WO2017094743A1 - COMPOSITION PHARMACEUTIQUE AYANT UNE ACTIVITÉ D'INHIBITION DE LA 11β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I - Google Patents

COMPOSITION PHARMACEUTIQUE AYANT UNE ACTIVITÉ D'INHIBITION DE LA 11β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I Download PDF

Info

Publication number
WO2017094743A1
WO2017094743A1 PCT/JP2016/085471 JP2016085471W WO2017094743A1 WO 2017094743 A1 WO2017094743 A1 WO 2017094743A1 JP 2016085471 W JP2016085471 W JP 2016085471W WO 2017094743 A1 WO2017094743 A1 WO 2017094743A1
Authority
WO
WIPO (PCT)
Prior art keywords
substituted
unsubstituted
aromatic heterocyclic
formula
compound
Prior art date
Application number
PCT/JP2016/085471
Other languages
English (en)
Japanese (ja)
Inventor
道賢 畑中
Original Assignee
塩野義製薬株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 塩野義製薬株式会社 filed Critical 塩野義製薬株式会社
Publication of WO2017094743A1 publication Critical patent/WO2017094743A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A61K31/4155—1,2-Diazoles non condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4178—1,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4245—Oxadiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/18—One oxygen or sulfur atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/18—One oxygen or sulfur atom
    • C07D231/20—One oxygen atom attached in position 3 or 5
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/99—Enzyme inactivation by chemical treatment

