WO2017214942A1

WO2017214942A1 - Lentiviral expression vector for improving expression of tctp gene, and applications thereof

Info

Publication number: WO2017214942A1
Application number: PCT/CN2016/086066
Authority: WO
Inventors: 毛侃琅
Original assignee: 毛侃琅
Priority date: 2016-06-16
Filing date: 2016-06-16
Publication date: 2017-12-21

Abstract

A lentiviral expression vector for specifically promoting high expression of a TCTP gene comprises a fundamental sequence, a resistance gene sequence, a multiple-cloning-sites sequence, a promoter sequence, and a TCTP gene cDNA sequence of a pLVX-IRES-puro expression vector. The multiple cloning sites comprise an EcoR I enzyme cutting site and an Spe I enzyme cutting site, the TCTP gene cDNA sequence comprises an EcoR I enzyme cutting site, a TCTP gene coding sequence and an Spe I enzyme cutting site, and the TCTP gene cDNA sequence is forwardly inserted into the multiple-cloning-sites sequence. The lentiviral expression vector can serve as a tool applied to the research and development of drugs related to TCTP.

Description

Lentiviral expression vector for enhancing TCTP gene expression and application thereof

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a lentiviral expression vector for enhancing expression of a TCTP gene and an application thereof.

Background technique

[0002] Diabetes is a group of chronic non-infectious, metabolic diseases characterized by elevated blood glucose levels that are a serious hazard to human health. Whether in developed or developing countries, diabetes has become an epidemic in modern society and has become a worldwide public health problem that poses a serious threat to human health. According to the World Health Organization

According to the recommendations of the (WHO) and International Diabetes Federation (IDF) expert groups, diabetes can be divided into type 1, type 2, other special types and gestational diabetes. Among them, type 2 diabetes (T2DM) is the main body of diabetes. In recent years, the prevalence of type 2 diabetes has increased dramatically in countries around the world, and the surge in type 2 diabetes is the leading cause of the dramatic increase in the total number of diabetic patients worldwide. According to a large number of epidemiological surveys in recent years, the prevalence of diabetes in adults is close to 10%, and type 2 diabetes accounts for about 90% of all diabetic patients. The results of WHO statistics and predictions are as follows: In 1994, the number of people with diabetes was 120 million, in 1997 it was 135 million, in 2000 it was 175 million, in 2010 it was 239 million, and in 2025 it is expected to exceed 300 million. And the trend of a sharp increase in type 2 diabetes in the last three or fifty years will continue.

technical problem

[0003] TCTP is a protein widely expressed in eukaryotes. Its structure is highly conserved and participates in a series of cellular physiological functions such as cell cycle, apoptosis, protein translation, cell morphology, etc. Death protein. Recent studies have shown that TCTP plays an important role in the survival of pancreatic islet β cells and needs further study. However, the lack of lentiviral expression vectors that specifically promote the high expression of TCTP gene in the prior art makes the relevant studies not well developed.

Problem solution

Technical solution

[0004] In order to solve the problems existing in the prior art, the inventors conducted extensive research on the selection of vectors, the method of recombinant construction, and the like, and found that it will contain EcoR I cleavage sites and Spe. The TCTP gene cDNA sequence of the I cleavage site was inserted into the multiple cloning site of the pLVX-IRES-Puro expression vector to construct a lentiviral expression vector which specifically promotes high expression of the TCTP gene, thereby completing the present invention.

The present invention provides a lentiviral expression vector which specifically promotes high expression of a TCTP gene, including a basic sequence of a pLVX-IRE S-puro expression vector, a resistance gene sequence, a multiple cloning site sequence, a promoter sequence, and a T CTP a gene cDNA sequence; the multiple cloning site comprises an EcoR I cleavage site and a Spe l cleavage site, and the TCTP gene cDNA sequence comprises an EcoR I cleavage site, a TCTP gene coding sequence, and a Spe I cleavage site The TCTP gene cDNA sequence is positively inserted into the multiple cloning site sequence.

