WO2017217700A1 - 세포-유리형 dna의 암 질환의 진단 용도 - Google Patents

세포-유리형 dna의 암 질환의 진단 용도 Download PDF

Info

Publication number
WO2017217700A1
WO2017217700A1 PCT/KR2017/006012 KR2017006012W WO2017217700A1 WO 2017217700 A1 WO2017217700 A1 WO 2017217700A1 KR 2017006012 W KR2017006012 W KR 2017006012W WO 2017217700 A1 WO2017217700 A1 WO 2017217700A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cell
free dna
seq
nucleotide sequence
Prior art date
Application number
PCT/KR2017/006012
Other languages
English (en)
French (fr)
Inventor
송석길
Original Assignee
주식회사 넥스바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 넥스바이오 filed Critical 주식회사 넥스바이오
Publication of WO2017217700A1 publication Critical patent/WO2017217700A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Definitions

  • the present invention was made by the task number 1415145336 under the support of the Ministry of Trade, Industry and Energy of Korea, the research management professional agency of the project is Chungbuk industry-university convergence headquarters, the research project name is "the fourth year of industry-university convergence R & D", the research project name is "stomach diagnostic bio Marker Development and Commercialization ”, the host institution is Chungbuk National University College of Pharmacy, and the research period is 2015.08.01 ⁇ 2016.05.31.
  • the present invention relates to the use of cell-free DNA for the diagnosis of cancer diseases.
  • cfDNA Cell-free DNA
  • RNA and microRNA can be stored at room temperature and suitable for diagnostic tests compared to RNA and microRNA (Wong et al., 2013).
  • cfDNA can be used to diagnose pediatric lymphomas (Mussolin et al., 2013), prenatal testing (Casadio, 2013; Gahan, 2013), screening for acute coronary syndrome (Cui, 2013), and mortality in hemodialysis patients.
  • LEO heterozygosity
  • H3K9me3 The histone methylation marker, H3K9me3, is low in the cell-free DNA of rectal cancer patients and is associated with cancer development (Gezer, 2013). Methylated DNA and microRNA were analyzed in Biofluid and used as epigenetic biomarkers for cancer development (Ma et al., 2013).
  • Patent Document 1 Republic of Korea Patent Publication No. 10-2013-0004318
  • Patent Document 2 Republic of Korea Patent Publication No. 10-2015-0036776
  • Non-Patent Document 1 Campitelli M, et al., Human papillomavirus mutational insertion: specific marker of circulating tumor DNA in cervical cancer patients. PLoS One. 2012; 7 (8): e43393.
  • Non-Patent Document 2 Casadio V, et al., Urine cell-free DNA integrity as a marker for early prostate cancer diagnosis: a pilot study. Biomed Res Int. 2013; 2013: 270457.
  • Non-Patent Document 3 Catarino R, et al., Circulating DNA: diagnostic tool and predictive marker for overall survival of NSCLC patients. PLoS One. 2012; 7 (6): e38559.
  • Non-Patent Document 4 Cortese R, et al., Epigenetic markers of prostate cancer in plasma circulating DNA. Hum Mol Genet. 2012 Aug 15; 21 (16): 3619-31.
  • Non-Patent Document 5 Cui M, et al., Cell-Free circulating DNA: a new biomarker for the acute coronary syndrome. Cardiology. 2013; 124 (2): 76-84.
  • Non-Patent Document 6 Dawson SJ et al., Analysis of circulating tumor DNA to monitor metastatic breast cancer. N Engl J Med. 2013 Mar 28; 368 (13): 1199-209.
  • Non-Patent Document 7 Delgado PO et al., Characterization of cell-free circulating DNA in plasma in patients with prostate cancer. Tumour Biol. 2013 Apr; 34 (2): 983-6.
  • Non-Patent Document 8 Gahan PB. Circulating nucleic acids in plasma and serum: applications in diagnostic techniques for noninvasive prenatal diagnosis. Int J Womens Health. 2013 Apr 17; 5: 177-86.
  • Non-Patent Document 9 Gezer U et al., Characterization of H3K9me3- and H4K20me3-associated circulating nucleosomal DNA by high-throughput sequencing in colorectal cancer. Tumour Biol. 2013 Feb; 34 (1): 329-36.
  • Non-Patent Document 10 Ghorbian S, Ardekani AM. Non-Invasive Detection of Esophageal Cancer using Genetic Changes in Circulating Cell-Free DNA. Avicenna J Med Biotechnol. 2012 Jan; 4 (1): 3-13.
  • Non-Patent Document 11 Hashad D, Sorour A, Ghazal A, Talaat I. Free circulating tumor DNA as a diagnostic marker for breast cancer. J Clin Lab Anal. 2012 Nov; 26 (6): 467-72.
  • Non-Patent Document 12 Kirk R. Breast cancer: Circulating tumour DNA the better of the blood biomarkers. Nat Rev Clin Oncol. 2013 May; 10 (5): 247. doi: 10.1038 / nrclinonc.2013.48. Epub 2013 Mar 26.
  • Non-Patent Document 13 Kohlova M et al., Circulating cell-free DNA levels in hemodialysis patients and its association with inflammation, iron metabolism, and rhEPO doses. Hemodial Int. 2013 Oct; 17 (4): 664-7.
  • Non-Patent Document 14 Kuhlmann JD et al., LOH at 6q and 10q in fractionated circulating DNA of ovarian cancer patients is predictive for tumor cell spread and overall survival. BMC Cancer. 2012 Jul 31; 12: 325.
  • Non-Patent Document 15 Ma Y, Wang X, Jin H. Methylated DNA and microRNA in Body Fluids as Biomarkers for Cancer Detection. Int J Mol Sci. 2013 May 16; 14 (5): 10307-31.
  • Non-Patent Document 16 Majchrzak-CeliA et al., Detection of MGMT, RASSF1A, p15INK4B, and p14ARF promoter methylation in circulating tumor-derived DNA of central nervous system cancer patients. J Appl Genet. 2013 Aug; 54 (3): 335-44.
  • Non-Patent Document 17 Mussolin L et al., Plasma cell-free DNA in paediatric lymphomas. J Cancer. 2013 Apr 16; 4 (4): 323-9.
  • Non-Patent Document 18 Perkins G et al., Multi-purpose utility of circulating plasma DNA testing in patients with advanced cancers. PLoS One. 2012; 7 (11): e47020.
  • Non-Patent Document 19 Schwarzenbach H et al., Loss of heterozygosity at tumor suppressor genes detectable on fractionated circulating cell-free tumor DNAas indicator of breast cancer progression. Clin Cancer Res. 2012 Oct 15; 18 (20): 5719-30.
  • Non-Patent Document 20 Szpechcinski A et al., Quantitative analysis of free-circulating DNA in plasma of patients with resectable NSCLC. Expert Opin Biol Ther. 2012 Jun; 12 Suppl 1: S3-9.
  • Non-Patent Document 21 Tovbin D et al., Circulating cell-free DNA in hemodialysis patients predicts mortality. Nephrol Dial Transplant. 2012 Oct; 27 (10): 3927-35.
  • Non-Patent Document 22 Wong D et al., Optimizing blood collection, transport and storage conditions for cell free DNA increases access to prenatal diagnostic testing. Clin Biochem. 2013 Apr 30. pii: S0009-9120 (13) 00163-X.
  • Non-Patent Document 23 Zhou J, Shi YH, Fan J. Circulating cell-free nucleic acids: promising biomarkers of hepatocellular carcinoma. Semin Oncol. 2012 Aug; 39 (4): 440-8.
  • the inventors have tried to find new biomarkers useful for the early diagnosis of cancer diseases from biological substances present in the blood. As a result, we experimentally confirmed that certain cell-free DNA present in the blood appeared to be significantly high in cancer patients and experimentally demonstrated the possibility of using it as a diagnostic biomarker for cancer. By this, the present invention was completed.
  • One aspect of the present invention provides a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7 (cell-free), a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8 and the nucleotide sequence of SEQ ID NO: 9 It relates to a cancer diagnostic composition comprising an agent capable of detecting one or more cell-free DNA selected from the group consisting of cell-free DNA.
  • the cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7 may be derived from ENTPD6 (ectonucleoside triphosphate diphosphohydrolase 6) gene located on human chromosome 20.
  • the cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8 may be derived from FGR (FGR proto-oncogene, Src family tyrosine kinase) gene located on human chromosome 1.
  • FGR FGR proto-oncogene, Src family tyrosine kinase
  • the cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 9 may be derived from the FER (FER tyrosine kinase) gene located on human chromosome 5.
  • Agents capable of detecting the cell-free DNA are primers and / or probes comprising sequences complementary to the nucleotide sequence.
  • cfDNA cell-free DNA
  • the cell-free DNA may be double stranded DNA, but is not limited thereto.
  • the cell-free DNA may be present in the state of a nuclear protein complex, but is not limited thereto.
  • the cell-free DNA is observed in various physiological and pathological conditions such as inflammatory disorders, oxidative stress and malignant tumors, and thus can be used as a useful biomarker for the purpose of diagnosing and predicting prognosis.
  • the term “complementary” means that, under certain specific hybridization or annealing conditions, there is sufficient complementarity to selectively hybridize to the nucleotide sequence.
  • the term “complementary” has a meaning different from that of perfectly complementary, and the primers or probes of the present invention may selectively hybridize to any of the nucleotide sequences set forth in SEQ ID NOS: 7-9. If at all possible, it may have one or more mismatch nucleotide sequences.
  • probe refers to a natural or modified monomer, or a linear oligomer of natural or modified linkages, including deoxyribonucleotides and ribonucleotides, and which will specifically hybridize to a target nucleotide sequence. It may be naturally occurring or artificially synthesized.
  • the probe may preferably be a single chain, but is not limited thereto.
  • the probe may be oligodioxyribonucleotide, but is not limited thereto.
  • the probe may include, but is not limited to, naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogues or derivatives.
  • dNMP naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP)
  • nucleotide analogues or derivatives may include, but is not limited to, naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogues or derivatives.
  • the probe may include ribonucleotides, but is not limited thereto, and the probe may be a backbone modified nucleotide such as a peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365: 566-568). (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoramidate DNA, amide-linked DNA, MMI-linked DNA, 2′-O-methyl RNA, alpha-DNA and methylphosphonate It may include DNA, but is not limited thereto.
  • PNA peptide nucleic acid
  • the probe may be a sugar modified nucleotide such as 2'-0-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-0-alkyl DNA, 2'-0-allyl DNA, 2'- It may include, but is not limited to, O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexitol DNA.
  • a sugar modified nucleotide such as 2'-0-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-0-alkyl DNA, 2'-0-allyl DNA, 2'- It may include, but is not limited to, O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexitol DNA.