Definitions

  • the present invention has a type I 11 ⁇ -hydroxysteroid dehydrogenase type 1 (hereinafter referred to as 11 ⁇ -HSD-1) inhibitory activity, a pharmaceutical agent, particularly a therapeutic agent for a pathological condition involving hyperglucocorticoidemia, and
  • 11 ⁇ -HSD-1 type I 11 ⁇ -hydroxysteroid dehydrogenase type 1
  • the present invention relates to a compound useful as a preventive agent.
  • 11 ⁇ -HSD-1 is an enzyme that converts 11 ⁇ -dehydrosteroid, which is an inactive steroid, into an active steroid, and is considered to have important significance in the basal metabolism of the living body (Non-patent Document 1).
  • the 11 ⁇ -HSD-1 knockout mouse is resistant to hyperglycemia associated with obesity and stress (Non-patent Document 2).
  • the same phenomenon was observed in humans when carbenoxolone, an 11 ⁇ -HSD-1 inhibitor, was administered (Non-patent Document 3).
  • Non-patent document 5 describes that 11 ⁇ -HSD-1-KO mice are resistant to muscle atrophy induced by chronic administration of corticosterone, but no example of administration of a compound is described. Absent. Patent Document 1 discloses a compound having 11 ⁇ -HSD-1 inhibitory activity, but the compound of the present invention is useful for the treatment and / or prevention of pathological conditions involving hyperglucocorticoidemia, particularly muscle atrophy. That is not disclosed.
  • An object of the present invention is to provide a therapeutic and / or prophylactic agent excellent in a pathological condition involving hyperglucocorticoidemia.
  • the present invention (1) Formula (I): (Where Ring A is And Ring B is a substituted or unsubstituted aromatic heterocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring, R 1 is hydrogen or substituted or unsubstituted alkyl; R 2 is —OR 5 or —SR 5 ; R 3 is a group represented by the formula: —CH ⁇ CH—C (R a R b ) —R c —R d , R a and R b are each independently hydrogen, substituted or unsubstituted alkyl or halogen; R c is — (CH 2 ) n— (where n is an integer from 0 to 3); R d is hydrogen, halogen, hydroxy, carboxy, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstit
  • the compound represented by the formula (I) is Formula (II): (Wherein ring A, R 1 , R 2 and R 3 have the same meanings as (1) above), the compound of the above (1) or a pharmaceutically acceptable salt thereof is effective.
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia characterized by containing as a component.
  • Ring A is represented by formula (III): (Wherein R 4 has the same meaning as (1) above) and contains the compound of the above (1) or (2) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia which is characterized.
  • Hyperglucocorticoidemia comprising as an active ingredient the compound according to any one of (1) to (3) above, wherein R 1 is hydrogen, or a pharmaceutically acceptable salt thereof.
  • Therapeutic and / or prophylactic agent for pathological conditions involving (5) The compound or a pharmaceutically acceptable salt thereof according to any one of (1) to (4), wherein R 2 is —OR 5 (where R 5 has the same meaning as (1) above).
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia characterized by comprising as an active ingredient.
  • R 2 is —SR 5 (where R 5 has the same meaning as (1) above).
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia characterized by comprising as an active ingredient.
  • R a and R b each independently contains, as an active ingredient, the compound according to the above (1) to (7) or a pharmaceutically acceptable salt thereof, which is substituted or unsubstituted alkyl.
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia characterized by comprising as an active ingredient.
  • R d is represented by the formula: —C ( ⁇ O) —NR g R h, wherein R g and R h are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkyloxy or A compound represented by any one of the above (1) to (8) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • R d is represented by the formula: —NR i R j wherein R i and R j are each independently hydrogen, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted An alkylcarbonyl or a substituted or unsubstituted non-aromatic heterocyclic carbonyl.) Or a pharmaceutically acceptable salt thereof, which is a group represented by any one of the above (1) to (8) A therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia, characterized by containing as a component.
  • R 4 is —OR 6 , —CH 2 OH, —CH 2 OCONR 7 R 8 or —CH 2 NHCOR 12 , wherein R 12 is substituted or unsubstituted alkyl, and R 6 to R 8 are the above ( 1) and a pharmaceutically acceptable salt thereof as an active ingredient, wherein the hyperglucocorticoidemia is the same as 1) Therapeutic and / or prophylactic agent for pathological conditions involving (13)
  • the compound or a pharmaceutically acceptable salt thereof according to any one of (1) to (12) above, wherein R 7 and R 8 are each independently hydrogen or substituted or unsubstituted alkyl.
  • a therapeutic and / or prophylactic agent for a pathological condition associated with hyperglucocorticoidemia characterized by comprising: (14)
  • the compound represented by the formula (I) is Formula (II): Wherein ring A is represented by formula (III): (Wherein R 4 is —OH or —OC ( ⁇ O) NH 2 ), R 1 is hydrogen; R 2 is —OR 5 or —SR 5 ; R 5 is isopropyl; R 3 is the formula: —CH ⁇ CH—C (CH 3 ) 2 —NH (—C ⁇ O) —CH 3 )) or a pharmaceutically acceptable salt thereof as an active ingredient
  • a therapeutic and / or prophylactic agent for a pathological condition associated with hyperglucocorticoidemia characterized by comprising: (15) The therapeutic and / or prophylactic agent according to any one of (1) to (14) above, wherein the pathological condition associated with hyperglucocorticoidemia is muscle atrophy.
  • the therapeutic and / or prophylactic agent according to (15) above, wherein the pathological condition involving hyperglucocorticoidemia is a disease that decreases muscle mass.
  • the therapeutic and / or prophylactic agent according to (15) above, wherein the pathological condition involving hyperglucocorticoidemia is a disease that increases fat mass.
  • the therapeutic and / or prophylactic agent according to (15) above, wherein the pathological condition associated with hyperglucocorticoidemia is a disease that increases neutral fat.
  • the therapeutic and / or prophylactic agent according to (15) above, wherein the pathological condition associated with hyperglucocorticoidemia is a disease that increases free fatty acids.
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia comprising a compound having an HSD1 inhibitory action or a pharmaceutically acceptable salt thereof as an active ingredient.
  • a compound having an inhibitory action on HSD1 or a pharmaceutically acceptable salt thereof (preferably a compound represented by the formula (I) of the above (1) or a pharmaceutically acceptable salt thereof, particularly preferably a compound I- 30 or a compound I-168, or a pharmaceutically acceptable salt thereof)) as an active ingredient, and an agent for inhibiting muscle mass loss caused in a high glucocorticoid state.
  • a compound having an inhibitory action on HSD1 or a pharmaceutically acceptable salt thereof (preferably a compound represented by the formula (I) in the above (1) or a pharmaceutically acceptable salt thereof, particularly preferably compound I- 30 or Compound I-168, or a pharmaceutically acceptable salt thereof)) as an active ingredient, and an inhibitor of fat mass increase caused in a high glucocorticoid state.
  • a compound having an inhibitory action on HSD1 or a pharmaceutically acceptable salt thereof (preferably a compound represented by formula (I) in the above (1) or a pharmaceutically acceptable salt thereof, particularly preferably compound I- 30 or a compound I-168, or a pharmaceutically acceptable salt thereof)) as an active ingredient, and a neutral fatty acid increase inhibitor caused in a high glucocorticoid state.
  • a compound having an inhibitory action on HSD1 or a pharmaceutically acceptable salt thereof (preferably a compound represented by the formula (I) of (1) above or a pharmaceutically acceptable salt thereof, particularly preferably Compound I- 30 or a compound I-168, or a pharmaceutically acceptable salt thereof)) as an active ingredient, and an inhibitor of increase in free fatty acid caused in a high glucocorticoid state. Is included.
  • the therapeutic agent and / or preventive agent for a pathological condition involving hyperglucocorticoidemia of the present invention is very useful as an excellent therapeutic agent and / or prophylactic agent for muscle atrophy involving hyperglucocorticoidemia.
  • the therapeutic agent and / or prophylactic agent for a disease state involving hyperglucocorticoidemia of the present invention is useful for patients who have developed muscle atrophy due to hypercortisolemia.
  • an excellent therapeutic agent and / or preventive agent for diseases that decrease muscle mass, hyperlipidemia, diseases that increase triglycerides, and / or diseases that increase free fatty acids, which are associated with hyperglucocorticoidemia As very useful.
