WO2017134274A1 - New streptococcal proteases - Google Patents

New streptococcal proteases Download PDF

Info

Publication number
WO2017134274A1
WO2017134274A1 PCT/EP2017/052463 EP2017052463W WO2017134274A1 WO 2017134274 A1 WO2017134274 A1 WO 2017134274A1 EP 2017052463 W EP2017052463 W EP 2017052463W WO 2017134274 A1 WO2017134274 A1 WO 2017134274A1
Authority
WO
WIPO (PCT)
Prior art keywords
igg
seq
igde
sequence
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/052463
Other languages
English (en)
French (fr)
Inventor
Ulrich Von Pawel-Rammingen
Christian SPOERRY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=57995190&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2017134274(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to ES17703958T priority Critical patent/ES2877754T3/es
Priority to KR1020187025476A priority patent/KR102704583B1/ko
Priority to EP17703958.3A priority patent/EP3411389B1/en
Priority to SG11201806639VA priority patent/SG11201806639VA/en
Priority to US16/075,059 priority patent/US12006530B2/en
Priority to AU2017214441A priority patent/AU2017214441B2/en
Priority to CA3013527A priority patent/CA3013527C/en
Priority to DK17703958.3T priority patent/DK3411389T3/da
Priority to CN201780022485.6A priority patent/CN109311951B/zh
Application filed by Individual filed Critical Individual
Priority to JP2018540841A priority patent/JP7123801B2/ja
Priority to PL17703958T priority patent/PL3411389T3/pl
Publication of WO2017134274A1 publication Critical patent/WO2017134274A1/en
Anticipated expiration legal-status Critical
Priority to JP2022056522A priority patent/JP2022115853A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6402Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
    • C12N9/6405Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
    • C12N9/641Cysteine endopeptidases (3.4.22)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854Immunoglobulins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6848Methods of protein analysis involving mass spectrometry

