WO2017087943A1 - Amplification et détection de l'arn du viroïde cadang-cadang du cocotier (cccvd) - Google Patents

Amplification et détection de l'arn du viroïde cadang-cadang du cocotier (cccvd) Download PDF

Info

Publication number
WO2017087943A1
WO2017087943A1 PCT/US2016/063059 US2016063059W WO2017087943A1 WO 2017087943 A1 WO2017087943 A1 WO 2017087943A1 US 2016063059 W US2016063059 W US 2016063059W WO 2017087943 A1 WO2017087943 A1 WO 2017087943A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sequence
stem
reaction mixture
cccvd
Prior art date
Application number
PCT/US2016/063059
Other languages
English (en)
Inventor
Lawrence J. Wangh
Rocio F. URDANETA
Kenneth E. PIERCE
Original Assignee
Brandeis University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brandeis University filed Critical Brandeis University
Publication of WO2017087943A1 publication Critical patent/WO2017087943A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Definitions

  • Viroids are small, single-stranded RNA molecules, that typically range from 246 to 375 nucleotides in lengrt. Viroids do not have protein coats but contain genes for
  • Cadang-cadang is a disease caused by
  • CCCVd Coconut cadang-cadang viroid
  • compositions and methods for nucleic acid based diagnostic assays for the detection of CCCVd nucleic acids are provided herein.
  • compositions ⁇ e.g., primers, probes, kits, reaction solutions), and methods for improved CCCVd nucleic acid extraction and handling, hybridization, reverse transcription, amplification ⁇ e.g., using symmetric PCR, asymmetric PCR, LATE-PCR, or other amplification methods), and/or detection ⁇ e.g., homogenous detection).
  • the amplification methods disclosed herein comprise forming a reaction mixture.
  • the reaction mixture comprises a CCCVd nucleic acid target molecule with a CCCVd nucleic acid target sequence.
  • amplification methods include a pre-incubation step ⁇ e.g., forming a reaction mixture and incubating the mixture at one or more temperatures for one or more periods of time) at a point when the reaction mixture does not comprise a nucleic acid polymerase during the pre-incubation step.
  • the reaction mixture is incubated ⁇ e.g., for at least 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds or 30 seconds) at a temperature between 50 °C and the melting temperature of the one or more primers ⁇ e.g., a primer in Table 1) hybridized to target sequence (e.g., at a temperature of between 55 °C, 60 °C, 65 °C, 70 °C, 75 °C, 80 °C or 85 °C, and the melting temperature of the one or more primers hybridized to target sequence).
  • a primer in Table 1 hybridized to target sequence
  • the reaction mixture is incubated (e.g., for at least 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds or 30 seconds) at two or more temperatures between 50 °C and the melting temperature of the one or more primers hybridized to target sequence (e.g., at two or more temperatures of between 55 °C, 60 °C, 65 °C, 70 °C, 75 °C, 80 °C or 85 °C, and the melting temperature of the one or more primers hybridized to target sequence).
  • the pre-incubation step is performed under conditions such that the one or more primers that hybridize to the CCCvd nucleic acid target sequence in the absence of a nucleic acid polymerase.
  • the pre-incubation step is followed by the lowering of the temperature of the reaction mixture (e.g., to a temperature of no more than 30 °C, 25 °C or 20 °C).
  • the methods further comprise adding one or more nucleic acid polymerases (e.g., a reverse transcriptase, a DNA polymerase and/or a RNA polymerase) to the reaction mixture following the lowering of the temperature.
  • nucleic acid polymerases e.g., a reverse transcriptase, a DNA polymerase and/or a RNA polymerase
  • the reaction mixture is then incubated under conditions such that the one or more nucleic acid primers is extended by the one or more nucleic acid polymerases (e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase) to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • the one or more nucleic acid polymerases e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase
  • an extensible nucleic acid primer e.g., a primer comprising a random sequence of nucleotides or a sequence specific primer
  • a non-extensible oligonucleotides e.g., a non- extensible oligonucleotide in Table 3
  • the non-extensible oligonucleotide hybridized to the CCCVd nucleic acidtarget sequence has a predicted melting temperature that is higher (e.g., at least 5 °C higher, at least 10 °C higher, at least 15 °C higher) than the predicted melting temperature of the extensible nucleic acid primer hybridized to the CCCVd nucleic acid target sequence.
  • the method includes the step of forming a reaction mixture comprising the non-extensible oligonucleotide, the extensible nucleic acid primer (e.g., a primer in Table 1) and a CCCVd nucleic acid molecule comprising the CCCVd nucleic acid target sequence.
  • the non-extensible oligonucleotide has a predicted melting temperature of at least 85 °C, at least 90 °C, or at least 95 °C.
  • the non-extensible oligonucleotide comprises one or more chemical modifications (e.g., a 2'- O-methyl nucleoside).
  • the reaction mixture is incubated at one or more temperatures (e.g., at a temperature of at least 65 °C, 70 °C, 75 °C, 80 °C or 85 °C) for a period of time (e.g., at least about 1, 2, 3, 4, 5, 10, 15, 20, 25 or 30 minutes) sufficient to hybridize the non-extensible oligonucleotide and the extensible nucleic acid primer to the CCCVd nucleic acid target sequence.
  • the method further comprises adding one or more nucleic acid polymerases (e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase) to the reaction mixture.
  • nucleic acid polymerases e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase
  • reaction mixture is incubated under conditions such that the extensible nucleic acid primer is extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd target nucleic acid sequence or a complement thereof.
  • Exemplary primers and probes for use with the methods disclosed herein can be found in Table 1.
  • the methods provided herein relate to amplifying CCCVd nucleic acids using primers having high melting temperatures when hybridized to a CCCVd nucleic acid target.
  • the method comprises forming a reaction mixture comprising a CCCVd nucleic acid target molecule comprising a CCCVd nucleic acid target sequence, one or more primers that hybridize to the CCCVd nucleic acid target sequence and that comprise at least one primer that has a predicted melting temperature of at least 85 °C, and one or more nucleic acid polymerases (e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase).
  • nucleic acid polymerases e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase.
  • the reaction mixture is incubated under conditions such that the one or more nucleic acid primers are extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • methods of amplifying CCCVd RNA comprise the step of lysing cells (e.g., plant cells, animal cells, fungus cells, bacterial cells or parasite cells) in a solution comprising a chaotrope, a reducing agent, a detergent, a chelator and a buffer and application of mechanical disruption to form a nucleic acid solution comprising a CCCVd nucleic acid target molecule.
  • the nucleic acid solution is diluted without performing a nucleic acid purification step to form a reaction mixture comprising the CCCVd nucleic acid target molecule, one or more primers that hybridize to the CCCVd nucleic acid target molecule and one or more nucleic acid polymerases (e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase).
  • a nucleic acid polymerases e.g., a reverse transcriptase, an RNA polymerase and/or a DNA polymerase.
  • the nucleic acid solution comprising the CCCVd nucleic acid target molecule is diluted by an amount sufficient to reduce the concentration of the chaotrope, the reducing agent, the detergent, the chelator and the buffer to a level whereby the nucleic acid polymerase has at least 20% of the activity it has in a reaction mixture that does not comprise the chaotrope, the reducing agent, the detergent, the chelator and the buffer.
  • the nucleic acid solution is diluted by at least 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 45-fold or 50-fold. In some embodiments, the dilution is accomplished in one step.
  • the dilution is accomplished in two or more steps.
  • the first dilution step is carried out in a buffer that contains at least one DNA oligonucleotide primer and wherein said first-dilution step is followed by heating to at least 85 °C followed by gradual cooling, prior to a second dilution step.
  • the method comprises incubating the reaction mixture under conditions such that the one or more nucleic acid primers are extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • a CCCVd nucleic acid target molecule is isolated from a sample and prepared in a solution comprising a chaotrope, a reducing agent, a detergent, a chelator and a buffer.
  • the reducing agent is 2 mercaptoethanol, tris(2-carboxyethyl)phosphine, dithiothreitol, dimethyl sulfoxide, or any combination thereof.
  • the chaotrope is guanidine thiocyanate, guanidine isocyanate, guanidine hydrochloride, or any combination thereof.
  • the detergent is sodium dodecyl sulfate, lithium dodecyl sulfate, sodium taurodeoxycholate, sodium taurocholate, sodium glycocholate, sodium deoxycholate, sodium cholate, sodium alkylbenzene sulfonate, N-lauroyl sarcosine, or any combination thereof.
  • the chelator is ethylene glycol tetraacetic acid,
  • hydroxyethylethylenediaminetriacetic acid diethylene triamine pentaacetic acid, N,N- bis(carboxymethyl)glycine, ethylenediaminetetraacetic, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferric ammonium citrate, lithium citrate, or any combination thereof.
  • the buffer is tris(hydroxymethyl)aminomethane, citrate, 2-(N-morpholino)ethanesulfonic acid, N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic acid, 1,3- bis(tris(hydroxymethyl)methyl amino)propane, 4-(2-hydroxy ethyl)- 1 -piperazine
  • ethanesulfonic acid 3-(N-morpholino) propanesulfonic acid, bicarbonate, phosphate, or any combination thereof.
  • the methods provided herein comprise the addition of at least one mispriming prevention reagent to a reaction mixture.
  • the at least one mispriming prevention reagents comprises a mispriming prevention reagent that comprises a nucleic acid molecule comprising, in 5' to 3 ' order: (i) a first condition-dependent stem region comprising a 5' terminal covalently linked moiety and a first stem nucleic acid sequence, wherein the first stem nucleic acid sequence is at least 6 nucleotides in length and wherein the 5' terminal covalently linked moiety comprises a cyclic or polycyclic planar moiety that does not have a bulky portion; (ii) a condition-dependent loop region comprising a loop nucleic acid sequence of at least 3 nucleotides in length; and (iii) a second condition-dependent stem region comprising a second stem nucleic acid sequence and a 3' terminal covalently linked moiety, wherein the second stem nucleic acid sequence is at least 6 nucleotides in length and is complementary to the first stem nucleic acid sequence and wherein the 3' terminal covalent
  • the 3' terminal covalently linked moiety is non- identical to the 5' terminal covalently linked moiety.
  • the loop nucleic acid sequence is a single nucleotide repeat sequence. In some embodiments, the single nucleotide repeat sequence is a poly-cytosine sequence. In some embodiments, the loop nucleic acid sequence is between 25 and 40 nucleotides in length. In some embodiments, the first condition-dependent stem region hybridizes to the second condition-dependent stem region with a melting temperature of between 40 °C and 71 °C. In some embodiments, the first stem nucleic acid sequence and the second stem nucleic acid sequence are each 1 1 nucleotides in length.
  • the at least one mispriming prevention reagents comprises a mispriming prevention reagent that comprises an oligonucleotide that has a 3' end and a stem-loop structure having a stem comprising a double-stranded region that has a length greater than six nucleotides and a terminus away from the loop comprising a 3' nucleotide and a 5' nucleotide, the stem having a calculated stem melting temperature (Tm) below 94° C, wherein (a) the 3' end is non-extensible by the DNA polymerase, (b) the oligonucleotide is not fluorescently labeled and does not contribute background fluorescence, and (c) the stem terminus is stabilized by means selected from the group consisting of non-fluorescent fluorophore- quenching moieties covalently attached to the 3' and 5' nucleotides of the stem terminus and pairs of non-natural nucleotides that bind more strongly
  • kits for the performance of the methods described herein and reaction solutions, primers and probes used in the methods provided herein are provided herein.
  • Figure 1 shows real-time amplification and melting analysis comparing the results of reverse transcription and amplification of a viroid synthetic RNA using primers with different melting temperatures.
  • RT-LATE-PCR amplification was performed using low and high Tm antisense primers.
  • Part A shows SYBR Green detection of double-stranded DNA during real-time amplification using an antisense primer OPV9-A32 for two-step RT-LATE- PCR.
  • Inset shows the corresponding SYBR Green melt curve derivative.
  • the melt peak at 85 °C corresponds to the viroid-specific amplification product. Peaks at lower temperatures correspond to non-specific amplification products (e.g., primer dimers).
  • Part B shows SYBR Green detection during amplification and melting (inset) in samples using antisense primer OPV9-A40 for two-step RT-LATE-PCR.
  • Part C shows Cal Red fluorescence during the melt of the viroid-specific probe from the products shown in A. Inset shows the melt curve derivative with the peak at 62°C corresponding to the melting temperature of the probe.
  • Part D shows Cal Red fluorescence during the melt of the viroid-specific probe from the products shown in B. Key: solid black line, 100 copies of synthetic viroid RNA; solid grey line, 1,000 copies of synthetic viroid RNA; dashed grey line, 1,000 copies of RNA but no Reverse Transcriptase; dashed black line, NTC.
  • Figure 2 shows real-time SYBR Green detection and specific probe melting analysis following pre-annealing, reverse transcription and amplification across the trans-spliced junction of nad5 transcripts from purified coconut palm RNA.
  • Part A shows real-time SYBR Green fluorescence plots during one-step RT-PCR of nad5 from different inputs of total coconut palm RNA.
  • Part B shows ra3 ⁇ 4£5-specific probe fluorescence derivative from the post- PCR melt identifying the gene-specific product by the peak at 50 °C.