  • the point includes a point having a small clearance, a point having low toxicity, particularly a cardiotoxicity, or a point having a sufficiently long half-life for exhibiting a medicinal effect.
  • Halogen includes fluorine, chlorine, bromine and iodine. Particularly preferred are fluorine, chlorine and bromine.
  • Alkyl means a linear or branched alkyl group having 1 to 10 carbon atoms, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert- Examples include butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, n-octyl, n-nonyl, n-decyl and the like.
  • alkyl having 1 to 6 or 1 to 4 carbon atoms for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, iso Examples include pentyl, neopentyl, n-hexyl, and isohexyl.
  • Alkenyl means a linear or branched alkenyl having 2 to 8 carbon atoms having one or more double bonds to the above “alkyl”, and examples thereof include vinyl, 1-propenyl, 2 -Propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1,3-butadienyl, 3-methyl-2-butenyl and the like.
  • Alkynyl means linear or branched alkynyl having 2 to 8 carbon atoms having one or more triple bonds to the above “alkyl”, and examples thereof include ethynyl, propynyl, butynyl and the like. It is done. In addition to one or more triple bonds at any position, alkynyl may further have a double bond.
  • Cycloalkyl means a cyclic saturated hydrocarbon group having 3 to 15 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bridged cyclic hydrocarbon group, spiro hydrocarbon. Group and the like.
  • cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and a bridged cyclic hydrocarbon group are used.
  • the “spiro hydrocarbon group” includes a group formed by removing one hydrogen from a ring in which two hydrocarbon rings share one carbon atom. Specific examples include spiro [3.4] octyl.
  • “Bridged cyclic hydrocarbon group” includes a group formed by removing one hydrogen from an aliphatic ring having 5 to 8 carbon atoms in which two or more rings share two or more atoms. To do. Specifically, bicyclo [2.1.0] pentyl, bicyclo [2.2.1] heptyl, bicyclo [2.2.2] octyl and bicyclo [3.2.1] octyl, tricyclo [2.2. 1.0] heptyl and the following groups are exemplified.
  • Cycloalkenyl means a cyclic unsaturated aliphatic hydrocarbon group having 3 to 15 carbon atoms, and examples thereof include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, preferably cyclopropenyl, cyclobutenyl. , Cyclopentenyl and cyclohexenyl. Cycloalkenyl also includes a bridged cyclic hydrocarbon group having an unsaturated bond in the ring. Examples thereof include a group having 1 to 2 double bonds in the ring of the bridged cyclic hydrocarbon group exemplified for the above cycloalkyl.
  • Aryl means a monocyclic aromatic hydrocarbon group (eg, phenyl) and a polycyclic aromatic hydrocarbon group (eg, 1-naphthyl, 2-naphthyl, 1-anthryl, 2-anthryl, 9-anthryl, 1- Phenanthryl, 2-phenanthryl, 3-phenanthryl, 4-phenanthryl, 9-phenanthryl and the like.
  • phenyl or naphthyl (1-naphthyl, 2-naphthyl).
  • “Aromatic heterocyclic group” means a monocyclic aromatic heterocyclic group and a condensed aromatic heterocyclic group.
  • the monocyclic aromatic heterocyclic group is a substitutable optional group derived from a 5- to 8-membered aromatic ring which may contain 1 to 4 oxygen, sulfur and / or nitrogen atoms in the ring. Means a group which may have a bond at the position.
  • the fused aromatic heterocyclic group has 1 to 4 5 to 8 5 to 8 membered aromatic rings which may contain 1 to 4 oxygen, sulfur and / or nitrogen atoms in the ring. It means a group which may have a bond at any substitutable position which is fused with a member aromatic carbocyclic ring or other 5- to 8-membered aromatic heterocycle.
  • aromatic heterocyclic group examples include furyl (eg, 2-furyl, 3-furyl), thienyl (eg, 2-thienyl, 3-thienyl), pyrrolyl (eg, 1-pyrrolyl, 2-pyrrolyl).
  • 3-pyrrolyl imidazolyl (eg, 1-imidazolyl, 2-imidazolyl, 4-imidazolyl), pyrazolyl (eg, 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), triazolyl (eg, 1,2,4- Triazol-1-yl, 1,2,4-triazol-3-yl, 1,2,4-triazol-4-yl), tetrazolyl (eg 1-tetrazolyl, 2-tetrazolyl, 5-tetrazolyl), oxazolyl ( Examples: 2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyl (eg, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl) Zolyl), thiazolyl (eg 2-thiazolyl, 4-thiazolyl, 5-thiazolyl), thiadiazolyl, isothiazolyl (eg 3-isox
  • non-aromatic heterocyclic group may contain 1 to 4 oxygen atoms, sulfur atoms, and / or nitrogen atoms in the ring, and has a bond at any substitutable position.
  • a non-aromatic heterocyclic group may be further bridged with an alkyl chain having 1 to 4 carbon atoms, such as a cycloalkane (preferably a 5 to 6 membered ring), an aromatic carbocycle or an aromatic heterocycle.
  • the ring may be condensed. If it is non-aromatic, it may be saturated or unsaturated. A 5- to 8-membered ring is preferred.
  • alkyl e.g. methyl, ethyl, isopropyl, ter -Butyl
  • alkenyl eg vinyl
  • alkynyl e.g ethynyl
  • cycloalkyl e.g cyclopropyl, adamantyl
  • hydroxyalkyl eg hydroxymethyl
  • cycloalkylalkyl eg cyclohexylmethyl, adamantylmethyl
  • Cycloalkenyl eg: cyclopropenyl
  • aryl eg: phenyl, naphthyl
  • arylalkyl eg: benzyl, phenethyl
  • aromatic heterocyclic group eg: pyridyl, furyl
  • Substituents of “substituted or unsubstituted amino”, “substituted or unsubstituted carbamoyl”, “substituted or unsubstituted thiocarbamoyl” and “substituted or unsubstituted sulfamoyl” include alkyl, alkenyl, aryl, aromatic Heterocyclic group, alkylcarbonyl, arylcarbonyl, aromatic heterocyclic carbonyl, non-aromatic heterocyclic carbonyl, alkyloxycarbonyl, aryloxycarbonyl, aromatic heterocyclic oxycarbonyl, non-aromatic heterocyclic oxycarbonyl, sulfamoyl, alkyl Examples include sulfonyl, carbamoyl, cycloalkylsulfonyl, arylsulfonyl, aromatic heterocyclic sulfonyl, non-aromatic heterocyclic
  • Ring A Is mentioned. Preferably, Is mentioned. In particular, as ring A, Is preferred. Ring A includes both isomers of syn and anti.
  • Ring B includes substituted or unsubstituted heteroaryl or substituted or unsubstituted heterocycle. Preferred are furyl, thienyl, pyrrolyl, pyrazolyl, triazolyl, oxazolyl, thiazolyl, isothiazolyl, pyridyl, morpholino, morpholinyl, piperidyl, piperidino, piperazinyl, pyrrolidinyl, tetrahydrothienyl. In particular, as ring B, pyrazolyl is preferable. Ring B may have a substituent other than R 2 and R 3 .
  • R 1 includes hydrogen or substituted or unsubstituted alkyl.
  • hydrogen, methyl, ethyl, n-propyl and isopropyl are used. Hydrogen is particularly preferable.
  • R 2 includes a group represented by —OR 5 or —SR 5 .
  • —OR 5 is preferable.
  • Another response is preferably -SR 5 .
  • R 3 examples include a group represented by the formula: —CH ⁇ CH—C (R a R b ) —R c —R d .
  • R a and R b each independently include hydrogen, substituted or unsubstituted alkyl, or halogen.
  • a substituted or unsubstituted alkyl is mentioned.
  • both include methyl.
  • R c include — (CH 2 ) n— (where n is an integer of 0 to 3).
  • n 0 or 1 is preferable, and 0 is particularly preferable.
  • R d includes hydrogen, halogen, hydroxy, carboxy, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cyclo Alkenyl, substituted or unsubstituted aryl, substituted or unsubstituted aromatic heterocyclic group, substituted or unsubstituted non-aromatic heterocyclic group, represented by the formula: —C ( ⁇ O) —NR g R h
  • Examples include a group represented by the group or formula: —NR i R j .
  • R d includes halogen, hydroxy, cyano, a substituted or unsubstituted aromatic heterocyclic group or a substituted or unsubstituted non-aromatic heterocyclic group.
  • Another preferred R d is the formula: —C ( ⁇ O) —NR g R h, where R g and R h are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkyl And oxy or substituted or unsubstituted carbamoyl).
  • R d is preferably represented by the formula: —NR i R j where R i and R j are each independently hydrogen, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted alkyloxycarbonyl, substituted Or a substituted alkyl group or a substituted or unsubstituted non-aromatic heterocyclic carbonyl group).
  • R g and R h are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl Substituted or unsubstituted aryl, substituted or unsubstituted aromatic heterocyclic group, substituted or unsubstituted non-aromatic heterocyclic group, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted cycloalkylsulfonyl, And substituted or unsubstituted arylsulfonyl, substituted or unsubstituted aromatic heterocyclic sulfonyl, substituted or unsubstituted nonaromatic heterocyclic sulfonyl, substituted or unsubstituted alkyl
  • R i and R j are each independently hydrogen, carboxy, hydroxy, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted Substituted cycloalkenyl, substituted or unsubstituted aryl, substituted or unsubstituted aromatic heterocyclic group, substituted or unsubstituted non-aromatic heterocyclic group, substituted or unsubstituted acyl, substituted or unsubstituted carbamoyl Substituted or unsubstituted thiocarbamoyl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted cycloalkylsulfonyl, substituted or unsubstituted arylsulfonyl,