Definitions

  • the invention relates to a new Streptococcal proteases which displays IgG degrading cysteine protease activity.
  • the invention further relates to the treatment of and vaccination against streptococcal infections, the treatment of conditions mediated by pathogenic IgG antibodies, such as autoimmune diseases, and to the development of new tools for biotechnology. Background to the invention
  • Ig are central to the adaptive immune system by initiating the complement based and/or phagocyte based immune response.
  • Ig consists of variable antigen-recognizing Fab regions that are linked through a flexible hinge region with the Fc effector part. The Fc region mediates contact with specific receptors on phagocytic cells or triggers the classical pathway of complement by binding Clq.
  • the hinge region is target for several microbial proteases and examples include IdeS from S.
  • Streptococcal infection are common in humans, as well as domestic animal, like swine, horses and cattle. Streptococcal infections vary in severity from relatively mild diseases to serious life threatening conditions. The provision of streptococcal antigens that can be used in human and veterinary vaccines in the prophylaxis, prevention and treatment of streptococcal infections is greatly needed.
  • Proteases with strict sequence specificity are useful as biotechno logical tools.
  • Proteases that degrade immunoglobulins can have medical use, e.g. can proteases that specifically degrade IgG be used for treatment or prevention of diseases or conditions mediated by IgG antibodies. Summary of the invention
  • the present inventors have identified, purified and characterised a novel family of IgG degrading enzymes from streptoccoci.
  • This family of enzymes designated IgdE for Immunoglobulin G-degrading Enzyme, are cysteine proteases distinct from previous characterized streptococcal immunoglobulin degrading proteases of the IdeS family and mediates efficient cleavage of the hinge region of IgG with a high degree of specificity.
  • the enzyme has been identified in strains of S. suis, designated IgdE su i s ; in strains of S. agalactiae, designated IgdE ag aiactiae; in strains S. porcinus, designated IgdE p0 rcinus; in strains of S. equi, designated IgdE equ i; and in strains of S. pseudoporcinus, designated IgdEpseudoporcinus-
  • the IgdE from S.suis is demonstrated to be highly specific for porcine IgG. Similar to the IgM cleaving protease Idessuis, the 1121 amino acid large protein carries the proteolytic active domain in the N-terminal part of the protein. A full size protein is not essential for IgG cleavage in vitro, as a truncated S.suis IgdE protein consisting of the N- terminal 470 amino acids retains IgG cleavage activity.
  • S. suis can e.g. cause meningitis in humans and swine.
  • S. agalactiae can e.g. cause meningitis and sepsis in humans and cattle.
  • S. porcinus can e.g. cause respiratory tract infections in swine, porcine strangles.
  • S. equi can e.g. cause respiratory tract infections in horses, strangles.
  • Proteases of the IgdE family are of use in the prevention and treatment of
  • Streptococcal infections such as a vaccine for immunization against streptococcal infections.
  • IgdE antibodies are further of use in passive immunization and treatment of conditions associated with streptococcal infections.
  • IgdE proteases are also useful for developing new biotechnological tools, and for treating or preventing diseases or conditions mediated by IgG antibodies, such as autoimmune diseases, transplant rejection, post-operative treatment and acquired haemophilia. Accordingly, in a first aspect the invention provides an isolated IgdE polypeptide for use in generating an immune response in a subject.
  • the isolated IgdE polypeptide is preferably an IgdE su is, IgdE a galactiae, IgdEporcinus, IgdEequi, or an IgdE pS eudo P orcinus polypeptide, or a variant or fragment of any thereof which retains cysteine protease activity and/or is capable of generating an immune response to a streptococcus in a subject.
  • the variant may be an IgdE polypeptide from another bacterium.
  • the bacterium is preferably a Streptococcus.
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;
  • the immune response is a protective immune response.
  • the immune response generates antibodies able to neutralize the IgG degrading cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject.
  • the invention provides a method for generating an immune response in a subject comprising administering an IgdE polypeptide to said subject.
  • the invention provides an isolated polynucleotide encoding an IgdE polypeptide for use in generating an immune response in a subject.
  • the IgdE polypeptide is preferably an IgdE su is, IgdE a galactiae, IgdEporcinus, IgdEequi or an IgdEpseudoporcinus polypeptide, or a variant or fragment of any thereof which retains cysteine protease activity and/or is capable of generating an immune response to a streptococcus in a subject.
  • the variant may be an IgdE polypeptide from another bacterium.
  • the bacterium is preferably a Streptococcus.
  • the invention provides a polynucleotide encoding an IgdE polypeptide for use in generating an immune response in a subject comprising:
  • (x) a sequence having at least 70% identity to a sequence as defined in (u) or (v); or (y) a fragments of any of the sequences (u), (v), (w) or (x), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably S. pseudoporcinus in a subject..
  • the immune response is a protective immune response.
  • the immune response generates antibodies able to neutralize the IgG degrading cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject.
  • the invention provides a method for generating an immune response in a subject comprising administering a polynucleotide encoding an IgdE polypeptide to said subject.
  • the present invention provides an isolated IgdE polypeptide for use in treatment or prevention of a disease or condition mediated by IgG antibodies.
  • the IgdE polypeptide is preferably an IgdE su is, IgdE a galactiae, IgdEporcinus, IgdEequi or an IgdEpseudoporcinus polypeptide, or a variant or fragment of any thereof which retains cysteine protease activity.
  • the variant may be an IgdE polypeptide from another bacterium.
  • the bacterium is preferably a Streptococcus.
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;
  • the IgdE polypeptide can be an IgdE ag aiactiae polypeptide comprising:
  • the invention provides a method for treatment, prophylaxis or prevention of a disease or condition mediated by IgG antibodies comprising administering a therapeutically effective amount of an IgdE polypeptide to a subject.
  • the disease or condition mediated by IgG antibodies can be an autoimmune diseases, transplant rejection, post-operative treatment and acquired haemophilia.
  • the present invention provides an in vitro method for the cleavage of IgG, comprising contacting IgG with an IgdE polypeptide having cysteine protease activity.
  • the IgdE polypeptide is preferably an IgdE su is, IgdE a galactiae, IgdEporcinus, IgdEequi, or an IgdEpseudoporcinus polypeptide, or a variant or fragment of any thereof which retains IgG degrading cysteine protease activity.
  • the variant may be an IgdE polypeptide from another bacterium.
  • the bacterium is preferably a Streptococcus.
  • the present invention provides an in vitro method for the cleavage of IgG, comprising contacting IgG with an IgdE polypeptide comprising:
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;
  • the IgdE polypeptide can be an IgdE aga iac polypeptide comprising:
  • the present invention provides an in vitro method for the generation of Fc or Fab fragments of IgG, comprising contacting IgG with an IgdE polypeptide having IgG degrading cysteine protease activity.
  • the present invention provides a method for identifying a substance that activates or inhibits the IgG cysteine activity of an IgdE polypeptide.
  • the method can comprise;
  • Candidate compounds which may be tested in the methods according to the invention include simple organic molecules, commonly known as "small molecules", for example those having a molecular weight of less than 2000 Daltons.
  • the method may also be used to screen compound libraries such as peptide libraries, including synthetic peptide libraries and peptide phage libraries.
  • Other suitable molecules include polynucleotide sequences and any other molecules which modulate the IgG degrading activity of IgdE.
  • FIG. 1 IgG degradation activity in culture supernatants of S. suis.
  • A Concentrated (20x) culture supernatants of S. suis strains 10 and 10 Aidessuis were incubated with 2% porcine plasma for 16 h at 37 °C and analyzed by SDS-PAGE under reducing conditions. A degradation product (*) of approximately 32 kDa was observed.
  • B Anti-IgG Western Blot analysis of culture supernatant of S. suis strain 10 fractionated by ammonium sulfate precipitation. IgG degradation products (*) were obtained after incubation of 1% porcine plasma with 20-40% and 40-60% ammonium sulfate saturation fractions for 16 h at 37 °C. Lane 1 showing the protein size standard is a photographic image of the membrane before detection of the chemiluminescence signal.
  • FIG. 1 Schematic illustration of IgdE and the different rlgdE constructs with potential active site residues substitutions and the C-terminal truncation variant.
  • the secretion signal peptide (residues 1-37) is marked in light grey, the transglutaminase domain is boxed and the potential active site residues and substitutions are indicated.
  • B 3.3 ⁇ porcine IgG was incubated for 16 h at 37 °C with soluble fractions of E. coli cells expressing different rlgdE constructs. The reaction was analyzed SDS-PAGE under reducing conditions.
  • IgG cleavage occurred upon incubation with rlgdE, rIgdE D348A and rIgdE AC but not with rIgdE C302S or rIgdE H333A .
  • the weak protein band of 37 kDa is a contaminant present in lysate preparation and not related to IgdE activity.
  • DMSO control (n) were analyzed by Dunnett's Multiple Comparison Test with significance set at P values of ⁇ 0.05(*), ⁇ 0.01(**) and ⁇ 0.001(*** or ⁇ ).
  • the reaction was analyzed by non-reducing (A) and reducing (B) Coomassie blue stained SDS-PAGE. 3.3 ⁇ IgG was incubated with (+) or without (-) 10 nM purified rlgdE for 16h at 37°C. (C) The observed cleavage pattern and cleavage site proposes a model where one IgG heavy chain is first hydrolyzed by IgdE resulting in one free Fab fragment (Fab) and single cleaved IgG (scIgG) and in a second step the other heavy chain is hydrolyzed resulting in one Fc fragment (Fc) and two Fab fragments.
  • Fab free Fab fragment
  • scIgG single cleaved IgG
  • Fc Fc fragment
  • IgdE is highly specific for porcine IgG.
  • S. suis IgdE degrades endogenous IgG in all tested body fluids of healthy pigs and pigs with respective lesions, (size indicated with arrows). No other degradations products could be observed.
  • Body fluids were incubated with (+) or without (-) 10 nM purified rlgdE for 16h at 37°C.
  • the reactions were analyzed by SDS-PAGE (A) and anti-IgG Western blots (B) under reducing conditions. Lanes showing the protein size standard are a photographic image of the membrane before detection of the chemiluminescence signal. Images of different gels have been assembled into one figure.
  • IgdE is necessary for IgG cleavage by S. suis and IgG cleavage is independent of Idessuis.
  • Figure 8 Inhibitor profile of IgG degradation activity detected in culture supernatants of S. suis.
  • rIgdE AC was purified from lysate of IPTG induced E. coli carrying an expression plasmid. The elute of a Ni 2+ -affinity chromatography purification containing His-ZZ- tagged rIgdEAC was incubated with Tev-protease to remove the His-ZZ-tag prior to a second round of Ni 2+ -affinity chromatography purification. The flow through fractions 2 and 3 of this purification step containing untagged rIgdE AC were pooled, buffer ex-changed to PBS and used for further experiments. Two major bands around 50 kDa can be observed in these fractions, due to partial degradation of rIgdE AC .
  • rlgdEagaiactiae was incubated with polyclonal IgG of six different species for 18h at 37°C and analyzed by SDS-PAGE under reducing conditions. Degradation products are indicated by asterisks (*). Images of different gels have been used to create the figure.
  • B rlgdEagaiactiae was incubated with human or bovine serum for 18h in 37°C and analyzed by SDS-PAGE under reducing conditions. Degradation products are indicated by asterisks (*).
  • C Western Blot with crude extracts of rlgdEagaiactiae incubated with human and porcine serum for 18h in 37°C.
  • Human serum and monoclonal human IgGl were incubated in presence (+) or absence (-) of rlgdEagaiactiae for 18h at 37°C and analyzed by Westen blot under non- reducing conditions with a human IgGl -specific antibody.
  • SEQ ID NO: 1 is the amino acid sequence of the IgdE isolated from S. suis strain 10. Additional amino acid sequences of IgdEs from S. suis can be found e.g. in GenBank as accession nos WP O 12027720.1, WP 044687717.1, WP 045002893.1, WP 044981166.1, WP 044770432.1, WP 043041527.1, WP 014917307.1,
