WO2017214831A1

WO2017214831A1 - Lentiviral vector for specifically promoting high expression of nrg1 gene, and applications thereof

Info

Publication number: WO2017214831A1
Application number: PCT/CN2016/085636
Authority: WO
Inventors: 石庆学
Original assignee: 石庆学
Priority date: 2016-06-14
Filing date: 2016-06-14
Publication date: 2017-12-21

Abstract

Provided is a lentiviral expression vector for specifically promoting high expression of an NRG1 gene, comprising a fundamental sequence, a resistance gene sequence, a multiple-cloning-sites sequence, a promoter sequence, and an NRG1 gene cDNA sequence of a pLVX-IRES-puro expression vector. The multiple cloning sites comprise an EcoR I enzyme cutting site and an Not I enzyme cutting site, the NRG1 gene cDNA sequence comprises an EcoR I enzyme cutting site, an NRG1 gene coding sequence and an Not I enzyme cutting site, and the NRG1 gene cDNA sequence is forwardly inserted into the multiple-cloning-sites sequence. The lentiviral expression vector can be used in the preparation of drugs related to NRG1.

Description

Lentiviral vector for specifically promoting high expression of NRGI gene and application thereof

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a lentiviral vector which specifically promotes high expression of the NRG1 gene, and a construction method and application thereof.

Background technique

[0002] Schizophrenia is a serious mental illness that affects 1% of the total population. However, its pathogenesis is still unclear. Recently, genetic studies have determined that neuregulin l (NRGl) is a susceptibility gene for schizophrenia. NRG1 is a group of growth factors containing EGF-like domains whose shared EGF domain activates the tyrosine kinase activity of its receptor ERBB. All NRG1 share a common EGF-like domain located in the extracellular domain near the transmembrane segment. The EGF-like domain is an essential structure for activating the NRGI receptor ERBB, and only the EGF-like domain is sufficient to activate ErbB tyrosine kinase activity. Transgenic mice with mutations in structures other than the EGF-like domain have completely unused neurodevelopmental changes, suggesting that different subtypes of NRGI isoforms have different physiological functions, in particular, by different initiations that may exist The specific N-terminal sequence expressed by the sub-driver may have a bizarre function.

technical problem

[0003] NRG1 is associated with schizophrenia, and thus it is expected that a certain intervention effect on schizophrenia may be exerted by regulating the expression level of NRG1, but the relationship between the expression level of NRG1 and schizophrenia remains to be studied, and in the prior art, Lack of a lentiviral expression vector that specifically promotes high expression of the NRG1 gene is not conducive to the development of related research.

Problem solution

Technical solution

[0004] In order to solve the problems existing in the prior art, the inventors conducted extensive research on the selection of vectors, the method of recombinant construction, and the like, and found that the EcoR I cleavage site and Not are included.

The NRG 1 gene cDNA sequence of the I cleavage site was inserted into the multiple cloning site of the pLVX-IRES-Puro expression vector to construct a lentiviral expression vector which specifically promotes the high expression of the NRG1 gene, thereby completing the present invention.

The present invention provides a lentiviral expression vector that specifically promotes high expression of the NRG1 gene, including pLVX-IRE The basic sequence of the S-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and the N RG1 gene cDNA sequence; the multiple cloning site includes the EcoR I cleavage site and the Not I cleavage site The NRG1 gene cDNA sequence comprises an EcoR I restriction site, a NRG1 gene coding sequence and a Not I restriction site, and the NRG1 gene cDNA sequence is inserted into the multiple cloning site sequence.

[0006] According to the above technical solution, the lentiviral expression vector constructed by inserting the cDNA sequence of the NRG1 gene into the pLVX-IRES-Puro expression vector has high transfection efficiency and low dosage, and can stably, efficiently and stably increase NRG1. The advantages of gene expression can be used as a powerful tool in the preparation and treatment of NRG1 gene expression for diseases such as Alzheimer's disease.

