WO2017214941A1

WO2017214941A1 - Lentiviral vector for improving expression level of selp gene, and applications thereof

Info

Publication number: WO2017214941A1
Application number: PCT/CN2016/086065
Authority: WO
Inventors: 毛侃琅
Original assignee: 毛侃琅
Priority date: 2016-06-16
Filing date: 2016-06-16
Publication date: 2017-12-21

Abstract

A lentiviral expression vector for specifically promoting high expression of an SelP gene comprises a fundamental sequence, a resistance gene sequence, a multiple-cloning-sites sequence, a promoter sequence, and an SelP gene cDNA sequence of a pLVX-IRES-puro expression vector. The multiple cloning sites comprise an Spe I enzyme cutting site and an Not I enzyme cutting site, the SelP gene cDNA sequence comprises an Spe I enzyme cutting site, an SelP gene coding sequence and an Not I enzyme cutting site, and the SelP gene cDNA sequence is forwardly inserted into the multiple-cloning-sites sequence. The lentiviral expression vector has the advantages of high transfection efficiency and small usage and being capable of specifically, continuously, efficiently and stably expressing the SelP gene, and can serve as a powerful tool applied to the research and development of drugs related to SelP.

Description

Lentiviral vector for increasing expression level of SelP gene and application thereof

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a lentiviral vector for increasing the expression level of a SelP gene and an application thereof.

Background technique

[0002] Diabetes is a group of chronic non-infectious, metabolic diseases characterized by elevated blood glucose levels that are a serious hazard to human health. Whether in developed or developing countries, diabetes has become an epidemic in modern society and has become a worldwide public health problem that poses a serious threat to human health. According to the World Health Organization

According to the recommendations of the (WHO) and International Diabetes Federation (IDF) expert groups, diabetes can be divided into type 1, type 2, other special types and gestational diabetes. Among them, type 2 diabetes (T2DM) is the main body of diabetes. In recent years, the prevalence of type 2 diabetes has increased dramatically in countries around the world, and the surge in type 2 diabetes is the leading cause of the dramatic increase in the total number of diabetic patients worldwide. According to a large number of epidemiological surveys in recent years, the prevalence of diabetes in adults is close to 10%, and type 2 diabetes accounts for about 90% of all diabetic patients. The results of WHO statistics and predictions are as follows: In 1994, the number of people with diabetes was 120 million, in 1997 it was 135 million, in 2000 it was 175 million, in 2010 it was 239 million, and in 2025 it is expected to exceed 300 million. And the trend of a sharp increase in type 2 diabetes in the last three or fifty years will continue.

technical problem

[0003] SelP is a protein widely expressed in eukaryotes. Its structure is highly conserved and participates in a series of cellular physiological functions such as cell cycle, apoptosis, protein translation, cell morphology, etc. Death protein. Recent studies have shown that SelP plays an important role in the survival of pancreatic β-cells and needs further study. However, the lack of lentiviral expression vectors that specifically promote the high expression of SelP gene in the prior art has made the relevant studies not well developed.

Problem solution

Technical solution

[0004] In order to solve the problems existing in the prior art, the inventors conducted extensive research on the selection of vectors, the method of recombinant construction, and the like, and found that the Spe I cleavage site and Not The SelP gene cDNA sequence of the I cleavage site was inserted into the multiple cloning site of the pLVX-IRES-Puro expression vector to construct a lentiviral expression vector which specifically promotes high expression of the SelP gene, thereby completing the present invention.

The present invention provides a lentiviral expression vector which specifically promotes high expression of the SelP gene, including the basic sequence of the pLVX-IRES- puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and the SelP gene cDNA. The multiple cloning site includes a Spe1 cleavage site and a Not I cleavage site, and the SelP gene cDNA sequence includes a Spe I cleavage site, a SelP gene coding sequence, and a Not

The I cleavage site, the SelP gene cDNA sequence is inserted into the multiple cloning site sequence.