  • WP_044768304.1 WP 043033176.1, WP_044772573.1, ABQ42883.1, ABQ42882.1, ABQ42884.1, ABQ42885.1, WP 024402604.1, WP 044671803.1 , WP 014639000.1, WP 014636499.1, WP 044475270.1, WP 044683049.1, WP 044682603.1,
  • WP_044982674.1 WP_024406212.1, WP_024402376.1, WP_024382860.1
  • WP_029172805.1 AER15932.1, WP_024414493.1, WP_044762560.1, WP_024417771.1, WP 044675281.1, WP 044666819.1, WP 043032980.1, WP 044671755.1,
  • WP 024416363.1 ABL84354.1, ABL84413.1, WP_044758899.1, WP_024393919.1, WP_014736321.1, WP_024383620.1, WP_044475488.1, WP_024386700.1,
  • WP_044766774.1 WP_044672596.1
  • WP_043028752.1 WP_044771508.1
  • SEQ ID NO: 2 is a nucleic acid sequence encoding IgdE isolated from S. suis strain 10.
  • SEQ ID NO: 3 is the amino acid sequence of an IgdE isolated from S. agalactiae strain CCUG4208. Additional amino acid sequences of IgdEs from S. agalactiae can be found e.g. in GenBank as accession nos EPU21342.1, EFV98161.1, CAD47554.1, EPU23939.1, EPW71972.1, EPT99261.1, EPV90329.1, EGS26825.1, EPV84888.1, CFQ52811.1, EPT84780.1, EPT99074.1, CCW42936.1, CCW40848.1, EAO70450.1, EPU74838.1, EPT51236.1, EPU77761.1, EPT36280.1, WP 011058381.1, EPT59860.1, EPT39170.1, EPT38734.1, CFQ25568.1, EPU40877.1, WP 025193619.1, WP 000440329.1, WP 000440333.1, WP 000440330.1
  • WP 047199154.1 WP 001901206.1, WP 025193273.1, WP 025194923.1,
  • WP 000440334.1 WP 025195559.1, WP 047200043.1, WP 041165773.1, EPU33307.1,
  • WP_029692083.1 WP_017770870.1, WP_025197885.1, EA075153.1, WP_001884472.1,
  • SEQ ID NO: 4 is a nucleic acid sequence encoding IgdE isolated from S. agalactiae strain CCUG4208.
  • SEQ ID NO: 5 is the amino acid sequence of the IgdE isolated from S. porcinus strain DSM20725.
  • the amino acid sequences of IgdE from S. porcinus can be found e.g. in GenBank as accession no WP 003085269.1
  • SEQ ID NO: 6 is a nucleic acid sequence encoding IgdE isolated from S. porcinus strain DSM20725.
  • SEQ ID NO: 7 is the amino acid sequence of the IgdE isolated from S. equi strain ssp zooepidemicus #1. Additional amino acid sequences of IgdEs from S. equi can be found e.g. in GenBank as accession nos. KDE01980.1, KIS07668.1, KIS08707.1,
  • SEQ ID NO: 8 is a nucleic acid sequence encoding IgdE isolated from S. equi strain ssp zooepidemicus #1.
  • SEQ ID NO: 9 is the amino acid sequence of the IgdE isolated from
  • S. pseudoporcinus strain ATCC® BAA- 1381 The amino acid sequences of IgdE from S. pseudoporcinus can be found e.g. in GenBank as accession no WP 007895676.1.
  • SEQ ID NO: 10 is a nucleic acid sequence encoding IgdE isolated from
  • SEQ ID NO: 11 is the amino acid sequence of a C-terminally truncated variant of IgdE isolated from S. suis.
  • the IgdE polypeptide according to the present invention is preferably an IgdE su is, IgdEa galactiae, IgdEporcinus, IgdEequi, or an IgdE pS eudo P orcinus polypeptide, or a variant or fragment of any thereof which retains cysteine protease activity and/or is capable to raise an immune response to a streptococcus in a subject.
  • the variant may be an IgdE
  • the bacterium is preferably a Streptococcus.
  • the IgdE polypeptide may comprise the amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having at least 70% identity to the amino acid sequence of any of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 and having IgG degrading cysteine protease activity; or a fragment of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having IgG degrading cysteine protease activity.
  • the IgdE polypeptide may comprise the amino acid sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having at least 70% identity to the amino acid sequence of any of SEQ ID NOs: 1, 3, 5 7, 9, or 11 and being capable to raise an immune response to a streptococcus in a subject; or a fragment of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof being capable to raise an immune response to a streptococcus in a subject.
  • the streptococcus can be S. suis, S. agalactiae, S. porcinus, S. equi, or
  • the polypeptide comprises, or consists of, any of the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, or 11.
  • the polypeptide may additionally include a signal sequence or a N-terminal methionine.
  • Variant polypeptides are those for which the amino acid sequence varies from that in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 respectively, but which retain the same essential character or basic functionality as IgdE.
  • the variant polypeptides may therefore display IgG degrading cysteine protease activity, and/or be capable of raising an immune response to a streptococcus in a subject.
  • the immune response is a protective immune response.
  • the immune response generates antibodies able to neutralize the IgG degrading cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject.
  • an IgdE variant lacking the IgG cysteine protease activity can still be able to raise an immune response generating antibodies being able to neutralize the IgG cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject.
  • Such IgdE variants are included in the IgdE variants according to the invention.
  • polypeptides with more than about 70%> identity, preferably at least 80%>, at least 90% and particularly preferably at least 95%, at least 97% or at least 99% identity, with the amino acid sequence of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 are considered variants of the protein.
  • variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide maintains the basic IgdE functionality.
  • variants of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 may be measured over a region of at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, at least 275, at least 300 or more contiguous amino acids of the sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11, or more preferably over the full length of SEQ ID NOs: 1, 3, 5, 7, 9, or 11.
  • any of the above listed lower limits may be combined with any of the above listed upper limits to provide a range for the length of the polypeptide of the invention.
  • the polypeptide may be 50 to 250 amino acids in length, or 100 to 300 amino acids in length.
  • the polypeptide may be 100 to 586 amino acids in length, 150 to 500 amino acids in length or 100 to 400 amino acids in length.
  • Amino acid identity may be calculated using any suitable algorithm.
  • the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al. (1984) Nucleic Acids Research 12, 387-395).
  • the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al. (1990) J Mol Biol 215:403-10.
  • HSPs high scoring sequence pair
  • Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum
  • P(N) which provides an indication of the probability by which a match between two polynucleotide or amino acid sequences would occur by chance.
  • a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1 , preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • the variant sequences typically differ by at least 1, 2, 5, 10, 20, 30, 50 or more amino acids positions (which maybe substitutions, deletions or insertions of amino acids). For example, from 1 to 50, 2 to 30, 3 to 20 or 5 to 10 amino acid substitutions, deletions or insertions may be made.
  • the substitutions are preferably conservative substitutions, for example according to the following Table 1. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
  • the modifications are preferably conservative amino acid substitutions.
  • Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume.
  • the amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace.
  • the conservative substitution may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid.
  • Conservative amino acid changes are well-known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table Al below. Where amino acids have similar polarity, this can be determined by reference to the hydropathy scale for amino acid side chains in Table A2.
  • polypeptides comprise a cysteine residue and a histidine residue at a spacing typically found in cysteine proteases.
  • cysteine residues are found at position 302 and position 333.
  • aspartic acid residue completing the catalytic triad is found at position 348.
  • the fragment of the IgdE polypeptide used in the invention is typically at least 10, for example at least 15, 20, 25, 30, 40, 50 or more amino acids in length, up to 100, 150, 200, 250 or 300 amino acids in length, as long as it retains the IgG degrading cysteine protease activity of IgdE and/or being capable of raising an immune response to a streptococcus in a subject.
  • polypeptides used in the invention may be chemically modified, e.g. post- translationally modified.
  • they may be glycosylated, phosphorylated or comprise modified amino acid residues.
  • They may be modified by the addition of histidine residues to assist their purification or by the addition of a signal sequence to promote insertion into the cell membrane.
  • modified polypeptides fall within the scope of the term "polypeptide" used herein.
  • polypeptides for use in accordance with the invention display
  • the polypeptide cleaves IgG in the hinge region and more particularly in the hinge region of the heavy chain.
  • cleavage results in production of Fc and Fab fragments of IgG.
  • the activity is specific for IgG.
  • the IgG degrading cysteine protease activity may be determined by means of a suitable assay. For example, a test polypeptide may be incubated with IgG at a suitable temperature, such as 37°C. The starting materials and the reaction products may then be analysed by SDS PAGE to determine whether the desired IgG cleavage product is present.
  • this cleavage product is a 32kDa fragment. Typically there is no further degradation of IgG after this first cleavage.
  • the cleavage product may be subjected to N-terminal sequencing to verify that cleavage has occurred in the hinge region of IgG.
  • the cysteine protease activity of the polypeptides can be further characterised by inhibition studies.
  • the activity is inhibited by the peptide derivate Z- LVG- CFIN2, and/or by iodoacetic acid which are protease inhibitors.
  • the IgG degrading cysteine protease activity of the polypeptides is generally IgG- specific in that the polypeptides may not degrade other classes of Ig, namely IgM, and IgA, when incubated with these immunoglobulins under conditions that permit cleavage of IgG.
  • IgdE from S. suis, S. porcinus, and S. pseudoporcinm were found to be specific for porcine IgG.
  • IgdE from S. agalactiae was found to be specific for human IgG, and specifically human IgGl .
  • IgdE from S. equi was found to be specific for equine IgG, and specifically equine IgG7.
  • Polypeptides for use in the invention may be in a substantially isolated form. It will be understood that the polypeptide may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated.
  • a polypeptide for use in the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e.g. more than 80%, 90%>, 95% or 99%, by weight of the polypeptide in the preparation is a polypeptide of the invention.
  • Polypeptides for use in the present invention may be isolated from any suitable organism that expresses an IgdE polypeptide.
  • the IgdE polypeptide is isolated from suitable IgdE expressing streptococcal strains.
  • suitable organisms and strains may be identified by a number of techniques. For example, streptococcal strains may initially be tested for the presence an igdE gene.
  • Polynucleotide primers or probes may be designed based on for example, SEQ ID NOs: 2, 4, 6, 8, or 10. Examples of suitable primers are set out in SEQ ID NOs: 12-22. The presence of the igdE gene can then be verified by PCR using the primers or by hybridisation of the probes to genomic DNA of the strain.
  • a polynucleotide according to the invention may comprise or consist of: (a) the coding sequence of SEQ ID NOs: 4, 5, 6, 8, or 10; (b) a sequence which is degenerate as a result of the genetic code to the sequence as defined in (a); (c) a sequence having at least 70%) identity to a sequence as defined in (a) or (b) and which encodes a polypeptide having IgG degrading cysteine protease activity and/or be capable of raising an immune response to a streptococcus in a subject; or (d) a fragment of any one of the sequences as defined in (a), (b) or (c) which encodes a polypeptide having IgG degrading cysteine protease activity and/or be capable of raising an immune response to a streptococcus in a subject.
  • the polynucleotide is DNA.
  • the polynucleotide may be a RNA polynucleotide.
  • the polynucleotide may be single or double stranded, and may include within it synthetic or modified nucleotides.
  • a polynucleotide of the invention can typically hybridize to the coding sequence or the complement of the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 at a level significantly above background. Background hybridization may occur, for example, because of other DNAs present in a DNA library.
  • the signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10.
  • the intensity of interaction may be measured, for example, by radio labelling the probe, e.g. with 32 P.
