WO2017214938A1

WO2017214938A1 - Lentiviral expression vector for specifically promoting high expression of bace1 gene, and applications thereof

Info

Publication number: WO2017214938A1
Application number: PCT/CN2016/086062
Authority: WO
Inventors: 毛侃琅
Original assignee: 毛侃琅
Priority date: 2016-06-16
Filing date: 2016-06-16
Publication date: 2017-12-21

Abstract

A lentiviral expression vector for specifically promoting high expression of a BACE1 gene comprises a fundamental sequence, a resistance gene sequence, a multiple-cloning-sites sequence, a promoter sequence, and a BACE1 gene cDNA sequence of a pLVX-IRES-puro expression vector. The multiple cloning sites comprise an EcoR I enzyme cutting site and an Spe I enzyme cutting site, the BACE1 gene cDNA sequence comprises an EcoR I enzyme cutting site, a BACE1 gene coding sequence and an Spe I enzyme cutting site, and the BACE1 gene cDNA sequence is forwardly inserted into the multiple-cloning-sites sequence. The lentiviral expression vector has the advantages of high transfection efficiency and small usage and being capable of specifically, continuously, efficiently and stably expressing the BACE1 gene, and can serve as a powerful tool applied to the research and development of drugs related to BACE1.

Description

Lentiviral expression vector for specifically promoting high expression of B ACE1 gene and application thereof

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a lentiviral expression vector and application thereof which specifically promotes high expression of the BACE1 gene.

Background technique

[0002] Alzheimer's disease (AD) is the most common cause of senile dementia

. This disease is common in the elderly. It is a central nervous system degenerative degenerative disease with progressive cognitive impairment and memory impairment. The clinical manifestations are the deterioration of cognitive and memory functions, the progressive decline of daily living ability, and Various neuropsychiatric symptoms and behavioral disorders. More onset in the old age, latent onset, slow and irreversible, clinically based on intelligent damage.

technical problem

[0003] The current underlying cause of Alzheimer's disease is still not fully understood, but a large amount of data confirms that it is associated with the toxic damage to nerve cells caused by the production and accumulation of β-amyloid. Β-amyloid is formed by the activity of several enzymes, including an enzyme called pre-beta-degrading enzyme 1 (BACE1). The survey data show that the level of BACE1 is elevated in most patients with Alzheimer's disease, which in turn leads to more brain damage β-amyloid aggregation, making Alzheimer's disease more serious, so The role of BACE1 in Alzheimer's disease and its research as a therapeutic target are still indispensable, and the lentiviral expression vectors specifically required to promote the high expression of BACE1 gene required for these related studies are still lacking in the prior art.

Problem solution

Technical solution

[0004] In order to solve the problems existing in the prior art, the inventors conducted extensive research on the selection of vectors, recombinant construction methods, and the like, and found that BACE1 containing an EcoR I cleavage site and a Spe I restriction site. The gene cDNA sequence was inserted into the multiple cloning site of the pLVX-IRES-Puro expression vector to construct a lentiviral expression vector which specifically promotes high expression of the BACE1 gene, thereby completing the present invention.

The present invention provides a lentiviral expression vector which specifically promotes high expression of the BACE1 gene, including pLVX-IR The basic sequence of the ES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and the BACE1 gene cDNA sequence; the multiple cloning site comprises an EcoR I cleavage site and a Spe I cleavage site, The BACE1 gene cDNA sequence comprises an EcoR I restriction site, a BACE1 gene coding sequence and a Spe I restriction site, and the BACE1 gene cDNA sequence is inserted into the multiple cloning site sequence.

[0006] According to the above technical solution, the lentiviral expression vector constructed by inserting the BACE1 gene cDNA sequence into the pLVX-IRES-Puro expression vector has high transfection efficiency and low dosage, and can stably, efficiently and stably increase BACE1. The advantages of gene expression can be used as a powerful tool in the preparation and treatment of drugs for the treatment of BACE1 gene expression in diseases such as Alzheimer's disease.