[0006] According to the above technical solution, the lentiviral expression vector constructed by inserting the SelP gene cDNA sequence into the pLVX-IRES-Puro expression vector has high transfection efficiency and low dosage, and can stably, efficiently and stably increase SelP. The advantages of gene expression can be used as a powerful tool in the preparation and treatment of SelP gene expression in the treatment of diseases such as Alzheimer's disease.

As a further improvement of the present invention, the SelP gene coding sequence is obtained by PCR amplification, and the PCR primer comprises an upstream primer and a downstream primer, and the sequence of the upstream primer is: 5'-

GACTAGTATGGCCAACTGCCAAATAG -3', ie SEQ ID NO: 1, the sequence of the downstream primer is: 5'- GGCGGCCGCTTAAGGACTCGGGTCAAATGC -3', ie SEQ ID

NO: 2. Using the above PCR primer sequence, the SelP gene coding sequence can be amplified by PCR, and can be successfully inserted into the pLVX-IRES-Puro expression vector to continuously express the SelP gene, which reduces the cost of sequence synthesis and has a lower cost.

Correspondingly, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of a SelP gene, comprising the following steps:

[0009] A) SelP gene primer design: According to the SelP gene coding sequence, use Oligo

7 After analysis, select 5, - 0 01 0 Ding 000: 0100: D = 0 -3,, ie SEQ ID NO: 1 as the upstream primer, select 5,- GGCGGCCGCTTAAGGACTCGGGTCAAATGC

-3', that is, SEQ ID NO: 2 as a downstream primer, and then synthesizing the upstream primer and the downstream primer; the upstream bow and the downstream bow are free of the dimer, and the annealing temperature The gap is small;

[0010] B) obtaining the SelP gene cDNA sequence: using the upstream primer and the downstream primer for PCR amplification, obtaining a large number of SelP gene coding sequences, and then adding the A tail reaction to the sequence, using T4 DNA ligase Linked to the pGM-T vector to obtain a ligation product, which is transformed into competent Escherichia coli T In oplO, uniformly coated onto ampicillin-containing LB medium plate, picking positive monoclonal colony culture preservation liquid solution and preliminary identification by PCR, and preliminary identification results indicate that the SelP gene cDNA sequence was inserted into the successful bacterial liquid for sequencing identification; The correct E. coli was identified by liquid LB medium, and the pGM-T vector carrying the SelP gene cDNA sequence was extracted and digested with restriction endonuclease Spe I enzyme and Not I enzyme. Electrophoresis and gel extraction were performed. a fragment of about 2500 bp, which is the SelP gene cDNA sequence;

[0011] C)

Construction and identification of a lentiviral vector that specifically promotes high expression of the SelP gene: The plasmid pLVX-IRES-Pur o is extracted, digested with restriction endonuclease Spe I enzyme and Not I enzyme, electrophoresis, gel-removed recovery vector, and then used The SelP gene cDNA sequence was ligated into the ajpLVX-IRES-Puro expression vector to obtain a ligation product, and the ligation product was transformed into competent E. coli ToplO and uniformly coated on an ampicillin-containing LB medium plate. The positive monoclonal colonies were picked and cultured to preserve the bacterial liquid and preliminary identification by PCR. The preliminary identification results indicated that the SelP gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification;

[0012] D) Extraction of a lentiviral vector that specifically promotes high expression of the SelP gene: The sequencing result confirms that the SelP gene cDNA sequence is inserted into a successful bacterial cell expansion culture, and the recombinant plasmid is extracted to obtain a specific promotion of the Sel P gene. Expressed lentiviral expression vector.

[0013] The present invention utilizes genetic engineering technology to construct a lentiviral expression vector which specifically promotes high expression of the SelP gene, and after successful identification, is packaged into a virus and transduced into INS-1 cells, and the cells are selected by puromycin, and then quantified by real-time fluorescence. PCR and Western Blot techniques were used to verify the expression of SelP gene from mRNA and protein levels. The experimental results showed that the SelP gene cDNA sequence provided by the present invention was successfully inserted into the pLVX-IRES-Pu ro expression vector, which was specific, sustained, efficient and stable. Promote high expression of SelP gene.

