WO2017094015A1 - Methods for gender determination of avian embryos in unhatched eggs and means thereof - Google Patents

Methods for gender determination of avian embryos in unhatched eggs and means thereof Download PDF

Info

Publication number
WO2017094015A1
WO2017094015A1 PCT/IL2016/051291 IL2016051291W WO2017094015A1 WO 2017094015 A1 WO2017094015 A1 WO 2017094015A1 IL 2016051291 W IL2016051291 W IL 2016051291W WO 2017094015 A1 WO2017094015 A1 WO 2017094015A1
Authority
WO
WIPO (PCT)
Prior art keywords
acid sequence
reporter gene
nucleic acid
seq
denoted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2016/051291
Other languages
English (en)
French (fr)
Inventor
Daniel Offen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eggxyt Ltd
Original Assignee
Eggxyt Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3007066A priority Critical patent/CA3007066A1/en
Priority to HK19100128.4A priority patent/HK1257753A1/zh
Priority to EP16870133.2A priority patent/EP3384051A4/en
Priority to CN201680078336.7A priority patent/CN108474034A/zh
Priority to JP2018529065A priority patent/JP2019505175A/ja
Application filed by Eggxyt Ltd filed Critical Eggxyt Ltd
Priority to KR1020187018773A priority patent/KR20180099704A/ko
Publication of WO2017094015A1 publication Critical patent/WO2017094015A1/en
Priority to IL259721A priority patent/IL259721B/en
Priority to US15/996,045 priority patent/US20190029236A1/en
Anticipated expiration legal-status Critical
Priority to US16/729,921 priority patent/US20200149063A1/en
Priority to IL288409A priority patent/IL288409A/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/66Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/30Bird
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0393Animal model comprising a reporter system for screening tests
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • the present invention relates to methods of gender determination and identification in avian subjects. More specifically, the invention provides non-invasive methods and transgenic avian animals for gender determination and selection of embryos in unhatched avian eggs.
  • chicks are culled by billions on a daily basis via suffocation or grinding.
  • the males are terminated since they are not useful for laying eggs or to be bread for meat and the weak or unhealthy females are being terminated as well.
  • a method for in-ovo, or embryo sex-determination prior to hatching is thus highly desired due to both ethical and economic considerations.
  • visually identifying poultry fertile eggs is important to allow removal of unfertile eggs to save hatching costs (by prevention of hatching an unfertile egg), and to lower the bio-security risks involved in the continuation of the incubation of these contamination-prone unfertile eggs alongside the fertile eggs.
  • the gender may be determined by individual vent sexing which involves manually squeezing the feces out of the chick, which opens up the chicks' anal vent slightly, allowing to see if the chick has a small "bump", which would indicate that the chick is a male.
  • this method represents high risk of bird injury and mistakes in sex determination, together with cumbersome work conducted manually by trained personal.
  • Vent sexing or chick sexing is the method of distinguishing the sex of chicken and other hatchlings, usually by a trained person called a chick sexer or chicken sexer.
  • Chicken sexing is practiced mostly by large commercial hatcheries, who have to know the difference between the sexes in order to separate them into sex groups, and in order to take them into different programs, which can include the growing of one group and culling of the other group because due to being a sex which does not meet the commercial needs.
  • the relevant sex will continue its course to serve his or her purpose while the other sex or most of it will be culled within days of hatching being irrelevant to egg production.
  • Chicks are moved down a conveyer belt, where chick sexers separate out the males and toss them into a chute where they are usually ground up alive in a meat grinder.
  • Identification and determination of the fertility of an egg and the sex of the embryos in eggs prior to their hatching will enable the elimination of unfertile eggs, and the unwanted type of embryos while in their eggs, and thus will enormous reduce incubation costs (which includes the energy and efficiency costs alongside with air pollution and energy consumption).
  • chicks' suffering will cease and pollution from culling will be prevented.
  • An automated sexing device will additionally result in reduced eggs production costs by eliminating the need for chick sexers, as well as reduce the size of the hatcheries needed since at early stage 50% of the eggs will be reduced deducted from the process, thus reducing the costs of hatching these eggs, and later on the need for any elaborate killing procedures.
  • WO 2010/103111 describes an invasive method comprising a series of steps, among them introducing into the egg a labeled antibody, specifically designed to match a sex- specific antigen on the embryo.
  • WO 2014/0296707 describes luminance composition designed to serve as a biomarker for quantifying or evaluating efficiency of vaccination being injected into the bird's egg. No sex determination is described or even hinted in this disclosure. In-ovo injection apparatus and detection methods was disclosed by US 6244214.
  • WO 06124456 A2 discloses invasive methods of in-ovo sex determining of an avian embryo by determining the presence of an estrogenic steroid compound in a sample of embryonic fluid (e.g., allantoic fluid or blood) from the avian egg. Determining the presence of the compound is done by measuring analytes in samples obtained from said avian egg by competitive immunoassay utilizing fluorescence microscopy.
  • embryonic fluid e.g., allantoic fluid or blood
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas CRISPR-associated
  • Veron and coworkers (2015) demonstrated that expression levels of somatic cells in chicken embryos were modified by electroporation of CRISPR gRNA plasmids directed against the PAX7 transcription factor (Nadege et al. 2015), Bai and coworkers edited the PPAR-g, ATP synthase epsilon subunit (ATP5E).
  • Quansah, E. et. al. disclosed sperm mediated transgenesis in chicken using a PiggyBac transposon system. In particular, they disclose that aGFP plasmid and Lipofectamine LTXTM 9LPX) combination had no effect on viability, mobility or fertility of chicken sperm.
  • a first aspect of the invention relates to a method of gender determination of avian, or avian embryo in an unhatched egg, specifically, a fertilized unhatched egg.
  • the method may comprise the step of:
  • step (a) providing or obtaining at least one transgenic avian subject or animal comprising at least one exogenous reporter gene integrated into at least one position or location (also referred to herein as locus) in at least one of gender chromosome Z and W.
  • step (b) obtaining at least one fertilized egg from the transgenic avian subject, specifically animal or of any cells thereof.
  • the next step (c) involves determining in the egg if at least one detectable signal is detected.
  • detection of at least one detectable signal indicates the expression of said at least one reporter gene, thereby the presence of the W chromosome or Z chromosome in the avian embryo.
  • the invention in a second aspect, relates to an avian transgenic animal comprising, in at least one cell thereof, at least one exogenous reporter gene integrated into at least one position or location (also referred to herein as locus) in at least one of gender chromosome Z and W.
  • the invention in yet another aspect, relates to a cell comprising at least one exogenous reporter gene integrated into at least one position or locus in at least one of gender chromosome Z and W.
  • the invention provides a kit comprising:
  • At least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence encoding at least one guide RNA (gRNA); and (b) at least one second nucleic acid sequence comprising at least one said reporter gene.
  • FIG. 1A-1B Lucif erase reporter gene signal penetrates the egg shell
  • Luciferase expressing transgenic mice were injected subcutaneously with luciferin. Ear (Fig. 1A) and tail (Fig. IB) are excised 10 min thereafter and incorporated into unfertilized eggs. Eggs were imaged using the bio-space photon Imager (Bio space lab, USA).
  • Luciferase reporter gene signal is formed in a fertilized egg and penetrates the egg shell
  • Ear Fig. 2A
  • tail Fig. 2B
  • Luciferin is subsequently injected to induce bioluminescence. Images were taken 10 minutes thereafter using the bio-space photon Imager (Bio space lab, USA).
  • FIG. 3A-3B GFP reporter gene signal is not detectable through the egg shell
  • Tail from GFP-expressing transgenic mice were incorporated into Chicken embryo (10 days) or placed outside of the shell. Only tail placed outside of the egg shell (Fig. 3A) can be observed with GFP fluorescence, whereas no signal is detected when placed inside the egg (Fig. 3B) Images were taken after 5 minutes thereafter using the Maestro 2.2 Imager (Cambridge Research & Instrumentation, Inc. USA).
  • Luciferase reporter gene (star) is incorporated into the W chromosome of a female transgenic chicken (hen). Only female egg that carry the W and Z chromosomes, provide the reporter gene, specifically, luciferase signal.
  • Luciferase reporter gene (star) is incorporated into the Z chromosomes of female transgenic chicken (hen). Male embryos are detected via the luciferase signal and females are free of foreign DNA.
  • the invention provides a non-invasive efficient method for gender determination, using a reporter gene integrated in a gender specific chromosomes of transgenic avian subjects. Expression of this reporter gene in an embryo of an unhatched egg clearly and accurately identify the gender of said embryo.
  • a first aspect of the invention relates to a method of gender determination and optionally of selection of avian, or avian embryo in an unhatched egg, specifically, a fertilized unhatched egg.
  • the method may comprise the step of:
  • step (a) providing or obtaining at least one transgenic avian subject or animal comprising at least one exogenous reporter gene integrated into at least one position or location in at least one of gender chromosome Z and W.
  • step (b) obtaining at least one fertilized egg from the transgenic avian subject, specifically animal or of any cells thereof.
  • the next step (c) involves determining in the egg if at least one detectable signal is detected.
  • detection of at least one detectable signal indicates the expression of the at least one reporter gene, thereby the presence of the W chromosome or Z chromosome in the avian embryo.
  • the reporter gene has been integrated into the Z chromosome of a female transgenic avian
  • identification of a detectable signal in the examined egg indicate that the embryo has a maternal Z chromosome having a reporter gene integrated therein, and the embryo is thereby identified as male.
  • identification of a detectable signal in the examined egg indicate that the embryo carries a maternal W chromosome and is therefore determined as female, thereby providing gender determination thereof.
  • the transgenic avian provided by the invention may be either a female or a male, as described in more detail herein after.
  • the transgenic avian subject is a female
  • the egg identified by the method of the invention is laid by the transgenic female avian provided by the invention.
  • the transgenic female may be fertilized either by a transgenic male or by a wild type avian male.
  • fertilization may occur either by mating or by insemination of the transgenic avian female with sperms obtained from a transgenic or wild type avian male.
  • transgenic avian is a male
  • egg identified by the method of the invention may be laid by either a wild type or transgenic female mated with the transgenic male provided by the invention, or inseminated by any cells thereof, specifically sperm cells that comprise the exogenous reporter gene of the invention integrated into the gender chromosomes thereof.
  • the invention thus provides a method for detecting a gender of an avian embryo within an unhatched fertilized egg. It should be appreciated that the method of the invention may be applicable for unhatched eggs of any embryonic stage of an avian embryo.
  • Embryonic development stage or step of avian embryo refers to the stage of day 1 wherein the germinal disc is at the blastodermal stage and the segmentation cavity takes on the shape of a dark ring; the stage of day 2 wherein the first groove appears at the center of the blastoderm and the vitelline membrane appears; the stage of day 3 wherein blood circulation starts, the head and trunk can be discerned, as well as the brain and the cardiac structures which begins to beat; the stage of day 4 wherein the amniotic cavity is developing to surround the embryo and the allantoic vesicle appears; the stage of day 5 wherein the embryo takes a C shape and limbs are extending; the stage of day 6 wherein fingers of the upper and lower limbs becomes distinct;