[0007] As a further improvement of the present invention, the BACE1 gene coding sequence is obtained by PCR amplification, and the PCR primer comprises an upstream primer and a downstream primer, and the sequence of the upstream primer is: 5'-GCGAATTCATGGTTCCCTTCATCTATCTG -3', ie SEQ ID NO: 1, the sequence of the downstream primer is: 5, - AACTAGTTCACTTCAGCAGGGAGATGTC -3, ie SEQ ID NO: 2. Using the above PCR primer sequence, the BACE1 gene coding sequence can be amplified by PCR and successfully inserted into the pLVX-IRES-Puro expression vector to continuously express the BACE1 gene, which reduces the cost of sequence synthesis and lowers the cost.

Correspondingly, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the BACE1 gene, comprising the following steps:

[0009] A) BACE1 gene primer design: According to the BACE1 gene coding sequence, using Oligo 7 analysis, select 5, -GCGAATTCATGGTTCCCTTCATCTATCTG -3, ie SEQ ID NO: 1 as the upstream arch, select 5,- AACTAGTTCACTTCAGCAGGGAGATGTC -3' , ie SEQ ID

NO: 2 is used as a downstream primer, and then the upstream primer and the downstream primer are synthesized; the upstream primer and the downstream primer have no primer dimer, and the annealing temperature difference is small;

[0010] B) obtaining the BACE1 gene cDNA sequence: PCR amplification using the upstream primer and the downstream primer to obtain a large number of BACE1 gene coding sequences, and then adding the A tail reaction to the sequence, using T4 DNA ligase The ligation product was obtained by ligating to the pGM-T vector, and the ligation product was transformed into competent E. coli DH50C, uniformly coated on an ampicillin-containing LB medium plate, and the positive monoclonal colony culture preservation liquid was picked and subjected to PCR. Preliminary identification, the preliminary identification results indicate that the BACE1 gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification; the liquid colony was cultured and sequenced to identify the correct colorectal rod. The pGM-T vector carrying the BACE1 gene cDNA sequence was extracted and digested with the restriction enzyme EcoR I enzyme and Spe l enzyme, and the fragment of about 1000 bp was recovered by electrophoresis and gel-cutting. This fragment is BACE1. Gene cDNA sequence;

[0011] C)

Construction and identification of a lentiviral vector that specifically promotes high expression of BACE1 gene: The plasmid pLVX-IRES-Puro was extracted, digested with restriction endonuclease EcoR I enzyme and Spe l enzyme, electrophoresis, gel-removed vector, and T4 DNA ligase The BACE1 gene cDNA sequence was ligated into the ajpLVX-IRES-Puro expression vector to obtain a ligation product, which was transformed into competent E. coli DH50C and uniformly coated onto an ampicillin-containing LB medium plate. The positive monoclonal colonies were cultured and preserved, and the PCR was initially identified. The preliminary identification results indicated that the BACE1 gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification; [0012] D)

Extraction of lentiviral vector that specifically promotes high expression of BACE1 gene: The sequencing result confirmed that the BACE1 gene c-DNA sequence was inserted into the successful bacterial cell expansion culture, and the recombinant plasmid was extracted to obtain a lentivirus specifically promoting the high expression of BACE 1 gene. Expression vector.

[0013] The present invention utilizes genetic engineering technology to construct a lentiviral expression vector which specifically promotes high expression of BACE1 gene, and after being successfully constructed, it is packaged into a virus and introduced into RGC5 cells, and the cells are selected by puromycin, and then real-time quantitative PCR is used. Western Blot technology verified the change of BACE1 gene expression from mRNA and protein levels respectively. The experimental results showed that the BACE1 gene cDNA sequence provided by the present invention was successfully inserted into the pLV X-IRES-Puro expression vector, which can promote specifically, continuously, efficiently and stably. High expression of BACE1 gene

The present invention also provides a lentiviral expression vector which specifically promotes high expression of the BACE1 gene in the preparation of a therapeutic BACE

1 Use of a drug for a gene-related abnormality-related disease.

Advantageous effects of the invention

Beneficial effect

The lentiviral expression vector which specifically promotes the high expression of BACE1 gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, high efficiency and stable promotion of high expression of BACE1 gene, and can be used as a powerful tool. In the drug research and development related to BACE1; the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of B ACE1 gene, which has good operation effect and reduced sequence synthesis. Cost, lower cost.