  • Selective hybridisation may typically be achieved using conditions of medium to high stringency. However, such hybridisation may be carried out under any suitable conditions known in the art (see Sambrook et al., Molecular Cloning: A Laboratory Manual, 1989). For example, if high stringency is required suitable conditions include from 0.1 to 0.2 x SSC at 60°C up to 65°C. If lower stringency is required suitable conditions include 2 x SSC at 60°C.
  • the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 may be modified by nucleotide substitutions, for example from 1, 2 or 3 to 10, 25, 50 or 100 substitutions.
  • the polynucleotide of SEQ ID NO: 2, 4, 6, 8, 10 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends. Additional sequences such as signal sequences may also be included.
  • the modified polynucleotide generally encodes a polypeptide which has IgdE specific cysteine protease activity and/or is capable of raising an immune response to a streptococcus in a subject. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table 1 above.
  • a nucleotide sequence which is capable of selectively hybridizing to the complement of the DNA coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 will generally have at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the coding sequence of SEQ ID NO: 2, 4, 6, 8, or 10 respectively, over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO: 2, 4, 6, 8, or 10. Sequence identity may be determined by any suitable method, for example as described above.
  • polynucleotides of the invention Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred.
  • a polynucleotide which has at least 90%> sequence identity over 20, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides.
  • Polynucleotide fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length.
  • Fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700, 800, 900 or 1000 nucleotides in length, or even up to a few nucleotides, such as five, ten or fifteen nucleotides, short of the coding sequence of SEQ ID NO: 2, 4, 6, 8, or 10 respectively.
  • Polynucleotides for use in the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The polynucleotides are typically provided in isolated and/or purified form.
  • short polynucleotides will be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotide at a time.
  • Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15-30 nucleotides) to a region of the igdE gene which it is desired to clone, bringing the primers into contact with DNA obtained from a bacterial cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA.
  • the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector. Suitable primers are for example, those in SEQ ID NOs: 12-22.
  • polynucleotides as described herein have utility in production of the polypeptides for use in the present invention, which may take place in vitro, in vivo or ex vivo.
  • polynucleotides may be used as therapeutic agents in their own right or may be involved in recombinant protein synthesis.
  • polynucleotides for use in the invention are typically incorporated into a recombinant replicable vector.
  • the vector may be used to replicate the nucleic acid in a compatible host cell. Therefore, polynucleotides for use in the invention may be made by introducing an IgdE polynucleotide into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions which bring about replication of the vector.
  • the vector is an expression vector comprising a nucleic acid sequence that encodes an IgdE polypeptide.
  • expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals, which may be necessary and which are positioned in the correct orientation in order to allow for protein expression.
  • suitable vectors would be apparent to persons skilled in the art.
  • a polynucleotide for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • the term "operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence, such as a promoter, "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.
  • the vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
  • the vector is typically adapted to be used in vivo.
  • Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed.
  • Mammalian promoters such as ⁇ -actin promoters, may be used. Tissue-specific promoters are especially preferred.
  • Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art.
  • MMLV LTR Moloney murine leukaemia virus long terminal repeat
  • RSV rous sarcoma virus
  • CMV human cytomegalovirus
  • HSV promoters such as the HSV IE promoters
  • the vector may further include sequences flanking the polynucleotide giving rise to polynucleotides which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells by homologous recombination.
  • a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell.
  • viral vectors include herpes simplex viral vectors and retroviruses, including lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the polynucleotide into the host genome. Replication- defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.
  • the IgdE polypeptide, or polynucleotide may be used to treat or prevent diseases or conditions mediated by pathogenic IgG antibodies. It is well known in the art that pathogenic IgG antibodies are involved in the pathogenesis of a number of different diseases and conditions. Consequently, the effects of pathogenic IgG antibodies in such diseases can be inhibited using an IgdE polypeptide or polynucleotide.
  • the disease or condition can be an autoimmune disease.
  • diseases include Addison's disease, alopecia areata, ankylosing spondilitis, antiphospho lipid syndrome, aplastic anaemia, autoimmune gastritis, autoimmune hearing loss, autoimmune haemo lytic anaemias, autoimmune hepatitis, autoimmune hypoparathyroidism, autoimmune hypophysitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune polyendocrinopathy, Bechet's disease, bullous pemphigoid, cardiomyopathy, chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, coeliac disease, Crohn's disease, CREST syndrome, Degos disease, epidermolysis bullosa acquisita, essential mixed cryoglobulinaemia, giant cells arteritis, glomerulonephritis
  • the disease or condition can be asthma.
  • the asthma can be acute or chronic asthma.
  • IgG activates the classical pathway of the complement system.
  • IgdE polypeptides and polynucleotides can therefore be used to treat diseases and conditions where complement activation is detrimental to the patient.
  • the IgdE polypeptides and polynucleotides can be used to treat transplantation-derived disorders, for example transplant rejection (such as allograft and xenograft rejection) and graft-versus-host disease.
  • transplantation-derived disorder may occur due to the transplantation of a tissue or an organ in a patient.
  • IgdE polypeptides and polynucleotides are also of use in post-operative treatment, for example in the treatment of patients who have undergone heart by-pass operations.
  • IgdE polypeptides and polynucleotides can be used for the treatment of acquired haemophilia, i.e to remove IgG in haemophilia patients who have developed autoantibodies against coagulation factors.
  • a subject as used herein includes any mammalian subject such as a human, a pig, a hourse, and any cattle.
  • the invention encompasses in vitro methods for the cleavage of IgG, comprising contacting IgG with a polypeptide comprising:
  • the amino acid sequence is SEQ ID NO: 3.
  • the in vitro method for the cleavage of IgG comprises contacting IgG with a polypeptide comprising:
  • the polypeptide is specific for human IgG, and specifically human IgGl . Furthermore, the polypeptide cleaves IgGl as shown in Figure 4, irrespective of whether the light chain is kappa or lambda type.
  • the polypeptide is an IgG cysteine protease, which may typically comprise a catalytic site including a cysteine residue, a histidine residue and an aspartic acid residue in positions which correspond to positions 265, 296 and 311 of SEQ ID NO: 1.
  • a cysteine residue, histidine residue and an aspartic acid residue are found at positions 262, 293 and 308.
  • the variants and fragments of the polypeptide typically retain these residues.
  • the method of the present invention comprises incubating the polypeptide with a sample containing IgG under conditions which permit specific cysteine protease activity to occur.
  • the method further comprises identification and/or isolation of the cleavage products.
  • the analysis may be by any suitable method known in the art. In some instances, the analysis is by gel electrophoresis (e.g. SDS-PAGE) or mass spectrometry.
  • the in vitro method is used to generate Fc or Fab fragments of IgG.
  • the method comprises contacting IgG with a polypeptide of the invention.
  • the method of the invention is used to detect IgG. This may comprise (i) contacting a sample with a polypeptide under conditions that permit the IgG specific cysteine protease activity of the polypeptide; and (ii) monitoring for the presence of IgG specific cleavage fragments; wherein the presence of the specific cleavage fragments is indicative of IgG in the sample.
  • S. suis strain 10 is a virulent serotype 2 strain that has been used in several studies for mutagenesis and experimental infections of pigs (Smith et al. 1999. Infect. Immun. 67, 1750-1756).
  • Strain 10M7 was kindly provided by Hilde Smith (AWG, Lelystad,
  • S.suis strain 10M7 cultures were harvested at approximately OD 6 oo of ⁇ 0.6 and culture supernatants were sterile- filtrated through a 0.22 ⁇ Express PLUS membrane filter (Millipore) prior to fractionating the culture supernatant with ammonium sulfate to 30% saturation. The resulting precipitate was discarded and ammonium sulfate was added to the remaining supernatant to a final concentration of 50% saturation. The second precipitate was resuspended in 1/100 of the starting volume with 20 mM Bis-Tris pH 6.8 and buffer exchange against the same buffer was performed by HiPrep 26/10 Desalting column (GE Healthcare). The material was further fractionated by FPLC on a HiTrap Q HP column (GE Healthcare).
  • Proteins were eluted by a linear NaCl gradient, and fractions eluted at ⁇ 0.2 M NaCl were found to contain the IgG degrading activity.
  • the active fractions were subjected to size exclusion chromatography (HiPrep 16/60 Sephacryl S-100 HR, GE Healthcare) and there the IgG degrading activity was eluted at ⁇ 37 ml elution volume. Active fractions were analyzed by SDS-PAGE and protein bands were subjected to Mass spectrometry analysis. Mass spectroscopy
  • MALDI-TOF mass spectroscopy was performed by Umea Protein Analysis Facility (Umea University). Peptides for MS analysis were prepared by in-gel digestion using trypsin (sequencing grade modified, Promega) and analyzed by ESI LC-MS/MS using an HCT ultra ETD II iontrap instrument (Bruker) linked to an Easy nano LC system
  • thermosensitive vector pSET5 _AigdE a 618 bp 5 '- igdE am licon was generated with primers
  • Sequence analyses were performed using the SIB Bioinformatics Resource Portal Expasy (www.expasy.ch). SignalP 4.0 was run to identify a putative signal peptide and the respective cleavage sites (www.cbs.dtu.dk/services/SignalP/). In silico modelling of S. suis IgdE to identify the potential active site residues was performed using SWISS-MODEL (http://swissmodel.expasy.org/). A putative transmembrane region was identified using the consensus prediction web server TOPCONS (http://topcons.cbr.s i.se/) last accession 2015- 11-06.
  • the S. suis igdE gene lacking the signal peptide coding sequences (encoding amino acid 38-1 121) was amplified from chromosomal DNA of S. suis strain 10 as template using primers IgdE-frw Ncol (GTTTCCATGGATGAAAACTCACATTTACAATCG, SEQ ID NO: 18) and IgdE-rev NotI (ACGTGCGGCCGCATAAGCTTCGTAC, SEQ ID NO: 19) and cloned into pET ZZ la after digestion with Ncol and Notl (Thermo Scientific). The entire insert was sequenced to verify the cloning and the sequence of S. suis igdE.
  • the obtained sequence of S. suis strain 10 igdE was identical to the one of S. suis 05ZYH33 and contained an insertion of 32 amino acids compared to SSU RS08150 of S. suis Pl/7.
  • IgdE- H333A CAGAAGGTGTCCCGGCTGCTACAGCGCGTG, SEQ ID NO:21
  • IgdE- H333A CAGAAGGTGTCCCGGCTGCTACAGCGCGTG
  • D348A (TAAAAAGTGGCACACCATTGCCGGTACAGGTTTTATTACAG, SEQ ID NO:
  • IgdE AC consisting of the N-terminal 470 amino acids of S. suis IgdE was created by digesting full-length igdE in pZZla with restriction endonucleases Xhol (Thermo Scientific). The digested plasmids were purified, re-ligated and transformed into E. coli.
  • E. coli ArcticExpress (DE3)_RIL (Agilent Technologies) isolates carrying pET_ZZ_la igdE, igdE C302& , igdE m02A , igdE O302A or igdE AC were grown to ODeoo 0.6 at 30°C. Protein expression was induced with 1 mM IPTG at 12°C and incubation was continued for an additional 22 h.
  • the IgG degradation reaction was performed in the presence of 0.1-5 mM AEBSF (Sigma), 0.1-5 mM EDTA, 50-250 ⁇ E-64 (Sigma), 0.1-5 mM Z-LVG-CHN 2 (Bachem), 0.1-5 mM Iodoacetamide (Sigma) or 1/200 to 1/50 dilution of complete protease inhibitor cocktail (Roche).
  • porcine IgG porcine IgG
  • PBS PBS
  • other species human, goat, cow, horse and mouse
  • 10 nM purified rlgdE for 16 h at 37°C prior subjection to SDS-PAGE under either reducing or non-reducing conditions.
  • IgG degradation reaction was performed with 0.25 mg/ml porcine IgG and 2 ⁇ purified IgdE AC at 37°C in PBS uninhibited or in the presence of 2.5 ⁇ or 250 ⁇ AEBSF (Sigma), EDTA, E-64