  • the method of the invention may be applicable in determining the gender of an avian embryo in-ovo, inside the egg, at every stage of the embryonic developmental process. More specifically, from day 1, from day 2, from day 3, from day 4, from day 5, from day 6, from day 7, from day 8, from day 9, from day 10, from day 11, from day 12, from day 13, from day 14, from day 15, from day 16, from day 17, from day 18, from day 19, from day 20 and from day 21. More specifically, the method of the invention may be applicable for early detection of the embryo's gender, specifically, from day 1 to day 10, more specifically, between days 1 to 5..
  • the method of the invention may be applicable for fertilized unhatched eggs.
  • fertilized egg refers hereinafter to an egg laid by a hen wherein the hen has been mated by a rooster within two weeks, allowing deposit of male sperm into the female infundibulum and fertilization event to occur upon release of the ovum from the ovary.
  • Unhatched egg as used herein, relates to an egg containing and embryo (also referred to herein as a fertile egg) within a structurally integral (not broken) shell.
  • the method of the invention is based on determination of a detectable signal formed by a reporter gene integrated into specific loci of the transgenic avian female or male laying the examined egg.
  • the integrated reporter gene may be transferred to the embryo within the unhatched egg.
  • exogenous refers to originating from outside an organism that has been introduced into an organism for example by transformation or transfection with specifically manipulated vectors, viruses or any other vehicle.
  • the integrated exogenous gene may be a reporter gene.
  • reporter gene relates to gene which encodes a polypeptide, whose expression can be detected in a variety of known assays and wherein the level of the detected signal indicates the presence of said reported.
  • the exogenous reporter gene may be integrated into the avian gender chromosomes Z or W.
  • the avian "gender chromosome Z or W" as used herein refers to the chromosomal system that determines the sex of offspring in chicken wherein males are the homogametic sex (ZZ), while females are the heterogametic sex (ZW).
  • ZZ homogametic sex
  • ZW heterogametic sex
  • the presence of the W chromosome in the ovum determines the sex of the offspring while the Z chromosome is known to be larger and to possess more genes.
  • the method of the invention is based on the detection of a detectable signal that indicates and reflects the presence of the reporter gene and thereby the presence of a specific gender chromosome.
  • Detectable signal refers hereinafter to a change in that is perceptible either by observation or instrumentally. Without limitations, the signal can be detected directly or only in the presence of a reagent. In some embodiments, detectable response is an optical signal including, but are not limited to chemiluminescent groups.
  • At least one transgenic avian subject provided by the method of the invention may comprise at least two different reporter genes, each reporter gene may be integrated into at least one position or location in one of gender chromosome Z or W.
  • each of the gender chromosomes may be labeled differently.
  • the evaluation of the detectable signal formed may indicate the gender of the examined embryo.
  • the reporter gene comprised within the transgenic avian of the invention may be at least one bioluminescence reporter gene.
  • the expressed polypeptide is a bioluminescence protein and accordingly the assay measures the levels of light emitted from bioluminescent reaction.
  • Bioluminescence refers to the emission of light by biological molecules, such as proteins. Bioluminescence involves a molecular oxygen, an oxygenase, and a luciferase, which acts on a substrate, a luciferin, as will be described in more detail herein after.
  • the reporter gene may be luciferase.
  • the term "Luciferase” refers hereinafter to a class of oxidative enzymes that produce bioluminescence (photon emission). The emitted photon can be detected by light sensitive apparatus such as a luminometer or modified optical microscopes. Luciferase can be produced through genetic engineering in a variety of organisms mostly for use as a reporter gene. Luciferases occur naturally in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid.
  • the genes responsible for the light-emitting reaction have been isolated and used extensively in the construction of bio reporters that emit a blue-green light with a maximum intensity at 490 nm.
  • Three variants of lux are available, one that functions at ⁇ 30°C, another at ⁇ 37°C, and a third at ⁇ 45 °C.
  • the lux genetic system consists of five genes, luxA, luxB, luxC, luxD, and luxE. Depending on the combination of these genes used, several different types of bioluminescent bioreporters can be constructed.
  • the luciferase protein is a heterodimer formed by the luxA and luxB gene products.
  • the luxC, luxD, and luxE gene products encode for a reductase, transferase, and synthase respectively, that work together in a single complex to generate an aldehyde substrate for the bioluminescent reaction.
  • luxAB bioreporters contain only the luxA and luxB genes, which are able to generate the light signal. However, to fully complete the light-emitting reaction, the substrate (long chain aldehyde) must be supplied to the cell.
  • luxCDABE bioreporters contain all five genes of the lux cassette, thereby allowing for a completely independent light generating system that requires no extraneous additions of substrate nor any excitation by an external light source. Due to their rapidity and ease of use, along with the ability to perform the bioassay repetitively in real time and on-line, makes luxCDABE bioreporters extremely attractive.
  • the method of the invention may use as the reporter gene, the luxCDABE bioreporters.
  • the method of the invention may use as a reporter gene, the luc gene.
  • Firefly luciferase (luc gene) catalyzes a reaction that produces visible light in the 550-575 nm range.
  • a click-beetle luciferase is also available that produces light at a peak closer to 595 nm. Both luciferases require the addition of an exogenous substrate (luciferin) for the light reaction to occur.
  • the luciferase that may be used by the methods of the invention may be Gaussia princeps luciferase.
  • the luciferase used by the invention may be the luciferase encoded by the nucleic acid sequence as disclosed by GenBank: AYO 15993.1, having the amino acid sequence as disclosed by GenBank: AAG54095.1.
  • the luciferase used by the methods and kits of the invention may be encoded by a nucleic acid sequence comprising the sequence as denoted by SEQ ID NO. 22.
  • such luciferase may comprise the amino acid sequence as denoted by SEQ ID NO. 23, or any homologs, mutants or derivatives thereof.
  • luciferase used by the invention may be P. pyralis (firefly) luciferase.
  • such luciferase may be the luciferase encoded by the nucleic acid sequence as disclosed by GenBank: M15077.1, having the amino acid sequence as disclosed by GenBank: AAA29795.1.
  • the luciferase used by the methods and kits of the invention may be encoded by a nucleic acid sequence comprising the sequence as denoted by SEQ ID NO. 20.
  • such luciferase may comprise the amino acid sequence as denoted by SEQ ID NO. 21, or any homologs, mutants or derivatives thereof.
  • the luciferase used by the method of the invention may require supplementing additional reagents, specifically, a substrate.
  • the method may further comprise the step of providing to said egg of step (b), at least one of substrate and enzyme compatible to the bioluminescence reporter gene.
  • substrate or enzyme may be required for the formation of the detectable signal detected at step (c).
  • the method of the invention may comprise the step of providing to the egg of step (b), for example by injection, a substrate for luciferase.
  • substrate may be luciferin.
  • Luciferin as used herein is a generic term for the light-emitting compound found in organisms that generate bioluminescence. Luciferins typically undergo an enzyme-catalyzed oxidation and the resulting excited state intermediate emits light upon decaying to its basal state.
  • the substrate luciferin that is an essential element in formation of said detectable signal, is injected to said egg, specifically, prior to measurement and determination of said signal, as performed in step (c).
  • the substrate may be injected at day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 of embryonal development of said avian subject, specifically animal.
  • the substrate and/or further enzyme required for formation of the detectable signal may be provided to the fertilized egg as nucleic acid sequence encoding said substrate and/or enzyme, operably liked to said reporter gene.
  • Such specific embodiments may refer for example to the use of the luxCDABE bioreporters as described above.
  • LuxCDABE system contain five genes of the lux cassette, thereby allowing for a completely independent light generating system that requires no extraneous additions of substrate nor any excitation by an external light source.
  • the detectable signal may be detected using suitable bioluminescent means.
  • the detectable signal formed by the luciferase reporter gene may be detected by light sensitive apparatus such as a luminometer or modified optical microscopes or Charge Coupled Device (CCD), a highly sensitive photon detector.
  • CCD Charge Coupled Device
  • the at least one transgenic avian subject or animal provided by the method of the invention may be a female avian subject or animal.
  • the at least one reporter gene is integrated into at least one position of female chromosome Z, detection of a detectable signal indicates that the embryo in the unhatched egg is male.
  • At least one transgenic avian subject or animal provided by the method of the invention may be a female avian subject or animal.
  • the at least one reporter gene is integrated into at least one position of female chromosome W
  • detection of a detectable signal indicates that the embryo in the unhatched egg is female.
  • the transgenic animal provided by the method of the invention may be a male subject having the reporter gene integrated into the Z chromosomes thereof.
  • a detectable signal determined in an egg fertilized by such transgenic male or any sperms thereof indicates that the embryo carries a paternal Z chromosome comprising the transgenic reporter gene, and is therefore male.
  • detection of a detectable signal in an egg laid by a transgenic female avian fertilized by a transgenic male avian, both carrying the reporter gene of the invention integrated into the Z chromosomes thereof may indicate in case of an intense signal that the embryo carries two copies of a reporter gene integrated into the female and male Z chromosomes thereof. In case of a less intense signal, the egg may be determined as a female.
  • the method of the invention involves the provision of transgenic avian animals.
  • the preparation of transgenic avian animals requires the use of genetic engineering approach that may use specific nucleases.
  • the at least one reporter gene may be integrated into the gender chromosome of the transgenic avian subject or animal provided by the method of the invention using at least one programmable engineered nuclease (PEN).
  • PEN programmable engineered nucleases
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • ZFNs zinc finger nucleases
  • TALENs transcription-activator-like effector nucleases
  • SPIDRs Spacer Interspersed Direct Repeats
  • the CRISPR array is a distinct class of interspersed short sequence repeats (SSRs) that were first recognized in E. coli.
  • SSRs interspersed short sequence repeats
  • Similar CRISPR arrays were found in Mycobacterium tuberculosis, Haloferax mediterranei, Methanocaldococcus jannaschii, Thermotoga maritima and other bacteria and archaea. It should be understood that the invention contemplates the use of any of the known CRISPR systems, particularly and of the CRISPR systems disclosed herein.
  • the CRISPR-Cas system has evolved in prokaryotes to protect against phage attack and undesired plasmid replication by targeting foreign DNA or RNA.
  • the CRISPR-Cas system targets DNA molecules based on short homologous DNA sequences, called spacers that exist between repeats. These spacers guide CRISPR-associated (Cas) proteins to matching (and/or complementary) sequences within the foreign DNA, called proto-spacers, which are subsequently cleaved.
  • the spacers can be rationally designed to target any DNA sequence. Moreover, this recognition element may be designed separately to recognize and target any desired target.
  • the structure of a naturally occurring CRISPR locus includes a number of short repeating sequences generally referred to as "repeats".
  • CRISPR repeats occur in clusters and are usually regularly spaced by unique intervening sequences referred to as "spacers.”
  • CRISPR repeats vary from about 24 to 47 base pair (bp) in length and are partially palindromic.