  • the probe may be a nucleotide having a nucleotide modification, such as a C-5 substituted pyrimidine (substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, Tityl-, propynyl-, alkynyl-, thiazolyl-, imidazoryl-, pyridyl-, 7-deazapurine with C-7 substituents (substituents are fluoro-, bromo-, chloro- , Iodo-, methyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazolyl-, pyridyl-), inosine and diaminopurine
  • a C-5 substituted pyrimidine substituted pyrimidine
  • substituted pyrimidine substitute
  • the probe may be additionally labeled with a radiolabel, a fluorescent label, an enzyme label, a sequence tag, and / or a biotin, but is not limited thereto.
  • primer refers to a single-strand that can act as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) at a suitable temperature. Oligonucleotides.
  • Suitable lengths of the primers can be varied depending on various factors, such as temperature and the use of the primers.
  • the primer sequence need not have a sequence that is completely complementary to some sequences of the template, it is sufficient to have sufficient complementarity within the range that can be hybridized with the template to perform the primer-specific action.
  • the primer of the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence that is a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the sequence to act as a primer.
  • Primers of the invention may additionally be labeled with radiolabels, fluorescent labels, enzyme labels, sequence tags, or biotin.
  • the primers are used for gene amplification reaction.
  • the amplification reaction refers to a reaction for amplifying a nucleic acid molecule, for example, a polymerase chain reaction, a reverse transcription polymerase chain reaction, or a real-time polymerase chain reaction.
  • -time polymerase chain reaction ligase chain reaction, repair chain reaction, transcription-mediated amplification, self-sustained nucleotide sequence replication, target Selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction, arbitrarily primed polymerase chain reaction, nucleic acid nucleotide sequence based amplification (nucleic acid sequence based amplification), strand displac ement amplification) and / or loop-mediated isothermal amplification, but is not limited thereto.
  • the probe may be used in a microarray chip.
  • the probe may be used as a hybridizable array element in a microarray chip.
  • the props may be arranged and / or immobilized on a support.
  • the support includes suitable rigid or semi-rigid supports, such as membranes, filters, chips, slides, wafers, fibers, magnetic beads, nonmagnetic beads, gels, tubing, plates, polymers, microparticles and / or capillaries. It may be, but is not limited thereto.
  • the immobilization may be carried out by a chemical bonding method or by a covalent binding method such as UV, for example, may be bonded to the glass surface modified to include an epoxy compound or an aldehyde group, and also UV on the polylysine coating surface Can be combined by.
  • a chemical bonding method or by a covalent binding method such as UV, for example, may be bonded to the glass surface modified to include an epoxy compound or an aldehyde group, and also UV on the polylysine coating surface Can be combined by.
  • hybridization array element may be bound to the support through a linker, for example, ethylene glycol oligomer and diamine, but is not limited thereto.
  • Cancer in the present invention is not limited to a specific cancer, for example, breast cancer, lung cancer, stomach cancer, liver cancer, hematologic cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or ocular melanoma, uterine sarcoma, ovarian cancer, Including rectal cancer, anal cancer, colon cancer, colon cancer, fallopian tube cancer, endometrial cancer, cervical cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, kidney cancer, soft tissue tumors, urethral cancer, prostate cancer, bronchial cancer or bone marrow cancer It may be, but is not limited thereto.
  • Another embodiment of the present invention comprises a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7 (cell-free), a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8 and a nucleotide sequence of SEQ ID NO: 9
  • a kit for diagnosing cancer comprising a composition comprising an agent capable of detecting at least one cell-free DNA selected from the group consisting of cell-free DNA.
  • the cancer diagnostic kit may be a polymerase chain reaction (PCR) kit or a microarray chip.
  • PCR polymerase chain reaction
  • the polymerase chain reaction kit may include reagents required for PCR amplification, such as buffers, DNA polymerases, DNA polymerase cofactors, and dNTPs.
  • the kit can be made in a number of separate packaging or compartments containing the reagent components described above.
  • Another embodiment of the present invention comprises a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7 (cell-free), a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8 and the nucleotide sequence of SEQ ID NO: 9 It relates to a biomarker for diagnosing cancer comprising at least one cell-free DNA selected from the group consisting of cell-free DNA.
  • Another embodiment of the present invention comprises a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7 (cell-free), a cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8 and the nucleotide sequence of SEQ ID NO: 9 It relates to a method for providing information necessary for cancer diagnosis comprising the step of detecting one or more cell-free DNA selected from the group consisting of cell-free DNA.
  • the method for detecting cell-free DNA includes the following steps:
  • a primer set comprising the isolated cell-free DNA as a template, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, and an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 2;
  • a primer set consisting of an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 4;
  • PCR polymerase chain reaction
  • the biological sample may be one or more selected from the group consisting of blood, plasma, saliva, lymph, cerebrospinal fluid, synovial fluid, and cystic fluid, but is not limited thereto.
  • the biological sample is a bodily fluid, and the cell-free DNA may be present alone in the bodily fluid, or may be contained in an exosome.
  • the secretory is a 30nm-100nm sized vesicle containing DNA, RNA or protein that originates in the cell and is released into the body fluid.
  • the body fluid may be blood, urine, feces, saliva, lymph, cerebrospinal fluid, synovial fluid, cystic fluid, ascites, pleural effusion, amniotic fluid, chorionic villus sample, placental sample, tracheal lavage, interstitial fluid or ocular fluid ( ocular fluids).
  • the body fluid is blood, plasma or serum.
  • Cell-free DNA is isolated from the biological sample. Separation of the cell-free DNA can be carried out by separating secretory bodies from body fluids and extracting, separating and purifying nucleic acids from the separated secretory bodies.
  • cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 7, cell-free DNA comprising the nucleotide sequence of SEQ ID NO: 8, or SEQ ID NO: 9 Cell-free DNA containing sequences is detected.
  • the method for detecting the cell-free DNA may be performed by gene amplification or microarray.
  • the isolated cell-free DNA is used as a template, and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2 Primer set consisting of oligonucleotide consisting of;
  • a primer set consisting of an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 4;
  • PCR Polymerase chain reaction
  • the product of the PCR may be further sequenced.
  • the present invention provides novel uses for the diagnosis of cancer diseases of certain cell-free DNAs.
  • the cell-free DNA of the present invention is a novel cancer diagnostic biomarker that can be easily obtained from body fluids and can be easily detected by gene amplification methods.
  • the cell-free DNA of the present invention can be usefully used for early stage cancer diagnosis, evaluation of cancer progression, and performance and suitability evaluation of anticancer agents for cancer treatment.
  • the present invention relates to novel uses for the diagnosis of cancer diseases of certain cell-free DNAs.
  • the cell-free DNA of the present invention can be easily obtained from body fluids and used as a novel cancer diagnostic biomarker that can be easily detected by gene amplification methods.
  • the cell-free DNA of the present invention can be usefully used for early stage cancer diagnosis, evaluation of cancer progression, and performance and suitability evaluation of anticancer agents for cancer treatment.
  • X axis Melting temperature
  • Y axis first derivative of the change in fluorescence (dF / dT).
  • Cell-free DNA biomarkers were detected using dissociation melting point real time nucleic acid amplification (melting curve qPCR).
  • primers were designed to detect cell-free DNA fragments of the three cell-free DNA biomarkers, ENTPD6, FGR, and RER genes.
  • Table 1 below shows primer sequences for detecting cell-free DNA biomarkers for cancer diagnostics.
  • the base sequence of the cell-free DNA detected by the primer prepared in Example 1 was analyzed and shown in Tables 2 to 4, respectively.
  • Cell-free DNA fragments of three ENTPD6, FGR, and RER genes in blood were detected using a dissociation melting point real-time nucleic acid amplification method to determine whether cancer can be diagnosed.
  • Triton X-100 was added to 500 ⁇ l serum or plasma of a normal or gastric cancer patient, followed by denaturation at 98 ° C. for 5 minutes, and then left on ice for 5 minutes. Then 5 ⁇ l supernatant was taken after centrifugation at 3000 ⁇ rpm for 10 min and used for PCR.
  • PCR reaction compositions for use in the dissociation melting point real-time nucleic acid amplification method were prepared as shown in Table 5 below.
  • the dissociation melting point real-time nucleic acid amplification method was performed under the conditions of Table 6 below.
  • cell-free DNA biomarkers (ENTPD6, FGR, FER) are all observed in a constant form (peak) in the gastric cancer patient group, but not amplified at all in a normal person, or a single peak Only was observed. Therefore, it was confirmed that cancer can be diagnosed by observing amplification peaks of the cell-free DNA biomarkers (ENTPD6, FGR, FER).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 특정의 세포-유리형 DNA의 암 질환 진단에 관한 새로운 용도에 관한 것이다. 본 발명의 세포-유리형 DNA는 체액으로부터 쉽게 수득할 수 있으며 유전자 증폭 방법으로 용이하게 검출이 가능한 새로운 암 진단용 바이오마커다. 본 발명의 세포-유리형 DNA는 초기 단계의 암 진단, 암 진행의 평가, 암 치료용 항암제의 성능 및 적합성 평가에 유용하게 사용될 수 있다.

