WO2017214834A1

WO2017214834A1 - Lentiviral expression vector for specifically promoting high expression of ctla-4 gene, and applications thereof

Info

Publication number: WO2017214834A1
Application number: PCT/CN2016/085639
Authority: WO
Inventors: 石庆学
Original assignee: 石庆学
Priority date: 2016-06-14
Filing date: 2016-06-14
Publication date: 2017-12-21

Abstract

A lentiviral expression vector for specifically promoting high expression of a CTLA-4 gene comprises a fundamental sequence, a resistance gene sequence, a multiple-cloning-sites sequence, a promoter sequence, and a CTLA-4 gene cDNA sequence of a pLVX-IRES-puro expression vector. The multiple cloning sites comprise an EcoR I enzyme cutting site and an Spe I enzyme cutting site, the CTLA-4 gene cDNA sequence comprises an EcoR I enzyme cutting site, a CTLA-4 gene coding sequence and an Spe I enzyme cutting site, and the CTLA-4 gene cDNA sequence is forwardly inserted into the multiple-cloning-sites sequence. The lentiviral expression vector has the advantages of high transfection efficiency and small usage and being capable of specifically, continuously, efficiently and stably expressing the CTLA-4 gene, and can serve as a powerful tool applied to the research and development of drugs related to CTLA-4.

Description

Inventive name: lentiviral expression vector for specifically promoting high expression of CTL A-4 gene and application thereof

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a lentiviral expression vector which specifically promotes high expression of CTLA-4 gene, and a construction method and application thereof.

Background technique

[0002] The anti-tumor immune mechanism of the body includes both cellular immunity and humoral immunity, but the effector cells that play a major role in cellular immune mechanisms are T cells, among which CD8+ T cells are tumor immunity. The most important effect is the execution of cells. T cell activation requires dual signal recognition. The tumor antigen first binds to the MHC molecule on the antigen presenting cell or target cell, and then binds to the T lymphocyte surface antigen recognition receptor (TCR) to provide the first signal for T cell activation; T cell The surface CD28 binds to the antigen presenting cell surface or the target cell surface B7 molecule to provide a second signal. After double signal recognition, T cells are fully activated, and the activated T cells first self-proliferate, producing a large number of antigen-specific T cells, which migrate to the tumor to kill. Activated T cells upregulate the expression of negative regulatory molecules such as CTLA-4 2 to 3 days later.

technical problem

[0003] CTLA-4 is a transmembrane protein and belongs to the CD28 family. The ligand of CTLA-4 is a member of the B7 family, which competes with the CD28 molecule for binding to B7-1 and B7-2, inhibits the proliferation of activated T cells, and negatively regulates immunity. The affinity of CTLA-4 to B7 molecule is more than 20 times that of CD28. Under physiological conditions, it prevents over-amplification of immunity. The binding of CD28 or CTLA-4 to CD80/86 exerts a counteraction on the function of immune cells and plays a fine role in normal human body. The immune regulation plays a dynamic balance between health and disease. However, it is often used by tumor cells to achieve immune escape. Therefore, the study on the role of CTLA-4 in the development of tumors can promote the development of tumor therapy. However, the lack of lentiviral expression vectors that specifically promote the high expression of CTLA-4 gene in the prior art has hindered the progress of related research.

Problem solution

Technical solution

[0004] In order to solve the problems existing in the prior art, the inventor advances in the selection of the carrier, the method of reorganizing the construction, and the like. A large number of exploratory studies have been carried out. It is found that the CTLA-4 gene cDNA sequence containing the EcoR I restriction site and the Spe I restriction site can be inserted into the multiple cloning site of the pLVX-IRES-Puro expression vector to construct a specific CTLA. The lentiviral expression vector in which the -4 gene is highly expressed, thereby completing the present invention.

The present invention provides a lentiviral expression vector which specifically promotes high expression of the CTLA-4 gene, including the basic sequence of the pLVX-I RES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, the promoter sequence and CTLA-4 gene cDNA sequence; the multiple cloning site includes an EcoR I cleavage site and a Spe I cleavage site, and the CTLA-4 gene cDNA sequence includes an EcoR I cleavage site and a CTLA-4 gene coding sequence. And the Spe I restriction site, the CTLA-4 gene cDNA sequence is inserted into the multiple cloning site sequence.