  • Figure 3 shows real-time SYBR Green detection and specific probe melting analysis following pre-annealing, reverse transcription and amplification across the trans-spliced junction of nad5 transcripts from purified coconut palm RNA and from coconut palm total nucleic acids extracted using PrimeStoreTM.
  • Part A shows Real-time SYBR Green fluorescence increase in PrimeStoreTM extracts and purified RNA samples during RT-LATE-PCR without added PVP.
  • Part B shows real-time SYBR Green fluorescence increase in PrimeStoreTM extracts and purified RNA samples during RT-LATE-PCR with 1.5% PVP.
  • Part C shows probe fluorescence derivative plots from post-PCR melting analysis of samples in Part A.
  • Part D shows probe fluorescence derivative plots from post-PCR melting analysis of samples in Part B.
  • Figure 4 shows melting analysis using specific probes following pre-annealing, reverse transcription and co-amplification of the nad5 transcript and viroid synthetic RNA from coconut palm total nucleic acids extracted using PrimeStoreTM containing different numbers of added viroid RNA.
  • Figure 5 shows a standard curve based on the results of pre-annealing, reverse transcription and co-amplification of nad5 and viroid RNAs.
  • a standard curve for determining the concentration of viroid RNA in plant samples was generated using the ratio of the viroid probe fluorescent derivative peak height (at 65 °C) to the nad5 probe fluorescent derivative peak height (at 50 °C).
  • Figure 6 shows melting analysis with specific probes following pre-annealing at different temperatures prior to reverse transcription and co-amplification of nad5 and viroid from PrimeStoreTM extracts.
  • Probe fluorescence derivative plots from post RT-LATE-PCR of nad5 and viroid sequences following pre-incubation steps (Part A) on ice, (Part B) at 65 °C, or (Part C) at 85 °C.
  • Purified coconut palm RNA 50 ng RNA was tested in the absence of synthetic viroid RNA.
  • a 1/100 dilution of PrimeStoreTM extract from coconut palm was mixed with 1,000 or 10,000 copies of synthetic viroid RNA.
  • the nad5-probe melt peak at 50 °C is not significantly affected by the pre-incubation condition. Detection of the viroid probe melt peak improves with increasing pre-incubation temperature.
  • Figure 7 shows melting analysis with a viroid-specific probe following pre-annealing of purified oil palm RNA with a non- extensible opener, reverse transcription with random hexamers, and amplification. Results confirm that the oil palm was infected with Coconut Cadang Cadang Viroid (CCCVd). Probe fluorescence derivative plots from melting analysis following 2 step RT-LATE-PCR of viroid sequences using RT with a high-Tm 2'-0-methyl RNA opener and random hexamers.
  • Four replicate samples with CCCVd-infected oil palm RNA had a melt peak at about 57 °C, the characteristic T m of the probe used in this example with the amplified viroid sequence.
  • One of four no RT samples also had a melt peak at that temperature. No probe melt peak was present in the NTC samples.
  • Figure 8 shows mean C T values from real-time SYBR Green fluorescence increase as a function of starting RNA concentration following a pre-incubation of primers and RNA (closed circles) or no pre-incubation (open circles) prior to RT-PCR. Pre-incubation lowers the mean Cx value by more than 4 cycles at each step, reflecting much higher levels of cD ' NA that are generated during reverse transcription following that step.
  • Figure 9 shows melt derivative peaks for measuring relative CCCVd amplification in samples with different initial concentrations of the RNA target. Mean peak heights are compared for each RNA dilution in samples with ThermaStop-RT compared to samples without ThermaStop-RT.
  • amplicorf refers to a nucleic acid generated using primer pairs in an amplification reaction (e.g., PCR), such as those described herein.
  • the amplicon is typically single-stranded DNA (e.g., the result of asymmetric amplification), however, it may be RNA or dsDNA.
  • amplifying or "amplification” in the context of nucleic acids refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide ⁇ e.g., a single polynucleotide molecule), where the amplification products or amplicons are generally detectable.
  • Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes.
  • the generation of multiple DNA copies from one or a few copies of a target or template DNA molecule during a polymerase chain reaction (PCR) or a ligase chain reaction (LCR) are forms of amplification.
  • the type of amplification is asymmetric PCR ⁇ e.g., LATE-PCR) which is described in, for example, U.S. Pat. 7,198,897 and Sanchez et al., Proc. Natl. Acad. Sci. (USA), 101(7): 1933-1938 and Pierce et al., Proc. Natl. Acad. Sci.
  • LATE-PCR is employed using multiple end-point temperature detection (see, e.g., U.S. Pat. Pub. 2006/0177841 and Sanchez et al., BMC Biotechnology, 2006, 6:44, pages 1-14, both of which are herein incorporated by reference).
  • the terms “complementary” or “complementarity” are used in reference to polynucleotides ⁇ i.e., a sequence of nucleotides) related by the base-pairing rules.
  • the sequence “5'-A-G-T-3', M is complementary to the sequence "3'-T-C- A-5'.”
  • Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
  • the degree of complementarity between nucleic acid strands has significant effects on the rate, melting temperature, and stability of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
  • Hot-start and “cold-stop” describe the state of a reaction in which the DNA synthetic activity (as distinct from the exonuclease activity) of a DNA polymerase used in an amplification reaction is inhibited by an interaction with a temperature-dependent reagent, antibody and/or alkylating agent or some other means.
  • Hot-start refers to activation of the polymerase by raising the temperature of the reaction above the annealing temperature for first time and holding the high temperature long enough to render the polymerase capable of DNA synthesis.
  • Certain polymerase inhibitor reagents ⁇ e.g., certain reagents described herein) are able to be reactivated once the temperature of the reaction is reduced below the annealing temperature. Such reagents are referred to as "cold-stop" reagents.
  • the term “gene” refers to a nucleic acid ⁇ e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide or precursor.
  • the term “gene” encompasses both cDNA and genomic forms of a gene.
  • Sequence identity may also encompass alternate or "modified" nucleobases that perform in a functionally similar manner to the regular nucleobases adenine, thymine, guanine and cytosine with respect to hybridization and primer extension in amplification reactions.
  • the two primers will have 100%) sequence identity with each other.
  • Inosine (I) may be used as a replacement for G or T and effectively hybridize to C, A or U (uracil).
  • inosine replaces one or more G or T residues in one primer which is otherwise identical to another primer in sequence and length
  • the two primers are considered to have 100%) sequence identity with each other, in order to distinguish this type of hybridization from a destabilizing mismatch.
  • Other such modified or universal bases may exist which would perform in a functionally similar manner for hybridization and amplification reactions and will be understood to fall within this definition of sequence identity.
  • hybridization or “hybridize” is used in reference to the pairing of complementary nucleic acids.
  • the thermodynamic stability of hybridization between two nucleic acid sequences is influenced by such factors as the degree of complementary between the nucleic acids, the temperature and salt concentrations of the solution, and the G:C ratio within the nucleic acids.
  • the melting temperature of the hybrid is determined in part by that stability.
  • hybridization sequence is used is reference to a particular target sequence and a particular probe or primer, and it is the sequence in the target sequence that hybridizes to the particular probe or primer.
  • the probe or primer may be fully or partially complementary to the target sequence over the length of the hybridization sequence.
  • the term "kif refers to any delivery system for delivering materials.
  • kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials.
  • fragmented kit refers to a delivery system comprising two or more separate containers that each contains a sub-portion of the total kit components.
  • kit includes both fragmented and combined kits.
  • LATE-PCR refers to a non-symmetric PCR method that utilizes unequal concentrations of primers and yields single-stranded primer-extension products (referred to herein as amplification products or amplicons). LATE-PCR is described, for example, in U.S. Pat. No. 7, 198,897 and 8,367,325, each of which is incorporated by reference in its entirety.
  • nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA.
  • the term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4 acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5- (carboxyhydroxyl-methyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil,
  • dihydrouracil inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudo-uracil, 1- methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methyl-cytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N- isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyl
  • nucleobase is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
  • a nucleobase includes natural and modified residues, as described herein.
  • oligonucleotide refers to a nucleic acid that includes at least two nucleic acid monomer units ⁇ e.g., nucleotides), typically more than three monomer units, and more typically greater than ten monomer units.
  • the exact size of an oligonucleotide generally depends on various factors, including the ultimate function or use of the oligonucleotide. To further illustrate, oligonucleotides are typically less than 200 residues long ⁇ e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer
  • Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer".
  • the nucleoside monomers are linked by phosphodiester bonds or analogs thereof, including phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like, including associated counterions, e.g., H + , H 4 + , Na + , and the like, if such counterions are present.
  • oligonucleotides are typically single-stranded.
  • Oligonucleotides are optionally prepared by any suitable method, including, but not limited to, isolation of an existing or natural sequence, DNA replication or amplification, reverse transcription, cloning and restriction digestion of appropriate sequences, or direct chemical synthesis by a method such as the phosphotriester method of Narang et al. ⁇ 191 '9) Meth Enzymol. 68: 90-99; the phosphodiester method of Brown et al. ⁇ 191 '9) Meth Enzymol. 68: 109-151; the diethylphosphoramidite method of Beaucage et al. (1981) Tetrahedron Lett. 22: 1859-1862; the triester method of Matteucci et al.
  • polynucleotide and “nucleic acid” are used herein interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, synthetic polynucleotides, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified, such as by conjugation with a labeling component.
  • the term "primer” refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced (e.g., in the presence of nucleotides and an Inducing Agent such as a biocatalyst (e.g., a DNA polymerase or the like) and at a suitable temperature and pH).
  • the primer is typically single- stranded for maximum efficiency during amplification, but alternatively may be double- stranded at a particular temperature and condition.
  • the primer is generally first treated to separate its strands before being used to initiate extension for the generation of amplification products.
  • the primer is an oligodeoxyribonucleotide.
  • the primer is sufficiently long to prime the synthesis of extension products in the presence of the Inducing Agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
  • the primer is a capture primer.
  • primer annealing temperature refers to the temperature used for primer binding during the majority of the thermal cycles in a PCR amplification reaction. This definition recognizes the possibility that the annealing temperature during certain thermal cycles, either at the beginning, soon after the beginning, during, or near the end of an amplification reaction can be deliberately chosen to be above, or below, the annealing temperature chosen for the majority of thermal cycles.
  • probe refers to a material that may (i) provide a detectable signal, (ii) interact a first probe or a second probe to modify a detectable signal provided by the first or second probe, such as fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • target specific when used in reference to an
  • oligonucleotide reagent refers to reagents designed and produced for hybridization to a specific target sequence ⁇ e.g., for detection, characterization, or amplification of the target sequence).
  • a target-specific reagent may be allele discriminating or mismatch tolerant.
  • reaction mix refers to a combination of reagents ⁇ e.g., nucleic acids, nucleic acid target molecules, mispriming prevention reagents , nucleic acid polymerases, enzymes, fluorophores, buffers, salts, etc.) in solution in a single vessel ⁇ e.g., microcentrifuge tube, PCR tube, well, microchannel, etc.).
  • reagents e.g., nucleic acids, nucleic acid target molecules, mispriming prevention reagents , nucleic acid polymerases, enzymes, fluorophores, buffers, salts, etc.
  • sample refers to anything capable of being analyzed by the methods provided herein.
  • the sample comprises or is suspected to comprise one or more nucleic acids capable of analysis by the methods.
  • the samples comprise nucleic acids ⁇ e.g., DNA, RNA, cDNAs, etc.) from one or more pathogens or bioagents.
  • Samples can include, for example, blood, saliva, urine, feces, anorectal swabs, vaginal swabs, cervical swabs, and the like.
  • the samples are "mixture" samples, which comprise nucleic acids from more than one subject or individual.
  • the methods provided herein comprise purifying the sample or purifying the nucleic acid(s) from the sample.
  • the sample is purified nucleic acid.
  • the sample comprises two or more strains or subtypes of the same microorganism.
  • Tm melting temperature
  • T m 's are generally calculated by one of the three methods discussed earlier, that is, the "% GC", or the “2(A+T) plus 4 (G+C)", or “Nearest Neighbor” formula at some chosen set of conditions of monovalent salt concentration and primer concentration.
  • the use of Nearest Neighbor calculations the T m 's of both primers is more accurate, and is particularly important in the case of asymmetric PCR, as T m 's depend on the concentrations chosen for use in calculation or measurement.