Description

세포-유리형 DNA의 암 질환의 진단 용도
본 발명은 대한민국 산업통상자원부의 지원 하에서 과제번호 1415145336에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 충북산학융합본부, 연구 사업명은 “산학융합R&D 4차년도”, 연구 과제명은 “위암 진단 바이오마커 개발 및 실용화”, 주관기관은 충북대학교 약학대학, 연구기간은 2015.08.01 ~ 2016.05.31이다.
본 특허출원은 2016년 6월 14일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2016-0074010호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 세포-유리형 DNA의 암 질환의 진단 용도에 관한 것이다.
세포-유리형 DNA(Cell-Free DNA, cfDNA)는 RNA과 microRNA에 비해 상온 보관이 가능하며 진단 검사에 적합하다고 보고되었다(Wong 등, 2013). cfDNA는 소아림프종(paediatric lymphomas)의 진단(Mussolin 등, 2013), 산전검사(Casadio, 2013; Gahan, 2013), 급성 관동맥 증후군(acute coronary syndrome)의 검사(Cui, 2013), 혈액 투석환자의 사망률 측정 및 염증, 철분대사 및 rhEPO 연관성 분석(Tovbin, 2012; Kohlova 등, 2013), 유방암 진단 및 모니터링(Dawson, 2013; Kirk, 2013), 간암 진단(Zhou, 2012) 및 HPV(human paillomavirus mutational insertion) 진단(Campitelli, 2012)에 응용된 사례가 보고되었다.
또한, 세포-유리형 DNA에서 점돌연변이(point mutations), 미소부수체 변형(microsatelite alteration), DNA 메틸화(DNA methylation) 및 이형접합성 상실(LOH, Loss of heterozygosity)를 확인하여 바이오마커로 응용한 보고가 있다(Ghorbian, 2012).
또한, 정상인에 비해 유방암 환자에서 세포-유리형 DNA 수준이 높게 관찰되었고, 악성 종양(malignant tumor) 크기와의 높은 연관성도 관찰되었다(Hashad, 2012).
비소세포폐암(Non-small-cell lung carcinoma) 환자에서 세포-유리형 DNA가 증가하였다는 보고도 있다(Catarino, 2012; Szpechcinski, 2012). 암 사망률이 높은 환자에서 세포-유리형 DNA 수준이 높게 관찰되었다(Perkins, 2012). 전립선암 환자의 세포-유리형 DNA를 분석하여 10번 염색체에서 DNA 결손을 관찰하였으며, 치료에 대한 예후를 측정할 수 있었다(Cortese, 2012; Delgado, 2012).
유방암 환자에서 세포-유리형 DNA의 이형접합성 상실(LOH, Loss of heterozygosity)를 관찰하여 암 발생단계, 암 크기, 림프절 전이(lymph node metastasis), 양성 프로게스테론(positive progesterone) 및 HER2 수용체(receptor)와의 연관성을 보여주었다(Schwarzenbach, 2012).
난소암 환자의 세포-유리형 DNA을 분석하여 6q와 10q 염색체의 LOH가 암 세포 전이와 생존과 연관성을 예측하였다(Kuhlmann, 2012).
신경교종(glial tumor) 환자에서 세포-유리형 DNA의 고메틸화가 관찰되었다(Majchrzak-Celiska, 2013). 직장암 환자의 세포-유리형 DNA에서는 히스톤 메틸화 마커(histone methylation marker)인 H3K9me3 수준이 낮게 관찰되며 암 발생과 연관성을 보여주었다(Gezer, 2013). Biofluid에서 메틸화 DNA와 microRNA을 분석하여 암 발생에 대한 후성적 바이오마커(epigenetic biomarkers)로 이용하였다(Ma 등, 2013).
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 공개특허 제10-2013-0004318호
(특허문헌 2) 대한민국 공개특허 제10-2015-0036776호
[비특허문헌]
(비특허문헌 1) Campitelli M, et al., Human papillomavirus mutational insertion: specific marker of circulating tumor DNA in cervical cancer patients. PLoS One. 2012;7(8):e43393.
(비특허문헌 2) Casadio V, et al., Urine cell-free DNA integrity as a marker for early prostate cancer diagnosis: a pilot study. Biomed Res Int. 2013;2013:270457.
(비특허문헌 3) Catarino R, et al., Circulating DNA: diagnostic tool and predictive marker for overall survival of NSCLC patients. PLoS One. 2012;7(6):e38559.
(비특허문헌 4) Cortese R, et al., Epigenetic markers of prostate cancer in plasma circulating DNA. Hum Mol Genet. 2012 Aug 15;21(16):3619-31.
(비특허문헌 5) Cui M, et al., Cell-Free circulating DNA: a new biomarker for the acute coronary syndrome. Cardiology. 2013;124(2):76-84.
(비특허문헌 6) Dawson SJ et al., Analysis of circulating tumor DNA to monitor metastatic breast cancer. N Engl J Med. 2013 Mar 28;368(13):1199-209.
(비특허문헌 7) Delgado PO et al., Characterization of cell-free circulating DNA in plasma in patients with prostate cancer. Tumour Biol. 2013 Apr;34(2):983-6.
(비특허문헌 8) Gahan PB. Circulating nucleic acids in plasma and serum: applications in diagnostic techniques for noninvasive prenatal diagnosis. Int J Womens Health. 2013 Apr 17;5:177-86.
(비특허문헌 9) Gezer U et al., Characterization of H3K9me3- and H4K20me3-associated circulating nucleosomal DNA by high-throughput sequencing in colorectal cancer. Tumour Biol. 2013 Feb;34(1):329-36.
(비특허문헌 10) Ghorbian S, Ardekani AM. Non-Invasive Detection of Esophageal Cancer using Genetic Changes in Circulating Cell-Free DNA. Avicenna J Med Biotechnol. 2012 Jan;4(1):3-13.
(비특허문헌 11) Hashad D, Sorour A, Ghazal A, Talaat I. Free circulating tumor DNA as a diagnostic marker for breast cancer. J Clin Lab Anal. 2012 Nov;26(6):467-72.
(비특허문헌 12) Kirk R. Breast cancer: Circulating tumour DNA the better of the blood biomarkers. Nat Rev Clin Oncol. 2013 May;10(5):247. doi: 10.1038/nrclinonc.2013.48. Epub 2013 Mar 26.
(비특허문헌 13) Kohlova M et al., Circulating cell-free DNA levels in hemodialysis patients and its association with inflammation, iron metabolism, and rhEPO doses. Hemodial Int. 2013 Oct;17(4):664-7.