The present invention also provides a use of a lentiviral expression vector which specifically promotes high expression of a SelP gene for the preparation of a medicament for treating a disease associated with abnormal expression of a SelP gene.

Advantageous effects of the invention

Beneficial effect

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The lentiviral expression vector provided by the invention specifically promoting the high expression of the SelP gene has high transfection efficiency, low dosage, specificity, persistence, high efficiency and stability. The advantage of promoting the high expression of SelP gene can be used as a powerful tool in drug research and development related to SelP; the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of SelP gene The operation effect is good, the sequence synthesis cost is reduced, and the cost is low.

Brief description of the drawing

DRAWINGS

1 is a plasmid map of the pLVX-IRES-Puro expression vector.

2 is a schematic diagram showing the results of fluorescent quantitative PCR detection after puromycin screening of cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0019] INS-1 cells were purchased from the Cell Resource Center of Shanghai Institute of Biological Sciences. 293FT cells were purchased from Thermo Fisher, Premix PrimeSTAR HS enzyme, lentiviral expression vector pLVX-IRES-Puro, virus packaging auxiliary kit, Lenti-X GoStix reagent. Boxes are purchased from Takara, RNeasy Mini

Kit was purchased from QIAGEN, pGM-T was purchased from Tiangen, and Endo-Free Plasmid Mini Kit II was purchased from Omega bio-tek.

[0020] Example 1 Design of SelP gene primers.

[0021] According to the SelP gene coding sequence (GenBank NMJX 005.3), it was analyzed using 01igo7

Find upstream primers and downstream primers (requires as little primer-free dimer as possible and have a small annealing temperature difference), then add protective bases and restriction sites Spe I and Spe I at the 5' end of the upstream and downstream primers, respectively. The designed primer sequences are shown in Table 1. The designed PCR primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

[0022] Table 1 SelP gene PCR bow |

[] [Table 1]

[0023] Example 2 Construction of a lentiviral vector that specifically promotes high expression of the SelP gene [0024] After diluting the synthetic antibody, the SelP gene coding sequence was amplified by Premix PrimeSTAR HS enzyme, and then electrophoresed and then subjected to A tail reaction, and then ligated to pGM-T with T4 DNA ligase. The ligation product (SelP-T vector) was obtained on the vector, and the ligation product was transformed into competent E. coli Topi 0, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. Negative control group 1 (consistent cells were uniformly coated on ampicillin-free plates), negative control group 2 (competent cells were uniformly coated on plates containing 100 g/ml ampicillin), positive control group 1

(The ligation product of the double enzyme-cut empty vector was uniformly coated on a plate containing 100 g/ml ampicillin), and the positive control group 2 (the empty carrier was uniformly coated on a plate containing 100 g/mL ampicillin). In the experimental group, a single colony grew, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1. The positive control group 2 did not grow colonies.

[0025] After picking up 8 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with SelP gene primers for preliminary identification. The results showed that the cultures of 8 single colonies could be successfully amplified. The SelP gene was exported, and then the recombinant vector was sent to Shanghai Biotech Co., Ltd. for sequencing.

[0026] The bacteria with the correct sequencing result were cultured in liquid LB medium for 14 h, and then the recombinant T vector containing the SelP gene sequence was extracted, and the pLVX-IRES-Puro vector was firstly treated with Spe I enzyme and Not I, respectively. The enzyme was double-digested, electrophoresed and recovered, and the product was recovered by T4 DNA ligase, and then transformed into competent E. coli ToplO, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. The negative control group 1 was set up (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated on the plate containing 100 g/ml ampicillin), Positive control group 1 (the ligation product of the double enzyme-cut empty vector was uniformly coated on a plate containing 100 g/ml ampicillin), positive control group 2 (the empty vector was uniformly coated on 100 g/mL ampicillin) On the tablet). The experimental group grew a single colony, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, and the positive control group 2 did not grow colonies.