  • composition of the oligonucleotide (contained in the terms ⁇ and AS), the monovalent salt concentration, and the concentration of the oligonucleotide (contained in the term C) influence the T m .
  • the T m increases as the percentage of guanine and cytosine bases of the oligonucleotide increases but the T m decreases as the concentration of the oligonucleotides decrease.
  • the concentration of divalent cations such as magnesium which are present in most amplification reactions, have a strong effect on T m , but are typically not included in most of the commonly used formulas, including the nearest neighbor equation above.
  • T m is calculated using formulas that include factors for the effect of magnesium.
  • the T m values presented in this application were obtained using Visual OMP computer software (DNA Software), which utilizes a Nearest Neighbor formula plus proprietary factors for estimating the effects of magnesium and particular nucleotide mismatches.
  • T m is measured empirically by hybridization melting analysis as known in the art. The T m depends on the concentration of both strands.
  • the T m depends primarily on the concentration of the most abundant molecule (i.e., the primer).
  • the initial hybridization of the primer may be to a target oligonucleotide that is only partially complementary. In that case, the T m will be lower than that to a fully complementary target.
  • Targets with partial complementary to the primer i.e., the presence of mismatched nucleotide pairs in the hybrid
  • the amplicon contains sequences that are fully complementary to the primers and the T m may increase.
  • T m for a primer a partially complementary target can be calculated using Visual OMP. Tm can be determined empirically or calculated as described in Santa Lucia, J. PNAS (USA) 95 : 1460-1465 (1998), which is hereby incorporated by reference.
  • T m A means the melting temperature of an amplicon, either a double-stranded amplicon or a single-stranded amplicon hybridized to its complement.
  • T m A is calculated using Visual OMP, which utilizes a factor for magnesium concentration not included in the %GC formula.
  • T m A can also be determined empirically following amplification using a double-stranded DNA-binding dye such as SYBR Green in combination with melting analysis as is well known by those skilled in the art.
  • T m p refers to the concentration-adjusted melting temperature of the probe to its target, or the portion of probe that actually is complementary to the target sequence (e.g., the loop sequence of a molecular beacon probe).
  • T m p is calculated using the Nearest Neighbor formula given above or using Visual OMP, as for primer T m , or preferably is measured empirically.
  • a rough estimate of T m p can be calculated using commercially available computer programs that utilize the % GC method, see Marras, S.A. et al. (1999) "Multiplex Detection of Single-Nucleotide Variations Using Molecular Beacons," Genet. Anal. 14: 151 156, or using the Nearest Neighbor formula, or preferably is measured empirically.
  • T m p is determined empirically.
  • C T means threshold cycle and signifies the cycle of a real-time PCR amplification assay in which signal from a reporter indicative of amplicons generation first becomes detectable above background. Because empirically measured background levels can be slightly variable, it is standard practice to measure the CT at the point in the reaction when the signal reaches 10 standard deviations above the background level averaged over the 5-10 thermal cycles preceding fluorescence increase. Software provided with many thermal cyclers uses default parameters for determining CT values. DETAILED DESCRIPTION
  • Intramolecular base pairing of single-stranded CCCVd nucleic acids result in a secondary structure that may slow or prevent the hybridization of primers and probes to the CCCVd target.
  • Increasing temperature, decreasing salt concentrations, or including additives such as DMSO can decrease the stability of intramolecular base pairing and thereby reduce secondary structure, but these changes also decrease the stability and/or melting temperature of the primer to target or probe to target hybrids.
  • any method used to increase the hybridization of primers to their targets must also be compatible with reverse transcription if the target is RNA, and with amplification methods such as symmetric PCR, asymmetric
  • RNA or DNA RNA or DNA. In most cases this limits the range of salt concentrations, incubation temperatures, and primer T m 's.
  • reverse transcriptases are typically used at temperatures from 30 °C to 55 °C. At those temperatures, CCCVd RNAs will have extensive secondary structure. Using temperatures in the 60 °C to 70 °C range is possible with some engineered enzymes, but often still results in very short half-life of enzyme activity, or requires increasing the concentration of additives such as DTT, which can interfere with DNA polymerase activity or with fluorescent probe detection.
  • RNA solutions to about 65 °C to 70 °C for up to 5 minutes, then rapid cooling prior to the addition of reverse transcription reagents. While this may reduce some base pairing between different RNA molecules, it is unlikely to cause a long-term change in the intramolecular base pairing which can rapidly reform as the temperature is lowered - much more rapidly than a reaction involving two separate molecules.
  • amplification methods include a forming a reaction mixture in the absence of a nucleic acid polymerase and incubating the mixture at one or more temperatures disclosed herein for one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more) periods of time.
  • RNA usually referred to as the antisense primer
  • methods are described herein that include a pre-RT incubation step, or just "pre-incubation” that includes the antisense primer and the RNA and at temperatures of 50 °C or higher (e.g., at 50 °C or higher, 55 °C or higher, 60 °C or higher, 65 °C or higher, 70 °C or higher, 80 °C or higher , or 85 °C or higher) with salt concentrations and melting temperatures that enable
  • the pre-incubation can be done prior to either one-step (both reactions done without processing between them), or two-step RT-PCR.
  • the amplification can be symmetric PCR , asymmetric PCR, LATE-PCR, or other amplification methods. Methods have been previously described for pre-annealing of primers to RNA targets with low- to medium-levels of secondary structure, but where the salt concentrations were low and hybridization takes place at room temperature (Pierce, K.E. et al, 2010. Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus. J Appl Microbiol 109: 180-9; Pierce, K.E. and
  • HCV hepatitis C virus
  • a nucleic acids polymerase e.g., reverse transcriptase or DNA polymerase
  • a nucleic acids polymerase e.g., reverse transcriptase or DNA polymerase
  • the reaction mixture includes a CCCVd nucleic acid target molecule with a nucleic acid target sequence ⁇ i.e., a CCCVd RNA sequence) and one or more primers that hybridize to the CCCVd nucleic acid target sequence.
  • a CCCVd nucleic acid target molecule with a nucleic acid target sequence ⁇ i.e., a CCCVd RNA sequence
  • one or more primers that hybridize to the CCCVd nucleic acid target sequence.
  • the reaction mixture is incubated at a temperature between 50 °C and the melting temperature of the one or more primers hybridized to CCCVd target sequence.
  • the reaction mixture may be incubated at a temperature of at least 50°C, at least 51°C, at least 52°C, at least 53°C, at least 54°C, at least 55°C, at least 56°C, at least 57°C, at least 58 °C, at least 59°C, at least 60 °C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69 °C, at least 70°C, at least 71°C, at least 72°C, at least 73°C, at least 74°C, at least 75°C, at least 76°C, at least 77°C, at least
  • the reaction mixture may be incubated at two or more temperatures for one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more) periods of time.
  • the period of time may be at least 1 second, at least 2 seconds, at least 3 seconds, at least 4 seconds, at least 5 seconds, at least 6 seconds, at least 7 seconds, at least 8 seconds, at least 9 seconds, at least 10 seconds, at least 15 seconds, at least 20 seconds, at least 25 seconds, at least 30 seconds, at least 45 seconds, at least 60 seconds, at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 30 minutes.
  • the method further comprises lowering the temperature of the reaction mixture to at a temperature of no more than 15°C, no more than 16°C, no more than 17°C, no more than 18°C, no more than 19°C, no more than 20°C, no more than 21°C, no more than 22°C, no more than 23°C, no more than 24°C, no more than 25°C, no more than 26°C, no more than 27°C, no more than 28°C, no more than 29°C, no more than 30°C, no more than 31°C, no more than 32°C, no more than 33°C, no more than 34°C, or no more than 35°C).
  • the primers may be diluted at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold.
  • a nucleic acid polymerase is then added to the reaction mixture, followed by incubating the reaction mixture under conditions such that the one or more nucleic acid primers is extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • more than one nucleic acid polymerase is added to the reaction mixture.
  • the nucleic acid polymerase may be reverse transcriptase, an RNA polymerase, and/or DNA polymerase.
  • the nucleic acid polymerases are added to the reaction mixture at the same time. In other embodiments, the nucleic acid polymerases are added to the reaction mixture at different times.
  • reverse transcriptase may be added to the reaction mixture, and the reaction mixture may then be incubated a one or more temperatures to allow reverse transcription of a CCCVd RNA target sequence, followed by addition of DNA polymerase to amplify the resulting nucleic acid sequence.
  • the primers when hybridized to a CCCVd target sequence, have a melting temperature of at least 80 °C, at least 81°C, at least 82 °C, at least 83 °C, at least 84°C, at least 85°C, at least 86°C, at least 87 °C, at least 88°C, at least 89°C, at least 90°C, at least 9FC, at least 92 °C, at least 93°C, at least 94°C, at least 95°C, at least 96°C, at least 97 °C, at least 98°C, at least 99°C, or at least 100°C.
  • a mispriming prevention agent disclosed herein is added to the reaction mixture.
  • Primers specific for CCCVd nucleic acids may comprise a random sequence of nucleotides or primers may be sequence specific primers.
  • the melting temperature of the primer to the RNA or DNA target is equal to or higher than the pre-incubation
  • the RNA or DNA target has predicted intramolecular hybridization at the pre-incubation temperature that includes nucleotides targeted by the primer.
  • the T m of primer to target is at least 5 degrees higher, at least 6 degrees higher, at least 7 degrees higher, at least 8 degrees higher, at least 9 degrees higher, at least 10 degrees higher, at least 1 1 degrees higher, at least 12 degrees higher, at least 13 degrees higher than the pre-incubation temperature.
  • the T m of the primer to target during pre-incubation is at least 75 °C.
  • the incubation temperature is 70 °C or higher.
  • the target is a CCCVd target sequence. Exemplary primer sequences can be found in Table 1.
  • RT- PCR is one-step.
  • the pre-incubation step may be brief (e.g. at least 5 seconds, at least 10 seconds, or at least 30 seconds) or may be several minutes in duration, and may include multiple steps over a range of temperatures at which the primer(s) should hybridize the RNA or DNA target(s) (e.g. between the T m and 10 degrees below the T m ), or a slow (e.g. 1°C per second, 0.1°C per second, 0.01°C per second), continuous change over that range of temperatures.
  • the method may include a step at a
  • the T m is over 75 °C and reverse transcription and/or PCR is done in the presence of additives or solutions disclosed herein, and/or a mispriming reagents disclosed herein.
  • mispriming prevention reagents are shown in Table 2,
  • the reaction mixtures disclosed herein may also have Single Strand Binding Protein, which increase the specificity of the reactions.
  • the T m is over 75 °C, but the concentration of that primer is 100 nM or lower during RT, or is diluted to that concentration for amplification, resulting in a lower T m during that step.
  • the T m of hairpins formed on a single-stranded RNA or DNA molecule may be very high (e.g., at least 50 °C, at least 55 °C, at least 60 °C, at least 65 °C, at least 70 °C, or at least 80 °C ) at typical RT or PCR temperatures or conditions.
  • Base pairing on viroid circular RNA molecules can be even higher melting temperatures (e.g., 85 °C).
  • hairpin formation is dynamic and these structures are melting and reforming during the course of incubation.
  • the primer molecules will hybridize to available targets over time if the pre-incubation temperature reasonably close to that T m (e.g., within 10 °C, or preferably within 5 °C) and the T m of the primer - target hybrid is at or above the melting temperature, preferably at least 5 °C above that temperature. Since the thermodynamic stability is in generally higher for that intermolecular hybrid compared to the alternative intramolecular hybrid, a large percentage of the primer will be hybridized to the target if the reaction is allowed to reach equilibrium, but the time necessary to reach that point may be longer with targets having higher secondary structure.
  • a pre-incubation time between 5 seconds and 60 seconds may be sufficient for targets with minimal secondary structure at the incubation temperature.
  • the pre-incubation time is 1 to 3 minutes.
  • the pre-incubation time is at least 3 minutes, preferably at least 5 minutes, or at least 10 minutes.
  • the concentration of the primer is at least 1 ⁇ during pre-annealing. In more embodiments, the concentration of the primer is at least 2 ⁇ during pre-annealing. In some embodiments, the concentration of the primer is at least 1 ⁇ , at least 2 ⁇ , at least 3 ⁇ , at least 4 ⁇ , at least 5 ⁇ , at least 6 ⁇ , at least 7 ⁇ , at least 8 ⁇ , at least 9 ⁇ , or at least 10 ⁇ during pre-annealing.
  • Non- extensible oligonucleotides that hybridize with the CCCVd target and have a high T m can be used to reduce secondary structure and enable hybridization of a nucleic acid primer during the same pre-incubation or during the subsequent RT or PCR. Alternatively, they can be added directly to the RT mix or the PCR mix, to enable primers to bind to RNA, or to DNA, respectively.
  • the non- extensible opener typically modified on the 3' end to prevent extension by a polymerase, is designed to hybridize with the nucleotides on the target that might otherwise have base pairing with nucleotides targeted by a primer. Thus, the non- extensible oligonucleotide serves as an "opener" for the primer.