  • Uninhibited over-night cleavage was set as 100% relative cleavage for the time course experiment.
  • the initial cleavage rate was calculated from the initial increase of cleavage product (0-25% relative cleavage) and the initial cleavage rate of the uninhibited reaction was set as 100% relative activity.
  • Experiments were at least performed in triplicates. Statistical analyses were performed using GraphPad Prism Version 5.0.
  • Samples for SDS-PAGE were prepared with either reducing or non-reducing sample buffer and heated to 95°C for 5 min. 12% SDS-PAGE was either stained with Coomassie blue (Sigma), Coomassie FluorTM Orange Protein Gel Stain (Invitrogen) or blotted to Hybond-P PVDF membrane (GE Healthcare) for western blot analyses.
  • Membranes were blocked with 5% dry milk powder in 0.1 % PBS-Tween, followed by incubation with horse-radish peroxidase conjugated antibodies.
  • Goat anti-pig IgG-HRP (Thermo Scientific) and goat anti-porcine IgM-HRP (Thermo Scientific) was diluted 1 :25'000 and goat anti-porcine IgA-HRP (Thermo Scientific) was diluted 1 :12 ' 500.
  • S. suis IgdE processed porcine IgG was separated by SDS-PAGE as previously explained and transferred by semi-dry blotting on Hybond-P PVDF membrane (GE Healthcare) with 50 mM sodium-borate / 20% MetOH as blotting buffer. The membrane was stained with Ponceau S (Sigma) and after drying the ⁇ 32 kDa degradation product was tightly cut out. N-terminal Edman sequencing of the degradation product was performed by Proteome Factory (Berlin, Germany) and the sequence W/C PICPACE was obtained. The first position sequence determination was complicated due to a likely contamination yielding a strong tryptophan peak and only a minor peak at the cysteine position.
  • IgG titers against S. suis IgdE Maxisorb ® plates were coated with 0.6 ⁇ g rlgdE protein using carbonate buffer. After coating the plates were washed three times with PBS plus 0.1% Tween 20 (PBST) and blocked with 5% milk powder in PBS for 2 h at 37°C. Every sample and the controls were measured in a duplicate series of four (positive reference serum: six) twofold dilutions in PBST starting with a dilution of 1 : 100.
  • PBST PBS plus 0.1% Tween 20
  • ELISA values obtained from a serum sample drawn 20 days after experimental infection with S. suis strain 10 was arbitrary set to 100 ELISA units, while ELISA values from serum samples derived from colostrum deprived piglets were used as negative control.
  • Proteolytic activities of extracellular enzymes of S. suis were analyzed by incubating concentrated supernatants of S. suis strain 10 and the isogenic IgM protease mutant l OAidessuis with 2%> porcine plasma as putative substrate. After 3 hours of incubation, the reaction was analyzed by reducing SDS-PAGE. Interestingly, the plasma protein band patterns obtained from bacterial culture supernatants of both wild type strain 10 and the isogenic IgM protease mutant l OAidessuis contained an additional protein band of approximately 32 kDa, which was absent in the porcine plasma control (Fig. 1 A).
  • the 32 kDa band was excised, subjected to MALDI-TOF mass spectroscopy and identified as an IgG degradation product showing the presence of an IgG proteolytic activity in S. suis.
  • growth supernatant of bacterial cultures was fractionated by adding increasing amounts of ammonium sulfate (0 to 80% saturation). Fractions were tested for IgG cleaving activity with porcine plasma and IgG degradation fragments were detected by Western blot using specific polyclonal anti- porcine IgG antibodies.
  • IgdE Purification and sequence characteristics of IgdE, a novel protease of S. suis
  • protease enriched ammonium sulfate precipitates were tested for IgG cleaving activity in the presence of class specific protease inhibitors to preliminary classify the putative IgG protease.
  • Metallo protease inhibitor EDTA did not affect IgG cleavage, while serine protease inhibitor AEBSF interfered moderately with IgG cleavage.
  • Cysteine protease inhibitors E-64, Z-LVG-CFIN2 and iodoacetamide appeared to inhibit IgG degrading activity (Fig. 8).
  • Protein bands were identified by MALDI-TOF mass spectrometry and similarity searches against NCBI databases using a pBLAST algorithm. Since the initial characterization of the IgG proteolytic enzyme indicated that the protease is most likely a secreted cysteine protease, sequences of identified proteins were screened for i) the presence of a cysteine residue within the core of the protein and ii) the presence of a secretion signal peptide. Beside Idessuis that previously has been shown to be IgM specific two (out of ten) identified proteins contained a putative catalytic cysteine residue, but only one contained both a signal peptide sequence predicted by the SignalP algorithm and a core cysteine residue.
  • SSU RS08150 encodes a 1121 amino acid protein (GenBank accession no
  • WP O 12027720 with a putative transglutaminase core sequence motif located in the N- terminal half of the protein within amino acids 188 to 265.
  • the TOPCONS consensus prediction of membrane protein topology identified a putative transmembrane helix in the C-terminal approximately between amino acids 1059-1080.
  • the predicted size of 118kDa (without signal sequence) is somewhat less than the estimated size of the initially purified protein band after SDS-PAGE (data not shown), which is due to the slightly slower migration of proteins with low pi (pi 4.66) on SDS-PAGE.
  • the full-length putative protein sequence was used in similarity searches against NCBI databases using a pBLAST algorithm.
  • the N-terminal part of the protease shows also some similarity to hypothetical proteins of Streptococcus agalactiae and Streptococcus merionis (approximately 32% identity).
  • the putative protein is in some databases denoted as ribonuclease or ribonucleases G and E, but due to the absence of an experimentally confirmed function and based on the enzymatic activity against porcine IgG, the protein was denoted IgdE for Immunoglobulin G degrading enzyme of
  • IgdE is a novel cysteine protease
  • the S. suis IgdE sequence reveals the presence of a single cysteine residue in position 302 that, due to the inhibitor profile, is assumed to represent the catalytic site cysteine.
  • silico 3D-modelling http://swissmodel.expasy.org
  • S. suis IgdE using known transglutaminase domain structures as template, revealed a putative active site cleft in the N-terminal part of the protein containing a potential catalytic triad consisting of cysteine 302, histidine 333 and aspartic acid 348.
  • For identification of the putative protease domain and catalytic site residues of S. suis IgdE several recombinant IgdE constructs were created (Fig. 2A).
  • the IgG cleaving activity could be assigned to the N- terminal part of the protein, as a recombinant protein lacking amino acids 471 to 1121 is sufficient for IgG cleaving activity (Fig. 2B, lane 7).
  • SDS-PAGE analysis of porcine IgG incubated with the mutant proteins revealed that neither rIgdE C302S nor rIgdE H333A exhibited IgG cleaving activity, while rIgdE D348A showed somewhat reduced IgG cleaving activity.
  • these data strongly indicate that these three residues are part of the catalytic site of S. suis IgdE.
  • the inhibitor screen was repeated with purified recombinant IgdEAC and class specific protease inhibitors.
  • IgdE is not calcium dependent, as the protease is fully active in the presence of EDTA, while cysteine class specific inhibitors iodoacetamide and Z-LVG-CFIN2 efficiently interfered with IgG proteolytic activity as no cleavage product at all could be detected at 125 fold molar excess of inhibitor even after 18h incubation (Fig. 3).
  • the serine protease inhibitor AEBSF inhibited the IgdEAC moderately at 125 fold molar excess.
  • E-64 did not inhibit purified IgdEAC in this experimental setting, which might be due to a narrow active site similar as described for other streptococcal Ig- proteases, like IdeS and Idessuis.
  • Porcine IgG degradation products were analyzed by reducing and non-reducing SDS-PAGE. The observed band pattern under non-reducing conditions is consistent with a cleavage site located in the hinge region of the heavy chain just N-terminal of the interconnecting disulfide bonds (Fig. 4A). IgG degradation products obtained under reducing conditions (Fig. 4B) were subjected to N-terminal Edman sequencing and the obtained sequence C*PICPACE was found in the hinge region sequences of porcine IgG2ab, IgG4ab, and IgG6ab subtypes. Similar sequences with CPICPGCE as common motif are present in the hinge region of IgGlab and IgG5ab subtypes, while IgG3 exhibited a CPxxxxC sequence in the hinge region (Table3).
  • the host specificity of the protease was investigated by incubation of purified S. suis IgdE with IgG preparations of humans, goat, bovine, horse and mouse (Fig. 5B). Interestingly, only pig IgG was found to be a substrate for this novel IgG protease. Thus, IgdE shows a pronounced species specificity and targets only porcine IgG.
  • S. suis IgdE body fluids of healthy or diseased piglets were used. Fluids from heart sac, abdominal cavity, and joint, as well as cerebrospinal fluid and serum were treated with recombinant S. suis IgdE and analyzed by SDS-PAGE (Fig. 6A) and by Western blot using porcine IgG specific antibodies (Fig. 6B). No apparent change in the protein band pattern, except for the appearance of the diagnostic IgG cleavage product could be observed in the presence of rlgdE in heart sac, abdominal cavity and serum samples. Also no IgG, i.e. no cleavage products, were present in joint fluid and cerebrospinal fluids of healthy pigs.
  • S. suis IgdE is a highly specific IgG protease, complementing the previously described IgA and IgM degrading proteases of S. suis (Seele supra; Zhang et al. 2010. Vet. Microbiol. 140, 171-175). IgdE is the sole IgG cleaving enzyme expressed by S. suis
  • IgG and IgM cleaving activities in growth supernatant from wild type strain 10 were determined by Western blot using specific polyclonal anti-porcine IgG or IgM antibodies (Fig. 7). As expected, wild type strain 10 exhibited IgG and IgM cleaving activity (Fig.
  • IgdE domain was used as query sequence in blastp searches (E -value cutoff 1 to keep all possible proteases) against the NCBI sequences as well as the PATRIC sequences.
  • the obtained hits were in turn used as query sequences against the same databases, using the same parameters. From the list of matched sequences we chose those that in the second round had a match that overlap with the region matched in the first round, when IgdE was used as query. Sequences not containing the 'C in the catalytic site were removed from further consideration, and in case of identical sequences only one copy was kept.
  • S-layer homology domain W These are often present in two or more copies in the same genome, and have a SxC or GxC motif in the catalytic site instead the AxC motif found in the original IgdE sequences.
  • these sequences fit well to the Pfam model 'Transglut core'.
  • all sequences matching to the Transglut core model with an E-value of at most le-6 were removed, as well as sequences lacking the AxC motif. The remaining sequences were cut at both ends to contain only the parts matching the IgdE domain sequence. In cases this resulted in identical "domain" sequences only one copy was kept.
  • proteas belonging to the IgdE family were identified in S. porcinus, S. agalactiae, S. equi, and S. pseudoporcinus. The protease were cloned, expressed and characterized.
  • N-terminal sequence of the 32 kDa degradation product of human IgG is H(or G or S)TCPPCPAPE as shown by N-terminal Edman sequencing indicating that that this protein has the same cleavage site as papain in IgGl in the hinge region N- terminal of the cysteine residues believed to be involved in H-H covalent bonds between the heavy chains.
  • N-terminal sequence of the 32 kDa degradation product of porcine IgG is CPICPACE as shown by N-terminal Edman sequencing indicating that that this protein has the same cleavage site as IgdE within porcine IgG.
  • a polypeptide for use in generating an immune response in a subject comprising:
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity ;
  • a polynucleotide for use in generating an immune response in a subject comprising:
  • (n) a sequence having at least 70%> identity to a sequence as defined in (k) or (1); (o) a fragments of any of the sequences (k), (1), (m) or (n), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably a S. porcinus in a subject;
  • (x) a sequence having at least 70% identity to a sequence as defined in (u) or (v); or (y) a fragments of any of the sequences (u), (v), (w) or (x), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably S. pseudoporcinus in a subject.
  • a polypeptide for use in treatment or prevention of a disease or condition mediated by IgG antibodies comprising:
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;
  • (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;
  • a method for identifying a substance that activates or inhibits the IgG cysteine activity of an IgdE polypeptide comprising the steps;