  • R 4 includes substituted or unsubstituted alkyl or —OR 6 .
  • —OR 6 —CH 2 OH, —CH 2 OCONR 7 R 8 or —CH 2 NHCOR 12 , (R 6 is hydrogen or —CONR 7 R 8 , and R 7 and R 8 are each independently hydrogen. Or a substituted or unsubstituted alkyl group, and R 12 is a substituted or unsubstituted alkyl group).
  • R 7 and R 8 are each independently hydrogen or substituted or unsubstituted alkyl.
  • n and p are each independently an integer of 1 to 3. m is preferably 1 or 2. p is preferably 1. As the compound represented by the formula (I) or the compound having an HSD1 inhibitory action, the following two compounds are particularly preferable.
  • a therapeutic and / or prophylactic agent for a pathological condition involving hyperglucocorticoidemia characterized by containing a compound having an HSD1 inhibitory action or a pharmaceutically acceptable salt thereof as an active ingredient is preferred.
  • a compound having an HSD1 inhibitory action or a pharmaceutically acceptable salt thereof include the following compounds.
  • Examples of the pharmaceutically acceptable salt of the compound of the present invention include the following salts.
  • Examples of basic salts include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; ammonium salt; trimethylamine salt, triethylamine salt, dicyclohexylamine salt, ethanolamine salt, diethanolamine salt , Triethanolamine salt, procaine salt, meglumine salt, diethanolamine salt or ethylenediamine salt or other aliphatic amine salt; N, N-dibenzylethylenediamine, venetamine salt or other aralkylamine salt; pyridine salt, picoline salt, quinoline salt, isoquinoline Heterocyclic aromatic amine salts such as salts; tetramethylammonium salt, tetraethylammonium salt, benzyltrimethylammonium salt, benzyltriethylammonium salt, benzyltributylammonium salt
  • the acid salt examples include inorganic acid salts such as hydrochloride, sulfate, nitrate, phosphate, carbonate, bicarbonate, perchlorate; acetate, propionate, lactate, maleate, Organic acid salts such as fumarate, tartrate, malate, citrate, ascorbate; sulfonates such as methanesulfonate, isethionate, benzenesulfonate, p-toluenesulfonate; Examples include acidic amino acids such as aspartate and glutamate.
  • the solvate means a solvate of the compound of the present invention or a pharmaceutically acceptable salt thereof, and examples thereof include alcohol (eg, ethanol) solvate and hydrate.
  • examples of the hydrate include monohydrate, dihydrate and the like.
  • “Hyperglucocorticoidemia” refers to a condition in which cortisol, cortisone and / or corticosterone is chronically higher than a reference value, and particularly includes “hypercortisolemia”. Specifically, it refers to a state in which cortisol within 2 hours from waking up is 10 ⁇ g / mL or more, preferably 24.0 ⁇ g / mL or more.
  • the “pathological condition involving hyperglucocorticoidemia” refers to a pathological condition caused by becoming a state of hyperglucocorticoidemia due to an endogenous and / or exogenous cause.
  • First Step This is a step for producing a compound represented by the formula (II-B) by reacting a compound represented by the formula (II-A) with hydrazine.
  • Solvents include N-dimethylformamide, dimethyl sulfoxide, aromatic hydrocarbons (eg, toluene, benzene, xylene, etc.), saturated hydrocarbons (eg, cyclohexane, hexane, etc.), halogenated hydrocarbons (eg, dichloromethane) , Chloroform, 1,2-dichloroethane, etc.), ethers (eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.), esters (eg, methyl acetate, ethyl acetate, etc.), ketones (eg, Acetone, methyl ethyl ketone, etc.), nitriles (eg,
  • alcohols eg, methanol, ethanol, t-butanol, etc.
  • Pro-OH may be used.
  • the reaction may be performed at room temperature or at a temperature at which the solvent used is refluxed for 0.5 to 48 hours.
  • the second step is a step for producing a compound represented by the formula (II-C) by reacting a compound represented by the formula (II-B) with a compound represented by R 5 X in the presence of a base.
  • the solvent the solvent described in Step 1 can be used.
  • ketones eg, acetone, methyl ethyl ketone, etc.
  • N-dimethylformamide may be used.
  • Examples of the base include metal hydrides (eg, sodium hydride), metal hydroxides (eg, sodium hydroxide, potassium hydroxide, lithium hydroxide, barium hydroxide), metal carbonates (eg, sodium carbonate) , Calcium carbonate, potassium carbonate, cesium carbonate, etc.), metal alkoxide (eg, sodium methoxide, sodium ethoxide, potassium t-butoxide, etc.), sodium bicarbonate, metal sodium, organic amine (eg, triethylamine, diisopropylethylamine, DBU) 2,6-lutidine, etc.), pyridine, alkyl lithium (n-BuLi, sec-BuLi, tert-BuLi) and the like.
  • metal hydrides eg, sodium hydride
  • metal hydroxides eg, sodium hydroxide, potassium hydroxide, lithium hydroxide, barium hydroxide
  • metal carbonates eg, sodium carbonate
  • Calcium carbonate e.
  • a metal carbonate eg, sodium carbonate, calcium carbonate, potassium carbonate, cesium carbonate, etc.
  • the reaction may be performed at room temperature or at a temperature at which the solvent used is refluxed for 0.5 to 48 hours.
  • Step 2 This is a step for producing a compound represented by the formula (II-D) by hydrolyzing a compound represented by the formula (II-C).
  • the solvent the solvent described in Step 1 can be used.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • alcohols eg, methanol, ethanol, t-butanol, etc.
  • water and a mixed solvent thereof may be used.
  • the base the base described in Step 2 can be used.
  • a metal hydroxide eg, sodium hydroxide, potassium hydroxide, lithium hydroxide, barium hydroxide, etc.
  • the reaction may be performed at ⁇ 20 to 40 ° C. for 0.5 to 24 hours.
  • the fourth step is a step for producing a compound represented by the formula (IA) by reacting a compound represented by the formula (II-D) with a compound represented by the formula (ring A—NH—R 1 ).
  • the solvent the solvent described in Step 1 can be used.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • N-dimethylformamide may be used.
  • the base the base described in Step 2 can be used.
  • an organic amine eg, triethylamine, diisopropylethylamine, DBU, 2,6-lutidine, etc.
  • an organic amine eg, triethylamine, diisopropylethylamine, DBU, 2,6-lutidine, etc.
  • 1-ethyl-3- (3′-dimethylaminopropyl) carbodiimide (WSCI) or 1,3-dicyclohexylcarbodiimide (DCCD) can be used as a condensing agent.
  • WSCI 1-ethyl-3- (3′-dimethylaminopropyl) carbodiimide
  • DCCD 1,3-dicyclohexylcarbodiimide
  • N-hydroxybenzotriazole (HOBt) or N-hydroxysuccinimide (HOSu) can be used.
  • Fifth step is a step of producing a compound represented by the formula (II-E) by converting a hydroxy group of a compound represented by the formula (II-B) into chlorine.
  • phosphorus oxychloride POCl 3
  • the reaction may be carried out at a temperature at which phosphorus oxychloride is refluxed from ⁇ 20 ° C. for 0.5 to 24 hours.
  • the compound represented by the formula (II-E) is reacted with the compound represented by R 5 SH in the presence of a base to produce a compound represented by the formula (II-F).
  • the solvent the solvent described in Step 1 can be used.
  • ketones eg, acetone, methyl ethyl ketone, etc.
  • N-dimethylformamide may be used.
  • the base the base described in Step 2 can be used.
  • metal hydrides eg, sodium hydride
  • metal carbonates eg, sodium carbonate, calcium carbonate, potassium carbonate, cesium carbonate, etc.
  • the reaction may be performed at room temperature or at a temperature at which the solvent used is refluxed for 0.5 to 48 hours.
  • the seventh step is a step of hydrolyzing the compound represented by the formula (II-E) to produce the compound represented by the formula (II-F). What is necessary is just to carry out similarly to the said 3rd process.
  • the compound represented by the formula (II-F) is reacted with the compound represented by the formula (ring A-NH-R 1 ) to produce the compound represented by the formula (IB). What is necessary is just to carry out similarly to the said 4th process.
  • each symbol has the same meaning as described above, and the compound represented by the formula (II-G) may be a known compound or a compound derived from a known compound by a conventional method.
  • the ninth step is a step of reacting a compound represented by the formula (II-G) with a compound represented by the formula (ring A-NH-R 1 ) to produce a compound represented by the formula (IC). What is necessary is just to carry out similarly to the said 4th process.
  • each symbol is as defined above, and the compound represented by the formula (II-H) may be a known compound or a compound derived from a known compound by a conventional method.
  • Pro and Pro ′ mean protecting groups. Examples of Pro and Pro ′ include methyl group, ethyl group, benzyl group, benzoyl group, t-butyl group, etc. Hal means halogen.
  • Tenth step is a step of reacting a compound represented by the formula (II-H) with hydrazine to produce a compound represented by the formula (II-1). What is necessary is just to perform like the said 1st process.