Brief description of the drawing

DRAWINGS

1 is a plasmid map of the pLVX-IRES-Puro expression vector.

2 is a schematic diagram showing the results of fluorescent quantitative PCR detection after puromycin screening of cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0019] RGC5 cells were purchased from the Cell Resource Center of Shanghai Institute of Biological Sciences, and 293FT cells were purchased from Thermo Fisher, Premix PrimeSTAR HS enzyme, lentiviral expression vector pLVX-IRES-Puro, virus packaging auxiliary kit, and Lenti-X GoStix kit. Purchased from Takara, RNeasy Mini

Kit was purchased from QIAGEN, pGM-T was purchased from Tiangen, and Endo-Free Plasmid Mini Kit II was purchased from Omega bio-tek.

Example 1 Design of BACE1 Gene Primers.

[0021] According to the BACE1 gene coding sequence (GenBank NM_001207048.1), it was analyzed using 01igo7 to find upstream primers and downstream primers (requiring as little primer-free dimer as possible and the annealing temperature difference is small), then upstream primers and The protective base and the restriction sites EcoR I and Spe l were added to the 5' end of the downstream primer, respectively, and the designed primer sequences are shown in Table 1. The designed PCR primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

Table 1 PCR primer sequences of the BACE1 gene

[] [Table 1]

[0023] Example 2 Construction of a lentiviral vector that specifically promotes high expression of BACE1 gene

[0024] After diluting the synthetic antibody, the coding sequence of the BACE1 gene was sequenced with Premix PrimeSTAR HS enzyme. Amplification, electrophoresis recovery and then adding A tail reaction, using T4

The DNA ligase was ligated to the pGM-T vector to obtain the ligation product (BACE1-T vector), and the ligation product was transformed into competent E. coli DH5CC and uniformly coated on an ampicillin-containing LB medium plate at 37 ° C. After 12 h of culture, the negative control group 1 was set up (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated with 100 g/ml ampicillin). On the plate), positive control group 1 (the connection product of the double enzyme-cut empty vector was uniformly coated on the plate containing 100 g/ml ampicillin), positive control group 2 (the empty carrier was uniformly coated in 100 g/ mL of ampicillin on the plate). The experimental group grew a single colony, the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, the positive control group 2 did not grow colonies.

[0025] After picking up 8 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of BACE1 gene for preliminary identification. The results showed that the cultures of 8 single colonies could be successfully amplified. The CE1 gene was exported, and the recombinant vector was sent to Shanghai Biotech Co., Ltd. for sequencing.

[0026] The bacteria with the correct sequencing result were cultured in liquid LB medium for 14 h, and then the recombinant T vector containing the BACE1 gene sequence was extracted, and the pLVX-IRES-Puro vector was firstly used with EcoR I enzyme and Spe I, respectively. The enzyme was double-digested, electrophoresed and recovered, and the product was recovered by T4 DNA ligase, and then transformed into competent E. coli DH50C, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C for 12 h. The negative control group 1 was set up (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated on the plate containing 100 g/ml ampicillin), Positive control group 1 (the ligation product of the double enzyme-cut empty vector was uniformly coated on a plate containing 100 g/ml ampicillin), positive control group 2 (the empty vector was uniformly coated on 100 g/mL ampicillin) On the tablet). The experimental group grew a single colony, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, and the positive control group 2 did not grow colonies.

[0027] After picking up 6 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of BACE1 gene for preliminary identification. The results showed that all 6 cultures could successfully amplify the BACE1 gene, and then the recombinant vector was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were exactly as expected, and the pLVX-BACE1 plasmid was obtained.