[0006] According to the above technical solution, the lentiviral expression vector constructed by inserting the CTLA-4 gene cDNA sequence of the present invention into the pLVX-IRES-Pur o expression vector has high transfection efficiency, low dosage, sustainable, high efficiency and stability. The advantages of improving CTLA-4 gene expression can be used as a powerful tool in the preparation and treatment of CTLA-4 gene expression for diseases such as Alzheimer's disease.

[0007] As a further improvement of the present invention, the CTLA-4 gene coding sequence is obtained by PCR amplification, and the PCR primer comprises an upstream primer and a downstream primer, and the sequence of the upstream primer is: 5'-GCGAATTCATGGCTTGCCTTGGATTTC -3', ie SEQ ID NO: 1, the sequence of the downstream primer is: 5, - GACTAGTTCACATTCTGGCTCTGTTG -3, ie SEQ ID NO: 2. Using the above PCR primer sequences, the CTLA-4 gene coding sequence can be amplified by PCR, and can be successfully inserted into the pLVX-IRES-Puro expression vector to continuously express the CTLA-4 gene, which reduces the cost of sequence synthesis and lowers the cost.

Correspondingly, the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of the CTLA-4 gene, comprising the following steps:

[0009] A) CTLA-4 gene primer design: According to the CTLA-4 gene coding sequence, using Oligo 7 analysis, select 5,-GCGAATTCATGGCTTGCCTTGGATTTC-3', ie SEQ ID NO: 1 as the upstream bow I, select 5,- GACTAGTTCACATTCTGGCTCTGTTG -3', ie SEQ ID NO

: 2 as a downstream primer, and then synthesizing the upstream primer and the downstream primer; the upstream primer and the downstream primer have no primer dimer, and the annealing temperature difference is small;

[0010] B) obtaining a CTLA-4 gene cDNA sequence: PCR amplification using the upstream primer and the downstream primer to obtain a large number of CTLA-4 gene coding sequences, and then adding the A tail reaction to the sequence, T4 The DNA ligase was ligated to the pGM-T vector to obtain a ligation product, and the ligation product was transformed into competent E. coli DH5CC, uniformly coated on an ampicillin-containing LB medium plate, and a positive monoclonal colony culture preservation liquid was picked. The preliminary identification of PCR was carried out, and the preliminary identification results indicated that the CTLA-4 gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification; the correct E. coli was identified by liquid LB medium, and the cDNA sequence of CTLA-4 gene was extracted. The pGM-T vector was digested with the restriction enzyme EcoR I enzyme and Spe I enzyme, and the fragment of about 500 bp was recovered by electrophoresis and gel-cutting, and the fragment was the CTLA-4 gene cDNA sequence;

[0011] C)

Construction and identification of a lentiviral vector that specifically promotes the high expression of CTLA-4 gene: The plasmid pLVX-IRES-Puro was extracted, digested with the restriction enzyme EcoR I enzyme and Spe I enzyme, electrophoresis, and the gel was recovered to recover the vector. The CTLA-4 gene cDNA sequence was ligated into the ajpLVX-IRES-Puro expression vector by T4 DNA ligase to obtain a ligation product, which was transformed into competent E. coli DH50C and uniformly coated into ampicillin-containing LB medium. On the plate, the positive monoclonal colonies were cultured and preserved, and the PCR was initially identified. The preliminary identification results indicated that the CTLA-4 gene cDNA sequence was inserted into the successful bacterial solution for sequencing and identification;

[0012] D)

Extraction of lentiviral vector specifically promoting the high expression of CTLA-4 gene: The sequencing result confirmed that the CTLA-4 gene cDNA sequence was inserted into the successful bacterial cell expansion culture, and the recombinant plasmid was extracted to obtain a specific CTL A-4 gene. A highly expressed lentiviral expression vector.

[0013] The present invention utilizes genetic engineering technology to construct a lentiviral expression vector which specifically promotes the high expression of CTLA-4 gene. After successful identification, it is packaged into a virus and introduced into Jurkat cells. After the cells are selected by puromycin, the real-time fluorescence is quantified. The PCR and Western Blot techniques verified the changes of CTLA-4 gene expression from mRNA and protein levels, respectively. The experimental results confirmed that the CTLA-4 gene cDNA sequence provided by the present invention was successfully inserted into the p LVX-IRES-Puro expression vector, which can be specific and sustained. Highly and stably promote the high expression of CTLA-4 gene.