[0007] As a further improvement of the present invention, the NRG1 gene coding sequence is obtained by PCR amplification, and the PCR primer comprises an upstream primer and a downstream primer, and the sequence of the upstream primer is: 5'-GGAATTCATGGGGAAAGGACGCGCGGGC-3, ie, SEQ ID NO: 1, the sequence of the downstream primer is: 5, - AGCGGCCGCTTATACAGCAATAGGGTCTTGG -3, ie SEQ ID NO: 2. Using the above PCR primer sequence, the NRG1 gene coding sequence can be amplified by PCR, and can be successfully inserted into the pLVX-IRES-Puro expression vector to continuously express the NRG1 gene, which reduces the cost of sequence synthesis and lowers the cost.

Correspondingly, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the NRG1 gene, comprising the following steps:

[0009] A) NRG1 gene primer design: According to the NRG1 gene coding sequence, using Oligo 7 analysis, select 5'-GGAATTCATGGGGAAAGGACGCGCGGGC-3, ie, SEQ ID NO: 1 as the upstream primer, select 5, - AGCGGCCGCTTATACAGCAATAGGGTCTTGG-3, gPSEQ ID NO

: 2 as a downstream primer, and then synthesizing the upstream primer and the downstream primer; the upstream primer and the downstream primer have no primer dimer, and the annealing temperature difference is small;

[0010] B) obtaining the cDNA sequence of the NRG1 gene: PCR amplification using the upstream primer and the downstream primer to obtain a large number of NRG1 gene coding sequences, and then adding the A tail reaction to the sequence, using T4 DNA ligase The ligation product is obtained by ligation to the pGM-T vector, and the ligation product is transformed into competent E. coli ToplO, uniformly coated on an ampicillin-containing LB medium plate, and the positive monoclonal colony culture preservation liquid is picked and subjected to PCR. Preliminary identification, the preliminary identification results indicate that the NRG1 gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification; the correct E. coli was identified by liquid LB medium culture sequencing. And extract the pGM-T vector carrying the cDNA sequence of NRG1 gene, using restriction endonuclease EcoR

I enzyme and Not I enzyme double digestion, electrophoresis, gelatinization recovery of about 2000 bp fragment, this fragment is the NRG1 gene cDNA sequence;

[0011] C) Construction and identification of a lentiviral vector that specifically promotes high expression of the NRG1 gene: extraction of the plasmid pLVX-IR ES-Puro, digestion with restriction endonuclease EcoR I enzyme and Not I enzyme, electrophoresis, gelation The vector was recovered, and the NRG1 gene cDNA sequence was ligated into the pLVX-IRES-Puro expression vector using T4 DNA ligase.

The ligation product is obtained, and the ligation product is transformed into competent E. coli ToplO, uniformly coated on an ampicillin-containing LB medium plate, and the positive monoclonal colony culture preservation liquid is picked and subjected to preliminary identification by PCR, and preliminary identification is performed. The results indicated that the cDNA sequence of NRG1 gene was successfully inserted into the bacterial cell for sequencing.

[0012] D) Extraction of a lentiviral vector that specifically promotes high expression of the NRG1 gene: The sequencing result confirms that the cDNA sequence of the NRG1 gene is inserted into a successful bacterial cell expansion culture, and the recombinant plasmid is extracted to obtain a specific N RG1 gene. Expressed lentiviral expression vector.

[0013] The present invention utilizes genetic engineering technology to construct a lentiviral expression vector which specifically promotes high expression of NRG1 gene, and after successful identification, is packaged into a virus and transduced into HEB cells, and after puromycin is used to screen cells, real-time quantitative PCR is used. The Western Blot technique verified the change of NRG1 gene expression from mRNA and protein levels, respectively. The experimental results confirmed that the NRG1 gene cDNA sequence provided by the present invention was successfully inserted into the pLVX-I RES-Puro expression vector, and can be specifically, continuously, efficiently and stably promoted. The NRG1 gene is highly expressed.