[0028] The previously collected recombinant plasmid bacterial solution was taken out, inoculated into 15 ml of LB medium (containing 100 g/ml ampicillin), cultured at 37 ° C, 300 rpm for 16 h, using Endo-Free Plasmid Mini Kit II get on The recombinant plasmid pLVX-BACE1 was extracted and its purity and concentration were measured. The results are shown in Table 2.

[0029] Table 2 recombinant plasmid purity and concentration

[] [Table 2]

[0031] 293FT cells were cultured, and cells grown in good condition were inoculated into six wells, 1,000,000 cells per well, and the extracted recombinant plasmid pLVX-BACE1 2μ _§ was transfected into 293FT cells using a lentiviral packaging auxiliary kit. After 48 h, the virus-containing supernatant medium was collected, and the virus solution was filtered through a 0.45 μm sieve for infection of RG C5 cells, and the Lenti-X GoStix kit was used to detect a virus titer of 5,000,000 to 50,000,000 IFU.

Example 4 Lentiviral transduction RGC5 cells

[0033] Inoculate RGC5 cells in a 6-well plate, 1000000 cells per well, and after 12h, the cell density is about 50<3⁄4, respectively, take the virus solution, dilute the virus with DMEM complete medium 10 times, and then add polybrene (polybrene). ) The final concentration is 8 g/mL. The medium in the 6-well plate was added to the virus-containing DMEM complete medium (containing 10% fetal bovine serum). After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.00 g/ml.

Example 5 Fluorescence quantitative PCR was used to detect the expression level of BACE1 gene.

[0035] According to the GAPDH and BACE1 gene mRNA sequences, the primer design software Oligo 7.0 was used to design the bow [1] [Table 3] Genes and primers Primer sequences (5, -3,)

GAPDH-F TCTGACTTCAACAGCGACACC

GAPDH-R CTGTTGCTGTAGCCAAATTCGT

BACE1-F CCTATGCTGAGATTGCCAGGC

BACE1-R CAGAGGCCAGCACTTCAGAC [0036] RGC5 cells, pLVX empty vector control RGC5 cell group, and pLVX-BACE1 high expressing cells were inoculated to a 6-well plate, respectively. Cell density reaches δΟ^^Ο^吋, with RNeasy Mini

Kit extracts total RNA from each group of cells, using PrimeScrip RT reagent

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of the reverse transcription, add 9 (L RNase Free dH20 diluted cDNA, and store at -20 °C for later detection. Take the cDNA of each group of cells.

Ιμΐ was used as a template, and GAPDH was used as an internal reference. Real-time quantitative PCR (QPCR) was used to detect the relative expression of BACE1, and the reaction conditions were set: 95. C 30s, 1 cycle, 54. C 30s 40 cycles, 95. C 5s, 60 ° C lmin , 95 ° C 15 s, using SYBR Primescript RT-PCR Kit to detect the relative expression of BACE1 gene in each group of cells. After the pLVX-BACE1 cells were continuously cultured for 20 passages, the above experiment was repeated. The summarized results are shown in Figure 2. It can be seen that the expression level of BACE1 gene is about 200-fold higher than that of RGC5 cells, whether it is just after screening or after 20 generations of pLVX-BACE1 cells, and the BACE1 gene expression level of pLVX empty vector cells. There is almost no change compared with RGC5 cells, indicating that the B ACE1 gene cDNA sequence provided by the present invention is successfully inserted into the pLVX-IRES-Puro expression vector, and can specifically, stably, efficiently and stably promote the high expression of BACE1 gene.

[0037] The above is a further detailed description of the present invention in conjunction with the specific preferred embodiments. It is not intended that the specific embodiments of the invention are limited to the description. It will be apparent to those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the invention.

Industrial applicability

The lentiviral expression vector which specifically promotes the high expression of BACE1 gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, high efficiency and stable promotion of high expression of BACE1 gene, and can be used as a powerful tool. In the drug research and development related to BACE1, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the B ACE1 gene, which has a good operation effect, reduces the cost of sequence synthesis, and has a low cost.

