 합성 증가 및 콜라겐 섬유의 분해 저해 효과가 우수하여 피부 주름 개선에 탁월하다.
3-3. 피부 보습력 증가 측정 시험
상기 표 3에 기재된 실험예 1과 비교예 1 제형의 영양크림을 피부에 각각 도포했을 때 피부의 수분 보유능을 측정하기 위하여, 20대 내지 50대 연령층의 여성 20명에게 안면 왼쪽 부분에는 표 3의 실험예 1 영양크림(시험군)을, 안면 오른쪽 부분에는 표 3의 비교예 1 영양크림(대조군)을 충분한 양으로 부드럽게 마사지하여 도포하도록 하였다. 마사지는 골고루 약 1분간에 걸쳐서 실시하였다.
피부 수분량의 측정은 도포 전 실내온도 25℃ 및 상대습도 45%의 항온 항습실에서 코니오미터를 이용하여 피부 수분량을 측정하고, 상기 표 3의 실험예 1과 비교예 1 제형을 각각 안면 왼쪽 및 오른쪽에 도포 후 10분에 걸쳐 휴식을 취하고 도포 12시간 후 및 도포 24시간 후의 피부 수분량을 측정하였다. 측정 기기는 피부의 수분 함량에 따른 피부의 전기 용량을 측정하여 보습력을 측정하는 수분 함량측정기(coneometer; CM820, Courage Khazaka electronic GmbH, Germany)를 사용하여 피부 수분량을 측정하였다. 코니오미터는 피부의 표피내에 존재하는 수분의 양을 센서를 이용하여 수분의 이온 정도를 측정하고 이를 수치화하여 수분의 양을 계산함으로써 보습력을 측정하는 것이며, 측정방법은 하기와 같다.
1) 측정하고자 하는 피부 부위에 코니오미터 프로브를 올려놓았다.
2) 프로브를 피부에 누르면 센서를 통하여 피부의 전기전도도(capacitance)를 수치화하여 화면에 표시되었다.
3) 측정부위를 달리하여, 측정을 반복하였다.
4) 한번 측정 후, 킴와이프 같은 휴지로 센서를 닦은 후, 다시 측정하였다.
측정치는 평균값으로 하기 표 5에 나타내었다.
시험물질 피부 수분량(%)
물질 도포 전 12시간 후 24시간 후
실험예 1 30.0 44.1 38.5
비교예 1 30.2 37.6 30.5
상기의 결과에서 나타난 바와 같이, 비교예 1의 영양 크림을 도포한 경우 도포 12시간 경과 후에는 피부 수분량이 어느 정도 증가하였지만, 24시간 경과 후에는 도포 전의 상태와 유사한 수준으로 되돌아감을 알 수 있다. 반면, α-이오논을 함유하는 실험예 1의 영양 크림을 피부에 도포한 경우, 보습력이 24시간 이상 지속되고 피부 수분량 증가 효과 또한 비교예 1 보다 높음을 확인할 수 있었다.
3-4. 피부각질 제거 효과 시험
상기 표 3에 기재된 실험예 1과 비교예 1 제형의 영양크림을 피부에 각각 도포했을 때 피부 각질제거 효과를 측정하기 위하여, 20대 내지 50대 연령층의 여성 20명에게 안면 왼쪽 부분에는 표 3의 실험예 1 영양크림(시험군)을, 안면 오른쪽 부분에는 표 3의 비교예 1 영양크림(대조군)을 충분한 양으로 부드럽게 마사지하여 도포하도록 하였다. 마사지는 골고루 약 1분간에 걸쳐서 실시하였다.
피부 각질량의 측정은 도포 전 실내온도 25℃ 및 상대습도 45%의 항온 항습실에서 Charm view(Moritex, Japan)를 이용하여 초기 피부 각질량을 측정하였으며, 상기 표 3의 실험예 1과 비교예 1 제형을 각각 안면 왼쪽 및 오른쪽에 도포한 다음 24시간 후의 피부 각질량을 측정하고 피부 각질 감소량을 계산하였다. 각각의 값은 평균값으로 하기 표 6에 나타내었다.
시험물질 피부 각질량(%)
도포 전 24시간 후 피부각질 감소량
실험예 1 20.3 10.3 10.0
비교예 1 20.3 16.1 4.2
상기의 결과에서 나타난 바와 같이, α-이오논을 함유하는 실험예 1의 영양 크림은 α-이오논을 함유하지 않는 비교예 1의 영양 크림보다 피부각질 감소 효과가 우수함을 확인할 수 있었다. 피부에 보습 효과가 부여될수록 각질량은 감소하게 되는데 실험예 1의 영양 크림은 상기 실시예 3-3에서 입증된 바와 같이 뛰어난 수분 보유능으로 인해 비교예 1의 영양 크림보다 월등한 피부각질 감소 효과를 나타내는 것으로 판단된다.
[ 제조예 1] 화장품의 제조
1-1. 유연 화장수의 제조
하기 표 7의 조성으로, α-이오논을 함유하는 유연 화장수를 제조하였다.
조성 제조예1 -1( 중량% )
α-이오논 0.1
에탄올 10.0
폴리라우린산 폴리옥시에틸렌소르비탄 1.0
파라옥시안식향산메칠 0.2
글리세린 5.0
1,3-부틸렌글리콜 6.0
적량
색소 적량
1-2. 영양 화장수의 제조
하기 표 8의 조성으로, α-이오논을 함유하는 영양 화장수를 제조하였다.