The present invention also provides a lentiviral expression vector which specifically promotes high expression of the CTLA-4 gene in the preparation of a therapeutic CTLA

Use of a drug for -4 gene expression-associated diseases.

Advantageous effects of the invention Beneficial effect

The lentiviral expression vector which specifically promotes the high expression of CTLA-4 gene provided by the invention has the advantages of high transfection efficiency, low dosage, and can promote the high expression of CTLA-4 gene specifically, continuously, efficiently and stably. As a powerful tool for drug research and development related to CTLA-4; the present invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of CTLA-4 gene, which has a good operation effect and reduces the cost of sequence synthesis. The cost is lower.

Brief description of the drawing

DRAWINGS

1 is a plasmid map of the pLVX-IRES-Puro expression vector.

2 is a schematic diagram showing the results of fluorescent quantitative PCR detection after puromycin screening of cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0019] Jurkat cells were purchased from the Cell Resource Center of the Shanghai Institute of Biological Sciences. 293FT cells were purchased from Thermo Fisher, Premix PrimeSTAR HS enzyme, lentiviral expression vector pLVX-IRES-Puro, virus packaging auxiliary kit, and Lenti-X GoStix kit. Purchased from Takara, RNeasy Mini

Kit was purchased from QIAGEN, pGM-T was purchased from Tiangen, and Endo-Free Plasmid Mini Kit II was purchased from Omega bio-tek.

Example 1 Design of CTLA-4 gene primers.

[0021] According to the CTLA-4 gene coding sequence (GenBank NM_001037631.2), it was analyzed using 01igo7 to find upstream primers and downstream primers (requiring as little primer-free dimer as possible and the annealing temperature difference is small), and then upstream The protective base and the restriction sites EcoR I and EcoR I were added to the 5' end of the primer and the downstream primer, respectively, and the designed primer sequences are shown in Table 1. The designed PCR primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

Table 1 PCR bow of the CTLA-4 gene | [Table 1]

[0023] Example 2 Construction of a lentiviral vector that specifically promotes high expression of CTLA-4 gene

[0024] After diluting the synthetic antibody, the coding sequence of the CTLA-4 gene is amplified by Premix PrimeSTAR HS enzyme, and then electrophoresed and then subjected to A-tail reaction, and then T4 is used.

The DNA ligase was ligated to the pGM-T vector to obtain the ligation product (CTLA-4-T vector), and the ligation product was transformed into competent E. coli DH50C and uniformly coated onto an ampicillin-containing LB medium plate at 37 Cultured at °C for 12 h, the same control group was set to negative control group 1 (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated with 100 g/ml ampicillin). On the plate of penicillin), positive control group 1 (the connection product of the double enzyme-cut empty vector was uniformly coated on the plate containing 100 g/ml ampicillin), positive control group 2 (the empty carrier was evenly coated in 100%) g/mL ampicillin on the plate). The experimental group grew a single colony, the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, the positive control group 2 did not grow colonies.

[0025] After picking up 8 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of CTLA-4 gene for preliminary identification. The results showed that the cultures of 8 single colonies were successful. The CT LA-4 gene was amplified, and the recombinant vector was sent to Shanghai Biotech Co., Ltd. for sequencing.

[0026] The bacteria with the correct sequencing result were cultured in liquid LB medium for 14 h, and then the recombinant T vector containing the CTLA-4 gene sequence was extracted, and the pLVX-IRES-Puro vector was firstly used with the EcoR I enzyme and The Spe I enzyme was double-digested, electrophoresed and recovered, and the product was recovered by T4 DNA ligase, and then transformed into competent E. coli DH50C, uniformly coated on an ampicillin-containing LB medium plate, and cultured at 37 ° C. h, the same negative control group 1 was set (the competent cells were uniformly coated on the ampicillin-free plate), and the negative control group 2 (the competent cells were uniformly coated on the plate containing 100 g/ml ampicillin) ), positive control group 1 (the double-enzyme-cut empty vector ligation product was uniformly coated in 100 g/ml ampicillin) On the plate), positive control group 2 (the empty carrier was evenly spread on a plate containing 100 g/mL ampicillin). The experimental group grew a single colony, and the negative control group 1 grew colonies; the negative control group 2, the positive control group 1, and the positive control group 2 did not grow colonies.