(비특허문헌 14) Kuhlmann JD et al., LOH at 6q and 10q in fractionated circulating DNA of ovarian cancer patients is predictive for tumor cell spread and overall survival. BMC Cancer. 2012 Jul 31;12:325.
(비특허문헌 15) Ma Y, Wang X, Jin H. Methylated DNA and microRNA in Body Fluids as Biomarkers for Cancer Detection. Int J Mol Sci. 2013 May 16;14(5):10307-31.
(비특허문헌 16) Majchrzak-CeliA et al., Detection of MGMT, RASSF1A, p15INK4B, and p14ARF promoter methylation in circulating tumor-derived DNA of central nervous system cancer patients. J Appl Genet. 2013 Aug;54(3):335-44.
(비특허문헌 17) Mussolin L et al., Plasma cell-free DNA in paediatric lymphomas. J Cancer. 2013 Apr 16;4(4):323-9.
(비특허문헌 18) Perkins G et al., Multi-purpose utility of circulating plasma DNA testing in patients with advanced cancers. PLoS One. 2012;7(11):e47020.
(비특허문헌 19) Schwarzenbach H et al., Loss of heterozygosity at tumor suppressor genes detectable on fractionated circulating cell-free tumor DNAas indicator of breast cancer progression. Clin Cancer Res. 2012 Oct 15;18(20):5719-30.
(비특허문헌 20) Szpechcinski A et al., Quantitative analysis of free-circulating DNA in plasma of patients with resectable NSCLC. Expert Opin Biol Ther. 2012 Jun;12 Suppl 1:S3-9.
(비특허문헌 21) Tovbin D et al., Circulating cell-free DNA in hemodialysis patients predicts mortality. Nephrol Dial Transplant. 2012 Oct;27(10):3929-35.
(비특허문헌 22) Wong D et al., Optimizing blood collection, transport and storage conditions for cell free DNA increases access to prenatal diagnostic testing. Clin Biochem. 2013 Apr 30. pii: S0009-9120(13)00163-X.
(비특허문헌 23) Zhou J, Shi YH, Fan J. Circulating cell-free nucleic acids: promising biomarkers of hepatocellular carcinoma. Semin Oncol. 2012 Aug;39(4):440-8.
본 발명자들은 혈액 내에 존재하는 생물학적 물질로부터 암 질환의 조기 진단에 유용한 새로운 바이오마커를 발굴하기 위하여 연구 노력하였다. 그 결과, 혈액 내에 존재하는 특정의 세포-유리형(cell-free) DNA가 암 환자에게서 유의적으로 높은 수준으로 나타난다는 것을 실험적으로 확인하고 이의 암의 진단용 바이오마커로의 사용 가능성을 실험적으로 증명함으로써 본 발명을 완성하였다.
본 발명의 목적 및 장점은 하기의 발명의 상세한 설명, 청구의 범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태는 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형(cell-free) DNA를 검출할 수 있는 제제를 포함하는 암 진단용 조성물에 관한 것이다.
상기 서열번호 7의 뉴클레오타이드 서열을 포함하는 세포-유리형 DNA는 인간 20번 염색체에 위치한 ENTPD6 (ectonucleoside triphosphate diphosphohydrolase 6) 유전자로부터 유래된 것일 수 있다.
상기 서열번호 8의 뉴클레오타이드 서열을 포함하는 세포-유리형 DNA는 인간 1번 염색체에 위치한 FGR(FGR proto-oncogene, Src family tyrosine kinase) 유전자로부터 유래된 것일 수 있다.
상기 서열번호 9의 뉴클레오타이드 서열을 포함하는 세포-유리형 DNA는 인간 5번 염색체에 위치한 FER(FER tyrosine kinase) 유전자로부터 유래된 것일 수 있다.
상기 세포-유리형 DNA를 검출할 수 있는 제제는 상기 뉴클레오타이드 서열에 대하여 상보적인 서열을 포함하는 프라이머(primer) 및/또는 프로브(probe)이다.
본 명세서에서 용어 “세포-유리형 DNA (cell-free DNA, cfDNA)”는 인간의 체액에서 순환하는 단편(fragment) DNA를 의미한다.
상기 세포-유리형 DNA는 이중가닥 DNA인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 세포-유리형 DNA는 핵단백질 복합체의 상태로 존재하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 세포-유리형 DNA는 염증성 장애, 산화 스트레스 및 악성 종양 등의 다양한 생리학적 및 병리학적 병태들에서 관찰되므로 질병의 진단 및 예후 예측 목적의 유용한 바이오마커로서 사용될 수 있다.
본 명세서에서 용어 “상보적(complementary)”은 어떤 특정한 혼성화 또는 어닐링 조건 하에서, 상기 뉴클레오타이드 서열에 대하여 선택적으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. 따라서, 상기 용어 “상보적”은 완전히 상보적(perfectly complementary)과는 다른 의미를 가지며, 본 발명의 프라이머 또는 프로브가 상기 서열번호 7 내지 9에 개시된 뉴클레오타이드 서열 중 어느 하나의 서열에 선택적으로 혼성화할 수 있을 정도이면, 하나 또는 그 이상의 미스매치(mismatch) 뉴클레오타이드 서열을 가질 수 있다.
본 명세서에서 용어 “프로브”는 자연의 또는 변형된 모노머, 또는 자연의 또는 변형된 연쇄 (linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고, 타깃 뉴클레오타이드 서열에 특이적으로 혼성화할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다.
상기 프로브는 바람직하게는 단일쇄인 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 바람직하게는 상기 프로브는 올리고디옥시리보뉴클레오타이드인 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 프로브는 자연발생(naturally occurring)의 dNMP (즉, dAMP, dGMP, dCMP 및 dTMP), 뉴클레오타이드 유사체 또는 유도체를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 프로브는 리보뉴클레오타이드도 포함하는 것일 수 있으나, 이에 한정되는 것은 아니며, 상기 프로브는 골격 변형된 뉴클레오타이드, 예컨대, 펩타이드 핵산 (PNA) (M. Egholm et al., Nature, 365:566-568(1993)), 포스포로티오에이트 DNA, 포스포로디티오에이트 DNA, 포스포로아미데이트 DNA, 아마이드-연결된 DNA, MMI-연결된 DNA, 2'-O-메틸 RNA, 알파-DNA 및 메틸포스포네이트 DNA를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 프로브는 당 변형된 뉴클레오타이드, 예컨대, 2'-O-메틸 RNA, 2'-플루오로 RNA, 2'-아미노 RNA, 2'-O-알킬 DNA, 2'-O-알릴 DNA, 2'-O-알카이닐 DNA, 헥소스 DNA, 피라노실 RNA 및 안히드로헥시톨 DNA를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 프로브는 뉴클레오타이드 변형을 갖는 뉴클레오타이드, 예컨대, C-5 치환된 피리미딘(치환기는 플루오로-, 브로모-, 클로로-, 아이오도-, 메틸-, 에틸-, 비닐-, 포르밀-, 에티틸-, 프로피닐-, 알카이닐-, 티아조릴-, 이미다조릴-, 피리딜- 포함), C-7 치환기를 갖는 7-데아자퓨린 (치환기는 플루오로-, 브로모-, 클로로-, 아이오도-, 메틸-, 에틸-, 비닐-, 포르밀-, 알카이닐-, 알켄일-, 티아조릴-, 이미다조릴-, 피리딜-), 이노신 및 디아미노퓨린을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 프로브는 추가적으로 방사선 표지, 형광표지, 효소표지, 서열 택 및/또는 바이오틴에 의해 표지된 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 “프라이머”는 적합한 온도에서 적합한 완충액 내에서 적합한 조건(즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오타이드를 의미한다.