[0027] After picking up 6 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with SelP gene primers for preliminary identification. The results showed that all 6 cultures could successfully amplify the SelP gene, and then the recombinant vector bacteria were sent to Shanghai Biotech Co., Ltd. for sequencing, and the sequencing results were exactly as expected, and the pLVX-SelP plasmid was obtained.

[0028] Take out the previously stored recombinant plasmid bacterial solution, and inoculate 20 into 15 ml LB medium (containing 100 g/ml). The ampicillin was cultured at 37 ° C, 300 rpm for 16 h, and the recombinant plasmid pLVX-SelP was extracted with Endo-Free Plasmid Mini Kit II, and the purity and concentration were measured. The results are shown in Table 2.

Table 2 Purity and concentration of recombinant plasmid

[Table 2]

[0031] 293FT cells were cultured, and cells grown in good condition were inoculated into six wells, 1,000,000 cells per well, and the extracted recombinant plasmid pLVX-SelP 2μ _§ was transfected into 293FT cells using a lentiviral packaging auxiliary kit. After 48 h, the virus-containing supernatant medium was collected, and the virus solution was filtered through a sieve of 0.45 μm to infect INS-1 cells, and the Lenti-X GoStix kit was used to detect a virus titer of 5,000,000 to 50000000 IFU.

Example 4 Lentiviral transduction INS-1 cells

[0033] Inoculated INS-1 cells in a 6-well plate, 1000000 cells per well. After 12 hours, the cell density was about 50<3⁄4, and the virus solution was taken separately. The virus was diluted 10 times with DMEM complete medium, and then polyglycolamine was added. (polybrene) The final concentration was 8 g/mL. The medium in the 6-well plate was added to the virus-containing DMEM complete medium (containing 10% fetal bovine serum). After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.00 g/ml.

Example 5 Fluorescence quantitative PCR was used to detect the expression level of SelP gene.

[0035] According to the GAPDH and SelP gene mRNA sequences, the primer design software Oligo 7.0 was used to design the bow.

[] [Table 3] Genes and Primers Primer Sequences (5, -3,)

GAPDH-F TCTGACTTCAACAGCGACACC

GAPDH-R CTGTTGCTGTAGCCAAATTCGT

SelP-F GCAGCTTCCACTGCACTGACG

SelP-R CTCTTCACAACTGAAGCTGC [0036] INS-1 cells, pLVX empty vector control INS-1 cell group, and pLVX-SelP high expressing cells were inoculated into 6-well plates, respectively. Cell density reached 80<3⁄4-90<3⁄4吋, total RNA was extracted from each group with RNeasy Mini Kit, and PrimeScrip RT reagent was used for He ¹ J.

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of reverse transcription, add 9 (L of RNase Free dH ₂ 0 diluted cDNA, and store at -20 ° C for later detection. Take the cDNA of each group of cells.

Ιμΐ was used as a template, and GAPDH was used as an internal reference. Real-time quantitative PCR (QPCR) was used to detect the relative expression of SelP, and the reaction conditions were set: 95. C 30s, 1 cycle, 54°C 30s 40 cycles, 95. C 5s, 60. C lmin, 95 ° C for 15 s, the relative expression of SelP gene in each group was detected by SYBR Primescript RT-PCR Kit. After continuous culture of pLVX-SelP cells for 20 passages, the above experiment was repeated. The summarized results are shown in Figure 2. It can be seen that the expression level of SelP gene is more than 45-fold higher than that of INS-1 cells, whether it is just after screening or after 20 generations of pLVX-SelP cells, and Se IP of pLVX empty vector cells. The gene expression level was almost unchanged from that of INS-1 cells, indicating that the SelP gene cDNA sequence provided by the present invention was successfully inserted into the pLVX-IRES-Puro expression vector, and the SelP gene expression was promoted specifically, continuously, efficiently, and stably.

[0037] The above is a further detailed description of the present invention in conjunction with the specific preferred embodiments. It is not intended that the specific embodiments of the invention are limited to the description. It will be apparent to those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the invention.