  • the opener can be designed with very high T m without the risk of increasing non-specific product during subsequent amplification.
  • the opener or non-extensible oligonucleotide has a chemical modification.
  • the chemical modification is one or more 2'-0-methyl nucleosides.
  • the non- extensible oligonucleotide can include non-conventional nucleotides, such as 2'-0-methyl RNA, PNAs, or LNAs that increase the T m .
  • the opener i.e., the non- extensible nucleotide
  • the opener has a T m that is higher than the Tm of any predicted intramolecular base-pairing that includes nucleotides targeted by the opener or the primer.
  • the primers comprise a random sequence of nucleotides (e.g., the primer is a random hexamer).
  • random hexamers are used as primers in a two-step RT-PCR following pre-incubation of RNA with the opener.
  • gene-specific (sequence-specific) primers are used for 1-step RT-PCR following pre-incubation of RNA with the opener.
  • the primer includes non-conventional bases that increase the T m relative to DNA oligonucleotides.
  • the target of the opener is CCCVd RNA .
  • provided herein are methods for amplifying a nucleic acid (e.g., a CCCVd RNA) by forming a reaction mixture comprising a CCCVd nucleic acid target molecule comprising a CCCVd nucleic acid target sequence, a non-extendible oligonucleotide (i.e., an opener), and an extensible nucleic acid primer.
  • the reaction mixture is then incubated at one or more temperatures disclosed herein for a period of time disclosed herein to allow the non- extensible oligonucleotide (e.g., a non- extensible oligonucleotide of Table 3) and the extendible nucleic acid primer (e.g., a primer of Table 1) to hybridize with the CCCVd nucleic acid target sequence.
  • the non- extensible oligonucleotide e.g., a non- extensible oligonucleotide of Table 3
  • the extendible nucleic acid primer e.g., a primer of Table 1
  • the extendible nucleic acid primer and the non-extendible oligonucleotides hybridize to a regions of the CCCVd nucleic acid target sequence that are non-overlapping, and the non-extensible oligonucleotide hybridized to the CCCVd nucleic acid target sequence has a predicted melting temperature that is at least 10 °C higher than the predicted melting temperature of the extensible nucleic acid primer hybridized to the CCCVd nucleic acid target sequence.
  • the predicted melting temperature is at least 1°C higher, at least 2°C higher, at least 3°C higher, at least 4°C higher, at least 5°C higher, at least 6°C higher, at least 7°C higher, at least 8°C higher, at least 9°C higher, at least 10°C higher, at least 1 1°C higher, at least 12°C higher, at least 13°C higher, at least 14°C higher, at least 15°C higher, at least 16°C higher, at least 17°C higher, at least 18°C higher, at least 19°C higher, or at least 20°C higher.
  • non-extensible oligonucleotide hybridized to the CCCVd nucleic acid target sequence has a predicted melting temperature of at least 80 °C, at least 81°C, at least 82 °C, at least 83 °C, at least 84°C, at least 85°C, at least 86°C, at least 87 °C, at least 88°C, at least 89°C, at least
  • a nucleic acid polymerase is then added to the reaction mixture after the pre-incubation step.
  • the reaction mixture may then be incubated under conditions such that the one or more nucleic acid primers are extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • a CCCVd nucleic acid by forming a reaction mixture with a CCCVd nucleic acid target molecule comprising a CCCVd nucleic acid target sequence, one or more primers that hybridize to the CCCVd nucleic acid target sequence, and incubating the reaction mixture under conditions such that the one or more nucleic acid primers is extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • the one or more primers comprise a primer that has a predicted melting temperature of at least 80 °C, at least 81°C, at least 82°C, at least 83°C, at least 84°C, at least 85°, at least 86°C, at least 87°C, at least 88°C, at least 89°C, at least 90 °C, at least 91°C, at least 92°C, at least 93°C, at least 94°C, or at least 95 °C with the nucleic acid target sequence and a nucleic acid polymerase.
  • nucleic acid polymerase provided in any one of methods disclosed herein may be reverse transcriptase and/or DNA polymerase.
  • the nucleic acid polymerases are added to the reaction mixture at the same time (e.g., one step PCR or RT- PCR). In other embodiments, the nucleic acid polymerases are added to the reaction mixture at different times (e.g., two step PCR).
  • the reaction mixture comprises a DNA polymerase (e.g., Taq DNA polymerase, Tfi DNA polymerase, Pfu DNA polymerase, Bst DNA polymerase, Vent R DNA polymerase Deep Vent R DNA polymerase, KlearKall polymerase from LGC Biosearch, and Taq polymerase from Hain Lifescience).
  • the reaction mixture comprises dNTPs (e.g., dATP, dCTP, dGTP, dTTP, and/or dUTP).
  • the reaction mixture comprises a reverse transcriptase.
  • LATE-PCR amplifications and amplification assays are described in, for example, European patent EP 1,468, 1 14 and corresponding United States patent 7, 198,897; published European patent application EP 1805199 A2; Sanchez et al. (2004) Proc. Nat. Acad. Sci. (USA) 101 : 1933- 1938; and Pierce et al. (2005) Proc. Natl. Acad. Sci. (USA) 102: 8609-8614. All of these references are hereby incorporated by reference in their entireties.
  • LATE-PCR is a non- symmetric DNA amplification method employing the polymerase chain reaction (PCR) process utilizing one oligonucleotide primer (the "Excess Primer”) in at least five-fold excess with respect to the other primer (the “Limiting Primer”), which itself is utilized at low concentration, up to 200 nM, so as to be exhausted in roughly sufficient PCR cycles to produce fluorescently detectable double-stranded amplicon.
  • PCR polymerase chain reaction
  • the Limiting Primer is exhausted, amplification continues for a desired number of cycles to produce single-stranded product using only the Excess Primer, referred to herein as the Excess Primer strand.
  • LATE- PCR takes into account the concentration-adjusted melting temperature of the Limiting
  • Tm[ 0 ] L the concentration-adjusted melting temperature of the Excess Primer at the start of amplification
  • Tm [0] X the melting temperature of the single-stranded amplification product ("amplicon")
  • Trri A the melting temperature of the single-stranded amplification product
  • 0 ] can be determined empirically, as is necessary when non-natural nucleotides are used, or calculated according to the "nearest neighbor" method (Santa Lucia, J. (1998), PNAS (USA) 95: 1460-1465; and Allawi, H.T. and Santa Lucia, J. (1997), Biochem.
  • Tm 81.5 + 0.41 (%G+%C) - 500/L + 16.6 log [M]/(l + 0.7 [M]), where L is the length in nucleotides and [M] is the molar concentration of monovalent cations.
  • Melting temperatures of linear, or random-coil, probes can be calculated as for primers.
  • Melting temperatures of structured probes can be determined empirically or can be approximated as the Tm of the portion (the loop or the loop plus a portion of the stem) that hybridizes to the amplicon.
  • Tm [0] L is preferably not more than 5 °C below Tm [0] X , more preferably at least as high and even more preferably 3-10 °C higher, and Tm A is preferably not more than 25 °C higher than Tm [0 ] X , and for some preferred embodiments preferably not more than about 18 °C higher.
  • LATE-PCR is a non-symmetric PCR amplification that, among other advantages, provides a large "temperature space" in which actions may be taken. See WO 03/054233 and Sanchez et al. (2004), cited above.
  • Certain embodiments of LATE-PCR amplifications include the use of hybridization probes, in this case sets of signaling and quencher probes, whose Tm's are below, more preferably at least 5 °C below, the mean primer annealing temperature during exponential amplification after the first few cycles.
  • Sets of signaling and quencher probes are included in LATE-PCR amplification mixtures prior to the start of amplification.
  • a DNA dye, if used, can also be incorporated into the reaction mixture prior to the start of amplification.
  • the reaction mixture further comprises a detection reagent for detecting the formation of the amplification product.
  • the detection reagent comprises a dsDNA fluorescent dye (e.g., SYBR Green, PicoGreen).
  • the detection reagent comprises a detectably labeled probe (e.g., a molecular beacon, a TaqMan probe, a scorpion probe).
  • the detection reagent comprises a Lights-On probe and a Lights-Off probe.
  • the detection reagent comprises a Lights-Off Only probe and a dsDNA fluorescent dye.
  • RNA transcripts will lack a large number of nucleotides, often several thousand that would be present in the amplification product from the DNA.
  • amplification conditions can be adjusted to minimize amplification of the DNA (e.g., by keeping the extension step duration short), or the products from the DNA can be
  • RNA binding dye such as SYBR Green.
  • these steps may not always be possible or convenient.
  • amplify plant mitochondrial nad5 mRNA using primers to exons 2 and 4. These exons are separated by more than 33,000 nucleotides on the DNA and are transcribed separately, then joined together in "trans splicing" events that also include a transcript from exon 3 that is even more distant on the chromosome and encoded on the opposite DNA strand.
  • nad5 mitochondrial gene Another advantage of choice of the nad5 mitochondrial gene is its high degree of conservation that will enable tests on a wide range of plants using the same primers or slight modifications of the primers described herein.
  • Other genes with introns tens of thousands of bases in length or genes known to have trans-splicing could be similarly used. Although trans splicing has not been identified in animals, it is possible that such genes do exist and these principals could be extended to animals as well.
  • provided herein are methods of amplifying CCCVd nucleic acids that have been prepared in a solution prior to the amplification steps provided herein.
  • methods of amplifying CCCVd RNA by first lysing cells in a solution comprising a chaotrope, a reducing agent, a detergent, a chelator and a buffer ⁇ e.g., a PrimeStoreTM solution) and application of mechanical disruption to form a nucleic acid solution comprising a nucleic acid target molecule, and then forming a reaction mixture comprising one or more primers that hybridize to the CCCVd target molecule and a nucleic acid polymerase, and incubating the reaction mixture under conditions such that the one or more nucleic acid primers is extended by the nucleic acid polymerase to create an amplification product comprising the CCCVd nucleic acid target sequence or a complement thereof.
  • the nucleic acid solution is diluted without performing a nucleic acid purification step to form a reaction mixture comprising the CCCVd nucleic acid target molecule.
  • the nucleic acid solution is diluted in step by an amount sufficient to reduce the concentration of the chaotrope, the reducing agent, the detergent, the chelator and the buffer to a level whereby the nucleic acid polymerase has at least 10%, at least 20%, at least 30% at least 40%, at least 50%, at least 60%, or at least 70%, of the activity it has in a reaction mixture that does not comprise the chaotrope, the reducing agent, the detergent, the chelator and the buffer.
  • Dilution of the nucleic acid solution may be done in one step, two steps, or more steps.
  • the nucleic acid solution disclosed herein may be diluted by a factor of at least 5 fold, at least 10 fold, at least 15 fold, at least 20 fold, at least 25 fold, at least 30 fold, at least 35 fold, at least 40 fold, at least 45 fold, at least 50 fold, at least 55 fold, at least 60 fold, at least 65 fold, at least 70 fold, or at least 75 fold.
  • the first dilution step is carried out in a buffer that contains at least one ⁇ e.g., at least two, at least three, at least four, or at least five) DNA oligonucleotide primer(s) and wherein said first-dilution step is followed by heating to at least 80 °C, at least 81 °C, at least 82 °C, at least 83 °C, at least 84 °C, at least 85 °C, at least 86 °C, at least 87 °C, at least 88 °C, at least 89 °C, at least 90 °C, at least 91 °C, at least 92 °C, at least 93 °C, at least 94 °C, or at least 95 °C followed by gradual cooling, prior to a second dilution step.
  • a buffer that contains at least one ⁇ e.g., at least two, at least three, at least four, or at least five) DNA oligonucleotide
  • the methods further comprise co-amplification of a non-viroid target sequence by incubating the reaction mixture under conditions such that the one or more nucleic acid primers is extended by a nucleic acid polymerase to create an amplification product comprising the non-viroid target sequence (e.g., transcripts of nad5) or a complement thereof.
  • compositions and solutions as well as methods of employing them, that may advantageously improve conventional collection, lysis, transport and storage methods for the preparation of CCCVd nucleic acids from one or more biological sources.
  • the solutions and methods provided herein may provide a collection and preservation formulation to inactivate and lyse a biological specimen containing nucleic acids, and preserve nucleic acids (e.g., RNA and/or DNA) within the biological specimen, preferably all in a single reaction vessel, such that the integrity of the nucleic acids is at least substantially or fully maintained, so that a portion of the nucleic acids are readily available for analysis.
  • the methods and compositions may also enable isolated nucleic acids to remain at least substantially stable, without requiring consistent and constant cooler temperatures, such as refrigeration or freezing.
  • a composition that includes: a) one or more chaotropes (e.g., present in the composition an amount from about 0.5 M to about 6 M); b) one or more detergents (e.g., present in the composition an amount from about 0.1% to about 1%); c) one or more chelators (e.g., present in the composition in an amount from about 0.01 mM to about 1 mM); d) one or more reducing agents (e.g., present in the composition in an amount from about 0.05 M to about 0.3 M); and e) one or more defoaming agents (e.g., present in the composition in an amount from about 0.0001% to about 0.3%).
  • chaotropes e.g., present in the composition an amount from about 0.5 M to about 6 M
  • one or more detergents e.g., present in the composition an amount from about 0.1% to about 1%
  • c) one or more chelators e.g., present in the composition in an amount from
  • Exemplary chaotropes include, without limitation, guanidine thiocyanate (GuSCN), guanidine hydrochloride (GuHCl), guanidine isothionate, potassium thiocyanate (KSCN), sodium iodide, sodium perchlorate, urea, or any combination thereof.
  • GuSCN guanidine thiocyanate