[0027] After picking up 6 single colonies from the experimental group, 0.5 culture solutions were taken and PCR-amplified with primers of CTLA-4 gene for preliminary identification. The results showed that all the 6 culture broths could successfully amplify the CTLA-4 gene, and then the recombinant vector broth was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were exactly as expected, and the pLVX-CTLA-4 plasmid was obtained.

[0028] The previously collected recombinant plasmid bacterial solution was taken out, inoculated into 15 ml of LB medium (containing 100 g/ml ampicillin), cultured at 37 ° C, 300 rpm for 16 h, using Endo-Free Plasmid Mini Kit II The recombinant plasmid pLVX-CTLA-4 was extracted and its purity and concentration were measured. The results are shown in Table 2.

[0029] Table 2 recombinant plasmid purity and concentration

[] [Table 2]

[0030] Example 3 Lentiviral Packaging

[0031] 293FT cells were cultured, and cells grown in good condition were inoculated into six wells, 106 cells per well, and the extracted recombinant plasmid pLVX-CTLA-4 was taken using a lentiviral packaging auxiliary kit.

2 g was transfected into 293FT cells, and virus-containing supernatant medium was collected 48 h later, and the virus was filtered through a sieve of 0.45 μm for infection of Jurkat cells, Lenti-X.

The GoStix kit detects virus titers of 5xl06~5xl07 IFU.

Example 4 Lentiviral transduction Jurkat cells

[0033] Jurkat cells were inoculated into 6-well plates at 1000000 cells per well. After 12 hours, the cell density was about 50<3⁄4, and the virus solution was taken separately. The virus was diluted 10 times with DMEM complete medium, and polybrene was added. ) The final concentration is 8 g/mL. The medium in the 6-well plate was added to the virus-containing DMEM complete medium (containing 10% fetal bovine serum). After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.00 g/ml. [0034] Example 5 Fluorescence quantitative PCR was used to detect the expression level of CTLA-4 gene.

[0035] According to the GAPDH and CTLA-4 gene mRNA sequences, the primer design software Oligo 7.0 was used to design bows [] [Table 3]

[0036] Jurkat cells, pLVX empty vector control Jurkat cell group, and pLVX-CTLA-4 high expression cells were inoculated to a 6-well plate, respectively. Cell density reaches δΟ^^Ο^吋, with RNeasy Mini

Kit extracts total RNA from each group of cells, using PrimeScrip RT reagent

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of the reverse transcription, add 9 (L RNase Free dH20 diluted cDNA, and store at -20 °C for later detection. Take the cDNA of each group of cells.

Ιμΐ was used as a template, and GAPDH was used as an internal reference. Real-time quantitative PCR (QPCR) was used to detect the relative expression of CTLA-4, and the reaction conditions were set: 95. C 30s, 1 cycle, 54. C 30s 40 cycles, 95. C 5s, 60 ° C lmin , 95 ° C 15 s, using SYBR Primescript RT-PCR Kit to detect the relative expression of CTLA-4 gene in each group of cells. After continuous culture of pLVX-CTLA-4 cells for 20 passages, the above experiment was repeated. The summarized results are shown in Figure 2. It can be seen that whether the pLVX-CTLA-4 cells have been screened or have been cultured for 20 generations, the expression of CTLA-4 gene is about 300-fold higher than that of Jurkat cells, whereas the pLVX empty vector cells are The CTLA-4 gene expression level was almost unchanged from that of Jurkat cells, indicating that the C TLA-4 gene cDNA sequence provided by the present invention was successfully inserted into the pLVX-IRES-Puro expression vector, and the CTLA can be promoted specifically, continuously, efficiently, and stably. -4 gene is highly expressed.

[0037] The above is a further detailed description of the present invention in conjunction with the specific preferred embodiments, and the specific embodiments of the present invention are not limited to the description. For those skilled in the art to which the present invention pertains, a number of simple deductions or substitutions may be made without departing from the inventive concept. All should be considered as belonging to the scope of protection of the present invention.

Industrial applicability

The lentiviral expression vector which specifically promotes the high expression of CTLA-4 gene provided by the invention has the advantages of high transfection efficiency, low dosage, specific, sustained, high efficiency and stable promotion of high expression of CTLA-4 gene, and can be used as a powerful tool. It is applied to drug research and development related to CTLA-4; the invention also provides a method for constructing a lentiviral expression vector which specifically promotes high expression of CTLA-4 gene, has good operation effect, reduces sequence synthesis cost, and has low cost. .