  • the spacers are located between two repeats and typically each spacer has unique sequences that are from about 20 or less to 72 or more bp in length.
  • the CRISPR spacers used in the sequence encoding at least one gRNA of the methods and kits of the invention may comprise between 10 to 75 nucleotides (nt) each.
  • the spacers comprise about 20 to 25 nucleotides, more specifically, about 20 nucleobases.
  • a CRISPR locus also includes a leader sequence and optionally, a sequence encoding at least one tracrRNA.
  • the leader sequence typically is an AT-rich sequence of up to 550 bp directly adjoining the 5' end of the first repeat.
  • PEN may be a clustered regularly interspaced short palindromic repeat (CRISPR) type II system.
  • CRISPR clustered regularly interspaced short palindromic repeat
  • Type I More specifically, three major types of CRISPR-Cas system are delineated: Type I, Type II and Type III.
  • the type II CRISPR-Cas systems include the ⁇ '-type system (Streptococcus-like; also known as the Nmeni subtype, for Neisseria meningitidis serogroup A str. Z2491, or CASS4), in which Cas9, a single, very large protein, seems to be sufficient for generating crRNA and cleaving the target DNA, in addition to the ubiquitous Casl and Cas2.
  • Cas9 contains at least two nuclease domains, a RuvC-like nuclease domain near the amino terminus and the HNH (or McrA-like) nuclease domain in the middle of the protein, but the function of these domains remains to be elucidated.
  • HNH nuclease domain is abundant in restriction enzymes and possesses endonuclease activity responsible for target cleavage.
  • Type II systems cleave the pre-crRNA through an unusual mechanism that involves duplex formation between a tracrRNA and part of the repeat in the pre-crRNA; the first cleavage in the pre-crRNA processing pathway subsequently occurs in this repeat region. Still further, it should be noted that type II system comprise at least one of cas9, casl, cas2 csn2, and cas4 genes. It should be appreciated that any type II CRISPR-Cas systems may be applicable in the present invention, specifically, any one of type II-A or B.
  • the at least one cas gene used in the methods and kits of the invention may be at least one cas gene of type II CRISPR system (either typell-A or typell-B).
  • at least one cas gene of type II CRISPR system used by the methods and kits of the invention may be the cas9 gene. It should be appreciated that such system may further comprise at least one of casl, cas2, csn2 and cas4 genes. Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of "type II CRISPR- Cas " immune systems.
  • dsDNA Double-stranded DNA
  • the CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific double stranded DNA (dsDNA) cleavage, creating the double strand brakes (DSBs) required for the HDR that results in the integration of the reporter gene into the specific target sequence, for example, a specific target within the avian gender chromosomes W and Z.
  • the targeted DNA sequences are specified by the CRISPR array, which is a series of about 30 to 40 bp spacers separated by short palindromic repeats.
  • the array is transcribed as a pre-crRNA and is processed into shorter crRNAs that associate with the Cas protein complex to target complementary DNA sequences known as proto-spacers.
  • proto-spacer targets must also have an additional neighboring sequence known as a proto-spacer adjacent motif (PAM) that is required for target recognition.
  • PAM proto-spacer adjacent motif
  • CRISPR type II system requires the inclusion of two essential components: a "guide” RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9).
  • the gRNA is a short synthetic RNA composed of a "scaffold" sequence necessary for Cas9-binding and about 20 nucleotide long "spacer” or “targeting" sequence which defines the genomic target to be modified. Thus, one can change the genomic target of Cas9 by simply changing the targeting sequence present in the gRNA.
  • Guide RNA as used herein refers to a synthetic fusion of the endogenous bacterial crRNA and tracrRNA, providing both targeting specificity and scaffolding/binding ability for Cas9 nuclease.
  • single guide RNA also referred to as “single guide RNA” or “sgRNA”.
  • CRISPR was originally employed to "knock-out” target genes in various cell types and organisms, but modifications to the Cas9 enzyme have extended the application of CRISPR to "knock-in” target genes, selectively activate or repress target genes, purify specific regions of DNA, and even image DNA in live cells using fluorescence microscopy.
  • the ease of generating gRNAs makes CRISPR one of the most scalable genome editing technologies and has been recently utilized for genome-wide screens.
  • the target within the genome to be edited specifically, the specific target loci within the gender chromosomes Z or W, where the reporter gene of the invention is to be integrated, should be present immediately upstream of a Protospacer Adjacent Motif (PAM).
  • PAM Protospacer Adjacent Motif
  • the PAM sequence is absolutely necessary for target binding and the exact sequence is dependent upon the species of Cas9 (5' NGG 3' for Streptococcus pyogenes Cas9). In certain embodiments, Cas9 from 5. pyogenes is used in the methods and kits of the invention. Nevertheless, it should be appreciated that any known Cas9 may be applicable.
  • Non-limiting examples for Cas9 useful in the present disclosure include but are not limited to Streptococcus pyogenes (SP), also indicated herein as SpCas9, Staphylococcus aureus (SA), also indicated herein as SaCas9, Neisseria meningitidis (NM), also indicated herein as NmCas9, Streptococcus thermophilus (ST), also indicated herein as StCas9 and Treponema denticola (TO), also indicated herein as TdCas9.
  • SP Streptococcus pyogenes
  • SA Staphylococcus aureus
  • NM Neisseria meningitidis
  • ST Streptococcus thermophilus
  • TO Treponema denticola
  • the Cas9 of Streptococcus pyogenes Ml GAS may be applicable in the methods and kits of the invention.
  • the Cas9 protein may be encoded by the nucleic acid sequence as denoted by SEQ ID NO. 24.
  • the Cas9 protein may comprise the amino acid sequence as denoted by SEQ ID NO. 25, or any derivatives, mutants or variants thereof.
  • Cas9 undergoes a conformational change upon gRNA binding that shifts the molecule from an inactive, non-DNA binding conformation, into an active DNA-binding conformation.
  • the "spacer" sequence of the gRNA remains free to interact with target DNA.
  • the Cas9-gRNA complex binds any genomic sequence with a PAM, but the extent to which the gRNA spacer matches the target DNA determines whether Cas9 will cut.
  • a "seed" sequence at the 3' end of the gRNA targeting sequence begins to anneal to the target DNA. If the seed and target DNA sequences match, the gRNA continues to anneal to the target DNA in a 3' to 5' direction.
  • Cas9 will only cleave the target if sufficient homology exists between the gRNA spacer and target sequences. Still further, the Cas9 nuclease has two functional endonuclease domains: RuvC and HNH. Cas9 undergoes a second conformational change upon target binding that positions the nuclease domains to cleave opposite strands of the target DNA.
  • the end result of Cas9-mediated DNA cleavage is a double strand break (DSB) within the target DNA that occurs about 3 to 4 nucleotides upstream of the PAM sequence.
  • DSB double strand break
  • the resulting DSB may be then repaired by one of two general repair pathways, the efficient but error-prone Non-Homologous End Joining (NHEJ) pathway and the less efficient but high-fidelity Homology Directed Repair (HDR) pathway.
  • NHEJ Non-Homologous End Joining
  • HDR Homology Directed Repair
  • the insertion that results in the specific integration of the reporter gene of the invention to the specific target loci within the gender chromosomes W or Z is a result of repair of DSBs caused by Cas9.
  • the reporter gene of the invention is integrated, or knocked-in the target loci by HDR.
  • HDR Homology directed repair
  • the term "Homology directed repair (HDR)” refers to a mechanism in cells to repair double strand DNA lesions.
  • the most common form of HDR is homologous recombination.
  • the HDR repair mechanism can only be used by the cell when there is a homologue piece of DNA present in the nucleus, mostly in G2 and S phase of the cell cycle. When the homologue DNA piece is absent, another process called non-homologous end joining (NHEJ) can take place instead.
  • NHEJ non-homologous end joining
  • PEN Programmable engineered nucleases
  • Cas9 generates double strand breaks (DSBs) through the combined activity of two nuclease domains, RuvC and HNH.
  • the exact amino acid residues within each nuclease domain that are critical for endonuclease activity are known (DIOA for HNH and H840A for RuvC in 5.
  • pyogenes Cas9) and modified versions of the Cas9 enzyme containing only one active catalytic domain have been generated.
  • Cas9 nickases still bind DNA based on gRNA specificity, but nickases are only capable of cutting one of the DNA strands, resulting in a "nick", or single strand break, instead of a DSB.
  • DNA nicks are rapidly repaired by HDR (homology directed repair) using the intact complementary DNA strand as the template.
  • HDR homology directed repair
  • two nickases targeting opposite strands are required to generate a DSB within the target DNA (often referred to as a "double nick” or “dual nickase” CRISPR system).
  • This requirement dramatically increases target specificity, since it is unlikely that two off-target nicks will be generated within close enough proximity to cause a DSB. It should be therefore understood, that the invention further encompasses the use of the dual nickase approach to create a double nick-induced DSB for increasing specificity and reducing off-target effects.
  • the at least one reporter gene may be integrated into the gender chromosome of the transgenic avian subject, specifically animal by homology directed repair (HDR) mediated by at least one CRISPR/CRISPR-associated endonuclease 9 (Cas9) system.
  • HDR homology directed repair
  • Cas9 CRISPR/CRISPR-associated endonuclease 9
  • the gRNA of the kit of the invention may comprise at least one CRISPR RNA (crRNA) and at least one trans-activating crRNA (tracrRNA).
  • crRNA CRISPR RNA
  • tracrRNA trans-activating crRNA
  • the kit of the invention may comprise nucleic acid sequence encoding the at least one gRNA.
  • nucleic acid sequence may comprise a CRISPR array comprising at least one spacer sequence that targets and is therefore identical to at least one protospacer in a target genomic DNA sequence. It should be note that the nucleic acid sequence further comprises a sequence encoding at least one tracrRNA.
  • the CRISPR array according to the present disclosure comprises at least one spacer and at least one repeat.
  • the invention further encompasses the option of providing a pre-crRNA that can be processed to several final gRNA products that may target identical or different targets.
  • the crRNA comprised within the gRNA of the invention may be a single-stranded ribonucleic acid (ssRNA) sequence complementary to a target genomic DNA sequence.
  • the target genomic DNA sequence may be located immediately upstream of a protospacer adjacent motif (PAM) sequence and further.
  • the gRNA of the kit of the invention may be complementary, at least in part, to the target genomic DNA.
  • “Complementarity” refers to a relationship between two structures each following the lock-and-key principle.
  • complementarity is the base principle of DNA replication and transcription as it is a property shared between two DNA or RNA sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary (e.g., A and T or U, C and G).
  • the genomic DNA sequence targeted by the gRNA of the kit of the invention is located immediately upstream to a PAM sequence.
  • PAM sequence may be of the nucleic acid sequence NGG.
  • the PAM sequence referred to by the invention may comprise N, that is any nucleotide, specifically, any one of Adenine (A), Guanine (G), Cytosine (C) or Thymine (T).
  • N any nucleotide, specifically, any one of Adenine (A), Guanine (G), Cytosine (C) or Thymine (T).
  • the PAM sequence according to the invention is composed of A, G, C, or T and two Guanines.
  • the polynucleotide encoding the gRNA of the invention may comprise at least one spacer and optionally, at least one repeat.
  • the DNA encoding the gRNA of the invention may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • each spacer is located between two repeats. It should be further understood that the spacers of the nucleic acid sequence encoding the gRNA of the invention may be either identical or different spacers. In more embodiments, these spacers may target either an identical or different target genomic DNA.
  • such spacer may target at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more target genomic DNA sequence.
  • These target sequences may be derived from a single locus or alternatively, from several target loci.
  • spacer refers to a non-repetitive spacer sequence that is designed to target a specific sequence and is located between multiple short direct repeats (i.e., CRISPR repeats) of CRISPR arrays.