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2017/052463 2016-02-04 2017-02-03 New streptococcal proteases Ceased WO2017134274A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
PL17703958T PL3411389T3 (pl) 2016-02-04 2017-02-03 Nowe proteazy streptokokowe
CA3013527A CA3013527C (en) 2016-02-04 2017-02-03 New streptococcal proteases
EP17703958.3A EP3411389B1 (en) 2016-02-04 2017-02-03 New streptococcal proteases
SG11201806639VA SG11201806639VA (en) 2016-02-04 2017-02-03 New streptococcal proteases
US16/075,059 US12006530B2 (en) 2016-02-04 2017-02-03 Streptococcal proteases
AU2017214441A AU2017214441B2 (en) 2016-02-04 2017-02-03 New Streptococcal proteases
DK17703958.3T DK3411389T3 (da) 2016-02-04 2017-02-03 Nye streptokokproteaser
ES17703958T ES2877754T3 (es) 2016-02-04 2017-02-03 Nuevas proteasas estreptocócicas
CN201780022485.6A CN109311951B (zh) 2016-02-04 2017-02-03 新型链球菌蛋白酶
KR1020187025476A KR102704583B1 (ko) 2016-02-04 2017-02-03 신규한 스트렙토코커스 프로테아제
JP2018540841A JP7123801B2 (ja) 2016-02-04 2017-02-03 新しい連鎖球菌プロテアーゼ
JP2022056522A JP2022115853A (ja) 2016-02-04 2022-03-30 新しい連鎖球菌プロテアーゼ