  • GSCN potassium thiocyanate
  • sodium iodide sodium perchlorate
  • urea or any combination thereof.
  • Descriptions of additional exemplary chaotropes and chaotropic salts can be found in, inter alia, U.S. Pat. No. 5,234,809 (specifically incorporated herein in its entirety by express reference thereto).
  • Exemplary detergents include, without limitation, sodium dodecyl sulfate (SDS), lithium dodecyl sulfate (LDS), sodium taurodeoxycholate (NaTDC), sodium taurocholate (NaTC), sodium glycocholate (NaGC), sodium deoxycholate (NaDC), sodium cholate, sodium alkylbenzene sulfonate (NaABS), N-lauroyl sarcosine (NLS), salts of carboxylic acids (i.e., soaps), salts of sulfonic acids, salts of sulfuric acid, phosphoric and
  • polyphosphoric acid esters alkylphosphates, monoalkyl phosphate (MAP), and salts of perfluorocarboxylic acids, anionic detergents including those described in U.S. Pat. No. 5,691,299 (specifically incorporated herein in its entirety by express reference thereto), or any combination thereof.
  • Exemplary reducing agents include, without limitation, 2-mercaptoethanol (.beta.- ME), tris(2-carboxyethyl)phosphine (TCEP), dithiothreitol (DTT), formamide,
  • the reducing agent includes or is TCEP.
  • Exemplary chelators include, without limitation, ethylene glycol tetraacetic acid (EGTA), hydroxyethylethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTP A), N,N-bis(carboxymethyl)glycine (NTA),
  • EGTA ethylene glycol tetraacetic acid
  • HEDTA hydroxyethylethylenediaminetriacetic acid
  • DTP A diethylene triamine pentaacetic acid
  • NTA N,N-bis(carboxymethyl)glycine
  • the chelator includes EDTA, a citrate, or a combination thereof.
  • the chelator includes EDT.
  • the compositions disclosed herein may further include one or more buffers (e.g., present in the final composition in an amount from about 1 mM to about 1 M).
  • Exemplary buffers include, without limitation, tris(hydroxymethyl)aminom ethane (Tris), citrate, 2-(N- morpholino)ethanesulfonic acid (MES), N,N-Bis(2 -hydroxy ethyl)-2-aminoethanesulfonic Acid (BES), l,3-bis(tris(hydroxymethyl)methylamino)propane (Bis-Tris), 4-(2- hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES), 3-(N-morpholino)propanesulfonic acid (MOPS), N,N-bis(2-hydroxyethyl)glycine (Bicine), N-
  • Tris tris(hydroxymethyl)aminom ethane
  • MES 2-(N- morpholino)ethanesulfonic acid
  • BES N,N-Bis(2 -hydroxy ethyl)-2-aminoethanesulfonic Acid
  • the buffer includes a citrate.
  • the inclusion of one or more buffers is desirable to control the pH of the formulations, since it has been found that nucleic acid extraction is optimal in a pH range of about 5 to 7.
  • the one or more buffers employed in the disclosed compositions are chosen to provide a significant buffering capacity in the range from a pH of about 6 to a pH of about 8, more preferably within a pH range of about 6 to about 7, and more preferably still, within a pH range of about 6.2 to about 6.8.
  • compositions disclosed herein can further include a defoaming agent to prevent the formation of bubbles that typically result from the presence of detergents in the formulation.
  • Defoaming agents facilitate pipetting and handling of the disclosed compositions.
  • Exemplary surfactants/defoaming agents include, without limitation, cocoamidopropyl hydroxysultaine, alkylaminopropionic acids, imidazoline carboxylates, betaines, sulfobetaines, sultaines, alkylphenol ethoxylates, alcohol ethoxylates,
  • a defoaming agent includes a silicone polymer.
  • compositions disclosed herein may also further optionally include one or more short-chain (preferably from 1- to 6-carbon [i.e., C.sub. l-C.sub.6] alcohols)alkanols (e.g., present in the composition in an amount from about 1% to about 25%, although higher percentages of the alcohols may be employed if desired).
  • short-chain alkanols include linear and branched-chain alcohols, such as, without limitation, methanol, ethanol, propanol, butanol, pentanol, hexanol, or any combination thereof.
  • the method generally involves associating the sample with an amount of one of the disclosed compositions, under conditions effective to obtain a population of polynucleotides from the sample.
  • sample may be of any origin, including, without limitation, a clinical or veterinary sample; an environmental or ecological sample, a forensic or crime scene sample, or such like, and may contain one or more nucleic acids that are of viral, microbial, animal, or plant origin, or any combination thereof.
  • a sample may comprise plant cells, animal cells, fungus cells, bacterial cells or parasite cells.
  • the methods described herein are shown to work well with PrimeStoreTM, a reagent containing a reducing agent and a chaotropic compound.
  • the source of the nucleic acid for pre-incubation with a primer or opener contains a chaotropic compound and that incubation is done at 60 °C or higher. In preferred embodiments, the incubation is done at 70 °C or higher.
  • two or more antisense primers target different RNA molecules or different genes, or exons with a gene. In other preferred embodiments, one antisense primer targets an internal control RNA or gene. Additional information about nucleic acid solutions disclosed herein can be found in U.S. Patent 9,212,399, which is incorporated herein in its entirety.
  • mispriming prevention reagent may be a single- or a multi-stranded mispriming prevention reagent.
  • the reagents described here fall into a class of reagents that, when added to a primer-based amplification reaction, such as PCR assays or other primer- dependent DNA amplification reactions at a functional temperature-dependent concentration relative to the concentration of DNA polymerase in the reaction, is effective in preventing at least one manifestation of mispriming, including amplification of primer-dimers, increasing polymerase selectivity against 3' terminal mismatches, reducing scatter among replicates, and lower than maximal yield of amplification of one or more reaction products.
  • a primer-based amplification reaction such as PCR assays or other primer- dependent DNA amplification reactions at a functional temperature-dependent concentration relative to the concentration of DNA polymerase in the reaction.
  • mispriming prevention reagents described herein are capable of preventing or inhibit one or more manifestations of mispriming in at least some PCR amplification reactions and/or reverse transcription reactions.
  • "prevent a manifestation of mispriming” refers to the elimination or the reduction of the formation of one or more products of mispriming in a nucleic acid amplification reaction containing a reagent described herein compared to in an otherwise identical nucleic acid amplification reaction in which the reagent was omitted.
  • the reagents described herein comprise a single-stranded oligonucleotide that can be in an open configuration or a closed-hairpin configuration depending on whether six or more complementary nucleotides at or near the 3 ' terminus and the 5' terminus of the oligonucleotide are hybridized to each other in a temperature- dependent manner.
  • the reagent is active ⁇ i.e., inhibits mispriming) in the closed stem-loop hairpin conformation. In this conformation it binds to and increases the specificity of the DNA polymerase, including by greatly reducing the rate of DNA synthesis.
  • the mispriming prevention reagents described herein reduce or prevent Type 1 and/or Type 2 mispriming.
  • the mispriming prevention reagent provided herein reversibly acquires a principally stem-loop hairpin conformation at a first temperature but not at a second, higher temperature.
  • the first temperature is a temperature that is below an annealing temperature of an amplification reaction and the second temperature is a temperature that is above the annealing temperature of an amplification reaction.
  • the stem-loop hairpin confirmation of the mispriming prevention reagent reduces the activity of a thermostable DNA polymerase (e.g., Taq polymerase).
  • the mispriming prevention reagent is able to act as both a "hot-start" reagent and a "cold-stop" reagent during the performance of a primer-based nucleic acid amplification process.
  • the melting temperature, Tm, of a hairpin reagent having a stem of fixed sequence can be adjusted by increasing or decreasing the number of cytosine nucleotides in the loop.
  • hairpin Tm decreases as a function of increasing loop length, the relationship between loop length and hairpin Tm is not linear.
  • the empirically observed hairpin Tm differs from the in silico calculated Tm due the presence of the chemical moieties linked to the 3' and 5' ends of the stem.
  • paired identical moieties stabilize the closed stem structure to a greater extent than paired non-identical moieties.
  • the reagent described herein comprises non-identical 3' and 5' paired moieties.
  • the mispriming prevention reagent oligonucleotide described herein comprises, in 5' to 3' order, a first condition-dependent "stem” region, a condition- dependent "loop” region and a second condition-dependent "stem” region, wherein the first stem region hybridizes to the second stem region in a temperature dependent manner to acquire a stem-loop hairpin conformation ⁇ e.g., a stem -loop hairpin with a 3' or 5' overhang or a blunt-ended stem-loop hairpin).
  • the first stem region is linked to a first moiety and the second stem region is linked to a second, non-identical moiety.
  • the first moiety and the second moiety are cyclic or polycyclic planar moieties that do not have a bulky portion ⁇ e.g., a dabcyl moiety, a Black Hole Quencher moiety, such as a Black Hole Quencher 3 moiety or a coumarin moiety).
  • the first stem region comprises a first stem nucleic acid sequence ⁇ e.g., a nucleic acid sequence of at least 6, 7, 8, 9 or 10 nucleotides in length). In some embodiments, the first stem nucleic acid sequence is no more than 20, 19, 18, 17, 16, 15, 14, 12 or 11 nucleotides in length. In some embodiments, the first stem nucleic acid sequence is 10 nucleotides in length. In some embodiments, the first stem region comprises a 5' terminal moiety. In some embodiments, the 5' terminal moiety is linked (either directly or indirectly) to the most 5' nucleotide of the first stem region.
  • the 5' terminal moiety is linked (either directly or indirectly) to one of the 2, 3, 4, or 5 most 5' nucleotides of the first stem region.
  • the 5' terminal moiety comprises a cyclic or polycyclic planar moiety that does not have a bulky portion (not including the linker, if present).
  • the 5' terminal moiety is a dabcyl moiety.
  • the 5' terminal moiety is a coumarin moiety (e.g., Coumarin 39, Coumarin 47 or Biosearch Blue).
  • the loop region comprises a loop nucleic acid sequence (e.g., a nucleic acid sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length). In some embodiments, the loop nucleic acid sequence is between 25 and 40 nucleotides in length. In some embodiments, the loop nucleic acid sequence is a single nucleotide repeat sequence (e.g., a poly-cytosine, a poly-guanine, a poly-thymine, a poly-adenine or a poly-uracil sequence).
  • the single nucleotide repeat sequence is a poly-cytosine sequence.
  • the second stem region comprises a second stem nucleic acid sequence (e.g., a nucleic acid sequence of at least 6, 7 or 8 nucleotides in length). In some embodiments, the second stem nucleic acid sequence is no more than 20, 19, 18, 17, 16, 15, 14, 12 or 1 1 nucleotides in length. In some embodiments, the second stem nucleic acid sequence is 10 nucleotides in length. In some embodiments, the second stem nucleic acid sequence is complementary to the second stem nucleic acid sequence. In some embodiments, the second stem region comprises a 3 ' terminal moiety. In some embodiments, the 3 ' terminal moiety is linked (either directly or indirectly) to the most 3 ' nucleotide of the second stem region. In some embodiments, the 3 ' terminal moiety is linked (either directly or indirectly) to one of the 2, 3, 4, or 5 most 3 ' nucleotides of the second stem region. In some embodiments,
  • the 3 ' terminal moiety comprises a cyclic or polycyclic planar moiety that does not have a bulky portion (not including the linker, if present). In some embodiments, the 3 ' terminal moiety is a dabcyl moiety. In some embodiments, the 3 ' terminal moiety is a coumarin moiety (e.g., Coumarin 39, Coumarin 47 or Biosearch Blue). In some
  • the 3 ' terminal moiety is non-identical to the 5' terminal moiety. In some embodiments, the 3 ' terminus of the second stem region is non-extensible by a DNA polymerase.
  • the first stem region hybridizes to the second stem region in a temperature dependent manner to acquire a stem-loop hairpin conformation.
  • the stem-loop conformation comprises a 3 Or 5' overhang of 0, 1, 2, 3, 4 or 5 nucleotides.
  • the first stem region hybridizes to the second stem region with a melting temperature that is at least 30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C or 45 °C.
  • the first stem region hybridizes to the second stem region with a melting temperature that is no greater than 71 °C, 70 °C, 69 °C, 68 °C, 67 °C, 66 °C, 65 °C, 64 °C, 63 °C, 62 °C, 61 °C, 60 °C, 59 °C, 58 °C, 57 °C, 56 °C, 55 °C, 54 °C, 53 °C, 52 °C, 51 °C or 50 °C.
  • the first stem region hybridizes to the second stem region with a melting temperature that is between 40 °C and 71 °C, between 40 °C and 55 °C or between 45 °C and 55 °C. In some embodiments, the first stem region hybridizes to the second stem region with a melting temperature that is less than the annealing temperature of a nucleic acid amplification reaction (e.g., between 0 and 10 °C less than the annealing temperature, between 0 and 9 °C less than the annealing temperature, between 0 and 8 °C less than the annealing temperature, between 0 and 7 °C less than the annealing temperature, between 0 and 6 °C less than the annealing temperature or between 0 and 5 °C less than the annealing temperature).
  • a nucleic acid amplification reaction e.g., between 0 and 10 °C less than the annealing temperature, between 0 and 9 °C less than the annealing
  • the mispriming prevention reagents described herein include a G/C clamp at one or both ends of the stem regions.
  • the most 3 ' nucleic acid of the first stem nucleic acid sequence is cytosine and the most 5' nucleic acid of the second stem nucleic acid sequence is guanine.
  • the most 3 ' nucleic acid of the first stem nucleic acid sequence is guanine and the most 5' nucleic acid of the second stem nucleic acid sequence is a cytosine.
  • the most 5 ' nucleic acid of the first stem nucleic acid sequence is cytosine and the most 3 ' nucleic acid of the second stem nucleic acid sequence is guanine. In some embodiments, the most 5' nucleic acid of the first stem nucleic acid sequence is guanine and the most 3 ' nucleic acid of the second stem nucleic acid sequence is a cytosine.