상기 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변형될 수 있다.
또한, 상기 프라이머 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다.
따라서, 본 발명의 프라이머는 주형인 상기 뉴클레오타이드 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 충분한 상보성을 가지면 충분하다.
본 발명의 프라이머는 추가적으로 방사선 표지, 형광 표지, 효소 표지, 서열 택, 또는 바이오틴에 의해 표지될 수 있다.
본 발명의 일 구현예에 따르면, 상기 프라이머는 유전자 증폭 반응(amplification reaction)에 사용된다.
상기 증폭 반응은 핵산 분자를 증폭하는 반응을 의미하며, 예를 들어, 중합효소연쇄반응(ploymerase chain reaction), 역전사-중합효소 연쇄반응(reverse transcription polymerase chain reaction), 실시간-중합효소연쇄반응(real-time polymerase chain reaction), 리가아제 연쇄반응(ligase chain reaction), 복구연쇄반응(repair chain reaction), 전사-중재 증폭(transcription-mediated amplification), 자가 유지 뉴클레오타이드 서열 복제(self sustained sequence replication), 타깃 폴리뉴클레오티드 서열의 선택적 증폭(selective amplification of target polynucleotide sequences), 컨센서스 서열 프라이밍 중합효소연쇄반응(consensus sequence primed polymerase chain reaction), 임의적 프라이밍 중합효소연쇄반응(arbitrarily primed polymerase chain reaction), 핵산뉴클레오타이드 서열 기반증폭(nucleic acid sequence based amplification), 가닥 치환 증폭(strand displacement amplification) 및/또는 고리-중재 항온성 증폭(loopmediated isothermal amplification)을 포함하는 것일 수 있으나, 이에 한정되지는 않는다.
상기 프로브는 마이크로어레이칩(microarray chip)에 사용될 수 있다.
상기 프로브는 마이크로어레이칩에서 혼성화 어레이 요소(hybridizable array element)로서 이용될 수 있다.
상기 프로프는 지지체(substrate) 상에 배열 및/또는 고정화된 것일 수 있다.
상기 지지체는 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드, 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및/또는 모세관을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시되는 것일 수 있으며, 예를 들어, 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다.
또한, 상기 혼성화 어레이 요소는 링커, 예를 들어, 에틸렌 글리콜 올리고머 및 디아민을 통해 지지체에 결합되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서의 암은 특정 암으로 한정되는 것은 아니며, 예를 들어, 유방암, 폐암, 위암, 간암, 혈액암, 뼈암, 췌장암, 피부암, 두경부암, 피부 또는 안구 흑색종, 자궁육종, 난소암, 직장암, 항문암, 대장암, 결장암, 난관암, 자궁내막암, 자궁경부암, 소장암, 내분비암, 갑상선암, 부갑상선암, 신장암, 연조직종양, 요도암, 전립선암, 기관지암 또는 골수암을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 양태는 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA를 검출할 수 있는 제제를 포함하는 조성물을 포함하는 암 진단용 키트에 관한 것이다.
상기 암 진단용 키트는 중합효소연쇄반응(PCR, polymerase chain reaction)용 키트 또는 마이크로어레이 칩(microarray chip)일 수 있다.
상기 중합효소연쇄반응용 키트는 PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소, DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있다.
상기 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
본 발명의 또 다른 양태는 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA를 포함하는 암 진단용 바이오마커에 관한 것이다.
본 발명의 또 다른 양태는 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA를 검출하는 단계를 포함하는 암 진단에 필요한 정보 제공 방법에 관한 것이다.
상기 세포-유리형(cell-free) DNA를 검출하는 방법은 다음의 단계를 포함한다:
(a) 생물학적 시료로부터 세포-유리형(cell-free) DNA를 분리하는 단계; 및
(b) 상기 분리한 세포-유리형(cell-free) DNA를 주형으로 하고, 서열번호 1 의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 2의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트;
서열번호 3의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 4의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트; 및
서열번호 5 의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 6의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트; 로 이루어진 군에서 선택된 1종 이상의 프라이머 세트를 사용하여 중합효소연쇄반응(PCR, polymerase chain reaction)을 수행하는 증폭 단계.
상기 생물학적 시료는 혈액, 혈장, 타액, 림프액, 뇌척수액, 활액 및 낭종액(cystic fluid)로 이루어진 군에서 선택된 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
이하에서 본 발명의 방법을 단계별로 설명한다.
생물학적 시료로부터 세포-유리형 DNA(cell-free DNA)를 분리하는 단계
먼저 세포-유리형 DNA의 분리를 위한 생물학적 시료를 준비한다. 상기 생물학적 시료는 체액이며, 상기 세포-유리형 DNA는 상기 체액내에 단독으로 존재할 수 있으며 분비체(exosome)에 포함되어 존재할 수도 있다. 상기 분비체는 DNA, RNA 또는 단백질을 포함하는 30nm-100nm 크기의 소포(vesicle)로서 세포에서 기원하여 체액으로 방출된다.
상기 체액은 혈액, 소변, 대변, 타액, 림프액, 뇌척수액, 활액, 낭종액(cystic fluid), 복수, 흉막 삼출액, 양수, 융모막 융모 샘플, 태반샘플, 기관 세척액(lavage), 간질액 또는 안구액(ocular fluid)을 포함하지만 이에 한정되지 않는다. 가장 바람직하게는 상기 체액은 혈액, 혈장 또는 혈청이다.