[0006] According to the above technical solution, the lentiviral expression vector constructed by inserting the TCTP gene cDNA sequence into the pLVX-IRES-Puro expression vector has high transfection efficiency and low dosage, and can stably, efficiently and stably increase TCTP. The advantages of gene expression can be used as a powerful tool in the preparation and treatment of drugs for the treatment of TCTP gene expression in diseases such as Alzheimer's disease.

As a further improvement of the present invention, the TCTP gene coding sequence is obtained by PCR amplification, and the PCR primer comprises an upstream primer and a downstream primer, and the sequence of the upstream primer is: 5'-

GGAATTCATGATTATCTACCGGGACCTC -3, ie SEQ ID NO: 1, the sequence of the downstream primer is: 5,- GACTAGTCTAAAGATGTATTCCCCAATTC -3', ie SEQ ID

NO: 2. Using the above PCR primer sequence, the TCTP gene coding sequence can be amplified by PCR, and can be successfully inserted into the pLVX-IRES-Puro expression vector to continuously express the TCTP gene, which reduces the cost of sequence synthesis and lowers the cost.

Correspondingly, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of a TCTP gene, comprising the following steps:

[0009] A) TCTP gene primer design: According to the TCTP gene coding sequence, using Oligo 7 analysis, select 5'-GGAATTCATGATTATCTACCGGGACCTC-3', ie SEQ ID NO: 1 as the upstream bow, select 5 '- GACTAGTCTAAAGATGTATTCCCCAATTC -3, , that is, SEQ ID NO: 2 as a downstream primer, and then synthesizing the upstream primer and the downstream primer; the upstream primer and the downstream primer have no primer dimer, and the annealing temperature difference is small;

[0010] B) obtaining the TCTP gene cDNA sequence: PCR amplification using the upstream primer and the downstream primer to obtain a large number of TCTP gene coding sequences, and then adding the A tail reaction to the sequence, using T4 DNA ligase Attached to the pGM-T vector to obtain a ligation product, which is transformed into a competent colon In the ToplO strain, uniformly coated onto the ampicillin-containing LB medium plate, picking up the positive monoclonal colony culture preservation liquid solution and performing preliminary PCR identification. The preliminary identification results indicate that the TCTP gene cDNA sequence was inserted into the successful bacterial solution for sequencing identification. The correct E. coli was identified by liquid LB medium, and the pGM-T vector carrying the TCTP gene cDNA sequence was extracted and digested with the restriction enzymes EcoR I and Spe I, electrophoresis and gelatinization. Recover a fragment of about 500 bp, which is the TCTP gene cDNA sequence;

[0011] C) Construction and identification of a lentiviral vector that specifically promotes high expression of the TCTP gene: extraction of the plasmid pLVX-IR ES-Puro, digestion with restriction endonuclease EcoR I enzyme and Spe I enzyme, electrophoresis, gelation The vector was recovered, and the TCTP gene cDNA sequence was ligated into the ajpLVX-IRES-Puro expression vector by T4 DNA ligase.

The ligation product is obtained, and the ligation product is transformed into competent E. coli ToplO, uniformly coated on an ampicillin-containing LB medium plate, and the positive monoclonal colony culture preservation liquid is picked and subjected to preliminary identification by PCR, and preliminary identification is performed. The results indicated that the TCTP gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification;

[0012] D) Extraction of a lentiviral vector that specifically promotes high expression of the TCTP gene: The sequencing result confirms that the TCTP gene cDNA sequence is inserted into a successful bacterial cell expansion culture, and the recombinant plasmid is extracted to obtain a specific TC TP gene. Expressed lentiviral expression vector.

[0013] The present invention utilizes genetic engineering technology to construct a lentiviral expression vector which specifically promotes high expression of TCTP gene, and after successful identification, packaging into a virus and transfecting into INS-1 cells, and screening cells with puromycin, using real-time fluorescence quantitative The PCR and Western Blot techniques were used to verify the changes of TCTP gene expression from mRNA and protein levels, respectively. The experimental results showed that the TCTP gene cDNA sequence provided by the present invention was successfully inserted into the pLVX-IR ES-Puro expression vector, which was specific, sustained, efficient and stable. Promote high expression of TCTP gene.