  • Eleventh step is a step of producing a compound represented by the formula (II-J) by oxidizing a compound represented by the formula (II-I).
  • oxidizing agent metal salts such as IBX (2-iodoxybenzoic acid), chromium, manganese, silver, metal oxides, and organic oxidizing agents can be used.
  • solvent the solvent described in Step 1 can be used.
  • acetonitrile or esters eg, methyl acetate, ethyl acetate, etc.
  • the reaction may be performed at room temperature or at a temperature at which the solvent used is refluxed for 0.5 to 24 hours. This oxidation reaction step can also be performed under conditions such as Swern oxidation and TEMPO oxidation.
  • Twelfth step is a step of producing a compound represented by the formula (II-L) by a Wittig reaction between a compound represented by the formula (II-J) and a compound represented by the formula (II-K).
  • the solvent the solvent described in Step 1 can be used.
  • esters eg, methyl acetate, ethyl acetate, etc.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • the base the base described in Step 2 can be used.
  • an organic amine eg, triethylamine, diisopropylethylamine, DBU, 2,6-lutidine, etc.
  • the reaction may be performed at ⁇ 20 to 40 ° C. for 0.5 to 48 hours.
  • the thirteenth step is a step for producing a compound represented by the formula (II-M) by reacting a compound represented by the formula (II-L) with R b -Hal in the presence of a base.
  • the solvent the solvent described in Step 1 can be used.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • the base the base described in Step 2 can be used.
  • metal alkoxide eg, sodium methoxide, sodium ethoxide, potassium t-butoxide, etc.
  • LDA may be used.
  • the reaction may be performed at ⁇ 78 to 40 ° C. for 0.5 to 24 hours.
  • the 14th step is a step for producing a compound represented by the formula (II-N) by deprotecting a compound represented by the formula (II-M) under strongly acidic conditions.
  • the strong acid for example, trifluoroacetic acid or sulfuric acid can be used.
  • the solvent the solvent described in Step 1 can be used.
  • halogenated hydrocarbons eg, dichloromethane, chloroform, 1,2-dichloroethane, etc.
  • the reaction may be performed at ⁇ 78 to 40 ° C. for 0.5 to 24 hours.
  • Fifteenth step is a step of producing a compound represented by the formula (II-O) by reacting a compound represented by the formula (II-N) with an amine. What is necessary is just to carry out similarly to the said 4th process.
  • Sixteenth step is a step of producing a compound represented by the formula (II-P) by deprotecting the compound represented by the formula (II-O). What is necessary is just to carry out similarly to the said 3rd process.
  • the seventeenth step is a step for producing a compound represented by the formula (ID) by reacting a compound represented by the formula (II-P) with a compound represented by the formula (II-Q). What is necessary is just to carry out similarly to the said 4th process.
  • the eighteenth step is a step for reducing a compound represented by the formula (ID) to produce a compound represented by the formula (IE).
  • a catalytic hydrogenation reaction using a transition metal catalyst may be performed.
  • the transition metal catalyst platinum, palladium, rhodium, ruthenium, nickel or the like can be used.
  • the solvent the solvent described in Step 1 can be used.
  • alcohols eg, methanol, ethanol, t-butanol, etc.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • water, a mixed solvent thereof or the like may be used. .
  • the reaction may be performed in the presence of hydrogen and a transition metal catalyst at 20 to 50 ° C. for 0.5 to 48 hours.
  • a transition metal catalyst at 20 to 50 ° C. for 0.5 to 48 hours.
  • Pro represents a protecting group, and examples of the protecting group include a methyl group, an ethyl group, a benzyl group, a benzoyl group, and a t-butyl group.
  • 24th step is a step of converting a compound represented by the formula (II-R) into a compound represented by the formula (II-T).
  • one of R i and R j is hydrogen, and the other is substituted or unsubstituted carbamoyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted cycloalkyloxycarbonyl, substituted or unsubstituted
  • This is a reaction step in the case of substituted aryloxycarbonyl, substituted or unsubstituted heteroaryloxycarbonyl, or substituted or unsubstituted heterocycleoxycarbonyl.
  • the compound represented by the formula (II-R) may be reacted with a corresponding alcohol or amine.
  • the solvent the solvent described in Step 1 can be used.
  • aromatic hydrocarbons eg, toluene, benzene, xylene, etc.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • the reaction may be carried out for 0.5 to 24 hours at a temperature from ⁇ 20 ° C. to reflux of the solvent used.
  • each symbol has the same meaning as described above, and the compound represented by the formula (II-N) may be a known compound, or a compound derived from a known compound by a conventional method.
  • Protect represents a protecting group, and examples of the protecting group include a methyl group, an ethyl group, a benzyl group, a benzoyl group, a t-butyl group, etc.
  • Hal represents a halogen.
  • Twenty-fifth step is a step of reducing the compound represented by the formula (II-N) to produce the compound represented by the formula (II-V).
  • a compound represented by the formula (II-N) and ethyl chlorocarbonate are reacted to form an active ester, and then reacted with a reducing agent.
  • the solvent the solvent described in Step 1 can be used.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • ethers eg, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc.
  • the reducing agent examples include sodium triacetoxyhydroborate, sodium borohydride, lithium tetrahydroborate, pyridine borane complex, tetrahydrofuran borane complex, dimethyl sulfide borane complex and 2-picoline borane complex.
  • it is sodium borohydride.
  • the reaction may be performed at ⁇ 20 to 50 ° C. for 0.5 to 24 hours.
  • Twenty-sixth step is a step of producing a compound represented by the formula (II-W) by deprotecting the compound represented by the formula (II-V). What is necessary is just to perform like the said process 3.
  • Twenty-seventh step is a step of reacting a compound represented by the formula (II-W) with a compound represented by the formula (II-Q) to produce a compound represented by the formula (IH). What is necessary is just to perform like the said process 4.
  • Twenty-eighth step is a step of producing a compound represented by the formula (IJ) by reducing a compound represented by the formula (IH). What is necessary is just to carry out similarly to the said process 18 above.
  • Twenty-ninth step is a step of producing a compound represented by the formula (IK) by halogenating a compound represented by the formula (IH).
  • the solvent the solvent described in Step 1 can be used.
  • halogenated hydrocarbons eg, dichloromethane, chloroform, 1,2-dichloroethane, etc.
  • DAST ((diethylamino) sulfur trifluoride), NCS (N-chlorosuccinimide), NBS (N-bromosuccinimide), CBr 4 , PBr 3 , PBr 5 may be used.
  • the reaction may be carried out at a temperature from ⁇ 78 ° C. to reflux of the solvent used for 0.5 to 24 hours.
  • 30th step is a step of producing a compound represented by the formula (IL) by halogenating a compound represented by the formula (IJ). What is necessary is just to carry out similarly to the said process 29 above.
  • R g and R h are hydrogen, and other symbols are as defined above, and the compound represented by the formula (II-O) may be a known compound.
  • Protect may mean a protecting group, and examples of the protecting group include a methyl group, an ethyl group, a benzyl group, a benzoyl group, and a t-butyl group.
  • Thirty-first step is a step of dehydrating a compound represented by the formula (II-O) to produce a compound represented by the formula (II-X).
  • the reaction may be carried out in halogenated hydrocarbons (eg, dichloromethane, chloroform, 1,2-dichloroethane, etc.) with trifluoroacetic anhydride and pyridine at ⁇ 20 ° C. to 40 ° C. for 0.5 to 10 hours.
  • halogenated hydrocarbons eg, dichloromethane, chloroform, 1,2-dichloroethane, etc.
  • the thirty-third step is a step for producing a compound represented by the formula (IM) by reacting a compound represented by the formula (II-Y) with a compound represented by the formula (II-Q). What is necessary is just to perform like the said process 4.
  • Thirty-fourth step is a step of reducing a compound represented by the formula (IM) to produce a compound represented by the formula (IN). What is necessary is just to carry out similarly to the said process 18 above.
  • the compound represented by the formula (II-A) may be a known compound or a compound derived from a known compound by a conventional method.
  • Pro means a protecting group, and examples of the protecting group include a methyl group, an ethyl group, a benzyl group, a benzoyl group, a t-butyl group, etc.