상기 생물학적 시료로부터 세포-유리형 DNA를 분리한다. 상기 세포-유리형 DNA의 분리는 체액으로부터 분비체(exosome)을 분리하고, 분리된 분비체로부터 핵산을 추출, 분리 및 정제하는 방법을 통해 행할 수 있다.
세포-유리형(cell-free) DNA를 검출하는 방법
세포-유리형 DNA를 분리 정제한 후 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA, 또는 서열번호 9의 염기서열을 포함하는 세포-유리형(cell-free) DNA를 검출한다.
본 발명에서 상기 세포-유리형(cell-free) DNA를 검출하는 방법은 유전자 증폭 방식 또는 마이크로어레이 방식으로 실시될 수 있다.
세포-유리형 DNA의 검출이 유전자 증폭 방식으로 행해지는 경우 상기 분리한 세포-유리형(cell-free) DNA를 주형으로 하여, 서열번호 1 의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 2의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트;
서열번호 3의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 4의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트; 및
서열번호 5의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 6의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트를 사용하여 중합효소연쇄반응(PCR, polymerase chain reaction)을 수행한다.
상기 중합효소연쇄반응(PCR)을 행한 이후에 상기 PCR의 산물에 대하여 추가적으로 서열분석을 수행할 수 있다.
본 발명은 특정의 세포-유리형 DNA의 암 질환 진단에 관한 새로운 용도를 제공한다. 본 발명의 세포-유리형 DNA는 체액으로부터 쉽게 수득할 수 있으며 유전자 증폭 방법으로 용이하게 검출이 가능한 새로운 암 진단용 바이오마커다. 본 발명의 세포-유리형 DNA는 초기 단계의 암 진단, 암 진행의 평가, 암 치료용 항암제의 성능 및 적합성 평가에 유용하게 사용될 수 있다.
본 발명은 특정의 세포-유리형 DNA의 암 질환 진단에 관한 새로운 용도에 관한 것이다. 본 발명의 세포-유리형 DNA는 체액으로부터 쉽게 수득할 수 있으며 유전자 증폭 방법으로 용이하게 검출이 가능한 새로운 암 진단용 바이오마커로 사용될 수 있다. 본 발명의 세포-유리형 DNA는 초기 단계의 암 진단, 암 진행의 평가, 암 치료용 항암제의 성능 및 적합성 평가에 유용하게 사용될 수 있다.
도 1은 본 발명의 일 실시예에 따른 암 진단용 세포-유리형 DNA 바이오마커를 이용한 해리 용융점 실시간 핵산 증폭법 적용 결과이다. X 축: Melting 온도, Y 축: dF/dT(first derivative of the change in fluorescence).
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1. 세포-유리형 DNA 바이오마커 검출용 프라이머의 디자인
세포-유리형 DNA 바이오마커는 해리 용융점 실시간 핵산 증폭법(melting curve qPCR)를 이용하여 검출하였다. 먼저, 3가지 세포-유리형 DNA 바이오마커인 ENTPD6, FGR, RER 유전자의 세포-유리형 DNA 단편을 검출하기 위한 프라이머를 디자인하였다. Primer 3 프로그램을 이용하여 Tm 값 = 60℃, GC % = 50~55% 조건에서 프라이머를 디자인하였다. 아래 표 1은 암 진단용 세포-유리형 DNA 바이오마커를 검출하기 위한 프라이머 서열을 나타낸다. 해리 용융점 실시간 핵산 증폭법(Melting curve qPCR)에서 정상적으로 증폭되었다고 판단하는 기준은 Ct = 30 이하, dF/dT= 0.5 이상, melting curve = 1 개로 설정하였다.
GeneSymbol Gene Accession # Forward Primer Sequence(5'->3') Reverse Primer Sequence(5'->3')
ENTPD6 NM_001114089.3 CTGGGGCTCTCAGTAGTTGC(서열번호 1) TGGTGTTCCCAAACTGTTCA(서열번호 2)
FGR NM_001042729.1 AAAGGAAGGGACAGCTCTGC(서열번호 3) AAACAGCCAATCAAGGGACC(서열번호 4)
FER NM_001308028.1 TCCTGTCTAGCCGTCTGTTG(서열번호 5) GCACCAGGTACCGCTCTAG(서열번호 6)
실시예 2. 세포-유리형 DNA의 염기 서열 분석
실시에 1에서 제작한 프라이머로 검출한 세포-유리형 DNA의 염기 서열을 분석하여, 아래 표 2 내지 4에 각각 나타내었다.
유전자 이름 ENTPD6
염색체번호 chromosome 20
염색체상에서검출되는 위치 25187257-25187316
염기서열 CTGGGGCTCTCAGTAGTTGCCCAAGGGACGGAGTTTAAACCTTTCGAAAAGTAAATTGCCTGAATAGAAGTATAACTGAGGATTGAAAGACTGAATCAGATACGCGCTTCTGTTCCCATGAACAGTTTGGGAACACCA (서열번호 7)
유전자 이름 FGR
염색체번호 chromosome 1
염색체상에서검출되는 위치 c27949011-27948812
염기서열 GAAAAGGAAGGGACAGCTCTGCAGTGAGAGGAAAACCTATGGACCTGGGCCTCAGATGTCCCCTTGAGGGGGAATGGCCAGGCTAGAGTGGAGTCAGATGGGACAGAGCTGAGAACTAGGCTTTGCCATTTTCCTGCTGTGGGTCCCTTGATTGGCTGTTTAACCTCTCTGAGCCTCTATTAACTCATCTGTAATGTTGG (서열번호 8)
유전자 이름 FER
염색체번호 chromosome 5
염색체상에서검출되는 위치 108382799-108382998
염기서열 TTTATTGTCTACACCCTCGGAATCCTGTCTAGCCGTCTGTTGTATATTTTAAACATGACGGTGCAGTGCCTGCTATATGACAAACGTTGGTGATCCAGATGAGAAAGAGGAAACAGCTATGCAGGCAGTCCTTTAGAAGGTTTGACTATATCGAGGCTAAAGAGCTAGGGCAGCTGCTAGAGCGGTACCTGGTGCGGAGA (서열번호 9)
실시예 3. 해리 용융점 실시간 핵산 증폭법을 이용한 위암의 진단
3-1. 혈액에서 세포-유리형 DNA의 추출
혈액에서 3가지 ENTPD6, FGR, RER 유전자의 세포-유리형 DNA 단편을 해리 용융점 실시간 핵산 증폭 방법을 이용하여 검출하여 암을 진단할 수 있는 지 여부를 확인하였다.
먼저, 정상인 또는 위암 환자의 500㎕ 혈청 또는 혈장에 5㎕ Triton X-100 첨가한 뒤에 98℃, 5분 동안 변성 후에 얼음에 5분 동안 방치하였다. 그 다음, 3000x rpm, 10분 동안 원심분리 후에 5㎕ 상등액을 취하여 PCR 검사에 사용하였다.
3-2. 해리 용융점 실시간 핵산 증폭 반응 조성물의 제조
해리 용융점 실시간 핵산 증폭방법에 사용하기 위한 PCR 반응 조성물을 아래 표 5와 같이 제조하였다.
반응 조성물 용량(㎕) 최종 농도
2× Master Mix 12.5 1x
2.5pmol ENTPD6 1.25 0.125pmol
2.5pmol FGR 1.25 0.125pmol
2.5pmol FER 1.25 0.125pmol
DNA 5.0
ddH2O 1.25
Total volume 25.0
3-3. 해리 용융점 실시간 핵산 증폭법에 사용되는 검출조건
해리 용융점 실시간 핵산 증폭방법은 아래 표 6의 조건으로 실시하였다.
온도 시간 Cycle
95℃ 5 min 1
95℃ 10 sec 40
55℃ 30 sec
72℃ 30 sec
77~86℃ 해리용융점 관찰 1
3-4. 실험 결과
도 1에서 확인할 수 있듯이, 세포-유리형 DNA 바이오마커(ENTPD6, FGR, FER)는 위암 환자군에서 피크(peak)가 일정한 형태로 모두 관찰되지만, 정상인에서는 전혀 증폭되지 않거나, 단일의 피크(peak)만 관찰되었다. 따라서, 상기 세포-유리형 DNA 바이오마커(ENTPD6, FGR, FER)의 증폭 피크(peak)를 관찰함으로써 암 여부를 진단할 수 있음을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (13)