The present invention also provides the use of a lentiviral expression vector which specifically promotes high expression of a TCTP gene for the preparation of a medicament for treating a disease associated with abnormal expression of a TCTP gene.

Advantageous effects of the invention

Beneficial effect

The lentiviral expression vector which specifically promotes the high expression of the TCTP gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, high efficiency and stable promotion of high expression of the TCTP gene, and can be used as a powerful tool. In drug research and development related to TCTP; the present invention also provides specific promotion of TCTP A method for constructing a lentiviral expression vector with high expression of a gene, which has a good operation effect and reduces the cost of sequence synthesis

, the cost is lower.

Brief description of the drawing

DRAWINGS

1 is a plasmid map of the pLVX-IRES-Puro expression vector.

2 is a schematic diagram showing the results of fluorescent quantitative PCR detection after puromycin screening of cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0019] INS-1 cells were purchased from the Cell Resource Center of Shanghai Institute of Biological Sciences. 293FT cells were purchased from Thermo Fisher, Premix PrimeSTAR HS enzyme, lentiviral expression vector pLVX-IRES-Puro, virus packaging auxiliary kit, Lenti-X GoStix reagent. Boxes are purchased from Takara, RNeasy Mini

Kit was purchased from QIAGEN, pGM-T was purchased from Tiangen, and Endo-Free Plasmid Mini Kit II was purchased from Omega bio-tek.

Example 1 Design of TCTP Gene Primers.

[0021] According to the TCTP gene coding sequence (GenBank NM_001033581.1), it was analyzed using 01igo7 to find upstream primers and downstream primers (requiring as little primer-free dimer as possible and the annealing temperature difference is small), then upstream primers and The protective base and the restriction sites EcoR I and EcoR I were added to the 5' end of the downstream primer, respectively, and the designed primer sequences are shown in Table 1. The designed PCR primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

Table 1 PCR bow of the TCTP gene |

[] 1]

[0023] Example 2 Construction of a lentiviral vector that specifically promotes high expression of TCTP gene

[0024] After diluting the synthetic antibody, the coding sequence of the TCTP gene was amplified by Premix PrimeSTAR HS enzyme, and then electrophoresed and then subjected to A tail reaction, and then ligated to pGM-T with T4 DNA ligase. The ligation product (TCTP-T vector) was obtained on the vector, and the ligation product was transformed into competent E. coli To plO, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. Negative control group 1 (consistent cells were uniformly coated on ampicillin-free plates), negative control group 2 (peripheral cells were uniformly coated in 100)

g/ml ampicillin on the plate), positive control group 1 (the connection product of the double enzyme-cut empty vector was evenly coated in 100

g/ml ampicillin on the plate), positive control group 2 (the empty carrier was evenly spread on a plate containing 100 g/mL ampicillin). The experimental group grew a single colony, the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, the positive control group 2 did not grow colonies.

[0025] After picking up 8 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of TCTP gene for preliminary identification. The results showed that the cultures of 8 single colonies could be successfully amplified. The TCTP gene was released, and the recombinant vector was then sent to Shanghai Biotech for sequencing.

[0026] The bacteria with the correct sequencing result were cultured in liquid LB medium for 14 h, and then the recombinant T vector containing the TCTP gene sequence was extracted, and the pLVX-IRES-Puro vector was firstly used with EcoR I enzyme and Spe I, respectively. The enzyme was double-digested, electrophoresed and recovered, and the product was recovered by T4 DNA ligase, and then transformed into competent E. coli ToplO, uniformly coated on ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. The negative control group 1 was set up (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated on the plate containing 100 g/ml ampicillin), Positive control group 1 (the ligation product of the double enzyme-cut empty vector was uniformly coated on a plate containing 100 g/ml ampicillin), positive control group 2 (the empty vector was uniformly coated on 100 g/mL ampicillin) On the tablet). The experimental group grew a single colony, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, and the positive control group 2 did not grow colonies.