조성 제조예 1-2( 중량% )
α-이오논 0.05
와셀린 2.0
세스퀴올레인산소르비탄 0.8
폴리옥시에틸렌올레일에틸 1.2
파라옥시안식향산메칠 적량
프로필렌글리콜 5.0
에탄올 3.2
카르복시비닐폴리머 18.0
수산화칼륨 0.1
색소 적량
적량
1-3. 영양 크림의 제조
하기 표 9의 조성으로, α-이오논을 함유하는 영양 크림을 제조하였다.
조성 제조예 1-3( 중량% )
α-이오논 0.2
스테아린산 15.0
세탄올 1.0
수산화칼륨 0.7
글리세린 5.0
프로필렌글리콜 3.0
방부제 적량
적량
정제수 to 100
1-4. 팩의 제조
하기 표 10의 조성으로, α-이오논을 함유하는 팩을 제조하였다.
조성 제조예 1-4( 중량% )
α-이오논 0.05
글리세린 5.0
프로필렌글리콜 4.0
폴리비닐알코올 15.0
에탄올 8.0
폴리옥시에틸렌올레일에칠 1.0
파라옥시안식향산메칠 0.2
색소 적량
적량
1-5. 에센스의 제조
하기 표 11의 조성으로, α-이오논을 함유하는 에센스를 제조하였다.
조성 제조예 1-5( 중량% )
α-이오논 0.2
프로필렌글리콜 10.0
글리세린 10.0
히아루론산나트륨수용액(1%) 5.0
에탄올 5.0
폴리옥시에틸렌경화피마자유 1.0
파라옥시안식향산메칠 0.1
적량
정제수 to 100
[ 제조예 2] 건강기능식품의 제조
2-1. 건강기능식품의 제조
하기 표 12의 조성으로, α-이오논을 함유하는 건강기능식품을 제조하였다.
조성 제조예 2-1
α-이오논 1000 ㎎
비타민 혼합물 적량
비타민 A 아세테이트 1.0 ㎎
비타민 E 0.13 ㎎
비타민 B1 0.15 ㎎
비타민 B2 0.5 ㎎
비타민 B6 0.2 ㎍
비타민 B12 10 ㎎
비타민 C 10 ㎍
비오틴 1.7 ㎎
니코틴산아미드 50 ㎍
엽산 0.5 ㎎
판토텐산 칼슘 적량
무기질 혼합물 적량
황산제1철 1.75 ㎎
산화아연 0.82 ㎎
탄산마그네슘 25.3 ㎎
제1인산칼륨 15 ㎎
제2인산칼륨 55 ㎎
구연산칼륨 90 ㎎
탄산칼슘 100 ㎎
염화마그네슘 24.8 ㎎
상기 비타민 및 미네랄 혼합물의 조성비는 비교적 건강기능식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강기능식품 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강기능식품 조성물 제조에 사용할 수 있다.
2-2. 건강 음료의 제조
하기 표 13의 조성으로, α-이오논을 함유하는 건강 음료를 제조하였다.
조성 제조예 2-2(mg)
α-이오논 1000 ㎎
구연산 1000 ㎎
올리고당 100 g
매실농축액 2 g
타우린 1 g
정제수 적량
통상의 건강 음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후 만들어진 용액을 여과하여 멸균된 21 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 볼 발명의 건강 음료 조성물의 제조에 사용한다. 상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.
2-3. 정제의 제조
하기 표 14의 조성으로, 통상의 정제 제조방법에 따라 타정하여 α-이오논을 함유하는 정제를 제조하였다.
조성 제조예 2-3(mg)
α-이오논 100 ㎎
옥수수 전분 100 ㎎
유당 100 ㎎
스테아린산 마그네슘 2 ㎎
2-4. 캡슐제의 제조
하기 표 15의 조성으로, 통상의 캡슐제 제조방법에 따라 젤라틴 캡슐에 충전하여 α-이오논을 함유하는 캡슐제를 제조하였다.
조성 제조예 2-4(mg)
α-이오논 100 ㎎
옥수수 전분 100 ㎎
유당 100 ㎎
스테아린산 마그네슘 2 ㎎
2-5. 환의 제조
하기 표 16의 조성으로, 통상의 환 제조 방법에 따라 1환 당 4 g이 되도록 환을 제조하였다.
조성 제조예 2-5(mg)
α-이오논 1 g
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
2-6. 과립의 제조
하기 표 17의 조성으로, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60℃에서 건조하여 과립을 형성한 후 포에 충진하여 과립을 제조하였다.
[ 제조예 3] 피부 외용 연고의 제조
하기 표 18의 조성으로, α-이오논을 함유하는 피부 외용 연고를 제조하였다.
조성 제조예 3( 중량% )
α-이오논 0.5
디에틸 세바케이트 8.0
경납 5.0
폴리옥시에틸렌올레일에테르 포스페이트 6.0
벤조산 나트륨 적량