  • spacers may comprise between about 15 to about 30 nucleotides, specifically, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. More specifically, about 20-25 nucleotides.
  • the guide or targeting RNA encoded by the CRISPR system of the invention may comprise a CRISPR RNA (crRNA) and a trans activating RNA (tracrRNA).
  • the sequence of the targeting RNA encoded by the CRISPR spacers is not particularly limited, other than by the requirement for it to be directed to (i.e., having a segment that is the same as or complementarity to) a target sequence in avian genomic DNA that is also referred to herein as a "proto-spacer".
  • proto-spacers comprise nucleic acid sequence having sufficient complementarity to a targeting RNA encoded by the CRISPR spacers comprised within the nucleic acid sequence encoding the gRNA of the methods and kits of the invention.
  • a crRNA comprises or consists of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nt of the spacer (targeting) sequence followed by 19-36 nt of repeat sequence.
  • the targeting spacer may comprise or consist of a segment that targets any one of the genomic DNA sequence for which representative spacer sequences are indicated herein.
  • the spacers of the CRISPR system of the invention may encode a targeting guide RNA (gRNA).
  • gRNA targeting guide RNA
  • a “gRNA” or “targeting RNA” is an RNA that, when transcribed from the portion of the CRISPR system encoding it, comprises at least one segment of RNA sequence that is identical to (with the exception of replacing T for U in the case of RNA) or complementary to (and thus "targets") a DNA sequence in the target genomic DNA.
  • the CRISPR systems of the present disclosure may optionally encode more than one targeting RNA, and the targeting RNAs be directed to one or more target sequences in the genomic DNA.
  • the at least one reporter gene may be integrated into a gender chromosome of the transgenic avian subject, specifically animal by co- transfecting at least one cell of the avian subject, specifically animal or at least one cell introduced into the avian subject, specifically animal, with: (a) at least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence encoding at least one guide RNA (gRNA); and (b) at least one second nucleic acid sequence comprising at least one reporter gene.
  • gRNA guide RNA
  • At least two nucleic acid molecules should be provided.
  • nucleic acids or nucleic acid molecules is interchangeable with the term “polynucleotide(s)” and it generally refers to any polyribonucleotide or poly- deoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA or any combination thereof.
  • Nucleic acids include, without limitation, single - and double-stranded nucleic acids.
  • nucleic acid(s) also includes DNAs or RNAs as described above that contain one or more modified bases.
  • oligonucleotide is defined as a molecule comprised of two or more deoxyribonucleotides and/or ribonucleotides, and preferably more than three. Its exact size will depend upon many factors which in turn, depend upon the ultimate function and use of the oligonucleotide.
  • the oligonucleotides may be from about 8 to about 1 ,000 nucleotides long.
  • the oligonucleotide molecule/s used by the kit of the invention may comprise any one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more bases in length.
  • Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., alpha-enantiomeric forms of naturally-occurring nucleotides), or modified nucleotides or any combination thereof.
  • this term also encompasses a cDNA, i.e. complementary or copy DNA produced from an RNA template by the action of reverse transcriptase (RNA-dependent DNA polymerase).
  • an "isolated polynucleotide” is a nucleic acid molecule that is separated from the genome of an organism.
  • a DNA molecule that encodes the reporter gene used by the methods and kits of the invention or any derivatives or homologs thereof, as well as the sequences encoding the CRISPR/Cas9 and gRNAs of the methods and kits of the invention, that has been separated from the genomic DNA of a cell is an isolated DNA molecule.
  • Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism.
  • nucleic acid molecule that has been isolated from a particular species is smaller than the complete DNA molecule of a chromosome from that species.
  • nucleic acid sequences used by the methods and kits of the invention specifically, nucleic acid sequences comprising sequences encoding the Cas9 and gRNA, or alternatively the reporter gene of the invention, may be provided constructed within a vector.
  • the invention thus further relates to recombinant DNA constructs comprising the polynucleotides of the invention, and optionally, further additional elements such as promoters, regulatory and control elements, translation, expression and other signals, operably linked to the nucleic acid sequence of the invention.
  • recombinant DNA refers to a nucleic acid comprising an open reading frame encoding one of the CRISPR system of the invention, specifically, the CRISPR/Cas9 type II, along with the gRNA of the invention that target the Cas9 to specific locus within avian chromosomes Z and/or W.
  • recombinant DNA as used herein further refers to a nucleic acid comprising an open reading frame encoding the reporter gene of the invention, specifically, transgene.
  • nucleic acid As referred to herein, by the term “gene” or “transgene” is meant a nucleic acid, either naturally occurring or synthetic, which encodes a protein product.
  • nucleic acid is intended to mean natural and/or synthetic linear, circular and sequential arrays of nucleotides and nucleosides, e.g., cDNA, genomic DNA (gDNA), mRNA, and RNA, oligonucleotides, oligonucleosides, and derivatives thereof.
  • operatively-linked is intended to mean attached in a manner which allows for transgene transcription.
  • encoding is intended to mean that the subject nucleic acid may be transcribed and translated into either the desired polypeptide or the subject protein in an appropriate expression system, e.g., when the subject nucleic acid is linked to appropriate control sequences such as promoter and enhancer elements in a suitable vector (e.g., an expression vector) and when the vector is introduced into an appropriate system or cell.
  • At least one of the first and the second nucleic acid sequences provided and used by the methods and kits of the invention may be constructed and comprised within a vector.
  • Vectors or “Vehicles”, as used herein, encompass vectors such as plasmids, phagemides, viruses, integratable DNA fragments, and other vehicles, which enable the integration of DNA fragments into the genome of the host, or alternatively, enable expression of genetic elements that are not integrated.
  • Vectors are typically self-replicating DNA or RNA constructs containing the desired nucleic acid sequences, and operably linked genetic control elements that are recognized in a suitable host cell and effect the translation of the desired spacers.
  • the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system.
  • a prokaryotic promoter system typically includes a transcriptional promoter, transcription enhancers to elevate the level of RNA expression.
  • Vectors usually contain an origin of replication that allows the vector to replicate independently of the host cell.
  • the expression vectors used by the invention may comprise elements necessary for integration of the desired reporter gene of the invention into the avian gender specific chromosomes W and/or Z.
  • control and regulatory elements includes promoters, terminators and other expression control elements.
  • Such regulatory elements are described in Goeddel; [Goeddel., et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)].
  • any of a wide variety of expression control sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding any desired protein using the method of this invention.
  • a vector may additionally include appropriate restriction sites, antibiotic resistance or other markers for selection of vector-containing cells.
  • Plasmids are the most commonly used form of vector but other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels et al., Cloning Vectors: a Laboratory Manual (1985 and supplements), Elsevier, N.Y.; and Rodriquez, et al. (eds.) Vectors: a Survey of Molecular Cloning Vectors and their Uses, Buttersworth, Boston, Mass (1988), which are incorporated herein by reference.
  • an avian cell comprising the reporter gene integrated into specific loci within the gender chromosomes Z or W thereof must be prepared.
  • Such cell may be prepared by co- transfecting the cell with the first and second nucleic acid sequences provided by the methods and kits of the invention or with any construct comprising the same.
  • Transfection as used herein is meant the process of inserting genetic material, such as DNA and double stranded RNA, into mammalian cells. The insertion of DNA into a cell enables the expression, or production, of proteins using the cells own machinery.
  • co-transfection refers to simultaneous transfection of at least two different nucleic acid molecules or any vector comprising the same to each single cell.
  • the nucleic acid sequences to be transfected can be transiently expressed for a short period of time, or become incorporated into the genomic DNA, where the change is passed on from cell to cell as it divides.
  • the invention therefore provides methods for an in-ovo gender determination of an avian embryo in-ovo based on expression of a reporter gene, specifically, luciferase.
  • “Expression” generally refers to the process by which gene-encoded information is converted into the structures present and operating in the cell. Therefore, according to the invention "expression" of a reporter gene, specifically, may refer to transcription into a polynucleotide, translation into a protein, or even posttranslational modification of the protein.
  • the at least one reporter gene in the second nucleic acid sequence may be flanked at 5' and 3' thereof by homologous arms. It should be appreciated that in some embodiments, these arms are required and therefore facilitate HDR of the reporter gene at the integration site.
  • the reporter gene in the second nucleic acid sequence used by the method of the invention may be flanked with two arms that are homologous or show homology or identity of about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to at least one nucleic acid sequence comprised within the target loci within the gender chromosomes Z or W, that serves as the integration site to facilitate specific integration via HDR.
  • the target sequence is also referred to herein as at least one "proto-spacer" that is recognized by the "spacer" sequences that are part of the gRNA used by the invention, and provided by the first nucleic acid sequence.
  • the term “Homologous arms”, as used herein refers to HDR templates introduced into specific vectors or viruses, used to create specific mutations or insertion of new elements into a gene, that possess a certain amount of homology surrounding the target sequence to be modified (depending on which PEN is used).
  • the arms sequences (left, upstream and right, downstream) may comprise between about 10 to 5000 bp, specifically, between about 50 to 1000 bp, between 100 to 500, specifically, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, lOOObp.
  • the targeting sequence within the gRNA encoded by the first nucleic acid sequence provided by the methods and kits of the invention exhibits homology or identity of about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to at least one nucleic acid sequence comprised within the target loci within the gender chromosomes Z or W, referred to herein as the "proto-spacer".
  • the at least one reporter gene in the second nucleic acid sequence may be operably linked to any one of a gender specific promoter, an embryonal specific promoter (for example a-Globin Promoter as referred in Mason et al. 1996) and an inducible promoter (for example light-inducible promoters derived from the soybean SSU gene claimed into US 5750385, or derived from parsley chalcone synthase CHS promoter as referred in Weisshaar et al. 1991, or an engineered version of EL222, a bacterial Light-Oxygen- Voltage protein that activates expression when illuminated with blue light cited from Metta-Mena et al. 2014).
  • a gender specific promoter for example a-Globin Promoter as referred in Mason et al. 1996) and an inducible promoter (for example light-inducible promoters derived from the soybean SSU gene claimed into US 5750385, or derived from parsley chalcone synthase
  • the reporter gene is under the control of an embryonic promoter, thereby limiting the expression of the transgenic reporter gene to the embryonal stage, with no expression in the adult chick.
  • the reporter transgene is used and expressed only at the embryonal stage, for diagnostic purposes.
  • “Promoter” as used herein refers to a particular region of the DNA that has the ability to control the expression of the gene which is placed downstream.
  • “Promoter specific for gender in chicks” refers hereinafter to a promoter that will activate the expression of a gene, only in a specific chick gender (i.e. male or female).