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE1630021 2016-02-04
SE1630021-2 2016-02-04

Publications (1)

Publication Number Publication Date
WO2017134274A1 true WO2017134274A1 (en) 2017-08-10

Family

ID=57995190

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/052463 Ceased WO2017134274A1 (en) 2016-02-04 2017-02-03 New streptococcal proteases

Country Status (13)

Country Link
US (1) US12006530B2 (https=)
EP (1) EP3411389B1 (https=)
JP (2) JP7123801B2 (https=)
KR (1) KR102704583B1 (https=)
CN (1) CN109311951B (https=)
AU (1) AU2017214441B2 (https=)
CA (1) CA3013527C (https=)
DK (1) DK3411389T3 (https=)
ES (1) ES2877754T3 (https=)
PL (1) PL3411389T3 (https=)
PT (1) PT3411389T (https=)
SG (1) SG11201806639VA (https=)
WO (1) WO2017134274A1 (https=)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020016318A1 (en) 2018-07-17 2020-01-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
CN111447946A (zh) * 2017-12-15 2020-07-24 英特维特国际股份有限公司 用于针对猪链球菌进行保护的疫苗
US10955420B2 (en) 2016-09-07 2021-03-23 Mayo Foundation For Medical Education And Research Identification and monitoring of cleaved immunoglobulins by molecular mass
WO2021067598A1 (en) 2019-10-04 2021-04-08 Ultragenyx Pharmaceutical Inc. Methods for improved therapeutic use of recombinant aav
WO2021163322A1 (en) 2020-02-14 2021-08-19 Ultragenyx Pharmaceutical Inc. Gene therapy for treating cdkl5 deficiency disorder
US11209439B2 (en) 2015-09-24 2021-12-28 Mayo Foundation For Medical Education And Research Identification of immunoglobulin free light chains by mass spectrometry
EP4079848A1 (en) 2021-04-22 2022-10-26 Genovis Ab Immunoglobulin cleaving enzyme
CN115398241A (zh) * 2020-02-14 2022-11-25 汉莎生物制药股份有限公司 免疫球蛋白检测及相关治疗
WO2022266044A1 (en) * 2021-06-15 2022-12-22 The University Of North Carolina At Chapel Hill Methods and compositions for depleting antibodies
WO2023019168A1 (en) 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions and methods for treating a muscular dystrophy
US11584922B2 (en) 2017-05-26 2023-02-21 Genovis Ab Protease and binding polypeptide for O-glycoproteins
US11604196B2 (en) 2014-04-04 2023-03-14 Mayo Foundation For Medical Education And Research Isotyping immunoglobulins using accurate molecular mass
WO2023088988A1 (en) * 2021-11-18 2023-05-25 Intervet International B.V. A method to produce a vaccine against streptococcus suis and the said vaccine
US11946937B2 (en) 2017-09-13 2024-04-02 Mayo Foundation For Medical Education And Research Identification and monitoring of apoptosis inhibitor of macrophage
US12153052B2 (en) 2017-09-13 2024-11-26 Mayo Foundation For Medical Education And Research Identification and monitoring of immunoglobulin J chains
US12546782B2 (en) 2013-03-15 2026-02-10 Mayo Foundation For Medical Education And Research Identification and monitoring of monoclonal immunoglobulins related to monoclonal gammopathy by molecular mass with mass spectrometry
WO2026062146A1 (en) 2024-09-18 2026-03-26 Genovis Ab Immunoglobulin proteases and their uses

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2017214441B2 (en) 2016-02-04 2021-08-19 Genovis Ab New Streptococcal proteases
WO2021254479A1 (zh) * 2020-06-18 2021-12-23 上海宝济药业有限公司 一种免疫球蛋白降解酶IdeE的突变体
CA3195177A1 (en) 2020-10-07 2022-04-14 Asklepios Biopharmaceutical, Inc. Therapeutic adeno-associated virus delivery of fukutin related protein (fkrp) for treating dystroglycanopathy disorders including limb girdle 2i (lgmd2i)
WO2022221529A1 (en) 2021-04-16 2022-10-20 Asklepios Biopharmaceutical, Inc. Rational polyploid aav virions that cross the blood brain barrier and elicit reduced humoral response
JPWO2024111657A1 (https=) * 2022-11-25 2024-05-30
JPWO2025047641A1 (https=) * 2023-08-25 2025-03-06
WO2025256977A1 (en) 2024-06-13 2025-12-18 Bayer Aktiengesellschaft Novel igm and igg cleaving enzymes
WO2025256978A1 (en) 2024-06-13 2025-12-18 Bayer Aktiengesellschaft Variants of igm and igg cleaving enzymes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002092818A2 (fr) * 2001-04-26 2002-11-21 Institut Pasteur Sequence du genome streptococcus agalactiae et ses utilisations
WO2015040125A1 (en) * 2013-09-20 2015-03-26 Genovis Ab A method for analysing a sample of immunoglobulin molecules
EP2949749A1 (en) * 2001-12-18 2015-12-02 Hansa Medical AB Ides, an igg-degrading enzyme of streptococcus pyogenes

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008525033A (ja) 2004-12-22 2008-07-17 ノバルティス ヴァクシンズ アンド ダイアグノスティクス, インコーポレイテッド B群連鎖球菌
PL1901773T3 (pl) 2005-06-09 2012-09-28 Hansa Medical Ab Zastosowanie proteinazy IDES (Z S. Pyogenes) do leczenia chorób autoimmunologicznych oraz odrzutów przeszczepu
DK2190984T3 (da) 2007-09-14 2013-12-02 Genovis Ab Fremgangsmåder og kits til oprensning og påvisning af glycosyleret IgG
GB201115841D0 (en) * 2011-09-13 2011-10-26 Genovis Ab Protein and method
AU2017214441B2 (en) 2016-02-04 2021-08-19 Genovis Ab New Streptococcal proteases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002092818A2 (fr) * 2001-04-26 2002-11-21 Institut Pasteur Sequence du genome streptococcus agalactiae et ses utilisations
EP2949749A1 (en) * 2001-12-18 2015-12-02 Hansa Medical AB Ides, an igg-degrading enzyme of streptococcus pyogenes
WO2015040125A1 (en) * 2013-09-20 2015-03-26 Genovis Ab A method for analysing a sample of immunoglobulin molecules