Claims (12)

  1. 이오논(ionone) 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 화장료 조성물.
  2. 제1항에 있어서, 상기 이오논 또는 이의 화장품학적으로 허용 가능한 염은 전체 조성물 중량에 대하여 0.0001 내지 20 중량%로 포함되는 것을 특징으로 하는 화장료 조성물.
  3. 제1항에 있어서, 상기 조성물은 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 각질제거제, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조된 것을 특징으로 하는 화장료 조성물.
  4. 제1항에 있어서, 상기 조성물은 피부주름 개선 성분을 추가로 포함 하는 것을 특징으로 하는 화장료 조성물.
  5. 제4항에 있어서, 상기 추가로 포함되는 피부주름 개선 성분은 비타민 C, 레티노산, TGF(transforming growth factor), 동물 태반 유래의 단백질, 베툴린산 및 클로렐라 추출물로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 화장료 조성물.
  6. 이오논(ionone) 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 건강기능식품 조성물.
  7. 제6항에 있어서, 상기 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조된 것을 특징으로 하는 건강기능식품 조성물.
  8. 제6항에 있어서, 상기 조성물은 피부주름 개선 성분을 추가로 포함하는 것을 특징으로 하는 건강기능식품 조성물.
  9. 제8항에 있어서, 상기 추가로 포함되는 피부주름 개선 성분은 비타민 C, 레티노산, TGF(transforming growth factor), 동물 태반 유래의 단백질, 베툴린산 및 클로렐라 추출물로 이루어진 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 건강기능식품 조성물.
  10. 이오논(ionone) 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 의약외품 조성물.
  11. 이오논(ionone) 또는 이의 염을 유효성분으로 함유하는 조성물을 투여 또는 복용하는 것을 포함하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선을 위한 방법.
  12. 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 및/또는 피부광노화 개선 효과를 갖는 조성물의 용도.
PCT/KR2017/006574 2016-06-22 2017-06-22 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물 WO2017222317A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201780038940.1A CN109348703A (zh) 2016-06-22 2017-06-22 包含紫罗兰酮或其盐作为有效成分的具有改善皮肤保湿、去除皮肤角质、增强皮肤弹性、抑制红斑、改善皮肤皱纹或改善皮肤光老化效果的组合物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160077927A KR101702389B1 (ko) 2016-06-22 2016-06-22 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
KR10-2016-0077927 2016-06-22

Publications (1)

Publication Number Publication Date
WO2017222317A1 true WO2017222317A1 (ko) 2017-12-28

Family

ID=58156314

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/006574 WO2017222317A1 (ko) 2016-06-22 2017-06-22 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물

Country Status (4)

Country Link
US (1) US10137070B2 (ko)
KR (1) KR101702389B1 (ko)
CN (1) CN109348703A (ko)
WO (1) WO2017222317A1 (ko)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210003473A (ko) 2019-07-02 2021-01-12 (주)아모레퍼시픽 헵타히드록시플라반을 유효성분으로 포함하는 피부 탄력 증진 또는 피부 주름 개선용 조성물
CN110478266B (zh) * 2019-09-17 2022-09-16 广东丸美生物技术股份有限公司 富含胶原三肽的化妆品组合物、护肤化妆品及应用与制备方法
KR102655943B1 (ko) 2019-10-02 2024-04-11 (주)아모레퍼시픽 피부 탄력 증진 또는 피부 주름 개선용 조성물
CN113116738B (zh) * 2019-12-31 2022-09-02 新生活化妆品科技(上海)有限公司 外用添加剂及其应用、皮肤外用制品
CN115414341B (zh) * 2022-09-14 2023-04-11 中国农业大学 一种包含α-紫罗兰酮用于抗紫外线暴露引起肾脏损伤的组合物
WO2024159923A1 (zh) * 2023-01-31 2024-08-08 株式会社资生堂 一种外用皮肤屏障功能修护剂