  • “Promoter specific for development in chicks” refers to a promoter that will activate the expression of a gene, only at specific stages of the chick development.
  • the at least one reporter gene may be inserted and thereby integrated into at least one non-coding region of the target gender chromosome. Such approach avoids the disruption of genes that may be required for development and maturation of the unhatched embryo.
  • Non-coding region refers to components of an organism's DNA that do not encode protein sequences. Some noncoding DNA region is transcribed into functional non-coding RNA molecules, other functions of noncoding DNA regions include the transcriptional and translational regulation of protein-coding sequences, scaffold attachment regions, origins of DNA replication, centromeres and telomeres. The hypothesized non-functional portion (or DNA of unknown function) has often been referred to as "junk DNA".
  • the at least one reporter gene may be integrated into at least one site at gender W chromosome.
  • the specific locus in the W chromosome may be location 1022859-1024215.
  • the target locus may comprise the nucleic acid sequence as denoted by SEQ ID NO. 3.
  • the at least one gRNA required to target the reporter gene to such specific location within the W chromosome may comprises the nucleic acid sequence as denoted by any one of SEQ ID NO. 1 and 2, these gRNAs are designated herein as gRNAl and gRNA2, respectively.
  • the gRNA used by the method of the invention to prepare the transgenic avian female may comprise the nucleic acid sequence as denoted by SEQ ID NO. 1 (gRNAl).
  • the at least one reporter gene comprised within said second nucleic acid sequence may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 4 and 5, that facilitate the integration thereof to said specific loci in W chromosome, respectively. It should be appreciated that these arms are also referred to herein as left and right arms, respectively.
  • the gRNA used for preparing the transgenic avian female of the invention may comprise the nucleic acid sequence as denoted by SEQ ID NO. 2 (gRNA2).
  • the at least one reporter gene comprised within the second nucleic acid sequence is flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 6 and 7, respectively. It should be appreciated that these arms are also referred to herein as left and right arms, respectively.
  • the at least one reporter gene used by the method of the invention for preparing the transgenic avian animal may be integrated into at least one site at gender Z chromosome.
  • the specific loci in the Z chromosome may be any one of regions 9156874-9161874, as denoted by SEQ ID NO: 15, 27764943-27769943, as denoted by SEQ ID NO:16, 42172748-42177748, as denoted by SEQ ID NO: 17, 63363656-63368656, as denoted by SEQ ID NO: 18 and 78777477-78782477, as denoted by SEQ ID NO: 19 of Chromosome Z of female chicken.
  • the at least one gRNA required to target the reporter gene to such specific location within the Z chromosome may comprises the nucleic acid sequence as denoted by any one of gRNA3: ACAGACCTATGATATGT, as denoted by SEQ ID NO. 11 ; gRNA4: CGATTATCACTCACAAG, as denoted by SEQ ID NO. 12; gRNA5: CTGGTT AGC ATGGGGAC , as denoted by SEQ ID NO. 13; gRNA6: GTAAAGAGTCAGATACA, as denoted by SEQ ID NO. 14.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 41 and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 42 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA3 of SEQ ID NO: 11.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 43
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 46
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 46
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • gRNA sequences suitable for integration into specific loci within the Z chromosome may include but are not limited to gRNA7 of Z chromosome locus chrZ_42174515_-l, comprising the nucleic acid sequence GTAATACAGAGCTAAACCAG, as also denoted by SEQ ID NO:26, gRNA8 of Z chromosome locus chrZ_9157091_l, comprising the nucleic acid sequence ACAGACCTATGATATGTGAG, as also denoted by SEQ ID NO:27, gRNA9 of Z chromosome locus chrZ_27767602_-l, comprising the nucleic acid sequence GAGCTTGTGAGTGATAATCG, as also denoted by SEQ ID NO:28,
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 31, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 32, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA7 of SEQ ID NO:26.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • gRNAl 1 of SEQ ID NO:30 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNAl 1 of SEQ ID NO:30.
  • the cells may be plated onto a feeder layer in an appropriate medium, for example, DMEM supplemented with growth factors and cytokines, fetal bovine serum and antibiotics.
  • DMEM fetal bovine serum
  • the embryonic stem cells may have a single targeted locus (heterozygotic) or both loci targeted (homozygotic).
  • Cells containing the construct may be detected by employing a selective medium and after sufficient time for colonies to grow, colonies may be picked and analyzed for the occurrence of gene targeting.
  • PCR may be applied to verify the integration of the desired exogenous sequences into the target loci, using primers within and outside the construct sequence. Colonies which show gene targeting may then be used for injection into avian embryos. The ES cells can then be trypsinized and the modified cells can be injected through an opening made in the side of the egg. After sealing the eggs, the eggs can be incubated under appropriate conditions until hatching. Newly hatched avian can be tested for the presence of the target construct sequences, for example by examining a biological sample thereof, e.g., a blood sample. After the avian have reached maturity, they are bred and their progeny may be examined to determine whether the exogenous integrated sequences are transmitted through the germ line.
  • Chimeric avian are generated which are derived in part from the modified embryonic stem cells or zygote cells, capable of transmitting the genetic modifications through the germ line.
  • Mating avian strains containing exogenous sequences, specifically, the reporter gene used by the invention, or portions thereof, with strains in which the avian wild type loci, or portions thereof, is restored, should result in progenies displaying an in-ovo detectable gender.
  • transgenic avian can also be produced by other methods, some of which are discussed below.
  • avian cells suitable for transformation for generating transgenic animals are primordial germ cells (PGC), sperm cells and zygote cells (including embryonic stem cells).
  • PPC primordial germ cells
  • sperm cells can be transformed with DNA constructs by any suitable method, including electroporation, microparticle bombardment, lipofection and the like.
  • the sperm can be used for artificial insemination of avian.
  • Progeny of the inseminated avian can be examined for the exogenous sequence as described above.
  • primordial germ cells may be isolated from avian eggs, transfected with the exogenous reporter gene of the invention by any appropriate method, and transferred or inserted into new embryos, where they can become incorporated into the developing gonads. Hatched avian and their progeny can be examined for the exogenous reporter gene sequence as described by the invention.
  • dispersed blastodermal cells isolated from eggs can be transfected by any appropriate means with the exogenous reporter gene sequence, or portions thereof, integrated to the gender specific chromosomes Z or W, followed by injection into the subgerminal cavity of intact eggs. Hatched avian subjects and their progeny may be examined for the exogenous reporter gene as described above.
  • Chicken primordial germ cells are the precursors for ova and spermatozoa.
  • the invention provides the production of transgenic chickens via a germline transmission system using PGCs co-transfected with the reporter gene construct and with the CRISPR/Cas9 gRNA construct that directs the integration of the reporter gene into the gender specific chromosomes W and Z.
  • PGCs are sorted and transferred into the bloodstream of 2.5 -day recipient embryos for germline transmission.
  • the "Preparation of transgenic avian animal” refers to a multi-step method involving genetic engineering techniques for production of chicken with genomic modifications wherein a) Primordial Germ Cells (PGCs) are isolated from the blood of two days-old chick embryos; b) a transgene construct is incorporated into cultured PGCs by using lentiviral system, Piggybac transposon vectors, TALENS or CRISPR/Cas9 techniques; (c) transgenic PGCs are identified and injected into the circulatory system of embryos and migrate to the developing gonads; d) recipient embryos are incubated at 37°C until hatching (d) hatched males are reared to sexual maturity and crossed with wild-type hens (e) offspring are screened to identify those derived from the transgenic PGCs.
  • PPCs Primordial Germ Cells
  • a transgene construct is incorporated into cultured PGCs by using lentiviral system, Piggybac transposon vectors
  • the invention relates to an avian transgenic animal comprising, in at least one cell thereof, at least one exogenous reporter gene integrated into at least one position or location (also referred to herein as locus) in at least one of gender chromosome Z and W.
  • avian relates to any species derived from birds characterized by feathers, toothless beaked jaws, the laying of hard-shelled eggs, a high metabolic rate, a four- chambered heart, and a lightweight but strong skeleton.
  • Avian species includes, without limitation, chicken, quail, turkey, duck, Gallinacea sp, goose, pheasant and other fowl.
  • the term "hen” includes all females of the avian species.
  • a “transgenic avian” generally refers to an avian that has had a heterologous DNA sequence, or one or more additional DNA sequences normally endogenous to the avian (collectively referred to herein as "transgenes”) chromosomally integrated into the germ cells of the avian. As a result of such transfer and integration, the transferred sequence may be transmitted through germ cells to the offspring of a transgenic avian.
  • the transgenic avian (including its progeny) also have the transgene integrated into the gender chromosomes of somatic cells.
  • the at least one transgenic animal of the invention may comprise at least two different reporter genes.
  • each reporter gene may be integrated into at least one position or location in one of gender chromosome Z or W.
  • the reporter gene comprised within the transgenic animal of the invention may be at least one bioluminescence reporter gene.
  • such bioluminescence reporter gene may comprise or may be luciferase.
  • the at least one transgenic avian animal provided by the invention may be female.
  • the at least one reporter gene in such transgenic avian female may be integrated into at least one position of the female chromosome Z.
  • the at least one transgenic avian animal may be female, having at least one reporter gene integrated into at least one position of the female chromosome W.
  • the at least one reporter gene may be integrated into the gender chromosome of the transgenic animal of the invention using at least one PEN.
  • PEN may be in certain embodiments, a CRISPR type II system.
  • the at least one reporter gene may be integrated into the gender chromosome of the transgenic avian animal of the invention by HDR mediated by at least one CRISPR/Cas9 system.
  • the at least one reporter gene may be integrated into a gender chromosome of the transgenic avian animal of the invention by co-transfecting at least one cell of this avian animal, or at least one cell that is to be introduced into said avian animal with at least two nucleic acid sequences. More specifically, such cell may be co-transfected with (a) at least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence encoding at least one gRNA, thereby providing a CRISPR mediated integration; and (b) at least one second nucleic acid sequence comprising at least one reporter gene.
  • the at least one reporter gene in the second nucleic acid sequence may be flanked at 5' and 3' thereof by homologous arms. These arms exhibit homology to the integration target site within the target gender chromosome, thereby facilitating HDR at the integration site.
  • the at least one reporter gene in the second nucleic acid sequence may be operably linked to any one of a gender specific promoter, an embryonal specific promoter and an inducible promoter. Such promoter should limit the expression of the reporter gene of the invention to the specific desired gender (in case of gender specific promoter), the specific embryonic stage (embryonic specific promoter) or specific conditions (inducible conditions).
  • the at least one reporter gene comprised within the transgenic avian animal of the invention may be integrated into at least one non-coding region of one of its gender chromosomes.
  • the at least one reporter gene may be integrated into at least one site at gender W chromosome.
  • the integration site may be located at locus 1022859-1024215 at the W chromosome, specifically, galGal5_dna range of chromosome W:1022859-1024215.