  • the reagent does not fluoresce when present in an
  • the reagent does not fluoresce because is not stimulated with an appropriate excitation wavelength. In some embodiments, the reagent does not fluoresce because it does not comprise a fluorescent moiety. In some embodiments, the 3 ' terminal moiety and/or the 5 ' terminal moiety is a quencher of electromagnetic energy, including fluorescent light released from a fluorescent DNA-binding dye, such as SYBR Green, that intercalates into the stem of the closed-hairpin.
  • a fluorescent DNA-binding dye such as SYBR Green
  • a multi-stranded mispriming prevention reagent comprising at least two non-identical 5' or 3 ' terminal moieties.
  • the multi-stranded mispriming prevention reagent is a double-stranded mispriming prevention reagent.
  • the multi-stranded mispriming prevention reagent comprises a first nucleic acid strand of and a second nucleic acid strand.
  • the first and/or second nucleic acid strand of at least 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25,26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.
  • the first and/or second nucleic acid strand is between 18 and 24 nucleotides in length.
  • the first and/or second nucleic acid strand is between 20 and 22 nucleotides in length.
  • the first and/or second nucleic acid strand is 21nucleotides in length. In some embodiments, the first and second strand are the same length. In some embodiments, the first and second strand are different lengths. In some embodiments, the first nucleic acid strand hybridizes to the second nucleic acid strand with a melting temperature that is no less than 25 °C, 30 °C, 32 °C, 35 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C, 45 °C, 46 °C, 47 °C, 48 °C, 49 °C or 50 °C. In some
  • the first nucleic acid strand hybridizes to the second nucleic acid strand with a melting temperature that is no greater than 77 °C, 76 °C, 75 °C, 74 °C, 73 °C, 72 °C, 71 °C, 70 °C, 69 °C, 68 °C, 67 °C, 66 °C, 65 °C, 64 °C, 63 °C, 62 °C, 61 °C or 60 °C.
  • first and second nucleic acid strand collectively comprise at least two non-identical 5' or 3 ' terminal moieties (e.g., 2, 3 or 4 terminal moieties).
  • the at least two non-identical moieties are selected from dabcyl moieties, Black Hole Quencher moieties and coumarin moieties.
  • the at least two non-identical moieties comprise a dabcyl moiety and a coumarin moiety (e.g., Coumarin 39, Coumarin 47 and Biosearch Blue).
  • one of the non-identical moieties is located at the 5' terminus of the first nucleic acid strand and one of the non- identical moieties is located at the 3 ' terminus of the second nucleic acid strand. In some embodiments, one of the non-identical moieties is located at the 3' terminus of the first nucleic acid strand and one of the non-identical moieties is located at the 5' terminus of the second nucleic acid strand. In some embodiments, a dabcyl moiety is located at the 5' terminus of the first nucleic acid strand and a Biosearch Blue moiety is located at the 3' terminus of the second nucleic acid strand.
  • a Biosearch Blue moiety is located at the 5' terminus of the first nucleic acid strand and a dabcyl moiety is located at the 3' terminus of the second nucleic acid strand.
  • a coumarin moiety is located at the 3' terminus of the first strand and the 3' terminus of the second strand and a Biosearch Blue moiety is located at the 5' terminus of the second strand.
  • a carbon spacer is located at the 5' terminus of the first strand.
  • the non-identical terminal moieties are linked (either directly or indirectly) to the most 3' or the most 5' nucleotide of the first or second nucleic acid strand.
  • the non-identical terminal moieties are linked (either directly or indirectly) to one of the 2, 3, 4, or 5 most 3' or most 5' nucleotides of the first or second nucleic acid strand.
  • the mispriming prevention reagent is an oligonucleotide that has a 3' end and a stem-loop structure having a stem comprising a double-stranded region that has a length greater than six nucleotides and a terminus away from the loop comprising a 3' nucleotide and a 5' nucleotide, the stem having a calculated stem melting temperature (Tm) below 94° C.
  • Tm stem melting temperature
  • the 3' end is non-extensible by the DNA polymerase.
  • the oligonucleotide is not fluorescently labeled and does not contribute background fluorescence.
  • the stem terminus is stabilized by means selected from the group consisting of non-fluorescent fluorophore- quenching moieties covalently attached to the 3' and 5' nucleotides of the stem terminus and pairs of non-natural nucleotides that bind more strongly than a natural DNA-DNA hybrid and that include each of the 3' and 5' nucleotides of the stem terminus.
  • PrimeSafe or ThermaStop are added to reverse transcription reactions and PCR in order to inhibit enzyme activity until the temperature is increased to the desired reaction temperature.
  • versions of ThermaStop for reverse transcriptase include RNA nucleotides or RNA analogs, such as 2'-0-methyl RNA which are likely to have higher affinity for reverse transcriptase (an RNA-dependent DNA polymerase).
  • a two-step RT-PCR may also include a ThermaStop version with only DNA nucleotides that will have higher affinity to the DNA-dependent DNA polymerase (e.g. Taq polymerase).
  • both types of ThermaStop are included in a one-step RT-PCR. In such cases, it is necessary that both enzymes be inactive at
  • ThermaStop inhibiting reverse transcriptase at low temperatures is no longer inhibitory (or at least only partially inhibitory) at the temperature of the reverse transcription step (e.g. 40 °C, or 45 °C, or 50 °C).
  • This can be accomplished using a first version of ThermaStop that includes RNA nucleotides in a stem-loop structure with a T m below that temperature.
  • the DNA polymerase should remain inhibited by a second version of ThermaStop with DNA nucleotides in a stem-loop structure with a T m at least 5 degrees higher, preferably at least 10 degrees higher than that of the first ThermaStop.
  • transcriptase by the second ThermaStop during the reverse transcription step is possible, but desired cDNA production can be accomplished by increasing the duration of the reverse transcription step and/or by adjusting the concentrations of both ThermaStops.
  • Example 1 The use of primers with very high melting temperature (T m ) improves two-step RT-LATE-PCR amplification of a synthetic viroid RNA.
  • a synthetic double-stranded DNA having the following positive strand sequence was custom synthesized by Integrated DNA technologies (Coralville, Iowa, USA) The sequence shown below is comprised of a 17 promoter (underlined) followed by a DNA sequence analogous to CCCVd RNA.
  • RNA transcript was generated from the synthetic DNA using Hi ScribeTM T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions.
  • Reverse transcription was done using one of the following antisense primers: OPV9-A32 (Lim) 5' ⁇ TTCTGCAGTAGTTTTTGGGGTGCCCTGTAGAT-3' or
  • OPV9-A40 (Lim) 5'-TTGGCCTCTCCTGCAGTAGTTTTTGGGGTGCCCTGTAGAT-3'
  • the 30 nucleotides at the 3' end of these primers are identical, but the A40 primer has additional nucleotides at the 5' end.
  • Each primer is complementary to the CCCVd sequence, except for the two T nucleotides at the 5' end (shown in bold) which were included to improve LATE-PCR amplification.
  • the predicted T m of the shorter (A32) primer to the RNA target is 86.3°C at a primer concentration of 1 ⁇ (the concentration during the preincubation) and is 75.8°C to the fully complementary DNA sequence at a primer
  • the predicted T m of the longer (A40) primer to the RNA target is 91.0 °C and 80.2°C to the fully complementary DNA. All other conditions of the RT and LATE-PCR steps are identical, so differences in results between samples with the different primers are likely due to differences in the ability of the antisense primers to hybridize with the highly folded RNA target during the RT step. All primers and probes described in the examples were custom synthesized by BioSearch Technologies (Petaluma, CA, USA).
  • Synthetic viroid RNA was pre-incubated with 1 ⁇ antisense primers and 0.2 ⁇ ]/ ⁇ , RNase Inhibitor (Clontech laboratories, Mountain View, CA, USA) in IX PrimeScript buffer (75 mM potassium chloride, 3 mM magnesium chloride, 50 mM TRIS, pH 8.3. (Clontech Laboratories) at 85 °C for 3 minutes, then 60 °C for 10 minutes to enhance hybridization.
  • the pre-incubation mixes then were cooled to 25 °C and kept on ice until diluted with an equal volume of reverse transcription mix to achieve concentrations of 500 nM antisense primer, 400nM dNTPs, 1 ⁇ Reagent 1, 1 lJ/ ⁇ L ⁇ RNase Inhibitor (Clontech laboratories), 1 U/ ⁇ PrimeScript Reverse Transcriptase (Clontech Laboratories) and IX PrimeScript buffer. Control samples without Reverse Transcriptase were run in parallel to monitor for amplification from any residual synthetic viroid DNA. All samples were incubated at 50 °C for 5 minutes, 85 °C for 5', then cooled to 25 °C.
  • Two ⁇ _, of the RT sample was diluted with 18 ⁇ _, of a LATE-PCR reagent mix to obtain the final concentrations of 50 nM antisense primer, 1 ⁇ sense primer OPV191-S24 (5'-TTGGGAGACTACCCGGTGGATACA-3'), 250 nM hybridization probe OPV-ntl97- A20 (5' ⁇ CalRed610-ATGTAAGAGCCGCGTGAGAT -Black Hole Quencher2 (BHQ2)-3*, 400nM dNTPs, 0.25X SYBR Green 1 ⁇ Reagent 1, 0.06 ⁇ ]/ ⁇ , Invitrogen Taq DNA Polymerase (ThermoFisher Scientific), 3mM MgCl 2 , and IX Reaction Buffer (ThermoFisher Scientific).
  • Real-time SYBR Green fluorescence data was analyzed using the adaptive baseline setting of the Stratagene software. Cal Red fluorescence data was exported to Microsoft Excel and was normalized using the fluorescence at 75 °C, a temperature at which there is no detectable hybridization of probe and viroid amplification product.
  • Each of the 4 replicate samples at both RNA concentrations had a SYBR Green melt peak at approximately 85 °C, corresponding to the viroid-specific amplicon (inset in Figure 1, Part A), but 2 samples in the 100 copy group had a relatively small peak at 85 °C and a much larger non-specific product peak at approximately 80 °C.
  • One of four samples processed without reverse transcriptase ("no RT") and two of four samples without RNA (NTC) showed SYBR Green fluorescence increase with CT values in the 35 to 37 cycle range, but SYBR Green melt analysis showed only non-specific product peaks around 80 °C.
  • the viroid sequence-specific probe fluorescence during the post-PCR melt confirmed the reverse transcription and amplification of the synthetic viroid RNA target.
  • Samples with the lower-Tm antisense primer showed fluorescence signal above background in all samples with RNA and reverse transcription, but 3 of the 4 samples with 100 RNA copies showed relatively low fluorescence signal ( Figure 1, Part C).
  • All samples with RNA targets and reverse transcriptase and the higher-Tm antisense primer generated strong fluorescence signal ( Figure 1, Part D).
  • the expected T m of the probe - amplicon hybrid of about 62°C was confirmed in the derivative plots (insets). None of the RT or NTC samples generated detectable probe fluorescence above background.
  • Plant nad5 trans-spliced mitochondrial gene provides an RNA-specifw internal control that could be used in RT-PCR tests for the detection of plant pathogens.
  • RNA pathogen e.g., virus and viroid
  • Verifying adequate RNA isolation, reverse transcription, and amplification is required in RNA pathogen (e.g., virus and viroid) detection tests to insure against false negative results.
  • a host species gene is amplified to confirm the quality of these steps. It is customary that such control genes include a region that includes an intron, a transcribed segment that is removed from the final messenger RNA.
  • control genes include a region that includes an intron, a transcribed segment that is removed from the final messenger RNA.
  • the sense primer is complementary to a site in exon 2 and the antisense primer is complementary to a site in exon 4.
  • exons are separated by more than 33,000 nucleotides in the date palm mitochondrial genome (GenBank Accession number NC016740). (The size and organization of this gene is presumed to be similar in other palms, as the gene is highly conserved among plants.)
  • Exon 3 is only 21 nucleotides in length and is encoded on the opposite DNA strand over 70,000 nucleotides away from exon 2. Generating the final mRNA requires joining separate transcripts from those regions.
  • the primers used in this example produce an amplicon of about 150 nucleotides from the mRNA, but cannot amplify the gene from DNA using typical PCR protocols because of the large distance between primer hybridization sites.
  • RNA concentrations were measured using the Nanodrop instrument.
  • A38 (5'-TTAGGTATTAGTTTTGTAATGGTTGGAGCAGCAAACTC-3') and 0.2 ⁇ / ⁇ .
  • RNase Inhibitor in IX PrimeScript buffer at 85 °C for 3 minutes, then 60 °C for 10 minutes, then cooled to 25 °C and diluted 10 fold with an RT-LATE-PCR reagent mix to obtain the final concentrations of 100 nM antisense primer, 1 ⁇ sense primer NAD5X2-I213-S25, (5'-CTCGGGAGTCTCTTTGTAGGATACT-3'), 250 nM probe NAD5x4-24-A16 (CR)
  • a smaller peak at 41°C was also present and may be due to a splicing variant (the probe hybridizes near the 5' end of the exon 4 sequence), nucleotide modification of the transcript ⁇ e.g., C to U RNA editing), or to an artifact of PCR amplification.
  • the lack of any probe signal from samples without reverse transcriptase demonstrates the absence of any DNA contamination in the palm RNA sample and/or the inability of the primers to generate the extremely long product using this PCR protocol.
  • this control could be useful not only for verifying the quality of a test for detecting infectious agents, but also for quantifying relative levels of that agent by comparing real-time C T values in separate reactions, or by comparing the real-time SYBR signal of the control to the quantitative probe signal from the infectious agent. It should be possible to obtain quantitative nad5 probe signals at end point if the probe concentration is increased, the number of cycles decreased, and/or the efficiency of the nad5 amplification reduced ⁇ e.g., by reducing the concentration and/or T m of one or both primers).
  • Extracts were diluted by a factor of 10, 100, or 1,000 in 10 mM TRIS, pH 8.3, and added to a pre-incubation mix containing antisense primer NAD5x4-63-A38, 0.2 ⁇ ]/ ⁇ , RNase Inhibitor in IX PrimeScript buffer. Samples were heated at 85 °C for 3 minutes, then 60 °C for 10 minutes, then cooled to 25 °C and diluted 10 fold with an RT-LATE-PCR reagent mix to obtain the final reagent concentrations as the in the previous example, except that some samples did not contain PVP in the RT-LATE-PCR reagent mix. The RT incubation, denaturation, thermal cycling, and post-PCR melting were done as described in that experiment.