Claims

claims

[Claim 1] A lentiviral expression vector that specifically promotes high expression of the BACE1 gene, characterized by: including the basic sequence of the pLVX-IRES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and BACE1 gene cDNA sequence; the multiple cloning site includes EcoR I restriction site and Spe

I enzyme cleavage site, the BACE1 gene cDNA sequence includes EcoR I enzyme cleavage site, BACE1 gene coding sequence and Spe I enzyme cleavage site, and the BACE1 gene cDNA sequence is inserted into the multiple cloning site sequence in the forward direction.

[Claim 2] The lentiviral expression vector specifically promoting the high expression of BACE1 gene according to claim 1

, which is characterized in that: the BACE1 gene coding sequence is obtained by PCR amplification, the PCR primer includes an upstream primer and a downstream primer, the sequence of the upstream primer is: 5'- GCGAATTCATGGTTCCCTTCATCTATCG -3, that is, SEQ ID NO: 1, so The sequence of the downstream primer is: 5'-

AACTAGTTCACTTCAGCAGGGAGATGTC -3, i.e. SEQ ID NO: 2.

[Claim 3] The construction method of a lentiviral expression vector that specifically promotes high expression of BACE1 gene according to claim 2, characterized in that: comprising the following steps:

A) BACE1 gene primer design: According to the BACE1 gene coding sequence, use Oligo 7 to analyze and select 5, - GCGAATTCATGGTTCCCTTCATCTATCG -3', that is, SEQ ID NO: 1 as the upstream primer, select 5'-

AACTAGTTCACTTCAGCAGGGAGATGTC-3, that is, SEQ ID NO: 2 as the downstream primer, and then the upstream primer and the downstream primer are synthesized;

B) Obtaining the BACE1 gene cDNA sequence: Use the upstream primer and the downstream primer to perform PCR amplification to obtain a large number of BACE1 gene coding sequences, and then perform an A-tailing reaction on the sequence, and then connect it to pGM using T4 DNA ligase Obtain the ligation product on the -T vector, transform the ligation product into competent E. coli DH50C, spread it evenly on an LB medium plate containing ampicillin, pick out positive single clone colonies, culture and preserve the bacterial liquid, and conduct preliminary PCR identification , the preliminary identification results showed that the BACE1 gene cDNA sequence was successfully inserted into the bacterial liquid for sequencing and identification; the liquid LB medium was used to culture and sequence the correct E. coli , and extract the pGM-T vector containing the BACE1 gene cDNA sequence, double-digest it with restriction endonuclease ISEcoR I enzyme and Spe I enzyme, perform electrophoresis and gel cutting to recover a fragment of about 1000 bp, which is the BACE1 gene cDNA sequence;

C) Construction and identification of a lentiviral vector that specifically promotes high expression of the BACE1 gene: Extract the plasmid pLVX-IRES-Puro, double-digest it with the restriction endonuclease EcoR I enzyme and Spe I enzyme, electrophoresis, and gel cutting to recover the vector, and then Use T4 DNA ligase to connect the BACE1 gene cDNA sequence into the pLVX-IRES-Puro expression vector to obtain a ligation product, transform the ligation product into competent E. coli DH50C, and spread it evenly onto an LB medium plate containing ampicillin On the top, select positive single clone colonies, culture and preserve the bacterial liquid and perform preliminary PCR identification. The preliminary identification results indicate that the BACE1 gene cDNA sequence is successfully inserted into the bacterial liquid for sequencing identification;

D) Extraction of lentiviral vectors that specifically promote the high expression of the BACE1 gene: The sequencing results confirm that the BACE1 gene cDNA sequence has been successfully inserted into the bacterial liquid amplification culture, and the recombinant plasmid is extracted to obtain the lentivirus that specifically promotes the high expression of the BACE1 gene. Expression vector.

[Claim 4] Use of the lentiviral expression vector that specifically promotes high expression of the BACE1 gene according to any one of claims 1 to 3 in the preparation of drugs for the treatment of diseases related to abnormal expression of the BACE1 gene.