  • loci comprises the nucleic acid sequence as denoted by SEQ ID NO. 3.
  • appropriate gRNAs used for the preparation of the transgenic avian animal of the invention may comprise the nucleic acid sequence as denoted by any one of SEQ ID NO. 1 and 2.
  • these gRNAs are referred to herein as gRNAl and gRNA2, respectively.
  • the transgenic avian animal provided by the invention has been prepared using a gRNAl that comprises the nucleic acid sequence as denoted by SEQ ID NO. 1.
  • the reporter gene that should be integrated must carry in certain embodiments, particular arms facilitating incorporation thereof in the target integration site directed by the gRNA used.
  • the at least one reporter gene may be comprised within the second nucleic acid sequence, where this reporter gene is flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 4 and 5, respectively.
  • the transgenic avian animal provided by the invention may be prepared using a gRNA2 that comprises the nucleic acid sequence as denoted by SEQ ID NO. 2.
  • the at least one reporter gene comprised within the second nucleic acid sequence may be according to specific embodiments, flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 6 and 7, respectively.
  • the transgenic avian animal of the invention may comprise at least one reporter gene integrated into at least one site at gender Z chromosome.
  • such avian transgenic animal may be female that carry the transgenic reporter gene integrated into the Z chromosome.
  • the specific loci in the Z chromosome may be any one of regions 9156874-9161874, as denoted by SEQ ID NO:15, 27764943-27769943, as denoted by SEQ ID NO: 16, 42172748-42177748, as denoted by SEQ ID NO: 17, 63363656-63368656, as denoted by SEQ ID NO: 18 and 78777477-78782477, as denoted by SEQ ID NO: 19 of Chromosome Z of female chicken.
  • the at least one gRNA required to target the reporter gene to such specific location within the Z chromosome may comprises the nucleic acid sequence as denoted by any one of gRNA3: ACAGACCTATGATATGT, as denoted by SEQ ID NO. 11 ; gRNA4: CGATTATCACTCACAAG, as denoted by SEQ ID NO. 12; gRNA5: CTGGTTAGCATGGGGAC, as denoted by SEQ ID NO. 13 ; gRNA6: GTAAAGAGTCAGATACA, as denoted by SEQ ID NO. 14.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 41, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 42, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA3 of SEQ ID NO: 11.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 43, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 46 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA5 of SEQ ID NO:13.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 47, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 48 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA6 of SEQ ID NO: 14.
  • gRNA sequences suitable for integration into specific loci within the Z chromosome may include but are not limited to gRNA7 of Z chromosome locus chrZ_42174515_-l, comprising the nucleic acid sequence GTAATACAGAGCTAAACCAG, as also denoted by SEQ ID NO:26, gRNA8 of Z chromosome locus chrZ_9157091_l, comprising the nucleic acid sequence ACAGACCTATGATATGTGAG, as also denoted by SEQ ID NO:27, gRNA9 of Z chromosome locus chrZ_27767602_-l, comprising the nucleic acid sequence GAGCTTGTGAGTGATAATCG, as also denoted by SEQ ID NO:28, gRNA 10 of Z chromosome locus chrZ_78779927_l, comprising the nucleic acid sequence GTAAAGAGTCAGATACACAG, as also denoted by SEQ ID NO:
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 31, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 32, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA7 of SEQ ID NO:26.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • gRNAl 1 of SEQ ID NO:30 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNAl 1 of SEQ ID NO:30.
  • the invention relates to a cell comprising at least one exogenous reporter gene integrated into at least one position or location in at least one of gender chromosome Z and W.
  • the cell provided by the invention may be an avian cell.
  • the avian cell provided by the invention may be a primordial germ cell (PGC).
  • PPC primordial germ cell
  • primordial germ cells refers to germline stem cells that serve as progenitors of the gametes and give rise to pluripotent embryonic stem cells.
  • PGCs primordial germ cells
  • the cell provided by the invention may comprise at least one reporter gene integrated into a gender chromosome of the cell.
  • such specific integration of the reporter gene may be enabled by co-transfecting the cell with: (a) at least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence encoding at least one guide RNA (gRNA); and (b) at least one second nucleic acid sequence comprising at least one said reporter gene.
  • the at least one reporter gene in the second nucleic acid sequence co-transfected to the cell of the invention may be flanked at 5' and 3' thereof by homologous arms for HDR at the integration site.
  • the gRNA may comprise the nucleic acid sequence as denoted by SEQ ID NO. 1 referred to herein as gRNAl.
  • the at least one reporter gene comprised within the second nucleic acid sequence may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 4 and 5, respectively.
  • the cell provided by the invention may be prepared by using gRNA referred to herein as gRNA2.
  • gRNA2 may comprise the nucleic acid sequence as denoted by SEQ ID NO. 2.
  • the at least one reporter gene comprised within the second nucleic acid sequence may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 6 and 7, respectively.
  • the cell provided by the invention may be prepared by integrating the at least one reporter gene of the invention into the Z chromosome of the cell.
  • the at least one reporter gene may be integrated into at least one site at gender Z chromosome.
  • the specific loci in the Z chromosome may be any one of regions 9156874-9161874, as denoted by SEQ ID NO: 15, 27764943- 27769943, as denoted by SEQ ID NO: 16, 42172748-42177748, as denoted by SEQ ID NO: 17, 63363656-63368656, as denoted by SEQ ID NO: 18 and 78777477-78782477, as denoted by SEQ ID NO: 19 of Chromosome Z of female chicken.
  • the at least one gRNA required to target the reporter gene to such specific location within the Z chromosome of the cell of the invention may comprises the nucleic acid sequence as denoted by any one of gRNA3: ACAGACCTATGATATGT, as denoted by SEQ ID NO. 11 ; gRNA4: CGATTATCACTCACAAG, as denoted by SEQ ID NO. 12; gRNA5: CTGGTT AGC ATGGGGAC , as denoted by SEQ ID NO. 13; gRNA6: GTAAAGAGTCAGATACA, as denoted by SEQ ID NO. 14.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 41, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 42, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA3 of SEQ ID NO: 11.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 43, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 46
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 46
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • gRNA sequences suitable for integration into specific loci within the Z chromosome may include but are not limited to gRNA7 of Z chromosome locus chrZ_42174515_-l, comprising the nucleic acid sequence GTAATACAGAGCTAAACCAG, as also denoted by SEQ ID NO:26, gRNA8 of Z chromosome locus chrZ_9157091_l, comprising the nucleic acid sequence ACAGACCTATGATATGTGAG, as also denoted by SEQ ID NO:27, gRNA9 of Z chromosome locus chrZ_27767602_-l, comprising the nucleic acid sequence GAGCTTGTGAGTGATAATCG, as also denoted by SEQ ID NO:28,
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 31, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 32, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA7 of SEQ ID NO:26.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 36
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • the invention provides a kit comprising:
  • At least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence encoding at least one guide RNA (gRNA); and (b) at least one second nucleic acid sequence comprising at least one said reporter gene.
  • the at least one reporter gene in the second nucleic acid sequence comprised within the kit of the invention may be flanked at 5' and 3' thereof by homologous arms for HDR at the integration site.
  • the at least one reporter gene in the second nucleic acid sequence of the kit of the invention may be operably linked to any one of a gender specific promoter, an embryonic specific promoter and an inducible promoter.
  • the at least one reporter gene may be integrated into at least one non-coding region of the gender chromosome, specifically, to chromosome W.
  • the first nucleic acid sequence of the kit of the invention may encode at least one gRNA comprising the nucleic acid sequence as denoted by any one of SEQ ID NO. 1 and 2, also referred to herein as gRNAl and gRNA2, respectively.
  • the first nucleic acid sequence of the kit of the invention may comprise a gRNA, being gRNAl.
  • gRNAl may comprise the nucleic acid sequence as denoted by SEQ ID NO. 1.
  • the reporter gene comprised within said second nucleic acid sequence of the kit of the invention may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 4 and 5, respectively.
  • the kit of the invention may comprise in the first nucleic acid sequence thereof, a sequence encoding gRNA2.
  • sequence encodes the nucleic acid sequence as denoted by SEQ ID NO. 2.
  • the least one reporter gene comprised within the second nucleic acid sequence of the kit of the invention may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by SEQ ID NO. 6 and 7, respectively.
  • the at least one reporter gene may be integrated into at least one site at gender Z chromosome.
  • the specific loci in the Z chromosome may be any one of regions 9156874-9161874, as denoted by SEQ ID NO: 15, 27764943-27769943, as denoted by SEQ ID NO:16, 42172748-42177748, as denoted by SEQ ID NO: 17, 63363656-63368656, as denoted by SEQ ID NO: 18 and 78777477-78782477, as denoted by SEQ ID NO: 19 of Chromosome Z of female chicken.
  • the first nucleic acid sequence of the kit of the invention may comprise a gRNA, being the at least one of gRNA3: ACAGACCTATGATATGT, as denoted by SEQ ID NO. 11 ; gRNA4: CGATTATCACTCACAAG, as denoted by SEQ ID NO. 12; gRNA5: CTGGTT AGC ATGGGGAC , as denoted by SEQ ID NO. 13 ; gRNA6: GTAAAGAGTCAGATACA, as denoted by SEQ ID NO. 14.
  • the at least one reporter gene comprised within the second nucleic acid sequence of the kit of the invention may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by any one of SEQ ID NO. 41-48. More specifically, for integrating the reporter gene of the invention into the specific locus within the Z chromosome, left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 41, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 42, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA3 of SEQ ID NO: 11.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 43, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 44, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA4 of SEQ ID NO: 12.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 45, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 47
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 48
  • the first nucleic acid sequence of the kit of the invention may comprise a gRNA, being the at least one of gRNA7 of Z chromosome locus chrZ_42174515_-l, comprising the nucleic acid sequence GTAATACAGAGCTAAACCAG, as also denoted by SEQ ID NO:26, gRNA8 of Z chromosome locus chrZ_9157091_l, comprising the nucleic acid sequence ACAGACCTATGATATGTGAG, as also denoted by SEQ ID NO:27, gRNA9 of Z chromosome locus chrZ_27767602_-l, comprising the nucleic acid sequence GAGCTTGTGAGTGATAATCG, as also denoted by SEQ ID NO:28, gRNA 10 of Z chromosome locus chrZ_78779927_l, comprising the nucleic acid sequence GTAAAGAGTCAGATACACAG, as also denoted by SEQ ID NO:
  • the at least one reporter gene comprised within the second nucleic acid sequence of the kit of the invention may be flanked at 5' and 3' thereof by homologous arms comprising the amino acid sequence as denoted by any one of SEQ ID NO. 31 to 40. More specifically, for integrating the reporter gene of the invention into the specific locus within the Z chromosome, left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 31, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 32, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA7 of SEQ ID NO: 26.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 34, may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA8 of SEQ ID NO:27.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 35, and right arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 37
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 38
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • gRNAl 1 of SEQ ID NO:30 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNAl 1 of SEQ ID NO:30.
  • the reporter gene comprised within the second nucleic acid sequence of the kit of the invention may be at least one bioluminescence reporter gene.
  • the kit of the invention may be suitable for use in the preparation of a transgenic avian animal comprising at least one exogenous reporter gene integrated into at least one position or location in at least one of gender chromosome Z and W.