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100854552B1 (ko) * 2000-12-28 2008-08-26 유니레버 엔.브이. 이중 구획 포장 내에 레티노이드 및 레티노이드 부스터시스템을 포함하는 안정한 피부 관리 제품
KR20090084624A (ko) * 2008-02-01 2009-08-05 마리 케이 인코포레이티드 방향성 피부활성 성분을 사용하여 피부를 치료하는 방법
KR20110030182A (ko) * 2009-09-17 2011-03-23 주식회사 엘지생활건강 피부주름 개선용 조성물
JP2013253087A (ja) * 1999-07-30 2013-12-19 Unilever Nv 皮膚保護組成物
KR20150062443A (ko) * 2013-11-29 2015-06-08 (주)아모레퍼시픽 아이오논(ionone) 유도체 화합물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5759556A (en) * 1996-09-27 1998-06-02 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Skin care compositions containing certain cyclic aliphatic unsaturated compounds and retinol or retinyl ester
CN102250161B (zh) * 2011-04-12 2016-08-03 中国医学科学院药用植物研究所 具有酪氨酸酶抑制活性的紫罗兰酮类衍生物及其制备方法和用途
CN103054782B (zh) * 2013-01-28 2014-11-05 沈群华 具有滋润与营养皮肤功能的护肤霜及其制作方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013253087A (ja) * 1999-07-30 2013-12-19 Unilever Nv 皮膚保護組成物
KR100854552B1 (ko) * 2000-12-28 2008-08-26 유니레버 엔.브이. 이중 구획 포장 내에 레티노이드 및 레티노이드 부스터시스템을 포함하는 안정한 피부 관리 제품
KR20090084624A (ko) * 2008-02-01 2009-08-05 마리 케이 인코포레이티드 방향성 피부활성 성분을 사용하여 피부를 치료하는 방법
KR20110030182A (ko) * 2009-09-17 2011-03-23 주식회사 엘지생활건강 피부주름 개선용 조성물
KR20150062443A (ko) * 2013-11-29 2015-06-08 (주)아모레퍼시픽 아이오논(ionone) 유도체 화합물

Also Published As

Publication number Publication date
US10137070B2 (en) 2018-11-27
US20170367954A1 (en) 2017-12-28
KR101702389B1 (ko) 2017-02-03
CN109348703A (zh) 2019-02-15

Similar Documents

Publication Publication Date Title
WO2017222317A1 (ko) 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2017146414A1 (ko) α-테르피네올을 유효성분으로 함유하는 피부 보습 및 피부 주름 개선용 조성물
WO2018004141A1 (ko) 시멘, 베헨산, 2-메톡시나프탈렌, 티몰 및 이들의 염으로 이루어진 군에서 선택된 어느 하나 이상을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2017213346A1 (ko) 디오스민 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2021080129A1 (ko) 하이드란제놀 또는 필로둘신을 유효성분으로 하는 피부장벽 강화 및 아토피 피부염 개선용 조성물
WO2018186640A1 (ko) 오시멘 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
EP3097913B1 (en) Cosmetic use of a hydroxypyranone derivative compound for promoting differentiation of adipocytes
WO2017142265A1 (ko) 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물
WO2018186641A1 (ko) 피페로날 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2018186644A1 (ko) 자스몬 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
KR101787319B1 (ko) 신코닌(Cinchonine) 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
KR101951559B1 (ko) 시나핀산(Sinapinic acid) 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2016117762A1 (ko) 구스베리 추출물 또는 글루타티온을 포함하는 조성물
KR101777544B1 (ko) 요놀(Ionol) 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2020256380A1 (ko) 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물
WO2020256381A1 (ko) 옥타데센 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물
WO2016003120A1 (ko) 알피나 골무꽃 추출물을 포함하는 미백용 조성물
KR101701502B1 (ko) 데칸알 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2017217660A1 (ko) 수베르산 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
KR102032830B1 (ko) 쌀겨 추출물을 함유하는 피부 개선용 건강기능식품
KR101958105B1 (ko) 구아일 아세테이트(Guaiyl acetate) 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2023277626A1 (ko) 2-phloroeckol을 유효성분으로 포함하는 피부 개선용 조성물
KR101720712B1 (ko) 레비스틸라이드 a을 포함하는 피부 개선용 조성물
WO2023132738A1 (ko) 식물 추출물을 유효성분으로 포함하는 피부 손상 예방 또는 개선을 위한 조성물
KR20170138754A (ko) 카다베린 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17815730

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17815730

Country of ref document: EP

Kind code of ref document: A1