  • Figures 3 A and 3B show the real-time SYBR Green fluorescence plots of nad5 amplification from the PrimeStore-prepared plant nucleic acid and from 50 ng of total coconut palm RNA purified as described in the previous example.
  • Samples in (A) have no added PVP during RT-PCR; samples in (B) contain 1.5% PVP.
  • Final fluorescence was reduced and C T values were higher than expected in the PrimeStoreTM 1/10 dilution samples relative to other dilutions, although the fluorescence reduction was less in samples with PVP.
  • Figure 3 Parts C and D show the nad5 probe fluorescence derivative plots for the same samples without PVP (C) and with PVP (D).
  • Replicates of the PrimeStoreTM 1/10 dilution without PVP had relatively low fluorescence from the nad5-specific probe, confirming the inhibition of specific product amplification and/or fluorescence detection. All other PrimeStoreTM and purified RNA samples without PVP had strong fluorescence from the nad5-specific probe.
  • Replicates of the PrimeStoreTM 1/10 dilution with PVP had fluorescence from the nad5-specific probe at nearly the level observed with higher
  • PrimeStoreTM dilutions and purified RNA were obtained from the plant or from the PrimeStoreTM itself, but that the presence of 1.5% PVP can at least partially overcome that inhibition.
  • No nad5-specific probe fluorescence was observed above background in control samples without reverse transcriptase or without RNA, confirming that all SYBR Green fluorescence increase in those samples was due to non-specific amplification. That result also confirms the inability of the nad5 primers to amplify coconut palm DNA, which is present in the PrimeStoreTM samples.
  • the synthetic viroid RNA, coconut palm RNA, and the primers and probes described in the previous examples can be combined in a single tube for RT-LATE-PCR.
  • This example shows that the plant gene can serve as a control for reverse transcription and amplification in a detection assay for viroid RNAs.
  • the relative probe signal levels for the viroid and control gene provide a means to quantify the level of viroid RNA in the plant.
  • Figure 4 shows the probe fluorescence derivative plot averages for each replicate group from the post-PCR melt.
  • the nad5 probe melt peak at 50 °C and the viroid probe melt peak at 65 °C were detected in all samples with both RNAs.
  • the mean height of the nad5 probe melt peak was similar for each replicate group, including those without synthetic viroid RNA, indicating that co-amplification of the viroid sequence did not interfere with nad5 amplification.
  • the mean height of the viroid probe peak (above the mean NTC background) was related to the number of RNA transcripts in the sample.
  • Figure 5 shows a quantification curve based on the ratio of nad5 peak height to viroid peak height in individual samples. Those knowledgeable in the art would recognize that the area under these peaks could also be used for estimating RNA copy number. Thus, it should be possible to estimate the relative levels of viroid infection in different plants or in different regions of an individual plant.
  • Example 5 High pre-incubation temperatures improve RT-LATE-PCR detection of synthetic viroid RNA in an assay with plant nad5 internal control.
  • RNA molecules including ribosomal RNA, GC-rich mRNAs, RNA virus non- coding regions, viroids and other circular RNAs have stable secondary structure due to the high stability of RNA to RNA nucleotide interactions. This secondary structure, although dynamic, can slow or prevent the hybridization of the antisense primer at temperatures typically used with reverse transcriptase. This experiment tests the effects of pre-incubating the RNA and antisense primer at different temperatures prior to the reverse transcription step.
  • PrimeStoreTM preparation of coconut palm nucleic acid plus either 1,000 or 10,000 copies of synthetic viroid RNA were mixed with 1 ⁇ antisense primer NAD5x4-63-A38, 1 ⁇ antisense primer OPV9-A40, 0.2 RNase Inhibitor, and 500 ng Extreme Thermostable Single Strand Binding Protein (New England Biolabs) in IX PrimeScript buffer. Three aliquots were prepared for each RNA mixture. One set of aliquots was kept on ice and not heated prior to the addition of the RT-PCR mix. A second set of aliquots was heated to 65 °C for 3 minutes, then 60 °C for 10 minutes.
  • the third set of aliquots was heated to 85 °C for 3 minutes, then 60 °C for 10 minutes.
  • the RT-LATE-PCR reagent mix, the RT-LATE-PCR incubations and cycling, and the post-PCR melt programs were as described in that example.
  • Figure 6 shows the combined nad5 probe and viroid probe fluorescence derivative plot from post-PCR melting analysis following pre-incubation on ice (A), at 65 °C (B), or 85 °C (C).
  • the nad5 probe melt peak height from purified plant RNA, or from the PrimeStoreTM samples was largely unaffected by differences in the pre-incubation temperature.
  • detection of the viroid probe melt peak at 65 °C varied depending on the pre-incubation temperature. Following pre-incubation on ice there was no viroid probe melt peak in any of the samples containing synthetic viroid.
  • a viroid probe melt peak was detected in 2 of 3 replicates containing 10,000 copies of the viroid RNA, but none of the samples containing 1,000 copies of the viroid RNA.
  • a viroid melt peak was detected in all 3 replicates containing 10,000 copies of the viroid RNA and 2 of 3 samples containing 1,000 copies of the viroid RNA.
  • the 50 °C temperature of the reverse transcription step is not sufficiently high to enable primer hybridization, for samples pre-incubated on ice.
  • a temperature of 65 °C enables hybridization of the primer to at least some of the viroid RNA molecules.
  • Some fraction of the viroid RNA molecules may be single-stranded at the site of primer hybridization at that temperature. Since intramolecular hybridization (secondary structure formation) is a dynamic process, increasing the duration of the incubation at 65 °C is likely to result in additional primer hybridization and improved detection in subsequent RT-PCR results.
  • Example 6 Pre-incubation and RT-LATE-PCR of CCCVd using a 2'O-methyl RNA opener and random hexamers.
  • RNA was isolated from the leaves of oil palm plants that had symptoms of infection by CCCVd.
  • the RNA was extracted using a combination of TRIzol reagent (ThermoFisher Scientific) and Chloroform, followed by purification with miRNeasy Mini Kit (Qiagen) according to the manufacturer's recommendations.
  • the precipitated RNA was resuspended in RNase-free water and stored at -80 °C. Upon initial thaw, the sample was diluted 10 fold in The RNA Storage Solution (ThermoFisher Scientific), containing 1 ⁇ / ⁇ . RNase inhibitor.
  • the opener is fully complementary to nucleotides 124 through 151 of the viroid. Those viroid nucleotides are partially complementary with nucleotides 121 through 94 in the viroid and are hybridized with those nucleotides in predicted secondary structures. Hybridization of the opener to the viroid RNA should allow primers to access to that latter segment of RNA nucleotides.
  • the pre-incubation mix was heated at 75 °C for 3 minutes, 70 °C for 3 minutes, 65 °C for 5 minutes, then 60 °C for 30 minutes, cooled to room
  • Each LATE-PCR sample included 2 ⁇ ⁇ of the reverse transcription sample diluted into 18 ⁇ ⁇ of a reagent mix to obtain final concentrations of 50 nM antisense primer OPV91- A25 (5' ⁇ TTCGCACGATCGACCCAGGTACGCT ⁇ 3*), 1 ⁇ sense primer OPV16-S30t (5'-TCTTTGTAGCCTCTCTGGGGAAATCTACAG-3), 50 nM probe OPV-nt31-A26 (5 , -Quasar670-AAGCCTCTCCTGCAGTAGTTTTTGTT-BHQ2-3*), 400 nM dNTPs, 0.24X SYBR Green, and 0.06 ⁇ / ⁇ Platinum Tfi DNA polymerase (exo-) (ThermoFisher
  • ThermaStop-RT a modified oligonucleotide that includes 2'-0-methyl RNA nucleotides at each end of the molecule (shown as mA, mC, mG, and mU in the sequences below).
  • ThermaStop-RT greatly reduces activity of reverse transcriptase at room temperature, thereby providing a hot-start for the RT step and greatly reducing non-specific amplification in the subsequent PCR.
  • RNA with the CCCVd sequence was transcribed in vitro as described above and stored at -80 °C. An aliquot of the RNA was thawed and serially diluted using 10 mM TRIS, pH 8.0 containing 1 unit/microliter RNase Inhibitor (Takara). Samples of RNA at each dilution were mixed with 500 nM primer OPV9-A40, 50 ng/microliter Extreme
  • Thermostable Single-Stranded DNA Binding Protein (ET-SSB, New England Biolabs), and 2 units/microliter RNase Inhibitor in IX First Strand Buffer (Superscript III First-Strand Synthesis System, ThermoFisher Scientific) and were incubated 3 minutes at 85 °C, 10 minutes at 65 °C, then cooled to 25 °C.
  • the pre-incubation mixes were then diluted with an equal volume of an RT reagent mixture to obtain final concentrations of 250 nM primer OPV9-A20, 5,000 nM primer OPV-184 S24, 25 ng/microliter ET-SSB, 1 unit/microliter RNase Inhibitor, 0.4 mM each dNTP, 4 micromolar ThermaStop-RT (5'- Black Hole Quencher 1 - mUmAmAmUmAmGmUmGmUmACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC CmUmGmUmAmUmUmAmUmUmA-Biosearch Blue - 3'), and 2.5 units/microliter
  • °C. RT samples were then diluted 1 :4 with a PCR reagent mixture containing 0.4 mM dNTP, 0.3X SYBR Green, 1.25 micromolar ThermaStop DBB (5 * - Dabcyl - GAATAATATAGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTATATTC - Biosearch Blue -3'), 625 iiM probe OPV ntl97-A20 Cal Red, 3 mM magnesium chloride, and 0.075 units/microliter Invitrogen Taq Polymerase in I X Invitrogen PGR buffer.
  • Four PGR replicate samples of 20 microliters were prepared from each RT sample.
  • PGR cycling and post-PCR melting were done using a Stratagene Mx3005P.
  • the thermal profile included 95 °C for 2 minutes, followed by 50 cycles of 95 C C for 10 seconds, 68°C for 10 seconds, and 72°C for 35 seconds with fluorescence detection during the 72°C step.
  • Samples were cooled at a rate of approximately 4°C per minute to 30 °C, held for 2 minutes at 30 °C, and melted in 0.5 °C increments to a final temperature of 95 °C.
  • Each melt step was 35 seconds in duration to enable 3 fluorescent endpoint detections for SYBR Green and Cal Red. Real- time SYBR Green fluorescence was analyzed using the adaptive baseline settings of the Mx3005P software.
  • Example 8 ThermaStop-RT reduces non-specific amplification and improves duple RT- LATE ⁇ PCR of CCCVd and nadS transcripts from coconut palm RNA.
  • ThermaStop-RT described in the previous example is a variation of ThermaStop, a reagent designed to interact with DNA polymerase and thereby provide a hot-start for PGR.
  • ThermaStop-RT is designed to have a higher affinity with reverse transcriptase, greatly reducing the activity of the enzyme at low temperatures (e.g., 0 °C, 4°C, 18°C, 25 °C), but not at temperatures used for reverse transcription (e.g., 40 °C, 45 °C, 50 °C, 55 °C, 60 C C), thereby providing a hot-start for RT-PCR.
  • This experiment demonstrates the improvement in RT-LATE-PCR results using a hot start for reverse transcription. It also demonstrates that two distinct RNA. targets can be quantified following a duplex reverse transcription followed by LATE-PCR, even when those targets vary in concentration by several orders of magnitude.
  • Primer nad5x4-63-A38 and primer nad5x2-1213-S25 were included in the RT mixtures at concentrations of 250 nM and 5,000 nM, respectively.
  • Two RT mixtures were prepared, one containing 4 micromolar ThermaStop-RT and the other without that reagent.
  • RNA isolated from coconut palm using the same 10 "2 dilution for all samples) and serial dilutions of synthetic CCCVd RNA (prepared by in vitro transcription) were mixed directly with the RT mixtures without a pre-incubation step and were incubated at 50 °C for 30 minutes, then 95 °C for 2 minutes, then cooled to 25 °C.
  • the PCR reagent mixture was similar to that used in the previous example, but also included 625 nM probe nad5x4-24-A16-Cal Red. It should be noted that all samples included ThermaStop DBB during PCR to provide hot start for DNA polymerase. Thermal cycling and melt profiles were identical to those of the previous example.
  • SYBR Green dye binds double-stranded DNA from both of the specific products and from non-specific amplification and therefore could not be used to quantify individual targets.
  • RT-LATE-PCR generates single-stranded DNA from each of the targeted RNA sequences and the relative quantities of a product can be measured using sequence-specific probes during post-PCR melting analysis. Both probes used in this experiment are labeled with a Cal Red fluorophore, but can be distinguished by melting temperature; the CCCVd probe melting at 61°C, and the nad5 probe melting at 50 °C. All samples had the same initial concentration of coconut palm RNA and generated a nad5 probe melt peak at 50 °C.
  • the mean peak height (relative to a baseline from samples without reverse transcriptase) was 342 units with a standard deviation of 36 units for the 28 samples with ThermaStop.
  • the mean peak height was 283 units with a standard deviation of 39 units for the 28 samples without ThermaStop-RT.
  • the difference is extremely statistically significant (P ⁇ 0.0001) and the lower mean quantity of the nad5 amplicon in samples without ThermaStop-RT is likely due to an increased synthesis of non-specific cDNA formed during the RT step.
  • Figure 9 shows the mean derivative peak height of the CCCVd probe for samples either with or without ThermaStop-RT and CCCVd RNA at dilutions of 10 "6 to 10 "11 .
  • the peak heights were roughly proportional to the logarithm of the initial concentration of CCCVd RNA.
  • Samples with dilutions of 10 " to 10 " showed higher mean peak values for samples with ThermaStop-RT compared to samples without ThermaStop-RT. The difference became greater as the initial RNA concentration decreased.
  • 10 "11 only 2 of 4 samples with ThermaStop and none of the 4 samples without ThermaStop had a detectable melt peak above baseline.
  • concentrations of multiple targets even when that concentration may differ by several orders of magnitude. This is not possible using with symmetric RT-PCR (primer pairs at the same concentration), as amplification of the more abundant target generates large quantities of double-stranded DNA that inhibit further amplification and interfere with the detection of the less abundant target.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés et des compositions permettant d'amplifier des acides nucléiques du CCCVd.
PCT/US2016/063059 2015-11-20 2016-11-21 Amplification et détection de l'arn du viroïde cadang-cadang du cocotier (cccvd) WO2017087943A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562258197P 2015-11-20 2015-11-20
US62/258,197 2015-11-20