  • the method of the invention may use any of the kits of the invention as described herein.
  • kits of the invention may further comprise any reagent, buffer, media or material required for the preparation of the transgenic avian animals of the invention.
  • the kit of the invention may further comprise instructions as well as containers for the different components thereof.
  • the oligonucleotide/s or polynucleotide/s used by the kit/s and method/s of the invention are isolated and/or purified molecules.
  • isolated or purified when used in reference to a nucleic acid means that a naturally occurring sequence has been removed from its normal cellular (e.g., chromosomal) environment or is synthesized in a non-natural environment (e.g., artificially synthesized).
  • an "isolated” or “purified” sequence may be in a cell-free solution or placed in a different cellular environment.
  • purified does not imply that the sequence is the only nucleotide present, but that it is essentially free (about 90-95% pure) of non-nucleotide material naturally associated with it, and thus is distinguished from isolated chromosomes.
  • references to “a method” includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • mice C57BL/6-Tg(CAG-EGFP)10sb/J are from The Jackson Laboratory (catalogue number 00329).
  • Cas9 SmartNucleaseTM All-in-one tagged vectors is ordered from System Bioscience Inc., catalogue number CAS8/9xx series.
  • pCMV-Gluc 2 vector is ordered from New England Biolabs Inc., catalogue number N8081S.
  • Female cells are of Gallus gallus, chicken T lymphocyte cells.
  • Male cells are of Gallus gallus, chicken Liver, ordered from ATCC® Number: CRL- 2118TM.
  • D-Luciferin (Sigma-Aldrich Co. LLC, Israel, catalogue number 2591-17-5) is dissolved at room temperature in DPBS to a final concentration of 15 mg/mL.
  • luciferin or saline solution (negative control) is injected subcutaneously in the loose skin around the neck and shoulder area of transgenic luciferase-expressing mice. Ear and tail are excised after 10 min and introduced into Chicken embryo (10 days). Alternatively, excised ear and tail from transgenic luciferase-expressing transgenic mice is incorporated into the Chicken embryo prior to direct injection to the egg of 0.1 ml of luciferin or saline solution.
  • Bioluminescence is observed by using Bio-space photon Imager (Bio space lab, USA). Restriction-free (RF) cloning
  • gRNAs into Cas9-SmartNucleaseTM vector is performed by applying the Restriction Free method (Peleg Y et al., 2010). Primers are ordered from Sigma- Genosys (Rehovot, Israel) and subsequent RF reactions were carried out using Phusion polymerase (Thermo Scientific, Hudson, NH, USA). Plasmid purification is carried out using the MEGAspin kit and DNA-spin plasmid DNA purification kit, respectively (Intron Biotechnology Biotechnology, Daejoen, South Korea).
  • PGCs are grown in KO-DMEM (Life Technologies), of which 40% is preconditioned on buffalo rat liver cells (BRL, ATCC), and supplemented with 7.5% fetal bovine serum (Hyclone), 2.5% irradiated chicken serum, IX non-essential amino acids, 2mM glutamine, lmM sodium pyruvate, O. lmM -mercaptoethanol (all from Life Technologies), 4ng/ml recombinant human fibroblast growth factor, 6ng/ml recombinant mouse stem cell factor (both from R&D Systems) and grow on an irradiated feeder layer of BRL cells. The cells are passaged 3 times per week onto fresh feeder layers.
  • Concentrated vehicle that may be either lenti virus at a titer of about 10 7 MOI or plasmid DNA
  • Injections are carried out weekly three injections.
  • the injected embryos hatch 3 weeks after injection. These are GO birds.
  • the DNA is extracted from CAM samples of the hatched chicks and detection of the presence/absence of vector DNA is carried out by semi-quantitative PCR.
  • Blood sample GO chicks at 2-3 weeks of age and repeat PCR screen. GO birds are raised to sexual maturity, 16-20 weeks for males, 20-24 weeks for females. Cockerels are tested for semen production from approximately 16 weeks. Hens are inseminated, fertile eggs collected daily.
  • the Gl chicks are hatch 3 weeks later and each individual chick wing banded and a chick chorioallantoic membrane (CAM) sample taken from the shell. Extract DNA from CAM samples and carry out PCR screen for presence of transgene, predicted to be single copy level. Repeat screen to confirm and sex chicks on DNA from blood sample 2-3 weeks later.
  • CAM chick chorioallantoic membrane
  • a blood sample is taken from Gl birds to prepare genomic DNA for PCR analysis. Gl birds are used for breeding G2.
  • transgenic mice expressing reporter genes such as firefly luciferase (having a nucleic acid sequence as denoted by SEQ ID NO: 20; encoding the amino acid sequence as denoted by SEQ ID NO:21)and green fluorescent protein (eGFP), were first employed.
  • reporter genes such as firefly luciferase (having a nucleic acid sequence as denoted by SEQ ID NO: 20; encoding the amino acid sequence as denoted by SEQ ID NO:21)and green fluorescent protein (eGFP)
  • luciferase activity in Figure 1 luciferin was injected subcutaneously to luciferase-expressing transgenic mice, tails and ears were then excised and introduced through a 5mm hole in the egg shell of an unfertilized egg. As shown in the figure, the luciferase detectable signal is clearly observed in tail and ear samples (Fig. 1A, IB) through the egg shell. The inventors therefore next examined the feasibility of inducing luciferase reaction in-ovo. Therefore, ears and tails of luciferase-expressing transgenic mice were excised, introduced through a hole into a fertilized egg that carry a 10-days old chicken embryo and luciferin was subsequently injected. As clearly shown in Figures 2A and 2B, an in-ovo luciferase reaction successfully resulted in a detectable signal that was able to penetrate the egg shell.
  • Luciferase reporter gene specifically, firefly luciferase (comprising the amino acid sequence as denoted by SEQ ID NO. 21, encoded by the nucleic acid sequence as denoted by SEQ ID NO:20) was thus further selected for incorporation into sex chromosomes W and Z.
  • FIG 4 represents a schematic illustration of the method of the invention for identification of embryo's gender in-ovo. More specifically, a transgenic avian female hen containing a gender specific chromosome (W) with the luciferase reporter gene integrated therein is provided. In eggs laid by said hen, expression of the reporter gene observed by a detectable signal indicates that the embryo carry the W gender chromosome and is therefore female. This enables the selection for continued incubation of male while females that carry the reporter gene are discarded. This selection is probably more relevant for Poultry.
  • W gender specific chromosome
  • Figure 5 schematically presents yet a further alternative that facilitates determination of male embryo, in-ovo. More specifically, the provision of transgenic female chickens carrying the gender specific Z chromosome with a reporter gene integrated therein, results in female embryos (that received the maternal wild type W chromosome) without reporter gene or male embryos (that received the maternal labeled Z chromosome) expressing the transgenic luciferase gene.
  • Example 2
  • the CRISPR/Cas9 mediated HDR method is selected. Relevant gRNA sites are then sought from both gender chromosomes.
  • Two guide RNAs are selected, synthesized and cloned separately into the Cas9 SmartNuclease vector containing the wild type Cas9 nuclease (Horizon) by Restriction free cloning protocol: gRNAl : GCACTAGGAACCAGCAGCAG, as denoted by SEQ ID NO. 1 and gRNA2: GTAGCCCCAAGAGGGCTAGG, as denoted by SEQ ID NO. 2.
  • the regions 9156874-9161874, as denoted by SEQ ID NO: 15, 27764943-27769943, , as denoted by SEQ ID NO: 16, 42172748-42177748, as denoted by SEQ ID NO:17, 63363656-63368656, as denoted by SEQ ID NO: 18 and 78777477-78782477, as denoted by SEQ ID NO: 19 of Chromosome Z of female chicken are analyzed for guide RNA design.
  • RNA3 ACAGACCTATGATATGT, as denoted by SEQ ID NO. 11
  • gRNA4 CGATTATCACTCACAAG, as denoted by SEQ ID NO. 12
  • gRNA5 CTGGTTAGCATGGGGAC, as denoted by SEQ ID NO. 13
  • gRNA6 GTAAAGAGTCAGATACA, as denoted by SEQ ID NO. 14.
  • gRNA sequences suitable for integration into specific loci within the Z chromosome may include but are not limited to gRNA7 of Z chromosome locus chrZ_42174515_-l, comprising the nucleic acid sequence GTAATACAGAGCTAAACCAG, as also denoted by SEQ ID NO:26, gRNA8 of Z chromosome locus chrZ_9157091_l, comprising the nucleic acid sequence ACAGACCTATGATATGTGAG, as also denoted by SEQ ID NO:27, gRNA9 of Z chromosome locus chrZ_27767602_-l, comprising the nucleic acid sequence GAGCTTGTGAGTGATAATCG, as also denoted by SEQ ID NO:28, gRNA 10 of Z chromosome locus chrZ_78779927_l, comprising the nucleic acid sequence GTAAAGAGTCAGATACACAG, as also denoted by SEQ ID NO:
  • gRNAs have few predicted off-target sites, none of which were in known coding sequences.
  • Flanking sequences homological of the appropriate flanking sequences indicated above of female W chromosome or of the female Z chromosome loci are introduced into the luciferase-expressing vector upstream to the CMV-promoter and downstream the Neomycin-resistance or alternatively downstream the polyA site (ordered synthetic DNA, Integrated DNA Technologies, Inc., USA).
  • the reporter gene specifically Luciferase may be cloned for using either the Guide 1 (gRNAl), as denoted by SEQ ID NO. 1 or Guide 2 (gRNA2): as denoted by SEQ ID NO. 2.
  • gRNAl Guide 1
  • gRNA2 Guide 2
  • Left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 4
  • the “Right arm” comprising the nucleic acid sequence as denoted by SEQ ID NO. 5
  • gRNA2 For cloning using the gRNA2, “Left arm” comprising the nucleic acid sequence as denoted by SEQ ID NO. 6, and the “Right arm” comprising the nucleic acid sequence as denoted by SEQ ID NO. 7 are provided.
  • a "left arm" for the region upstream to the CMV-promoter comprises the nucleic acid sequence as denoted by SEQ ID NO. 8
  • a "right arm” for the region downstream the Neomycin-resistance may comprise the nucleic acid sequence as denoted by SEQ ID NO. 9, or SEQ ID NO.10 for the region downstream the poly A site.
  • the Luciferase reporter gene may be cloned for using either the gRNA3, as denoted by SEQ ID NO. 11, gRNA4 : as denoted by SEQ ID NO. 12, gRNA5, as denoted by SEQ ID NO. 13, gRNA6, as denoted by SEQ ID NO. 14.
  • gRNA7 of SEQ ID NO:26 may be used to integrate the reporter gene of the invention to the specific loci directed by gRNA7 of SEQ ID NO:26.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 34
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 33
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 34
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO.
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • left arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 39
  • right arm comprising the nucleic acid sequence as denoted by SEQ ID NO. 40
  • the two above described vectors specifically, the gRNA/Cas9 and the reporter-gene vectors are co-transfected to PGCs as detailed in experimental procedures. After stable clones are identified, the cells are expanded and confirmed for the luciferase integration by PCR. Confirmed clones are injected into recipient chicken embryos at Stage 14-16 (H&H). The injected embryos are transferred to surrogate shells and incubated until hatch at 37°C. The sex of the chicks is determined after hatch by PCR for the W- chromosome.
  • Female and Male chimeras are grown to sexual maturity and bred to wild type male and female chickens. Hatched chicks are evaluated for the expression of luciferase, and the germline progeny are confirmed by PCR to carry targeted luciferase.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
PCT/IL2016/051291 2015-12-03 2016-12-01 Methods for gender determination of avian embryos in unhatched eggs and means thereof Ceased WO2017094015A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
KR1020187018773A KR20180099704A (ko) 2015-12-03 2016-12-01 부화되지 않은 알에서 조류 배아의 성별 결정 방법 및 이의 수단
HK19100128.4A HK1257753A1 (zh) 2015-12-03 2016-12-01 对未孵化卵中的禽类胚胎进行性别确定的方法及其用具
EP16870133.2A EP3384051A4 (en) 2015-12-03 2016-12-01 METHOD FOR THE SEX DETERMINATION OF BIRD EMBRYOS IN UNBALANCED EGGS AND AGENTS THEREOF
CN201680078336.7A CN108474034A (zh) 2015-12-03 2016-12-01 对未孵化卵中的禽类胚胎进行性别确定的方法及其用具
JP2018529065A JP2019505175A (ja) 2015-12-03 2016-12-01 鳥の未孵化卵内の胚の性別決定法及びその手段
CA3007066A CA3007066A1 (en) 2015-12-03 2016-12-01 Methods for gender determination of avian embryos in unhatched eggs and means thereof
IL259721A IL259721B (en) 2015-12-03 2018-05-31 Methods for gender determination of avian embryos in unhatched eggs and means thereof
US15/996,045 US20190029236A1 (en) 2015-12-03 2018-06-01 Methods for gender determination of avian embryos in unhatched eggs and means thereof
US16/729,921 US20200149063A1 (en) 2015-12-03 2019-12-30 Methods for gender determination and selection of avian embryos in unhatched eggs
IL288409A IL288409A (en) 2015-12-03 2021-11-25 Methods for gender determination of avian embryos in unhatched eggs and means thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562262409P 2015-12-03 2015-12-03
US62/262,409 2015-12-03