  • Pro '' means a protecting group, and the protecting group includes t- (Butyl group, trityl group, benzyl group, p-methoxybenzyl group, silyl group, methanesulfonyl group, acyl group, etc.)
  • Thirty-fifth step is a step of producing a compound represented by the formula (II-AA) by reacting a compound represented by the formula (II-A) with a compound represented by the formula (II-Z). What is necessary is just to perform like the said 1st process.
  • Thirty-sixth step is a step of producing a compound represented by the formula (II-AB) by halogenating a compound represented by the formula (II-AA).
  • it can be halogenated under the conditions described in Example 3 of WO2007 / 058346.
  • phosphorous oxychloride may be used for reaction for 0.5 to 24 hours from ⁇ 20 ° C. to a temperature at which phosphorus oxychloride is refluxed.
  • the solvent described in Step 1 can be used as the solvent, but it may not be used.
  • PBr 3 can be used in the same manner.
  • a fluorine body can be obtained by making potassium fluoride act on a corresponding chlorine body.
  • Thirty-seventh step is a step of producing a compound represented by the formula (IO) from a compound represented by the formula (II-AB).
  • the compound of the present invention has excellent type I 11 ⁇ hydroxysteroid dehydrogenase inhibitory activity. Therefore, it is used for the treatment or prevention of diseases involving type I 11 ⁇ hydroxysteroid dehydrogenase, particularly diseases such as hyperlipidemia, diabetes, obesity, arteriosclerosis, atherosclerosis, hyperglycemia and / or syndrome X. be able to. In particular, it is useful in the treatment or prevention of diabetes.
  • the compound used in the present invention can be administered orally or parenterally.
  • the compound used in the present invention is a usual preparation, for example, solid preparations such as tablets, powders, granules, capsules; liquid preparations; oil suspensions; or liquid preparations such as syrups or elixirs It can be used also as any dosage form.
  • the compound used in the present invention can be used as an aqueous or oily suspension injection or nasal solution.
  • conventional excipients, binders, lubricants, aqueous solvents, oily solvents, emulsifiers, suspending agents, preservatives, stabilizers and the like can be arbitrarily used.
  • Formulations of the compounds used in the present invention are prepared by combining (eg, mixing) a therapeutically effective amount of a compound used in the present invention with a pharmaceutically acceptable carrier or diluent.
  • the preparation of the compound used in the present invention is produced by a known method using well-known and readily available components.
  • the dose of the compound used in the present invention varies depending on the administration method, the patient's age, weight, condition, and type of disease, but usually about 0.05 mg to 3000 mg per day for an adult when administered orally, preferably May be administered in an amount of about 0.1 mg to 1000 mg divided if necessary. In the case of parenteral administration, about 0.01 mg to 1000 mg, preferably about 0.05 mg to 500 mg is administered per day for an adult. In administration, it can be used in combination with other therapeutic agents.
  • a phosphonium salt (13.5 g) was added to a tetrahydrofuran solution (40 ml) of compound II-3 (5.6 g), and triethylamine (3.4 g) was added dropwise thereto over 20 minutes. Then, it stirred at room temperature for 3 hours. After completion of the reaction, water (40 ml) was added and extracted with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off, and the residue was purified by silica gel column chromatography to obtain compound II-4 (5.2 g).
  • Triethylamine (152 ⁇ l) and ethyl chlorocarbonate (84 ⁇ l) were added to a solution of compound II-6 (237 mg) in tetrahydrofuran (3 ml) at 0 ° C., and the mixture was stirred at room temperature for 1 hour.
  • sodium borohydride (69 mg) and water (1 ml) were added at 0 ° C., and the mixture was stirred for 20 minutes.
  • an aqueous hydrochloric acid solution was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and the solvent was distilled off.
  • log k ′ is a value representing the degree of lipophilicity and is calculated by the following equation.
  • log k ′ log (t R ⁇ t 0 ) / t 0 t R : retention time of compound under gradient conditions t 0 : XTerra MS C18 5 ⁇ m, 2.1 ⁇ 100 mm column (Waters) was used for measuring the retention time of the standard substance not retained on the column, and the flow rate was 0.25 mL. It was measured by applying a linear gradient of acetonitrile / pH 6.8 buffer (5:95 to 95: 5/20 minutes) per minute.
  • Cortisol concentration was calculated from a standard curve prepared with cortisol of known concentration for each experiment. The concentration of cortisol produced when no inhibitor was included was taken as the control value, and the inhibitory curve plotting the inhibition rate against the control value at each concentration of the inhibitor was the 50% inhibitory concentration (IC50 value) against 11 ⁇ -HSD1 of the inhibitor. Calculated.
  • 11 ⁇ -HSD1 inhibitor Compound evaluation for mouse 11 ⁇ -HSD1 Inhibitors include 50 mM sodium phosphate buffer (pH 7.5), bovine serum albumin (1 mg / ml), NADPH (0.42 mg / ml), glucose-6-phosphate (1.26 mg / ml), glucose-6 -Substrate 11-dehydrocorticosterone (2 ⁇ M) was added after preincubation for 30 minutes at room temperature in a reaction solution consisting of phosphate dehydrogenase and enzyme (total volume 10 ⁇ l). After reacting at 37 ° C.
  • Corticosterone concentration was calculated from a standard curve prepared with corticosterone of known concentration for each experiment. The concentration of corticosterone produced when no inhibitor was included was taken as the control value, and the inhibitory curve of the inhibitor against 11 ⁇ -HSD1 (IC50 value) was plotted from the inhibition rate against the control value at each concentration of the inhibitor. ) was calculated.
  • mice Used 6-week-old male C57BL / 6J Jcl mice were purchased from CLEA Japan, and after 1-week preliminary breeding, 7-week-old Used in the experiment.
  • Breeding conditions The mice are kept in a breeding environment with a temperature of 23 ⁇ 2 ° C and humidity of 55 ⁇ 10%. The lighting is cycled from 8:00 to 20:00 and from 20:00 to 8:00. Is set. During the preliminary breeding and the experiment period, solid feed (CE-2, Nippon Claire) and sterile tap water were freely given.
  • Identification of individual and cage An individual number was marked on the tail of the mouse with oil-based ink for identification.
  • the cage was labeled with the name of the person responsible for the test, date of arrival, strain, sex, and supplier, and was kept at 20 / cage during preliminary breeding. After the start of the experiment, the animals were raised at 3 animals / cage.
  • Administration method Oral administration was forcibly administered into the stomach with an oral sonde at a rate of 10 mL / kg. Intravenous administration was carried out from the tail vein with a glass syringe at a rate of 2.5 mL / kg.
  • Evaluation items Blood was collected at a time point from the heart, and the drug concentration in plasma was measured using HPLC or LC / MS / MS.
  • the area under the plasma concentration-time curve was calculated using the non-linear minimum program WinNonlin (registered trademark), and the biologic was calculated from the AUC of the oral administration group and intravenous administration group. Availability was calculated.
  • mice 9-10 week old male ob / ob mice were used in the HSD1 inhibitory activity evaluation method experiments using isolated adipose tissue.
  • the test compound 30-50 mg / kg was orally administered to the animals, and after 8 and 16 hours, visceral fat was removed under chloral hydrate anesthesia, and the HSD1 activity in fat was measured.
  • the HSD1 inhibitory activity of the test compound was calculated by taking the 0.5% methylcellulose solution orally and giving the HSD1 activity in fat of animals treated in the same manner as 100.
  • phosphate buffer 50 mM sodium phosphate (pH 7.5), bovine serum albumin (1 mg / ml)
  • HSD1 enzyme activity was measured using 60 ⁇ l of reaction solution (50 mM sodium phosphate buffer (pH 7.5), bovine serum albumin (1 mg / ml), NADPH (0.42 mg / ml), glucose-6-phosphate (1.26 mg / ml), glucose-6-phosphate dehydrgenase) and 20 ⁇ l of fat homogenate solution were mixed, and 20 ⁇ l of 10 ⁇ M 11-DHC solution was added as a substrate, and then the reaction was started. The reaction was carried out at 37 ° C. for 60 minutes, and the reaction was stopped by adding 200 ⁇ l of ethyl acetate.
  • Mouse myoblast cell line C2C12 cells were cultured in the appropriate media described below and maintained at 37 ° C., 95-98% humidity and 5% CO 2 . In normal culture, the cells were cultured in DMEM Low Glucose (GIBCO) + 10% fetal bovine serum (FBS, GIBCO) + Penicillin (100 units / mL, GIBCO) + Streptomycin (100 ug / mL, GIBCO).
  • DMEM Low Glucose GIBCO
  • FBS fetal bovine serum
  • Penicillin 100 units / mL
  • GIBCO Penicillin
  • Streptomycin 100 ug / mL, GIBCO