  1. 서열번호 7의 염기서열을 포함하는 세포-유리형(cell-free) DNA, 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형(cell-free) DNA를 검출할 수 있는 제제를 포함하는 암 진단용 조성물.
  2. 제 1 항에 있어서, 상기 제제는 상기 염기서열에 대하여 상보적인 서열을 포함하는 프라이머(primer) 인 것인, 암 진단용 조성물.
  3. 제 2 항에 있어서, 상기 프라이머는 유전자 증폭반응(amplification reaction)에 사용되는 것인, 암 진단용 조성물.
  4. 제 3 항에 있어서, 상기 유전자 증폭반응은 중합효소연쇄반응(PCR, polymerase chain reaction)인 것인, 암 진단용 조성물.
  5. 제 2 항에 있어서, 상기 프로브는 마이크로어레이(microarray)에 사용되는 것인, 암 진단용 조성물.
  6. 제 1 항에 있어서, 상기 암은 유방암, 폐암, 위암, 간암, 혈액암, 뼈암, 췌장암, 피부암, 두경부암, 피부 또는 안구 흑색종, 자궁육종, 난소암, 직장암, 항문암, 대장암, 결장암, 난관암, 자궁내막암, 자궁경부암, 소장암, 내분비암, 갑상선암, 부갑상선암, 신장암, 연조직종양, 요도암, 전립선암, 기관지암 및 골수암으로 이루어진 군에서 선택되는 암인 것인, 암 진단용 조성물.
  7. 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free DNA), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA를 검출할 수 있는 제제를 포함하는 조성물을 포함하는 암 진단용 키트.
  8. 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free DNA), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA를 포함하는 암 진단용 바이오마커.
  9. 서열번호 7의 염기서열을 포함하는 세포-유리형 DNA(cell-free DNA), 서열번호 8의 염기서열을 포함하는 세포-유리형 DNA 및 서열번호 9의 염기서열을 포함하는 세포-유리형 DNA로 이루어진 군에서 선택된 1종 이상의 세포-유리형 DNA 검출하는 검출 단계를 포함하는 암 진단에 필요한 정보 제공 방법.
  10. 제 9 항에 있어서, 상기 검출 단계는 유전자 증폭 방식 또는 마이크로어레이 방식으로 수행하는 것인, 암 진단에 필요한 정보 제공 방법.
  11. 제 9 항에 있어서, 상기 검출 단계는 다음의 단계를 포함하는 것인, 암 진단에 필요한 정보 제공 방법:
    서열번호 1의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 2의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트;
    서열번호 3의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 4의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트; 및
    서열번호 5의 염기서열로 이루어진 올리고뉴클레오타이드 및 서열번호 6의 염기서열로 이루어진 올리고뉴클레오타이드로 이루어진 프라이머 세트;
    로 이루어진 군에서 선택된 1종 이상의 프라이머 세트를 사용하여 중합효소연쇄반응(PCR, polymerase chain reaction)을 수행하는 증폭 단계.
  12. 제 9 항에 있어서, 상기 검출 단계는 생물학적 시료로부터 분리된 세포-유리형(cell-free) DNA를 분리하는 분리 단계를 포함하는 것인, 암 진단에 필요한 정보 제공 방법.
  13. 제 12 항에 있어서, 상기 생물학적 시료는 혈액, 혈장, 타액, 림프액, 뇌척수액, 활액 및 낭종액(cystic fluid)으로 이루어진 군에서 선택된 1종 이상인 것인, 암 진단에 필요한 정보 제공 방법.
PCT/KR2017/006012 2016-06-14 2017-06-09 세포-유리형 dna의 암 질환의 진단 용도 WO2017217700A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160074010A KR101860547B1 (ko) 2016-06-14 2016-06-14 세포-유리형 dna의 암 질환의 진단 용도
KR10-2016-0074010 2016-06-14