[0027] After picking up 6 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of TCTP gene for preliminary identification. The results showed that all the six culture broths could successfully amplify the TCTP gene, and then the recombinant vector broth was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were exactly in line with expectations. , obtained pLVX-TCTP plasmid.

[0028] The previously collected recombinant plasmid bacterial solution was taken out, inoculated into 15 ml of LB medium (containing 100 g/ml ampicillin), cultured at 37 ° C, 300 rpm for 16 h, using Endo-Free Plasmid Mini Kit II The recombinant plasmid pLVX-TCTP was extracted and its purity and concentration were measured. The results are shown in Table 2.

[0029] Table 2 recombinant plasmid purity and concentration

[] [Table 2]

[0031] 293FT cells were cultured, and cells grown in good condition were inoculated into six wells, 1,000,000 cells per well, and the extracted recombinant plasmid pLVX-TCTP 2μ _§ was transfected into 293FT cells using a lentiviral packaging auxiliary kit. After 48 h, the virus-containing supernatant medium was collected, and the virus solution was filtered through a sieve of 0.45 μm for infection of INS-1 cells, and the Lenti-X GoStix kit was used to detect a virus titer of 5,000,000 to 50,000,000 IFU.

Example 4 Lentiviral transduction of INS-1 cells

[0033] Inoculated INS-1 cells in a 6-well plate, 1000000 cells per well. After 12 hours, the cell density was about 50<3⁄4, and the virus solution was taken separately. The virus was diluted 10 times with DMEM complete medium, and then polyglycolamine was added. (polybrene) The final concentration was 8 g/mL. The medium in the 6-well plate was added to the virus-containing DMEM complete medium (containing 10% fetal bovine serum). After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.00 g/ml.

Example 5 Fluorescence quantitative PCR was used to detect the expression level of TCTP gene.

[0035] According to the GAPDH and TCTP gene mRNA sequences, the primer design software Oligo 7.0 was used to design the bow. [table 3]

[0036] INS-1 cells, pLVX empty vector control INS-1 cell group, and pLVX-TCTP high expressing cells were inoculated to a 6-well plate, respectively. The cell density reached 80<3⁄4-90<3⁄4吋, and the total RNA of each group was extracted with RNeasy Mini Kit, and PrimeScrip RT reagent was used for He ¹ J.

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of reverse transcription, add 9 (L of RNase Free dH ₂ 0 diluted cDNA, and store at -20 ° C for later detection. Take the cDNA of each group of cells.

Ιμΐ was used as a template, and GAPDH was used as an internal reference. Real-time quantitative PCR (QPCR) was used to detect the relative expression of TCTP, and the reaction conditions were set: 95. C 30s, 1 cycle, 54°C 30s 40 cycles, 95. C 5s, 60. C lmin, 95 ° C for 15 s, the relative expression of TCTP gene in each group was detected by SYBR Primescript RT-PCR Kit. After the pLVX-TCTP cells were continuously cultured for 20 passages, the above experiment was repeated. The summarized results are shown in Figure 2. It can be seen that the expression level of TCTP gene is 60-fold higher than that of INS-1 cells, whether it is just after screening or after 20 generations of pLVX-TCTP cells, and the TCTP gene of pLVX empty vector cells. The expression level of the TCTP gene was successfully inserted into the pLVX-IRES-Puro expression vector, which promoted the high expression of TCTP gene specifically, continuously, efficiently and stably.

[0037] The above is a further detailed description of the present invention in conjunction with the specific preferred embodiments. It is not intended that the specific embodiments of the invention are limited to the description. It will be apparent to those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the invention.

Industrial applicability

The lentiviral expression vector provided by the invention specifically promoting the high expression of the TCTP gene has high transfection efficiency. It has the advantages of low dosage, specific, sustained, efficient and stable promotion of high expression of TCTP gene, and can be used as a powerful tool in drug research and development related to TCTP. The present invention also provides specific promotion of high expression of TCTP gene. The construction method of lentiviral expression vector has good operation effect and reduces the cost of sequence synthesis

, the cost is lower.