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/IL2018/050573 Continuation-In-Part WO2018216022A1 (en) 2015-12-03 2018-05-24 Methods for gender determination of avian embryos in unhatched eggs and means thereof
US16/616,858 Continuation-In-Part US20200283849A1 (en) 2017-05-25 2018-05-24 Methods for gender determination of avian embryos in unhatched eggs and means thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/996,045 Continuation-In-Part US20190029236A1 (en) 2015-12-03 2018-06-01 Methods for gender determination of avian embryos in unhatched eggs and means thereof

Publications (1)

Publication Number Publication Date
WO2017094015A1 true WO2017094015A1 (en) 2017-06-08

Family

ID=58796444

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2016/051291 Ceased WO2017094015A1 (en) 2015-12-03 2016-12-01 Methods for gender determination of avian embryos in unhatched eggs and means thereof

Country Status (9)

Country Link
US (1) US20190029236A1 (enExample)
EP (1) EP3384051A4 (enExample)
JP (1) JP2019505175A (enExample)
KR (1) KR20180099704A (enExample)
CN (1) CN108474034A (enExample)
CA (1) CA3007066A1 (enExample)
HK (1) HK1257753A1 (enExample)
IL (2) IL259721B (enExample)
WO (1) WO2017094015A1 (enExample)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018216022A1 (en) * 2017-05-25 2018-11-29 Eggxyt Ltd Methods for gender determination of avian embryos in unhatched eggs and means thereof
WO2018218299A1 (en) * 2017-05-31 2018-12-06 Commonwealth Scientific And Industrial Research Organisation Trait selection in avians
WO2019058376A1 (en) 2017-09-19 2019-03-28 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) BIRDS WITH GENOME EDITION
WO2019135230A1 (en) * 2018-01-04 2019-07-11 Ramot At Tel-Aviv University Ltd. Transgenic eukaryotic organisms and methods for gender selection
WO2019170887A1 (de) 2018-03-09 2019-09-12 Technische Universität Dresden Verfahren zur in-ovo fertilisations- und geschlechtsbestimmung am geschlossenen ei
WO2020020973A3 (en) * 2018-07-24 2020-03-12 Tronico Method for determining a specific characteristic of an embryo in an unhatched egg
CN115960945A (zh) * 2022-12-05 2023-04-14 天津科技大学 蓝光诱导酿酒酵母定点dsb系统的构建
US12565664B2 (en) 2019-03-05 2026-03-03 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Genome-edited birds

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107760715B (zh) * 2017-10-17 2021-12-10 张业胜 一种转基因载体及其构建方法和应用
CN109402244B (zh) * 2018-12-20 2022-05-03 广西大学 一种哺乳动物胚胎性别鉴定方法
CN111073963B (zh) * 2019-12-10 2023-04-14 南京农业大学 一种一日龄鉴别鸡受精蛋性别的方法
IL299499A (en) * 2020-06-26 2023-02-01 Sunnybrook Res Inst Yolk extract supplements for culture media and related methods
CN114793988B (zh) * 2022-04-19 2023-01-17 中国科学院海洋研究所 一种基于形态学鉴定孔鳐受精卵的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2264450A1 (en) * 1998-03-05 1999-09-05 Andras Nagy Methods for monitoring heterologous sex chromosomes
US20060160080A1 (en) * 2002-08-14 2006-07-20 Roslin Institute (Edinburgh) Avian sex determination method

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH06124456A (ja) 1992-10-09 1994-05-06 Sony Corp 光学ピックアップ装置
GB9511439D0 (en) 1995-06-06 1995-08-02 Isis Innovation Gene product and method
AUPO060996A0 (en) 1996-06-21 1996-07-18 University Of Melbourne, The Sexing gene
US6244214B1 (en) 1999-01-06 2001-06-12 Embrex, Inc. Concurrent in ovo injection and detection method and apparatus
EP2376641A4 (en) * 2008-12-17 2013-01-09 Commw Scient Ind Res Org PROCEDURE FOR SEX MODULATION IN POULTRY
CA2751596A1 (en) * 2009-02-08 2010-08-12 The University Of Melbourne Sex-determination and methods of specifying same
WO2010103111A1 (en) 2009-03-13 2010-09-16 Van De Ven Beheer B.V. Method for avian sex determination
FR2969497B1 (fr) 2010-12-27 2013-06-28 Ceva Sante Animale Composition luminescente comme biomarqueur dans un oeuf aviaire, dispositif et procede correspondants.
KR102174868B1 (ko) * 2012-07-30 2020-11-06 인 오보 비.브이. 난 내 조류 배아의 성별, 생존능 및/또는 발달 단계 결정방법
DK2890973T3 (da) 2012-08-31 2020-11-30 Agri Advanced Tech Gmbh Spektrofotometrisk analyse af den embryonale kyllingefjerfarve
FR3023617B1 (fr) 2014-07-11 2018-06-15 Tronico Dispositif non invasif de determination de la fertilite et/ou du sexe d’un oeuf, et procede correspondant.

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2264450A1 (en) * 1998-03-05 1999-09-05 Andras Nagy Methods for monitoring heterologous sex chromosomes
US20060160080A1 (en) * 2002-08-14 2006-07-20 Roslin Institute (Edinburgh) Avian sex determination method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
COOPER, CAITLIN A. ET AL.: "Generation of gene edited birds in one generation using sperm transfection assisted gene editing (STAGE).", TRANSGENIC RESEARCH, 28 November 2016 (2016-11-28), pages 1 - 17, XP036230703 *
See also references of EP3384051A4 *
TIZARD, MARK.: "Precision genome engineering in the chicken: The gap between science and market place.", LECTURE, August 2014 (2014-08-01), IWRAB?II, Brasil, XP055387323, Retrieved from the Internet <URL:www.isb.vt.edu/documents/animal-biotech/2nd-Intl-Workshop-docs/Day-1/Tizard%20-%20PGE%20in%20chicken,pdf.> [retrieved on 20170323] *
URWIN, NIGEL.: "Would you prefer to eat genetically modified eggs, or see day-old chicks destroyed? Nigel Urwin.", THE GUARDIAN., 16 January 2014 (2014-01-16), XP055387318, Retrieved from the Internet <URL:www.theguardian.com/commentisfree/2014/jan/17/would-you-prefer-to-eat-genetically-modified-eggs-or-see-day-old-chicks-destroyed.> [retrieved on 20170323] *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018216022A1 (en) * 2017-05-25 2018-11-29 Eggxyt Ltd Methods for gender determination of avian embryos in unhatched eggs and means thereof
WO2018218299A1 (en) * 2017-05-31 2018-12-06 Commonwealth Scientific And Industrial Research Organisation Trait selection in avians
US12490723B2 (en) 2017-05-31 2025-12-09 Commonwealth Scientific And Industrial Research Organisation Transgenic chicken that expresses a fluorescent protein and SIAT1
WO2019058376A1 (en) 2017-09-19 2019-03-28 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) BIRDS WITH GENOME EDITION
EP3684172A4 (en) * 2017-09-19 2021-06-23 The State of Israel, Ministry of Agriculture & Rural Development, Agricultural Research Organization (ARO) (Volcani Center) GENOME EDITING BIRDS
WO2019135230A1 (en) * 2018-01-04 2019-07-11 Ramot At Tel-Aviv University Ltd. Transgenic eukaryotic organisms and methods for gender selection
WO2019170887A1 (de) 2018-03-09 2019-09-12 Technische Universität Dresden Verfahren zur in-ovo fertilisations- und geschlechtsbestimmung am geschlossenen ei
DE102018105512A1 (de) 2018-03-09 2019-09-12 Technische Universitaet Dresden Verfahren zur in-ovo fertilisations- und geschlechtsbestimmung am geschlossenen ei
US11378565B2 (en) 2018-03-09 2022-07-05 Technische Universität Dresden Method for in-ovo fertilisation determination and gender determination on a closed egg
WO2020020973A3 (en) * 2018-07-24 2020-03-12 Tronico Method for determining a specific characteristic of an embryo in an unhatched egg
US12565664B2 (en) 2019-03-05 2026-03-03 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Genome-edited birds
CN115960945A (zh) * 2022-12-05 2023-04-14 天津科技大学 蓝光诱导酿酒酵母定点dsb系统的构建

Also Published As

Publication number Publication date
EP3384051A4 (en) 2019-04-24
CN108474034A (zh) 2018-08-31
CA3007066A1 (en) 2017-06-08
IL259721A (en) 2018-07-31
EP3384051A1 (en) 2018-10-10
KR20180099704A (ko) 2018-09-05
IL288409A (en) 2022-01-01
US20190029236A1 (en) 2019-01-31
IL259721B (en) 2021-12-01
JP2019505175A (ja) 2019-02-28
HK1257753A1 (zh) 2019-10-25

Similar Documents

Publication Publication Date Title
EP3384051A1 (en) Methods for gender determination of avian embryos in unhatched eggs and means thereof
Yang et al. Genome editing and its applications in genetic improvement in aquaculture
CN106535630B (zh) 多重基因编辑
CN105073981A (zh) 动物中性成熟的控制
EP3629719B1 (en) Methods for gender determination of avian embryos in unhatched eggs and means thereof
US20170223938A1 (en) Transgenic chickens with an inactivated endogenous gene locus
WO2009023800A1 (en) Transgenic chickens with an inactivated endogenous gene locus
JPWO2005003342A1 (ja) メチル化を利用したトランスジェニック生物を作製する方法およびシステム
JPWO2015199225A1 (ja) 家禽始原生殖細胞の遺伝子改変方法、遺伝子改変された家禽始原生殖細胞、遺伝子改変家禽の生産方法及び家禽卵
US20240052304A1 (en) Sterile avian embryos, production and uses thereof
US20210037797A1 (en) Inducible disease models methods of making them and use in tissue complementation
US20200149063A1 (en) Methods for gender determination and selection of avian embryos in unhatched eggs
DK202170116A1 (en) Genetically modified salmon which produce sterile offspring
KR101724805B1 (ko) 유전자 적중 물질을 이용한 조류 유전자 편집방법 및 유전자 편집 조류
Idoko-Akoh Editing the genome of chicken primordial germ cells to introduce alleles and study gene function
CN117042600A (zh) 具有经编辑的anp32基因的抗甲型流感动物
OA19682A (en) Methods for gender determination of avian embryos in unhatched eggs and means thereof.
Stevens Analysis of putative mutants produced by genetrap technology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16870133

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2018529065

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 3007066

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 259721

Country of ref document: IL

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187018773

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016870133

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016870133

Country of ref document: EP

Effective date: 20180703