Publications (1)

Publication Number Publication Date
WO2017217700A1 true WO2017217700A1 (ko) 2017-12-21

Family

ID=60664592

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/006012 WO2017217700A1 (ko) 2016-06-14 2017-06-09 세포-유리형 dna의 암 질환의 진단 용도

Country Status (2)

Country Link
KR (1) KR101860547B1 (ko)
WO (1) WO2017217700A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016011141A1 (en) * 2014-07-17 2016-01-21 Blueprint Medicines Corporation Fgr fusions
KR20160129523A (ko) * 2015-04-30 2016-11-09 주식회사 넥스바이오 세포-유리형 dna의 위암 진단 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016011141A1 (en) * 2014-07-17 2016-01-21 Blueprint Medicines Corporation Fgr fusions
KR20160129523A (ko) * 2015-04-30 2016-11-09 주식회사 넥스바이오 세포-유리형 dna의 위암 진단 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DAOUD, GEORGES ET AL.: "Src Family Kinases Play Multiple Roles in Differentiation of Trophoblasts from Human Term Placenta", THE JOURNAL OF PHYSIOLOGY, vol. 571, no. 3, 15 March 2006 (2006-03-15), pages 537 - 553, XP055464776 *
DATABASE NCBI [O] 6 June 2016 (2016-06-06), XP055449368, Database accession no. NC_018931.2 *
LEE, SU RIM ET AL.: "Identification of a Circulating Tumor DNA in Gastric Cancer Patients", KOREA METABOIOMICS SOCIETY , 201 6 ANNUAL SYMPOSIUM AND GENERAL MEETING, April 2016 (2016-04-01), Seoul, Korea, pages 4 - 1 *
ONEYAMA, C. ET AL.: "Fer Tyrosine Kinase Oligomer Mediates and Amplifies Src-induced Tumor Progression", ONCOGENE, vol. 35, no. 4, 28 January 2016 (2016-01-28), pages 501 - 512, XP055449384 *

Also Published As

Publication number Publication date
KR101860547B1 (ko) 2018-05-23
KR20170141054A (ko) 2017-12-22

Similar Documents

Publication Publication Date Title
Jakupciak et al. Mitochondrial DNA as a cancer biomarker
EP2891720B1 (en) Method for screening cancer
EP3755813B1 (en) Improved detection of microsatellite instability
KR101751962B1 (ko) 세포-유리형 dna의 위암 진단 용도
WO2014003053A1 (ja) 膵臓がんの検出方法及び検出用キット
US10017824B2 (en) Method for determining nucleic acid composition of nucleic acid mixture
WO2020020072A1 (zh) 基于甲基化修饰的肿瘤标记物stamp-ep2
WO2020096394A1 (ko) 리덕션 프로브를 이용한 유전자의 메틸화 검출 방법, 검출 키트 및 pcr 장치
WO2016168174A1 (en) Predicting the occurrence of metastatic cancer using epigenomic biomarkers and non-invasive methodologies
WO2010118559A1 (zh) 一种癌症筛检的方法
CN110484621B (zh) 一种肝癌早期预警的方法
EP3916092A1 (en) Tumor marker stamp-ep5 based on methylated modification
Treger et al. Somatic TP53 mutations are detectable in circulating tumor DNA from children with anaplastic Wilms tumors
WO2021180105A1 (zh) 一种检测常见两性癌症的探针组合物
WO2021185274A1 (zh) 一种检测6种中国高发癌症的探针组合物
EP3950945A1 (en) Methylation modification-based tumor marker stamp-ep4
EP3904516A1 (en) Methylation modification-based tumor marker stamp-ep6
JP7331043B2 (ja) 食道癌を検出するための組成物及びその使用
WO2021175284A1 (zh) 检测3种实质性器官肿瘤的探针组合物
WO2013122319A1 (ko) 리가제 반응과 절단효소 증폭반응을 이용한 표적 유전자 또는 이의 돌연변이 검출방법
WO2013105774A1 (ko) 절단 가능한 프로브를 이용한 ｃ－Ｍｅｔ 유전자 검출 방법
WO2023210997A1 (ko) 위암 발병의 위험도를 예측하기 위한 조성물 및 이를 이용한 방법
WO2017084027A1 (zh) 一种用于急性髓细胞白血病预后分层的试剂盒及检测方法
US20190390282A1 (en) Target enrichment and sequencing of modified nucleic acids for human cancer detection
TWI385252B (zh) 一種癌症篩檢的方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17813524

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17813524

Country of ref document: EP

Kind code of ref document: A1