The present invention also provides the use of a lentiviral expression vector which specifically promotes high expression of the NRG1 gene for the preparation of a medicament for treating a disease associated with abnormal expression of a NRG1 gene.

Advantageous effects of the invention

Beneficial effect

The lentiviral expression vector which specifically promotes the high expression of the NRG1 gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, efficient and stable promotion of high expression of the NRG1 gene, and can be used as a powerful tool. In the drug research and development related to NRG1; the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the NRG1 gene, which has a good operation effect, reduces the cost of sequence synthesis, and has a low cost.

Brief description of the drawing DRAWINGS

1 is a plasmid map of the pLVX-IRES-Puro expression vector.

2 is a schematic diagram showing the results of fluorescent quantitative PCR detection after puromycin screening of cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0019] HEB cells were purchased from the Cell Resource Center of Shanghai Institute of Biological Sciences, and 293FT cells were purchased from Thermo Fisher, Premix PrimeSTAR HS enzyme, lentiviral expression vector pLVX-IRES-Puro, virus packaging auxiliary kit, and Lenti-X GoStix kit. Purchased from Takara, RNeasy Mini

Kit was purchased from QIAGEN, pGM-T was purchased from Tiangen, and Endo-Free Plasmid Mini Kit II was purchased from Omega bio-tek.

Example 1 Design of NRG1 gene primers.

[0021] According to the NRG1 gene coding sequence (GenBank NM_001159995.2), it was analyzed using 01igo7 to find upstream primers and downstream primers (requires as little primer-free dimer as possible and the annealing temperature difference is small), then upstream primers and The protective base and the restriction sites EcoR I and EcoR I were added to the 5' end of the downstream primer, respectively, and the designed primer sequences are shown in Table 1. The designed PCR primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

Table 1 PCR primer sequences of the NRG1 gene

[] [Table 1]

Example 2 Construction of a lentiviral vector that specifically promotes high expression of the NRG1 gene

[0024] After diluting the synthetic antibody, the coding sequence of the NRG1 gene was amplified by Premix PrimeSTAR HS enzyme, and then electrophoresed and then subjected to A tail reaction, and then ligated to pGM-T with T4 DNA ligase. The ligation product (NRG1-T vector) was obtained on the vector, and the ligation product was transformed into competent E. coli To plO, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. Negative control group 1 (consistent cells were uniformly coated on ampicillin-free plates), negative control group 2 (peripheral cells were uniformly coated in 100)

g/ml ampicillin on the plate), positive control group 1 (the connection product of the double enzyme-cut empty vector was evenly coated in 100

g/ml ampicillin on the plate), positive control group 2 (the empty carrier was evenly spread on a plate containing 100 g/mL ampicillin). The experimental group grew a single colony, the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, the positive control group 2 did not grow colonies.

[0025] After picking up 8 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of NRG1 gene for preliminary identification. The results showed that the cultures of 8 single colonies could be successfully amplified. The NRG 1 gene was released, and the recombinant vector was sent to Shanghai Biotech Co., Ltd. for sequencing.

[0026] The bacteria with the correct sequencing result were cultured in liquid LB medium for 14 h, and then the recombinant T vector containing the NRG1 gene sequence was extracted, and the pLVX-IRES-Puro vector was firstly used with EcoR I enzyme and Not I, respectively. The enzyme was double-digested, electrophoresed and recovered, and the product was recovered by T4 DNA ligase, and then transformed into competent E. coli ToplO, uniformly coated on ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. The negative control group 1 was set up (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated on the plate containing 100 g/ml ampicillin), Positive control group 1 (the ligation product of the double enzyme-cut empty vector was uniformly coated on a plate containing 100 g/ml ampicillin), positive control group 2 (the empty vector was uniformly coated on 100 g/mL ampicillin) On the tablet). The experimental group grew a single colony, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, and the positive control group 2 did not grow colonies.

[0027] After picking up 6 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of NRG1 gene for preliminary identification. The results showed that all the 6 culture broths could successfully amplify the NRG1 gene, and then the recombinant vector broth was sent to Shanghai Biotech Co., Ltd. for sequencing, and the sequencing results were exactly as expected, and the pLVX-NRG1 plasmid was obtained.