Publications (1)

Publication Number Publication Date
WO2017087943A1 true WO2017087943A1 (fr) 2017-05-26

Family

ID=57530842

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2016/063056 WO2017087942A1 (fr) 2015-11-20 2016-11-21 Amplification et détection de séquendes d'arn et d'adn comprenant des niveaux élevés d'hybridation intramoléculaire
PCT/US2016/063059 WO2017087943A1 (fr) 2015-11-20 2016-11-21 Amplification et détection de l'arn du viroïde cadang-cadang du cocotier (cccvd)

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2016/063056 WO2017087942A1 (fr) 2015-11-20 2016-11-21 Amplification et détection de séquendes d'arn et d'adn comprenant des niveaux élevés d'hybridation intramoléculaire

Country Status (1)

Country Link
WO (2) WO2017087942A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111876467A (zh) * 2020-08-04 2020-11-03 深圳柏悦基因科技有限公司 病毒保存液、试剂盒以及病毒rna的超灵敏检测方法

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US5234809A (en) 1989-03-23 1993-08-10 Akzo N.V. Process for isolating nucleic acid
US5691299A (en) 1994-12-08 1997-11-25 Henkel Corporation Anionic detergent mixtures
US6210931B1 (en) * 1998-11-30 2001-04-03 The United States Of America As Represented By The Secretary Of Agriculture Ribozyme-mediated synthesis of circular RNA
WO2003054233A1 (fr) 2001-12-19 2003-07-03 Brandeis University Pcr tardif
CN1600865A (zh) * 2003-09-23 2005-03-30 北京金长河科技发展有限公司 一种植物病毒检测基因芯片
US20060177841A1 (en) 2004-10-18 2006-08-10 Wangh Lawrence J Primers, probes and methods for nucleic acid amplification
US7517922B2 (en) 2001-10-30 2009-04-14 Wyman Ransome J Roadway repair and maintenance
US9212399B2 (en) 2007-10-01 2015-12-15 Longhorn Vaccines And Diagnostics, Llc Biological specimen collection and transport system and method of use
WO2016100335A1 (fr) 2014-12-19 2016-06-23 Brandeis University Réactifs de prévention du mésamorçage

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2198059B1 (fr) * 2007-10-09 2014-12-03 Igor Vassily Kutyavin Procédés permettant la détection améliorée de petites molécules d'arn

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US5234809A (en) 1989-03-23 1993-08-10 Akzo N.V. Process for isolating nucleic acid
US5691299A (en) 1994-12-08 1997-11-25 Henkel Corporation Anionic detergent mixtures
US6210931B1 (en) * 1998-11-30 2001-04-03 The United States Of America As Represented By The Secretary Of Agriculture Ribozyme-mediated synthesis of circular RNA
US7517922B2 (en) 2001-10-30 2009-04-14 Wyman Ransome J Roadway repair and maintenance
WO2003054233A1 (fr) 2001-12-19 2003-07-03 Brandeis University Pcr tardif
EP1468114A1 (fr) 2001-12-19 2004-10-20 Brandeis University Pcr tardif
US8367325B2 (en) 2001-12-19 2013-02-05 Brandeis University Late-PCR
US7198897B2 (en) 2001-12-19 2007-04-03 Brandeis University Late-PCR
CN1600865A (zh) * 2003-09-23 2005-03-30 北京金长河科技发展有限公司 一种植物病毒检测基因芯片
EP1805199A2 (fr) 2004-10-18 2007-07-11 Brandeis University Amorces, sondes et procedes d'amplification d'acides nucleiques
US20060177841A1 (en) 2004-10-18 2006-08-10 Wangh Lawrence J Primers, probes and methods for nucleic acid amplification
US9212399B2 (en) 2007-10-01 2015-12-15 Longhorn Vaccines And Diagnostics, Llc Biological specimen collection and transport system and method of use
WO2016100335A1 (fr) 2014-12-19 2016-06-23 Brandeis University Réactifs de prévention du mésamorçage

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ALLAWI, H.T.; SANTA LUCIA, J., BIOCHEM., vol. 36, 1997, pages 10581 - 10594
BEAUCAGE ET AL., TETRAHEDRON LETT., vol. 22, 1981, pages 1859 - 1862
BROWN ET AL., METH ENZYMOL., vol. 68, 1979, pages 109 - 151
K.E. PIERCE ET AL: "Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus", JOURNAL OF APPLIED MICROBIOLOGY, 1 December 2009 (2009-12-01), pages no - no, XP055100866, ISSN: 1364-5072, DOI: 10.1111/j.1365-2672.2009.04640.x *
LE NOVERE, N.: "MELTING, Computing the Melting Temperature of Nucleic Acid Duplex", BIOINFORMATICS, vol. 17, 2001, pages 1226 7
MARRAS, S.A. ET AL.: "Multiplex Detection of Single-Nucleotide Variations Using Molecular Beacons", GENET. ANAL., vol. 14, 1999, pages 151 - 156, XP004158697, DOI: doi:10.1016/S1050-3862(98)00018-7
MATTEUCCI ET AL., JAM CHEM SOC., vol. 103, 1981, pages 3185 - 3191
NARANG ET AL., METH ENZYMOL., vol. 68, 1979, pages 90 - 99
PIERCE ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 102, 2005, pages 8609 - 8614
PIERCE ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 102, no. 24, 2005, pages 8609 - 8614
PIERCE, K.E. ET AL.: "Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus", J APPL MICROBIOL, vol. 109, 2010, pages 180 - 9
PIERCE, K.E.; WANGH, L.W.: "Rapid detection and identification of hepatitis C virus (HCV) sequences using mismatch-tolerant hybridization probes: A general method for analysis of sequence variation", BIOTECHNIQUES, vol. 55, 2013, pages 125 - 32, XP055225161, DOI: doi:10.2144/000114076
SANCHEZ ET AL., BMC BIOTECHNOLOGY, vol. 6, no. 44, 2006, pages 1 - 14
SANCHEZ ET AL., PROC. NAT. ACAD. SCI. (USA, vol. 101, 2004, pages 1933 - 1938
SANCHEZ ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 101, no. 7, pages 1933 - 1938
SANTA LUCIA, J., PNAS (USA, vol. 95, 1998, pages 1460 - 1465
SANTA LUCIA, PNAS (USA, vol. 95, 1998, pages 1460 - 1465
SATHIS SRI THANARAJOO ET AL: "Detection of Coconut cadang-cadang viroid (CCCVd) in oil palm by reverse transcription loop-mediated isothermal amplification (RT-LAMP)", JOURNAL OF VIROLOGICAL METHODS, vol. 202, 1 June 2014 (2014-06-01), NL, pages 19 - 23, XP055350814, ISSN: 0166-0934, DOI: 10.1016/j.jviromet.2014.02.024 *
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays"
VIROLOGY ET AL: "774 PHYTOPATHOLOGY Specific Identification of Coconut Tinangaja Viroid for Differential Field Diagnosis of Viroids in Coconut Palm", 1 August 1998 (1998-08-01), XP055350815, Retrieved from the Internet <URL:http://apsjournals.apsnet.org/doi/pdf/10.1094/PHYTO.1998.88.8.774> [retrieved on 20170301] *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111876467A (zh) * 2020-08-04 2020-11-03 深圳柏悦基因科技有限公司 病毒保存液、试剂盒以及病毒rna的超灵敏检测方法

Also Published As

Publication number Publication date
WO2017087942A1 (fr) 2017-05-26

Similar Documents

Publication Publication Date Title
US20210388430A1 (en) Compositions of toehold primer duplexes and methods of use
Kubota et al. FRET-based assimilating probe for sequence-specific real-time monitoring of loop-mediated isothermal amplification (LAMP)
EP2529026B1 (fr) Amplification par autorepliement d&#39;acide nucléique cible
US8435741B2 (en) Isothermal nucleic acid amplification method using surfactant
US20110117559A1 (en) Small rna detection assays
US20110151444A1 (en) Method for detection of an rna molecule, a kit and use related therefor
JP2013507910A (ja) 核酸試料から標的配列を増幅するための方法および組成物
US20180094309A1 (en) Nucleic acid retro-activated primers
JP2015037426A (ja) ライゲーションに基づく核酸の正規化した定量化方法
JP2013500707A (ja) アンカーオリゴヌクレオチドおよびアダプターオリゴヌクレオチドを用いる核酸の正規化した定量化方法
JP2015530113A (ja) マイクロｒｎａ多重アッセイのための２プライマーｐｃｒ
JP2015522292A (ja) 協働的プライマー、プローブ、およびそれらの用途
JP6181742B2 (ja) Ｈｅｖアッセイ
CA2930926A1 (fr) Inhibiteur oligonucleotidique ameliore de polymerases d&#39;adn
JP2024032995A (ja) 水痘帯状疱疹ウイルスを増幅または検出するための組成物および方法
JP2009131252A (ja) Ｒｎａの検出方法
WO2017087943A1 (fr) Amplification et détection de l&#39;arn du viroïde cadang-cadang du cocotier (cccvd)
JP2013509885A (ja) 熱安定性ポリメラーゼとともに二本鎖核酸複合体を用いてデオキシリボヌクレオチド鎖を合成するための組成物および方法
JP5546109B2 (ja) 核酸の塩基配列の識別方法
JP2022508954A (ja) ヒトポリオーマウイルスｂｋウイルスを増幅、検出または定量化するための組成物および方法
WO2011112947A1 (fr) Procédés et compositions comprenant des activateurs de polymérisation d&#39;acide nucléique
JPWO2020072409A5 (fr)
IL203074A (en) Chimeric primers for enhancing nucleic acid enhancement reactions

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16809262

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16809262

Country of ref document: EP

Kind code of ref document: A1