Industrial applicability

Compared with the prior art, the beneficial effects of the present invention are as follows: The lentiviral expression vector provided by the invention specifically promoting the high expression of the SelP gene has high transfection efficiency, low dosage, specificity, persistence, high efficiency and stability. The invention has the advantages of promoting the high expression of the SelP gene, and can be used as a powerful tool for drug research and development related to SelP; the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the SelP gene, and has a good operation effect. Reduced serial synthesis costs and lower costs.

Claims

claims

[Claim 1] A lentiviral expression vector that specifically promotes high expression of the SelP gene, characterized by: including the basic sequence of the pLVX-IRES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and SelP gene cDNA sequence; The multiple cloning site includes a Spe I restriction site and a Not I restriction site. The SelP gene cDNA sequence includes a Spe I restriction site, a SelP gene coding sequence and a Not I restriction site. point, the SelP gene cDNA sequence is inserted into the multiple cloning site sequence in the forward direction.

[Claim 2] The lentiviral expression vector specifically promoting the high expression of SelP gene according to claim 1, characterized in that: the SelP gene coding sequence is obtained by PCR amplification, and the PCR primers include upstream primers and downstream primers, so The sequence of the upstream primer is: 5'- GACTAGTATGGCCAACTGCCAAATAG -3, that is, SEQ ID NO: 1, and the sequence of the downstream primer is: 5'-

GGCGGCCGCTTAAGGACTCGGGTCAAATGC-3, i.e. SEQ ID NO: 2.

[Claim 3] The construction method of a lentiviral expression vector that specifically promotes high expression of the SelP gene according to claim 2, characterized in that: comprising the following steps:

A) SelP gene primer design: Based on the SelP gene coding sequence, use Oligo 7 to analyze and select 5, - GACTAGTATGGCCAACTGCCAAATAG -3, that is, SEQ ID NO

: 1 as the upstream primer, select 5'-

GGCGGCCGCTTAAGGACTCGGGTCAAATGC -3, i.e. SEQ ID

NO: 2 as the downstream primer, and then synthesize the upstream primer and the downstream primer;

B) Obtaining the SelP gene cDNA sequence: Use the upstream primer and the downstream primer to perform PCR amplification to obtain a large number of SelP gene coding sequences, then perform an A-tailing reaction on the sequence, and then connect it to pGM using T4 DNA ligase Obtain the ligation product on the -T vector, transform the ligation product into competent E. coli ToplO, spread it evenly on an LB medium plate containing ampicillin, pick out positive single clone colonies, culture and preserve the bacterial liquid, and perform preliminary PCR identification. The preliminary identification results indicate that the SelP gene cDNA sequence was successfully inserted into the bacterial liquid for sequencing and identification; use liquid LB medium to culture and sequence the correct E. coli, and extract Extract the pGM-T vector containing the cDNA sequence of the SelP gene, double-digest it with the restriction endonuclease Spe I enzyme and Not I enzyme, and recover 2500 by electrophoresis and gel cutting.

A fragment of about bp, this fragment is the SelP gene cDNA sequence;

C)

Construction and identification of lentiviral vectors that specifically promote the high expression of the SelP gene: Extract the plasmid pLV T4 DNA

Ligase connects the SelP gene cDNA sequence to the pLVX-IRES-Puro expression vector to obtain a ligation product. The ligation product is transformed into competent E. coli ToplO, and evenly spread on an LB medium plate containing ampicillin, and picks Collect positive single clone colonies, culture and preserve the bacterial liquid and perform preliminary PCR identification. The preliminary identification results indicate that the SelP gene cDNA sequence has been successfully inserted into the bacterial liquid for sequencing identification; Extraction of lentiviral vector that specifically promotes high expression of the SelP gene: The sequencing results It was confirmed that the SelP gene cDNA sequence was successfully inserted into the bacterial liquid amplification culture, and the recombinant plasmid was extracted to obtain a lentiviral expression vector that specifically promotes the high expression of the SelP gene.

[Claim 4] Use of the lentiviral expression vector that specifically promotes high expression of the SelP gene according to any one of claims 1 to 3 in the preparation of drugs for the treatment of diseases related to abnormal expression of the SelP gene.