[0028] The previously collected recombinant plasmid bacterial solution was taken out, inoculated into 15 ml of LB medium (containing 100 g/ml ampicillin), cultured at 37 ° C, 300 rpm for 16 h, using Endo-Free Plasmid Mini Kit II get on Table 2 Purification and Concentration of Recombinant Plasmid

[] [Table 2]

[0030] Example 3 Lentiviral Packaging

[0031] 293FT cells were cultured, and cells with good growth state were inoculated into six wells, 1,000,000 cells per well, and the extracted recombinant plasmid pLVX-NRG1 2μ _§ was transfected into 293FT cells using a lentiviral packaging auxiliary kit. After 48 h, the virus-containing supernatant medium was collected, and the virus solution was filtered through a 0.45 μηι filter for infection of sputum cells, and the Lenti-X GoStix kit was used to detect the virus titer of 5,000,000 to 50000000 IFU.

Example 4 Lentiviral transduction of HEB cells

[0033] HEB cells were inoculated into 6-well plates at 1000000 cells per well. After 12 hours, the cell density was about 50<3⁄4, and the virus solution was taken separately. The virus was diluted 10 times with DMEM complete medium, and polybrene was added. ) The final concentration is 8 g/mL. The medium in the 6-well plate was added to the virus-containing DMEM complete medium (containing 10% fetal bovine serum). After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.00 g/ml.

Example 5 Fluorescence quantitative PCR was used to detect the expression level of NRG1 gene.

[0035] According to the GAPDH and NRG1 gene mRNA sequences, the primer design software Oligo 7.0 was used to design the bow.

[] [table 3]

HEB cells, pLVX empty vector control HEB cells, and pLVX-NRG1 high expressing cells were inoculated separately. 6-well plate. Cell density reached 80<3⁄4-90<3⁄4吋, total RNA was extracted from each group with RNeasy Mini Kit, and PrimeScrip RT reagent was used for He ¹ J.

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of the reverse transcription, add 9 (L RNase Free dH20 diluted cDNA, and store at -20 °C for later detection. Take the cDNA of each group of cells.

Ιμΐ was used as a template, GAPDH was used as an internal reference, and the relative expression of NRG1 was detected by real-time quantitative PCR (QPCR). The reaction conditions were set: 95. C 30s, 1 cycle, 54°C 30s 40 cycles, 95. C 5s, 60. C lmin, 95 ° C for 15 s, the relative expression of NRG1 gene in each group was detected by SYBR Primescript RT-PCR Kit. After the pLVX-NRG1 cells were continuously cultured for 20 passages, the above experiment was repeated. The summarized results are shown in Figure 2. It can be seen that the expression of NRG1 gene is more than 210-fold higher than that of HEB cells, whether it is just after screening or after 20 generations of pLVX-NRG1 cells, and the expression of NRG1 gene in pLVX empty vector cells. There is almost no change compared with HEB cells, indicating that the NRG 1 gene cDNA sequence provided by the present invention is successfully inserted into the pLVX-IRES-Puro expression vector, and can promote the high expression of NRG1 gene specifically, continuously, efficiently and stably.

[0037] The above is a further detailed description of the present invention in conjunction with the specific preferred embodiments. It is not intended that the specific embodiments of the invention are limited to the description. It will be apparent to those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the invention.

Industrial applicability

The lentiviral expression vector which specifically promotes the high expression of the NRG1 gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, high-efficiency and stable promotion of high expression of the NRG1 gene, and can be used as a powerful tool. In drug research and development related to NRG1; the present invention also provides specific promotion of NRG

The method for constructing a lentiviral expression vector with high expression of 1 gene has good operation effect, reduces the cost of sequence synthesis, and has low cost.