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL S. F., J MOL EVOL, vol. 36, 1993, pages 290 - 300
ALTSCHUL, S, F ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10
CHRISTIAN SPOERRY ET AL: "Identification and Characterization of IgdE, a Novel IgG-degrading Protease of Streptococcus suis with Unique Specificity for Porcine IgG", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 291, no. 15, 9 February 2016 (2016-02-09), US, pages 7915 - 7925, XP055357332, ISSN: 0021-9258, DOI: 10.1074/jbc.M115.711440 *
DATABASE UniProt [online] 26 June 2007 (2007-06-26), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:ABQ42881.1};", XP002768436, retrieved from EBI accession no. UNIPROT:A5JSJ3 Database accession no. A5JSJ3 *
DATABASE UniProt [online] 5 April 2011 (2011-04-05), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:EFV98161.1};", XP002770337, retrieved from EBI accession no. UNIPROT:E7S231 Database accession no. E7S231 *
DEVEREUX ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387 - 395
GREEN; SHAW, J. BIOL. CHEM., vol. 256, 1981, pages 1923 - 1928
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCL USA, vol. 89, 1992, pages 10915 - 10919
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov>
PROKESOVA ET AL., IMMUNOL. LETT., vol. 31, 1992, pages 259 - 265
RAWLINGS ET AL., NUCLEIC ACIDS RES., vol. 42, 2014, pages 503 - 509
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989
SEELE ET AL., J. BACTERIOL., vol. 195, 2013, pages 930 - 940
SEELE ET AL., J. VET. RES., vol. 46, 2015, pages 45
SMITH ET AL., INFECT. IMMUN., vol. 64, 1996, pages 4409 - 4412
SMITH ET AL., INFECT. IMMUN., vol. 67, 1999, pages 1750 - 1756
VINCENTS ET AL., FASEB J., vol. 10, 2011, pages 3741 - 3750
VON PAWEL-RAMMINGEN ET AL., EMBO J., vol. 21, 2002, pages 1607 - 161
ZHANG ET AL., VET. MICROBIOL., vol. 140, 2010, pages 171 - 175

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12546782B2 (en) 2013-03-15 2026-02-10 Mayo Foundation For Medical Education And Research Identification and monitoring of monoclonal immunoglobulins related to monoclonal gammopathy by molecular mass with mass spectrometry
US12099065B2 (en) 2014-04-04 2024-09-24 Mayo Foundation For Medical Education And Research Isotyping immunoglobulins using accurate molecular mass
US11604196B2 (en) 2014-04-04 2023-03-14 Mayo Foundation For Medical Education And Research Isotyping immunoglobulins using accurate molecular mass
US11209439B2 (en) 2015-09-24 2021-12-28 Mayo Foundation For Medical Education And Research Identification of immunoglobulin free light chains by mass spectrometry
US10955420B2 (en) 2016-09-07 2021-03-23 Mayo Foundation For Medical Education And Research Identification and monitoring of cleaved immunoglobulins by molecular mass
US11584922B2 (en) 2017-05-26 2023-02-21 Genovis Ab Protease and binding polypeptide for O-glycoproteins
US12529044B2 (en) 2017-05-26 2026-01-20 Genovis Ab Protease and binding polypeptide for O-glycoproteins
US12448614B2 (en) 2017-05-26 2025-10-21 Genovis Ab Enzymes for glycan analysis
US12153052B2 (en) 2017-09-13 2024-11-26 Mayo Foundation For Medical Education And Research Identification and monitoring of immunoglobulin J chains
US11946937B2 (en) 2017-09-13 2024-04-02 Mayo Foundation For Medical Education And Research Identification and monitoring of apoptosis inhibitor of macrophage
US12295999B2 (en) 2017-12-15 2025-05-13 Intervet Inc. Vaccine for protection against Streptococcus suis
CN111447946A (zh) * 2017-12-15 2020-07-24 英特维特国际股份有限公司 用于针对猪链球菌进行保护的疫苗
EP4154904A1 (en) 2018-07-17 2023-03-29 Institut National De La Sante Et De La Recherche Medicale - Inserm Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
WO2020016318A1 (en) 2018-07-17 2020-01-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
US12544437B2 (en) 2019-10-04 2026-02-10 Ultragenyx Pharmaceutical Inc. Methods for improved therapeutic use of recombinant AAV
WO2021067598A1 (en) 2019-10-04 2021-04-08 Ultragenyx Pharmaceutical Inc. Methods for improved therapeutic use of recombinant aav
CN115398241A (zh) * 2020-02-14 2022-11-25 汉莎生物制药股份有限公司 免疫球蛋白检测及相关治疗
EP4103947A1 (en) * 2020-02-14 2022-12-21 Hansa Biopharma AB Immunoglobulin detection and associated therapies
WO2021163322A1 (en) 2020-02-14 2021-08-19 Ultragenyx Pharmaceutical Inc. Gene therapy for treating cdkl5 deficiency disorder
WO2022223818A1 (en) 2021-04-22 2022-10-27 Genovis Ab Immunoglobulin cleaving enzyme
EP4079848A1 (en) 2021-04-22 2022-10-26 Genovis Ab Immunoglobulin cleaving enzyme
WO2022266044A1 (en) * 2021-06-15 2022-12-22 The University Of North Carolina At Chapel Hill Methods and compositions for depleting antibodies
WO2023019168A1 (en) 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions and methods for treating a muscular dystrophy
WO2023088988A1 (en) * 2021-11-18 2023-05-25 Intervet International B.V. A method to produce a vaccine against streptococcus suis and the said vaccine
WO2026062146A1 (en) 2024-09-18 2026-03-26 Genovis Ab Immunoglobulin proteases and their uses

Also Published As

Publication number Publication date
JP2022115853A (ja) 2022-08-09
PT3411389T (pt) 2021-06-28
CN109311951A (zh) 2019-02-05
CA3013527C (en) 2023-09-05
JP2019506866A (ja) 2019-03-14
KR102704583B1 (ko) 2024-09-06
US20190345533A1 (en) 2019-11-14
DK3411389T3 (da) 2021-06-21
AU2017214441B2 (en) 2021-08-19
ES2877754T3 (es) 2021-11-17
US12006530B2 (en) 2024-06-11
EP3411389A1 (en) 2018-12-12
JP7123801B2 (ja) 2022-08-23
CN109311951B (zh) 2022-10-11
KR20180124857A (ko) 2018-11-21
EP3411389B1 (en) 2021-03-24
CA3013527A1 (en) 2017-08-10
AU2017214441A1 (en) 2018-08-16
SG11201806639VA (en) 2018-09-27
PL3411389T3 (pl) 2021-10-25

Similar Documents

Publication Publication Date Title
US12006530B2 (en) Streptococcal proteases
CN104870468B (zh) 用于制备经蛋白水解处理的多肽的方法
EP3049105B1 (en) Vaccine
EP2756077B1 (en) Endoglycosidase from streptococcus pyogenes and methods using it
Roberts et al. Novel expression of Haemonchus contortus vaccine candidate aminopeptidase H11 using the free-living nematode Caenorhabditis elegans
Spoerry et al. Identification and characterization of IgdE, a novel IgG-degrading protease of Streptococcus suis with unique specificity for porcine IgG
Leão et al. Transcriptomic basis for an antiserum against Micrurus corallinus (coral snake) venom
Kukreja et al. Immunological characterization of the subunits of type A botulinum neurotoxin and different components of its associated proteins
Farias et al. On the three-finger protein domain fold and CD59-like proteins in Schistosoma mansoni
Zane et al. Peptide linker increased the stability of pneumococcal fusion protein vaccine candidate
Kang et al. Identification and characterization of the second cysteine protease inhibitor of Clonorchis sinensis (CsStefin-2)
Kobayashi et al. Functional activities of the Tsh protein from avian pathogenic Escherichia coli (APEC) strains
Chen et al. Molecular characterization of cathepsin B from Clonorchis sinensis excretory/secretory products and assessment of its potential for serodiagnosis of clonorchiasis
Kwon et al. Recombinant adenylate kinase 3 from liver fluke Clonorchis sinensis for histochemical analysis and serodiagnosis of clonorchiasis
CN107208128A (zh) 用于分析抗体样本中的聚集体的方法
Van der Geld et al. Expression of recombinant proteinase 3, the autoantigen in Wegener's granulomatosis, in insect cells
Bruno et al. Identification and characterization of serine proteinase inhibitors from Neospora caninum
Choi et al. Molecular and biochemical characterization of hemoglobinase, a cysteine proteinase, in Paragonimus westermani
Wu et al. Soluble expression and purification of the anthrax protective antigen in E. coli and identification of a novel dominant-negative mutant N435C
Liu et al. Molecular cloning, expression and characterization of aspartyl protease inhibitor from Ancylostoma ceylanicum
WO2002072624A2 (en) Assays, methods and means for targeting streptococcal inhibitor of complement (sic)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17703958

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3013527

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018540841

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11201806639V

Country of ref document: SG

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017214441

Country of ref document: AU

Date of ref document: 20170203

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187025476

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020187025476

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2017703958

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017703958

Country of ref document: EP

Effective date: 20180904