Claims

claims

[Claim 1] A lentiviral expression vector that specifically promotes high expression of the TCTP gene, characterized by: including the basic sequence of the pLVX-IRES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and TCTP gene cDNA sequence: the multiple cloning site includes EcoR I enzyme cut site and Spe I enzyme cut site, the TCTP gene cDNA sequence includes EcoR I enzyme cut site, TCTP gene coding sequence and Spe I enzyme cut site

I enzyme cutting site, the TCTP gene cDNA sequence is inserted into the multiple cloning site sequence in the forward direction.

[Claim 2] The lentiviral expression vector that specifically promotes high expression of TCTP gene according to claim 1, characterized in that: the TCTP gene coding sequence is obtained by PCR amplification, and the PCR primers include upstream primers and downstream primers, so The sequence of the above-mentioned upstream primer is: 5'- GGAATTCATGATTATCTACCGGGACCTC-3, that is, SEQ ID NO: 1. The sequence of the above-mentioned downstream primer is: 5'-

GACTAGTCTAAAGATGTATTCCCCAATTC -3' , which is SEQ ID NO: 2

[Claim 3] The construction method of a lentiviral expression vector that specifically promotes high expression of TCTP gene according to claim 2, characterized in that: comprising the following steps:

A) TCTP gene primer design: According to the TCTP gene coding sequence, use 01igo 7 to analyze and select 5, - GGAATTCATGATTATCTACCGGGACCTC -3, that is, SEQ ID NO: 1 as the upstream primer, select 5'-

GACTAGTCTAAAGATGTATTCCCCAATTC-3', i.e. SEQ ID NO: 2 as the downstream primer, and then synthesize the upstream primer and the downstream primer;

B) Obtaining the TCTP gene cDNA sequence: Use the upstream primer and the downstream primer to perform PCR amplification to obtain a large number of TCTP gene coding sequences, and then perform an A-tailing reaction on the sequence, and then connect it to pGM using T4 DNA ligase Obtain the ligation product on the -T vector, transform the ligation product into competent E. coli ToplO, spread it evenly on an LB medium plate containing ampicillin, pick out positive single clone colonies, culture and preserve the bacterial liquid, and perform preliminary PCR identification. The preliminary identification results showed that the TCTP gene cDNA sequence was successfully inserted into the bacterial liquid. Perform sequencing identification; use liquid LB medium to culture the correct E. coli for sequencing identification, and extract the pGM-T vector containing the TCTP gene cDNA sequence, double-digest with restriction endonuclease EcoR I enzyme and Spel enzyme, and perform electrophoresis. , cut rubber recycling 500

A fragment of about bp, this fragment is the TCTP gene cDNA sequence;

C) Construction and identification of lentiviral vectors that specifically promote the high expression of TCTP genes: Extract plasmid pLVX-IRES-Puro, double-digest with restriction endonucleases EcoR I and Spe I, electrophoresis, and gel cutting to recover the vector, and then Use T4 DNA ligase to connect the TCTP gene cDNA sequence into the pLVX-IRES-Puro expression vector to obtain a ligation product, transform the ligation product into competent E. coli Top10, and spread it evenly onto an LB medium plate containing ampicillin On the top, select positive single clone colonies, culture and preserve the bacterial liquid and perform preliminary PCR identification. The preliminary identification results indicate that the TCTP gene cDNA sequence has been successfully inserted into the bacterial liquid for sequencing and identification.

D) Extraction of lentiviral vectors that specifically promote the high expression of the TCTP gene: The sequencing results confirm that the TCTP gene cDNA sequence has been successfully inserted into the bacterial liquid amplification culture, and the recombinant plasmid is extracted to obtain the lentivirus that specifically promotes the high expression of the TCTP gene. Expression vector.

[Claim 4] Use of the lentiviral expression vector that specifically promotes high expression of TCTP gene according to any one of claims 1 to 3 in the preparation of drugs for the treatment of diseases related to abnormal TCTP gene expression