Claims

claims

[Claim 1] A lentiviral expression vector that specifically promotes high expression of the NRG1 gene, characterized by: including the basic sequence of the pLVX-IRES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and The NRG1 gene cDNA sequence is ij; the multiple cloning site includes an EcoR I enzyme cut site and a Not I enzyme cut site, and the NRG1 gene cDNA sequence includes an EcoR I enzyme cut site, the NRG1 gene coding sequence and the Not I enzyme cut site.

I enzyme cutting site, the NRG1 gene cDNA sequence is inserted into the multiple cloning site sequence in the forward direction.

[Claim 2] The lentiviral expression vector specifically promoting the high expression of NRG1 gene according to claim 1

, which is characterized in that: the NRG1 gene coding sequence is obtained by PCR amplification, the PCR primer includes an upstream primer and a downstream primer, the sequence of the upstream primer is: 5'-GGAATTCATGGGGAAAGGACGCGCGGGC-3', that is, SEQ ID NO: 1, so The sequence of the downstream primer is: 5'-

AGCGGCCGCTTATACAGCAATAGGGTCTTGG -3', i.e. SEQ ID NO

: 2.

[Claim 3] The construction method of a lentiviral expression vector that specifically promotes high expression of NRG1 gene according to claim 2, characterized in that: comprising the following steps:

A) NRG1 gene primer design: According to the NRG1 gene coding sequence, use Oligo 7 to analyze and select 5, - GGAATTCATGGGGAAAGGACGCGCGGGC

-3,, that is, SEQ ID NO: 1 as the upstream primer, select 5, -

AGCGGCCGCTTATACAGCAATAGGGTCTTGG -3', i.e. SEQ ID NO

: 2 as the downstream primer, and then synthesize the upstream primer and the downstream primer;

B) Obtaining the NRG1 gene cDNA sequence: Use the upstream primer and the downstream primer to perform PCR amplification to obtain a large number of NRG1 gene coding sequences, and then perform an A-tailing reaction on the sequence, and then connect it to pGM using T4 DNA ligase Obtain the ligation product on the -T vector, transform the ligation product into competent E. coli ToplO, spread it evenly on an LB medium plate containing ampicillin, pick out positive single clone colonies, culture and preserve the bacterial liquid, and conduct preliminary PCR identification , the preliminary identification results showed that the NRG1 gene cDNA sequence was successfully inserted into the bacteria. liquid for sequencing identification; use liquid LB medium to culture and sequence the correct Escherichia coli, extract the pGM-T vector containing the NRG1 gene cDNA sequence, and double-digest it with the restriction endonuclease E coR I enzyme and Not 1 enzyme. , perform electrophoresis and gel cutting to recover a fragment of about 2000 bp, which is the NRG1 gene cDNA sequence;

C) Construction and identification of lentiviral vectors that specifically promote high expression of the NRG1 gene: Extract the plasmid pLVX-IRES-Puro, double-digest it with the restriction endonuclease EcoR I enzyme and Not I enzyme, electrophoresis, and gel cutting to recover the vector, and then Use T4 DNA ligase to connect the NRG1 gene cDNA sequence into the pLVX-IRES-Puro expression vector to obtain a ligation product, transform the ligation product into competent E. coli ToplO, and spread it evenly onto an LB medium plate containing ampicillin On the top, select positive single clone colonies, culture and preserve the bacterial liquid and perform preliminary PCR identification. The preliminary identification results indicate that the NRG1 gene cDNA sequence is successfully inserted into the bacterial liquid for sequencing identification;

D) Extraction of lentiviral vectors that specifically promote the high expression of the NRG1 gene: The sequencing results confirm that the NRG1 gene cDNA sequence has been successfully inserted into the bacterial liquid amplification culture, and the recombinant plasmid is extracted to obtain a lentivirus that specifically promotes the high expression of the NRG1 gene. Expression vector.

[Claim 4] Use of a lentiviral expression vector that specifically promotes high expression of the NRG1 gene according to any one of claims 1 to 3 in the preparation of drugs for the treatment of diseases related to abnormal NRG1 gene expression