  • DMEM Low Glucose GIBCO + 2% horse serum (HS, GIBCO) + Penicillin (100 units / mL, GIBCO) + Streptomycin (100ug / mL, GIBCO ).
  • HS horse serum
  • Penicillin 100 units / mL, GIBCO
  • Streptomycin 100ug / mL, GIBCO
  • Test Example 5 Effects of compounds on changes in Atrogin and MuRF1 expression by cortisone treatment in C2C12 cells
  • the effects of glucocorticoid on Atrogin and MuRF1 expression in vitro, and the effects of compounds on the increase in Atrogin and MuRF1 expression by cortisone treatment were examined.
  • Effect of Compound on Atrogin and MuRF1 Expression Increase by Cortisone Treatment Differentiated C2C12 cells were treated with each concentration of Compound I-168 (Compound H), and 1 hour later, 1 uM cortisone (Sigma) was treated. After 24 hours, total RNA was extracted using RNAesay mini kit (QIAGEN) according to the manufacturer's recommended protocol.
  • the primer sequence used to measure the expression level of mouse Atrogin is FW primer: CTGGAAATAATGGATGGCCACA; RV primer: TGGAACCAAAGGCTCCCAAG was used.
  • the primer sequence used to measure the expression level of mouse MuRF1 is FW primer: TGTCTCACGGTTGAGGTGCCCTA; RV primer: CACCAGCATGGGATAGGCAGTAC Was used.
  • the primer sequence used to measure the expression level of mouse RPS18 is FW primer: TTCTGGCCAACGGTCTAGACACAC; RV primer: CCAGTGGTCTTGGTTGCTGA was used.
  • 1 uM cortisone treatment increased Atrogin and MuRF1 mRNA expression levels by 2.23 times and 1.50 times, respectively, and the pretreatment with compound I-168 (Compound H) suppressed these gene expression increases in a dose-dependent manner and significantly. From this result, it was shown that 11 ⁇ -HSD1 inhibitor suppresses cortisone-induced muscle atrophy in vitro (FIG. 1).
  • Six hours after the first administration the same dose of the compound as that of the first administration was orally administered.
  • the gastrocnemius muscle was removed and frozen immediately after removal. Add 3 times the amount of tissue homogenized to the gastrocnemius muscle (100 mM Tris-HCl (pH 7.5), 150 mM NaCl) and grind muscle tissue using TissueLyser II (Qiagen) in a room maintained at 4 degrees A muscle homogenate was created.
  • Test Example 7 Effects on mice by transplantation of cortisone pellets and effects of repeated oral administration of compounds
  • a cortisone pellet was subcutaneously transplanted to C57BL / 6J (male 10 weeks old, Claire, Japan) under anesthesia to produce a cortisone pellet transplanted animal.
  • Compound I-168 Compound H 30 mg / kg dissolved in 0.5% methylcellulose (Wako Pure Chemical Industries) for 9 days at a dose of 10 mL / kg, twice a day, Orally administered.
  • Body weight was measured on the day of transplantation and on the 2nd, 3rd, 5th, 8th, and 9th days after transplantation.
  • the amount of food consumption was calculated as the amount of food consumed for 24 hours from the sixth day after transplantation.
  • the grip strength test was performed using DEF002 (SD instruments) on the 8th day after transplantation.
  • blood was collected from the abdominal aorta under anesthesia, then the tibialis anterior (TA), gastrocnemius (GA), extensor digitorum longus (EDL), foot, Plantars (PLANT) were isolated and weighed.
  • Plasma was separated from the obtained blood sample, steroid was extracted using ethyl acetate, HPCL (2690 (Waters, Separations module), 2487 (Waters, Dual ⁇ absorbance detector), LichroCART 75-4 Supersphere 60 RP- The concentration of steroid contained in the extract was quantified using select B (Merck KGaA, Column).
  • select B Merck KGaA, Column.
  • blood cortisone concentration and cortisol concentration increased by transplanting cortisone pellets.
  • Repeated administration of the compound to cortisone pellet transplanted animals further increased blood cortisone levels and decreased blood cortisol levels.
  • transplantation of cortisone pellets decreased body weight and food consumption, decreased the weight of TA, GA, EDL, and plant, and decreased grip strength (FIGS. 4 and 5).
  • Test Example 8 Effects of Corticosterone on Mice and Effects of Repeated Oral Compound Administration
  • Corticosterone solution Sigma Aldrich, dissolved in 1% ethanol, supplied as 30 ug / mL or 100 ug / mL
  • C57BL / 6J male, 10 weeks old, Claire, Japan
  • compound I-30 (30 mg / mL) kg, 10 mL / kg
  • Animals were dissected 4 weeks after the start of dosing, and subcutaneous fat (FIG.
  • active ingredient means a compound of the present invention, a pharmaceutically acceptable salt thereof, or a hydrate thereof.
  • Hard gelatin capsules are manufactured using the following ingredients: Dose (mg / capsule) Active ingredient 250 Starch (dried) 200 Magnesium stearate 10 Total 460mg
  • Tablets are manufactured using the following ingredients: Dose (mg / tablet) Active ingredient 250 Cellulose (microcrystal) 400 Silicon dioxide (fume) 10 Stearic acid 5 665mg total The ingredients are mixed and compressed into tablets each weighing 665 mg.
  • Aerosol solution is prepared containing the following ingredients: weight Active ingredient 0.25 Ethanol 25.75 Propellant 22 (chlorodifluoromethane) 74.00 Total 100.00
  • the active ingredient and ethanol are mixed and this mixture is added to a portion of the propellant 22, cooled to ⁇ 30 ° C. and transferred to a filling device. The required amount is then fed into a stainless steel container and diluted with the remaining propellant. Attach the bubble unit to the container.
  • a tablet containing 60 mg of active ingredient is prepared as follows: Active ingredient 60mg 45mg starch Microcrystalline cellulose 35mg Polyvinylpyrrolidone (10% solution in water) 4mg Sodium carboxymethyl starch 4.5mg Magnesium stearate 0.5mg Talc 1mg 150mg total The active ingredients, starch, and cellulose are no. 45 mesh U.V. S. And mix well. An aqueous solution containing polyvinylpyrrolidone was mixed with the obtained powder, and the mixture was 14 mesh U.S. S. Pass through a sieve. The granules thus obtained were dried at 50 ° C. 18 mesh U.F. S. Pass through a sieve. No. 60 mesh U.S. S. Sodium carboxymethyl starch, magnesium stearate, and talc passed through a sieve are added to the granules, mixed and then compressed on a tablet press to obtain tablets each weighing 150 mg.
  • Capsules containing 80 mg of active ingredient are prepared as follows: Active ingredient 80mg Starch 59mg Microcrystalline cellulose 59mg Magnesium stearate 2mg Total 200mg Mix the active ingredient, starch, cellulose and magnesium stearate; 45 mesh U.V. S. Through the sieve and filled into hard gelatin capsules 200 mg each.
  • a suppository containing 225 mg of active ingredient is prepared as follows: Active ingredient 225mg Saturated fatty acid glyceride 2000mg Total 2225mg The active ingredient is No. 60 mesh U.S. S. And suspended in a saturated fatty acid glyceride that has been heated and melted to the minimum necessary. The mixture is then cooled in an apparent 2 g mold.
  • a suspension containing 50 mg of active ingredient is prepared as follows: Active ingredient 50mg Sodium carboxymethylcellulose 50mg Syrup 1.25ml Benzoic acid solution 0.10ml Fragrance q. v. Dye q. v. 5ml in total with purified water The active ingredient is No. 45 mesh U.V. S. And is mixed with sodium carboxymethylcellulose and syrup to form a smooth paste. Add the benzoic acid solution and perfume diluted with a portion of the water and stir. Then add a sufficient amount of water to the required volume.
  • the intravenous formulation is manufactured as follows: Active ingredient 100mg Saturated fatty acid glyceride 1000ml Solutions of the above components are usually administered intravenously to the patient at a rate of 1 ml per minute.
  • the compound according to the present invention is very useful as a therapeutic and / or prophylactic agent excellent in a pathological condition involving hyperglucocorticoidemia.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un agent destiné au traitement et/ou à la prévention d'affections associées à l'hyperglucocorticoïdémie, caractérisé en ce qu'il contient comme principe actif un composé représenté par la formule (I) : (dans laquelle le cycle A est (II), le cycle B est un hétérocycle aromatique substitué ou non substitué ou analogue, R1 est un hydrogène ou un alkyle substitué ou non substitué, R2 est -OR5 ou -SR5, R3 est un groupe représenté par la formule : - CH = CH - C (RaRb) - Rc- Rd, Ra et Rb sont chacun indépendamment un hydrogène ou un alkyle substitué ou non substitué ou analogue, Rc est - (CH2) n - (où n est un nombre entier de 0 à 3), Rd est un hydrogène, un halogène ou analogue, R4 est un alkyle substitué ou non substitué ou -OR6, R5est un alkyle substitué ou non substitué ou analogue, R6 est un hydrogène ou -CONR7R8, R7 et R8 sont chacun indépendamment un hydrogène ou un alkyle substitué ou non substitué) ou un sel pharmaceutiquement acceptable de ce dernier.
PCT/JP2016/085471 2015-11-30 2016-11-30 COMPOSITION PHARMACEUTIQUE AYANT UNE ACTIVITÉ D'INHIBITION DE LA 11β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I WO2017094743A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2015-233809 2015-11-30
JP2015233809 2015-11-30