Claims

claims

[Claim 1] A lentiviral expression vector that specifically promotes high expression of the CTLA-4 gene, characterized by: including the basic sequence of the pLVX-IRES-puro expression vector, the resistance gene sequence, the multiple cloning site sequence, and the promoter sequence and CTLA-4 gene cDNA sequence; the multiple cloning site includes EcoR I restriction site and Spe

I enzyme cleavage site, the CTLA-4 gene cDNA sequence includes EcoR I enzyme cleavage site, CTLA-4 gene coding sequence and Spe 1 enzyme cleavage site, the CTLA-4 gene cDNA sequence is inserted into the polypeptide in the forward direction. in the cloning site sequence.

[Claim 2] The lentiviral expression vector specifically promoting the high expression of CTLA-4 gene according to claim 1

, which is characterized in that: the CTLA-4 gene coding sequence is obtained by PCR amplification, the PCR primer includes an upstream primer and a downstream primer, the sequence of the upstream primer is: 5'-GCGAATTCATGGCTTGCCTTGGATTTC-3, that is, SEQ ID NO: 1 , the sequence of the downstream primer is: 5'-GACTAGTTCACATTCTGGCTCTGTTG -3, that is, SEQ ID NO: 2.

[Claim 3] The construction method of a lentiviral expression vector that specifically promotes high expression of CTLA-4 gene according to claim 2, characterized in that: comprising the following steps:

A) CTLA-4 gene primer design: According to the CTLA-4 gene coding sequence, use 01igo 7 to analyze and select 5, - GCGAATTCATGGCTTGCCTTGGATTTC -3', that is, SEQ ID NO: 1 as the upstream primer, select 5'-

GACTAGTTCACATTCTGGCTCTGTTG -3, that is, SEQ ID NO: 2 as the downstream primer, and then the upstream primer and the downstream primer are synthesized;

B) Obtaining the CTLA-4 gene cDNA sequence: Use the upstream primer and the downstream primer to perform PCR amplification to obtain a large number of CTLA-4 gene coding sequences, and then perform an A-tailing reaction on the sequence, and then connect it with T4 DNA The enzyme is connected to the pGM-T vector to obtain the ligation product

, transform the ligation product into competent E. coli DH50C, spread it evenly on an LB medium plate containing ampicillin, pick out positive single clone colonies, culture and preserve the bacterial liquid, and perform preliminary PCR identification. The preliminary identification results will be explained by CTLA -4 gene cDNA sequence was successfully inserted into the bacterial liquid for sequencing and identification; the correct E. coli was cultured and sequenced using liquid LB medium bacterium, and extract the pGM-T vector containing the CTLA-4 gene cDNA sequence, double digest it with the restriction endonuclease EcoR I enzyme and Spe I enzyme, electrophoresis, and gel cutting to recover a fragment of about 500 bp, this fragment is is the CTLA-4 gene cDNA sequence;

C) Construction and identification of lentiviral vectors that specifically promote high expression of CTLA-4 gene: Extract plasmid pLVX-IRES-Puro, double-digest with restriction endonucleases EcoR I and Spe I, electrophoresis, and gel cutting to recover the vector , and then use T4 DNA ligase to connect the CTLA-4 gene cDNA sequence into the pLVX-IRES-Puro expression vector to obtain a ligation product, transform the ligation product into competent E. coli DH50C, and spread it evenly into the ampicillin-containing On the LB medium plate, select positive single clone colonies, culture and preserve the bacterial liquid and perform preliminary PCR identification. The preliminary identification results indicate that the CTLA-4 gene cDNA sequence has been successfully inserted into the bacterial liquid for sequencing identification;

D) Extraction of lentiviral vector that specifically promotes high expression of CTLA-4 gene: Sequencing results confirm that the CTLA-4 gene cDNA sequence has been successfully inserted into bacterial liquid amplification and culture, and the recombinant plasmid is extracted to obtain a vector that specifically promotes CTLA-4 Lentiviral expression vector for high gene expression.

[Claim 4] Use of the lentiviral expression vector that specifically promotes high expression of CTLA-4 gene according to any one of claims 1 to 3 in the preparation of drugs for treating diseases related to abnormal CTLA-4 gene expression.