Publications (1)

Publication Number Publication Date
WO2017094743A1 true WO2017094743A1 (fr) 2017-06-08

Family

ID=58796817

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2016/085471 WO2017094743A1 (fr) 2015-11-30 2016-11-30 COMPOSITION PHARMACEUTIQUE AYANT UNE ACTIVITÉ D'INHIBITION DE LA 11β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I

Country Status (1)

Country Link
WO (1) WO2017094743A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007058346A1 (fr) * 2005-11-21 2007-05-24 Shionogi & Co., Ltd. COMPOSE HETEROCYCLIQUE PRESENTANT UNE ACTIVITE INHIBITRICE DE LA 11-β-HYDROXYSTEROIDE DESHYDROGENASE DE TYPE I
WO2008142986A1 (fr) * 2007-05-18 2008-11-27 Shionogi & Co., Ltd. DÉRIVÉ HÉTÉROCYCLIQUE CONTENANT DE L'AZOTE POSSÉDANT UNE ACTIVITÉ INHIBITRICE SUR LA 11 β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I
WO2011078101A1 (fr) * 2009-12-22 2011-06-30 塩野義製薬株式会社 Dérivé d'adamantanamine
WO2012124781A1 (fr) * 2011-03-17 2012-09-20 塩野義製薬株式会社 Procédé pour produire un dérivé d'acide pyrazolecarboxylique

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007058346A1 (fr) * 2005-11-21 2007-05-24 Shionogi & Co., Ltd. COMPOSE HETEROCYCLIQUE PRESENTANT UNE ACTIVITE INHIBITRICE DE LA 11-β-HYDROXYSTEROIDE DESHYDROGENASE DE TYPE I
WO2008142986A1 (fr) * 2007-05-18 2008-11-27 Shionogi & Co., Ltd. DÉRIVÉ HÉTÉROCYCLIQUE CONTENANT DE L'AZOTE POSSÉDANT UNE ACTIVITÉ INHIBITRICE SUR LA 11 β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I
WO2011078101A1 (fr) * 2009-12-22 2011-06-30 塩野義製薬株式会社 Dérivé d'adamantanamine
WO2012124781A1 (fr) * 2011-03-17 2012-09-20 塩野義製薬株式会社 Procédé pour produire un dérivé d'acide pyrazolecarboxylique

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HASSAN-SMITH, Z. ET AL.: "11β-hydroxysteroid dehydrogenase type 1 and age-associated muscle weakness in mice: implications for human ageing", THE LANCET, vol. 383, no. 1, 26 February 2014 (2014-02-26), pages S53, XP055599841 *
HASSAN-SMITH, Z. ET AL.: "Identification of an 11 beta-hydroxysteroid dehydrogenase type 1 regulated gene expression profile common to glucocorticoid and age associated myopathies", ENDOCRINE REVIEWS, vol. 34, no. 3, 2013 *
HIROTOSHI TANAKA ET AL: "Molecular mechanism for glucocorticoid-induced muscle atrophy", BIOMEDICAL GERONTOLOGY, vol. 35, no. 3, 2011, pages 11 - 16 *

Similar Documents

Publication Publication Date Title
JP4671369B2 (ja) Ｉ型１１βヒドロキシステロイド脱水素酵素阻害活性を有する含窒素複素環誘導体
JP5147109B2 (ja) Ｉ型１１βヒドロキシステロイド脱水素酵素阻害活性を有するヘテロ環化合物
JP6163428B2 (ja) インテグラーゼ阻害活性を有する多環性ピリドン誘導体
JP6108467B2 (ja) Ａｍｐｋ活性化作用を有するアザベンズイミダゾール誘導体
JP6372891B2 (ja) Ａｍｐｋ活性化作用を有する５−オキシベンズイミダゾールおよび５−オキシアザベンズイミダゾール誘導体
JP5207382B2 (ja) ウレア誘導体
US7998992B2 (en) Oxazolidinone derivative having inhibitory activity on 11β-hydroxysteroid dehydrogenase type 1
WO2014069426A1 (fr) Benzimidazole ayant pour effet d'activer l'ampk et dérivé d'azabenzimidazole
WO2009133834A1 (fr) Dérivé de cétoamide ayant une activité inhibitrice sur la lipase endothéliale
US8084646B2 (en) Process for production of hydroxyadamantaneamine
JPWO2016068099A1 (ja) Ａｍｐｋ活性化作用を有する複素環誘導体
WO2012081563A1 (fr) Dérivé de benzothiazole et d'azabenzothiazole ayant une activité d'inhibition de la lipase endothéliale
WO2012173099A1 (fr) Dérivé amino inhibant la lipase endothéliale
WO2017094743A1 (fr) COMPOSITION PHARMACEUTIQUE AYANT UNE ACTIVITÉ D'INHIBITION DE LA 11β-HYDROXYSTÉROÏDE DÉSHYDROGÉNASE DE TYPE I
JP2013014548A (ja) アシルスルホンアミド誘導体
JPWO2006129609A1 (ja) ２−ナフチルイミノ−５，５−ジ置換−１，３−チアジン誘導体
JP4702840B2 (ja) ２−ナフチルイミノ−１，３−チアジン誘導体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16870680

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16870680

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP