WO2017085233A1 - Virulence attenuated bacteria for treatment of malignant solid tumors - Google Patents

Virulence attenuated bacteria for treatment of malignant solid tumors Download PDF

Info

Publication number
WO2017085233A1
WO2017085233A1 PCT/EP2016/078084 EP2016078084W WO2017085233A1 WO 2017085233 A1 WO2017085233 A1 WO 2017085233A1 EP 2016078084 W EP2016078084 W EP 2016078084W WO 2017085233 A1 WO2017085233 A1 WO 2017085233A1
Authority
WO
WIPO (PCT)
Prior art keywords
bacterial strain
negative bacterial
proteins
protein
attenuated gram
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/078084
Other languages
English (en)
French (fr)
Inventor
Simon ITTIG
Marlise AMSTUTZ
Christoph Kasper
Guy R. Cornelis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitaet Basel
Original Assignee
Universitaet Basel
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR112018009753-5A priority Critical patent/BR112018009753B1/pt
Priority to ES16797930T priority patent/ES2880431T3/es
Priority to HK18115218.4A priority patent/HK1256137B/en
Priority to US15/773,524 priority patent/US11166987B2/en
Application filed by Universitaet Basel filed Critical Universitaet Basel
Priority to EP21170509.0A priority patent/EP3903813A1/en
Priority to EP16797930.1A priority patent/EP3377094B1/en
Priority to SI201631290T priority patent/SI3377094T1/sl
Priority to HRP20211191TT priority patent/HRP20211191T1/hr
Priority to SG11201803643TA priority patent/SG11201803643TA/en
Priority to CA3003563A priority patent/CA3003563A1/en
Priority to KR1020187016568A priority patent/KR102736981B1/ko
Priority to RS20210926A priority patent/RS62152B1/sr
Priority to JP2018526167A priority patent/JP7060503B2/ja
Priority to PL16797930T priority patent/PL3377094T3/pl
Priority to LTEP16797930.1T priority patent/LT3377094T/lt
Priority to SM20210423T priority patent/SMT202100423T1/it
Priority to IL259052A priority patent/IL259052B2/en
Priority to CN201680079454.XA priority patent/CN108472348B/zh
Priority to EA201890868A priority patent/EA201890868A1/ru
Priority to AU2016358257A priority patent/AU2016358257B2/en
Priority to BR122023024697-7A priority patent/BR122023024697A2/pt
Priority to DK16797930.1T priority patent/DK3377094T3/da
Publication of WO2017085233A1 publication Critical patent/WO2017085233A1/en
Anticipated expiration legal-status Critical
Priority to ZA2018/03902A priority patent/ZA201803902B/en
Priority to CY20211100666T priority patent/CY1124564T1/el
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0258Escherichia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0275Salmonella
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0291Yersinia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/104Pseudomonadales, e.g. Pseudomonas
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to recombinant virulence attenuated Gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject.
  • a major problem in treatment of malignant solid tumors is the delivery of therapeutic molecules to cancer cells in sufficient amounts, while reducing damage on non-related cells and tissue.
  • side effects like nausea and diarrhoea are massive.
  • angiogenesis inhibitors and immunotherapies have been exploited, including angiogenesis inhibitors and immunotherapies .
  • antibodies recognizing surface structures of tumor cells and, in an optimal case, selectively bind to tumor cells are used.
  • they can be conjugated to therapeutic agents or to lipid vesicles packed with drugs.
  • One of the challenges with such vesicles is the proper release of the active reagent.
  • Even more complex is the delivery of therapeutic proteins or peptides, especially when intracellular mechanisms are targeted.
  • Many alternative ways have been tried to solve the problem of delivering therapeutic proteins into eukaryotic cells, among which are "cell penetrating peptides" (CPP) or similar technologies as well as various nanoparticle-based methodologies.
  • CPP cell penetrating peptides
  • BCG Bacillus Calmette-Guerin
  • an optimal bacterial vehicle for targeted cancer therapy should provide high accumulation at the desired site of action while being minimally present at non-related sites.
  • the development of such a bacterial strain for the treatment of malignant solid tumors which is capable e.g. to deliver cargo produced inside bacteria to its site of action inside cancer cells, i.e. outside of bacteria, remains a major challenge.
  • the present invention relates to recombinant virulence attenuated Gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject.
  • the present invention provides recombinant virulence attenuated Gram-negative bacterial strains and the use thereof for treating a malignant solid tumor in a subject wherein the recombinant virulence attenuated Gram-negative bacterial strains allow the translocation of various type III effectors, but also of type IV effectors, of viral proteins and most importantly of functional eukaryotic proteins into cells of the malignant solid tumor.
  • the present invention relates to a recombinant virulence attenuated Gram- negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction: a promoter;
  • the method comprising administering to the subject said recombinant virulence attenuated Gram-negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to a method of treating a malignant solid tumor in a subjects, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor, comprising administering to the subject a recombinant virulence attenuated Gram-negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction:
  • the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to the use of a recombinant virulence attenuated Gram- negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction: a promoter;
  • the present invention relates to a recombinant virulence attenuated Gram- negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, for use in a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram- negative bacterial strain accumulates in the malignant solid tumor, the method comprising administering to the subject said recombinant virulence attenuated Gram-negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor, comprising administering to a subject a recombinant virulence attenuated Gram-negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, wherein the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to the use of a recombinant virulence attenuated Gram- negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, for the manufacture of a medicament for treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor.
  • a pharmaceutical composition comprising a recombinant virulence attenuated Gram-negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction:
  • the method comprising administering to the subject said pharmaceutical composition, wherein the pharmaceutical composition is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor, comprising administering to a subject a
  • composition comprising a recombinant virulence attenuated Gram-negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction:
  • a promoter a first DNA sequence encoding a delivery signal from a bacterial effector protein, operably linked to said promoter;
  • a second DNA sequence encoding a heterologous protein fused in frame to the 3 'end of said first DNA sequence, and a pharmaceutically acceatable carrier, wherein the pharmaceutical composition is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to the use of a pharmaceutical composition
  • a pharmaceutical composition comprising a recombinant virulence attenuated Gram-negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction:
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a recombinant virulence attenuated Gram-negative bacterial strain and a pharmaceutically acceptable carrier, wherein the recombinant virulence attenuated Gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, for use in a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor, the method comprising administering to the subject said pharmaceutical composition, wherein the pharmaceutical composition is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor, comprising administering to a subject a
  • composition comprising a recombinant virulence attenuated Gram-negative bacterial strain which is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, and a pharmaceutically acceatable carrier, wherein the pharmaceutical composition is administered in an amount that is sufficient to treat the subject.
  • the present invention relates to the use of a pharmaceutical composition
  • a pharmaceutical composition comprising a recombinant virulence attenuated Gram-negative bacterial strain which is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, and a pharmaceutically acceatable carrier, for the manufacture of a medicament for treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor.
  • Fig. 1 Characterization of T3SS protein delivery.
  • A Schematic representation of T3SS dependent protein secretion into the surrounding medium (in- vitro secretion)(left side) or into eukaryotic cells (right side).
  • I shows the type 3 secretion system.
  • II indicates proteins secreted into the surrounding medium, III proteins translocated through the membrane into the cytosol of eukaryotic cells (VII).
  • VI shows a stretch of the two bacterial membranes in which the T3SS is inserted and the bacterial cytosol underneath.
  • IV is a fusion protein attached to the YopEi_i38 N-terminal fragment (V)
  • B In-vitro secretion of I: Y. enterocolitica E40 wild type, II: Y.
  • enterocolitica ⁇ asd or III Y. enterocolitica ⁇ asd + pBadSi_2 as revealed by Western blotting on total bacterial lysates (IV) and precipitated culture supernatants (V) using an anti-YopE antibody.
  • Fig. 2 Characterization of T3SS protein delivery into epithelial cells.
  • A Anti-Myc immunofluorescence staining on HeLa cells infected at an MOI of 100 for 1 h with I: Y. enterocolitica ⁇ asd or II: Y. enterocolitica ⁇ asd + pBad_Si2.
  • Y-axis indicates anti-Myc staining intensity [arbitrary unit]
  • x-axis indicates time of infection in minutes
  • C Quantification of Anti-Myc immunofluorescence staining intensity within cells.
  • Y-axis indicates anti-Myc staining intensity [a.u.].
  • Fig. 3 Modifications of the T3SS based protein delivery allow nuclear localization of a Yo Ei.138 fusion protein (EGFP). EGFP signal in HeLa cells infected with I: Y.
  • EGFP Yo Ei.138 fusion protein
  • enterocolitica ⁇ asd or II Y. enterocolitica ⁇ asd
  • EGFP signal is shown in “a”, for localization comparison nuclei were stained in "b".
  • Fig. 4 Modifications of the T3SS based protein delivery allow removal of the YopEi.i 38 appendage.
  • HeLa cells are infected with two different Y. enterocolitica strains at the same time, which is reached by simple mixing of the two bacterial suspensions.
  • One strain is delivering the TEV protease fused to YopEi_i 38
  • the other strain delivers a protein of interest fused to YopEi_i3 8 with a linker containing a double TEV protease cleavage site.
  • the TEV protease After protein delivery into the eukaryotic cell, the TEV protease will cleave the YopEi_i3 8 appendage from the protein of interest (A) Digitonin lysed HeLa cells uninfected (II) or after infection (MOI of 100) for 2h with I: Y.
  • Fig. 5 Delivery of bacterial effector proteins into eukaryotic cells
  • A HeLa cells were infected with I: Y. enterocolitica ⁇ asd carrying II: pBad_Si2 or III: YopEi_i 3 8-SopE at an MOI of 100 for the time indicated above the images (2, 10 or 60 minutes). After fixation cells were stained for the actin cytoskeleton (B) HeLa cells were left uninfected (II) or infected with I: Y.
  • MOI 50; MOI50:MOI50 or MOI50:MOI100 the MOI indicated below the strain (MOI 50; MOI50:MOI50 or MOI50:MOI100) for lh.
  • fixation cells were stained for the actin cytoskeleton (shown in "a") and the presence of the YopEi_i 38 -SopE-Myc fusion protein was followed via staining anti-Myc (shown in "b").
  • Fig. 6 Delivery of bacterial effector proteins into eukaryotic cells (A) Phospho-p38 ("a"), total p38 ("b”) and actin ("c") western blot analysis on HeLa cells left untreated (II) or infected for 75 min with I: Y. enterocolitica ⁇ asd carrying III: pBad_Si2 or IV: YopEi_i 3 8-OspF at an MOI of 100.
  • A Phospho-p38 ("a"), total p38 ("b”) and actin (“c”) western blot analysis on HeLa cells left untreated (II) or infected for 75 min with I: Y. enterocolitica ⁇ asd carrying III: pBad_Si2 or IV: YopEi_i 3 8-OspF at an MOI of 100.
  • Statistical analysis was performed using an unpaired two-tailed t-test (ns indicates a non significant change, ** indicates a p value ⁇ 0.01, *** indicates a p value ⁇ 0.001).
  • Fig. 7 Delivery of human tBid into eukaryotic cells induces massive apoptosis.
  • A Cleaved Caspase 3 pl7 ("a") and actin ("b") western blot analysis on HeLa cells left untreated (II) or infected for 60 min with I: Y. enterocolitica ⁇ asd carrying III: pBad_Si2, IV: YopEi_i 3 8-Bid or V: YopEi_i 3 s-t-Bid at an MOI of 100.
  • cells were treated with VI: 0.5 ⁇ Staurosporine or VII: 1 ⁇ Staurosporine (B) Digitonin lysed HeLa cells left untreated (II) or after infection for lh with I: Y. enterocolitica ⁇ asd carrying III: pBad_Si2, IV: YopEi_i 3 8-Bid or V: YopEi_i 3 s-t-Bid at an MOI of 100 were analyzed by Western blotting anti-Bid ("a") allowing comparison of endogenous Bid levels (marked Z) to translocated YopEi_i 38 -Bid (marked X) or YopEi_i 38 -tBid (marked Y) levels.
  • VI 0.5 ⁇ Staurosporine
  • VII 1 ⁇ Staurosporine
  • B Digitonin lysed HeLa cells left untreated (II) or after infection for lh with I: Y. enterocolitica ⁇ asd carrying
  • Fig. 8 tBiD dependent phosphoproteome: HeLa cells were infected for 30 min with Y. enterocolitica ⁇ asd + YopEi_i 3 s-t-Bid at an MOI of 100 and as a control with Y. enterocolitica ⁇ asd + pBad_Si2.
  • A Graphical representation of the tBID phosphoproteome. Proteins containing phosphopeptides that were significantly regulated in a tBid dependent manner (gray) (q- value ⁇ 0.01) as well as known apopotosis related proteins (dark gray) are represented in a STRING network of known and predicted protein-protein interactions (high-confidence, score 0.7).
  • Fig. 9 Description of the type III secretion-based delivery toolbox.
  • A Vector maps of the cloning plasmids pBad Sil and pBad_Si2 used to generate fusion constructs with YopEi_i 38 .
  • the chaperone SycE and the YopEi_i 3 8-fusion are under the native Y. enterocolitica promoter.
  • the two plasmids only differ in presence of an arabinose inducible EGFP present on pBad Sil
  • B Multiple cloning site directly following the yopEi_i 38 fragment on pBad Sil and pBad_Si2 plasmids.
  • Fig. 10 Characterization of T3SS protein delivery into various cell lines. Anti-Myc immunofluorescence staining on Swiss 3T3 fibroblasts ("a"), Jurkat cells ("b") and HUVEC cells ("c") left untreated (II) or infected with Y. enterocolitica ⁇ asd + pBad_Si2 (I) at the MOI indicated above the images (MOI 25, 50, 100, 200 and 400 for HUVECs) for 1 h.
  • Fig. 11 T3SS dependency of delivery of bacterial effector proteins into eukaryotic cell. Digitonin lysed HeLa cells after infection at an MOI of 100 for time indicated above the blots (0, 5, 15, 10, 60 and 120 minutes) with Y.
  • enterocolitica AHOPEMT asd AyopB + YopEi_i 3 8- SopE-Myc (I) or Y. enterocolitica AHOPEMT asd + YopEi_i 3 8-SopE-Myc (II) were analyzed by Western blotting anti-Myc.
  • the size corresponding to YopEi_i 3 8-SopE-Myc is marked with "a", while the size of the endogenous c-Myc protein is marked with "b".
  • Fig. 12 and 13 T3SS dependent secretion of various other proteins into the culture supernatant.
  • I Y. enterocolitica ⁇ asd + YopEi_i 3 8 fused to the protein as indicated.
  • Protein content of total bacterial lysates ("A") and precipitated culture supernatants ("B") was analyzed by Western blotting using an anti-YopE antibody. Numbers written indicate molecular weight in kDa at the corresponding height.
  • Figs. 14A to N Y. enterocolitica and S. enterica strains used in this study. List of Y. enterocolitica and S.
  • enterica strains used in this study providing information on background strains, plasmids and proteins for T3SS dependent delivery encoded on corresponding plasmids. Further, information on oligonucleotides used for construction of the corresponding plasmid, the backbone plasmid and antibiotic resistances is provided.
  • Fig. 15 Delivery of murine tBid, murine Bid BH3 and murine Bax BH3 into B16F10 cells induces massive apoptosis.
  • B16F10 cells uninfected (I) or after infection (MOI of 50) for 2.5h with Y. enterocolitica ⁇ asd and II: + pBadSi_2, III: + YopEi_i 38 -F. enterocolitica codon optimized murine tBid, IV: + YopEi_i 3 8-F. enterocolitica codon optimized murine Bid BH3 or V: + YopEi_i 3 8-F. enterocolitica codon optimized murine Bax BH3.
  • Fig. 16 Delivery of murine tBid, murine Bid BH3 and murine Bax BH3 into D2A1 cells induces massive apoptosis.
  • D2A1 cells uninfected (I) or after infection (MOI of 50) for 2.5 h with Y. enterocolitica ⁇ asd and II: + pBadSi_2, III: + YopEi_i 3 8-F. enterocolitica codon optimized murine tBid, IV: + YopEi_i 3 8-F. enterocolitica codon optimized murine Bid BH3 or V: + YopEi_i 3 8-F. enterocolitica codon optimized murine Bax BH3.
  • After fixation cells were stained for the actin cytoskeleton and nuclei (both in gray).
  • Fig. 17 Delivery of murine tBid, murine Bid BH3 and murine Bax BH3 into HeLa cells induces massive apoptosis.
  • HeLa cells uninfected (I) or after infection (MOI of 50) for 2.5h with Y. enterocolitica ⁇ asd and II: + pBadSi_2, III: + YopEi_i 3 8-F. enterocolitica codon optimized murine tBid, IV: + YopEi_i 38 -7. enterocolitica codon optimized murine Bid BH3 or V: + YopEi_i 38 -7. enterocolitica codon optimized murine Bax BH3. After fixation cells were stained for the actin cytoskeleton and nuclei (both in gray).
  • Fig. 18 Delivery of murine tBid, murine Bid BH3 and murine Bax BH3 into 4T1 cells induces massive apoptosis.
  • 4T1 cells uninfected (I) or after infection (MOI of 50) for 2.5h with Y. enterocolitica ⁇ asd and II: + pBadSi_2, III: + YopEi_i 38 -7. enterocolitica codon optimized murine tBid, IV: + YopEi_i 38 -7. enterocolitica codon optimized murine Bid BH3 or V: + YopEi_i 38 -7. enterocolitica codon optimized murine Bax BH3. After fixation cells were stained for the actin cytoskeleton and nuclei (both in gray).
  • Fig. 19 Delivery of murine tBid by S. enterica grown under SPI-1 T3SS inducing conditions into eukaryotic cells induces apoptosis.
  • All S. enterica aroA strains were grown under SPI-1 T3SS inducing conditions. In some cases, cells were treated with II: 1 ⁇ Staurosporine. Numbers written indicate molecular weight in kDa at the corresponding height.
  • Fig. 20 Delivery of murine tBid by S. enterica grown under SPI-2 T3SS inducing conditions into eukaryotic cells induces apoptosis.
  • All S. enterica aroA strains were grown under SPI-2 T3SS inducing conditions. In some cases, cells were treated with II: 1 ⁇ Staurosporine. Numbers written indicate molecular weight in kDa at the corresponding height.
  • Fig. 21 S. enterica T3SS dependent secretion of various cell cycle proteins into the culture supernatant.
  • I and II Ink4a- MycHis
  • III and IV Ink4c-MycHis
  • V and VI Mad2-MycHis
  • VII and VIII Cdkl-MycHis.
  • Protein content of precipitated culture supernatants ("A") and total bacterial lysates (“B”) was analyzed by Western blotting using an anti-myc antibody. Numbers written indicate molecular weight in kDa at the corresponding height.
  • Fig. 22 T3SS dependent secretion of various known cell cycle interfering peptides into the culture supernatant.
  • I Y. enterocolitica ⁇ asd + pBad_Si2.
  • II-VII Y. enterocolitica ⁇ asd + YopEi_i 38 fused to peptides as listed following: II: Ink4A 84 -io3; III: pl07/RBLl 657-662, IV: p21141-160D149A, V: p21145-160D149A, VI: p21 i 7 _ 33 ; VII: cyclin D2i 3 9_i 47 .
  • Protein content of precipitated culture supernatants ("A") and total bacterial lysates (“B”) was analyzed by Western blotting using an anti-YopE antibody. Numbers written indicate molecular weight in kDa at the corresponding height.
  • Fig. 23 Fusion of the T3SS delivered protein to Ubiquitin allows removal of the YopEi. 138 appendage.
  • HeLa cells are infected with a strain delivering a protein of interest fused to YopEi_i 3 8 with a directly fused Ubiquitin (YopEi_i 3 8-Ubi).
  • YopEi_i 3 8-Ubi a directly fused Ubiquitin
  • endogenous Ubiquitin specific proteases will cleave the YopEi_i 38 -Ubi appendage from the protein of interest.
  • Digitonin lysed HeLa cells uninfected (I) or after infection (MOI of 100) for lh with II: Y.
  • enterocolitica ⁇ asd + YopEi_i 38 -Flag- INK4C-MycHis or III: + YopEi_i 38 -Flag-Ubiquitin-INK4C-MycHis were analyzed by Western blotting anti-INK4C for the presence of IV: YopEi_i 3 8-Flag-Ubiquitin-INK4C- MycHis or V: YopEi_i 38 -Flag-INK4C-MycHis, the cleaved form VI: INK4C-MycHis and VII: the endogenous INK4C.
  • Fig. 24 The Yersinia enterocolitica W227 virulence plasmid, pYV.
  • T3SS effector proteins, origin of replication and the arsenic resistance are indicated: I: origin of replication, II: yopO, III: yopP, IV: yopQ, V: yopT, VI: sycT,
  • XV yopE
  • XVI yadA
  • XVII-XVXX arsC, B, R and H.
  • Fig. 25 Validation of yop deletion by in vitro secretion analysis.
  • Fig. 26 Dose-escalation study in immuno-competent mice: weight of mice. Weight of mice was assessed daily following i.v. infection with bacteria. I: Days, II: weight in gram, III: Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ asd, IV: S. enterica AaroA administered i.v. in the amount indicated (10 5 , 10 6 , 10 7 , 10 8 cfu per animal).
  • Fig. 27 Dose-escalation study in immuno-competent mice: counts in blood. Counts in the blood at the time indicated were assessed by serial dilution and counting of resulting colony forming units (CFU). I: Days, II: CFU per ml, III: Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ asd, IV: S. enterica AaroA administered i.v. in the amount indicated (10 5 , 10 6 , 10 7 , 10 8 cfu per animal).
  • Fig. 28 Dose-escalation study in immuno-competent mice: counts in liver.
  • CFU colony forming units
  • Fig. 29 Dose-escalation study in immuno-competent mice: counts in lung. Counts in the lung at the time indicated were assessed by organ homogenization, serial dilution and counting of resulting colony forming units (CFU). I: Days, II: CFU per g III: Y. enterocohtica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ asd, IV: S. enterica AaroA administered i.v. in the amount indicated (10 5 , 10 6 , 10 7 , 10 8 cfu per animal).
  • Fig. 30 Dose-escalation study in immuno-competent mice: counts in spleen. Counts in the spleen at the time indicated were assessed by organ homogenization, serial dilution and counting of resulting colony forming units (CFU). I: Days, II: CFU per g III: Y. enterocohtica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ asd, IV: S. enterica AaroA administered i.v. in the amount indicated (10 5 , 10 6 , 10 7 , 10 8 cfu per animal).
  • Fig. 31 Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: scoring for physical appearance. I: Days, II: score, III: Y. enterocolitica MRS40 wt, IV: Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ . The arrow indicates the day of i.v. infection with 2xl0 5 bacteria.
  • Fig. 32 Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: scoring for behavior. I: Days, II: score, III: Y. enterocolitica MRS40 wt, IV: Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ . The arrow indicates the day of i.v. infection with 2xl0 5 bacteria.
  • Fig. 33 Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: weights of mice. Weight of mice was assessed daily following i.v. infection with bacteria. I: Days, II: body weight in gram, III: Y. enterocohtica MRS40 wt, IV: Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ . The arrow indicates the day of i.v. infection with 2xl0 5 bacteria.
  • Fig. 34 Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: biodistribution of Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ .
  • Counts in the organs at the time indicated were assessed by organ homogenization, serial dilution and counting of resulting colony forming units (CFU).
  • CFU colony forming units
  • Fig. 35 Biodistribution of Y. enterocolitica subsp. palearctica in the B16F10 melanoma mouse allograft model: biodistribution of Y. enterocolitica MRS40 wt Counts in the organs at the time indicated were assessed by organ homogenization, serial dilution and counting of resulting colony forming units (CFU).
  • CFU colony forming units
  • Fig. 36 Biodistribution of Y. enterocolitica subsp. palearctica in the 4T1 breast cancer mouse allograft model: biodistribution of Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ .
  • Counts in the organs at day 8 post infection were assessed by organ homogenization, serial dilution and counting of resulting colony forming units (CFU).
  • CFU colony forming units
  • Fig. 37 Delivery of synthetic increased pro-apoptotic proteins. Delivery of single synthetic proteins consisting of single or tandem repeats of BH3 domains originating from pro-apoptotic proteins t-BID or BAX leads to enhanced apoptosis induction in 4T1 and B16F10 cancerous cells. 4T1 (I) or B16F10 (II) cells were infected with Y.
  • enterocolitica AyopHOPEMT encoding on pBad-MycHisA IV: YopEi_i 3 8-tBID BH3 extended domain, V: YopEi_i38-linker-tBID BH3, VI: YopEi_i 38 -tBID BH3, VII: YopEi_i 38 -(tBID BH3) 2 , VIII: YopEi_i38-tBID BH3 - BAX BH3 or IX: ⁇ _ ⁇ 38 - ⁇ BH3 - tBID BH3.
  • a titration of the bacteria added to the cells was performed for each strain, cell counts determined and IC50 calculated using non- linear regression. IC50 MOI is indicated (III).
  • Fig. 38 Induction of apoptosis by pYV-encoded synthetic pro-apoptotic proteins. Delivery of a single or a tandem repeat of BID BH3 domain encoded on the pYV leads to apoptosis induction in 4T1 and B16F10 cancerous cells.
  • 4T1 (I) or B16F10 (II) cells were infected with Y. enterocolitica AHOPEMT + IV: pYV-YopEi_i 38 -BH3-Bid, or V: + pYV- YopEi_i38-(BH3-Bid) 2 or VI: with Y.
  • a titration of the bacteria added to the cells (MOI) was performed for each strain, cell counts determined and IC50 (III) calculated using non- linear regression.
  • Fig. 39 Tumor colonization of i.v. injected Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ in the 4T1 breast cancer allograft model. Bacterial counts in tumors are indicated as colony forming units (CFU) per gram of tissue (III). Counts were assessed in tumors at day 8 (I) and 14 (II) post infection. Each dot represents an individual mouse. The horizontal dashed line indicates the detection limit.
  • Fig. 40 Biodistribution of i.v. injected Y. enterocolitica AyopH,0,P,E,M,T in the 4T1 breast cancer allograft model.
  • CFU colony forming units
  • Fig. 41 Delay of tumor progression in wildtype Balb/C mice allografted s.c. with 4T1 breast cancer cells.
  • Wildtype Balb/C mice allografted s.c. with 4T1 breast cancer cells were i.v. injected with I: PBS or II: 1 * 10 7 Y. enterocolitica dHOPEMT + pYV-YopEi_i 38 (BH3- Bid) 2 , once the tumor had reached a size of 150-250 mm3.
  • the day of the i.v. injection of bacteria was defined as day 0. Tumor volume was measured over the following days (III; day 0 to day 9 post i.v. injection of bacteria) with calipers.
  • the relative tumor volume, normalized to the tumor volume at day 0, is indicated (IV) as mm 3 .
  • the mean is indicated with symbols, error bars depicted show the standard error of the mean. Statistical significance is measured with a 2way A OVA, * indicates p value ⁇ 0.05, ** a p value ⁇ 0.005.
  • Fig. 42 Tumor progression in wildtype Balb/C mice allografted s.c. with 4T1 breast cancer cells.
  • Wildtype Balb/C mice allografted s.c. with 4T1 breast cancer cells were i.v. injected with I: PBS or II: 1 * 10 7 Y. enterocolitica dHOPEMT, once the tumor had reached a size of 150-250 mm3.
  • the day of the i.v. injection of bacteria was defined as day 0.
  • Tumor volume was measured over the following days (III; day 0 to day 9 post i.v. injection of bacteria) with calipers.
  • the relative tumor volume, normalized to the tumor volume at day 0, is indicated (IV) as mm 3 .
  • the mean is indicated with symbols, error bars depicted show the standard error of the mean. Detailed description of the invention
  • the present invention relates to recombinant virulence attenuated Gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject.
  • Gram-negative bacterial strain includes the following bacteria:
  • Aeromonas salmonicida Aeromonas hydrophila, Aeromonas veronii, Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis,
  • Chlamydophila abortus Chlamydophila pneumoniae, Chromobacterium violaceum
  • Citrobacter rodentium Desulfovibrio vulgaris, Edwardsiella tarda, Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, Escherichia coli, Lawsonia
  • Pseudoalteromonas spongiae Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp, Salmonella enterica and other Salmonella sp, Shigella flexneri and other Shigella sp, Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii, Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis,
  • Gram-negative bacterial strains of the invention are Gram-negative bacterial strains comprised by the family of Enterobacteriaceae and
  • the Gram-negative bacterial strain of the present invention is normally used for delivery of heterologous proteins by the bacterial T3SS into eukaryotic cells in vitro and/or in vivo, preferably in vivo.
  • recombinant virulence attenuated Gram-negative bacterial strain refers to a recombinant virulence attenuated Gram-negative bacterial strain genetically transformed with a vector.
  • a useful vector of the present invention is e.g an expression vector, a vector for chromosomal or virulence plasmid insertion or a DNA or RNA fragment for chromosomal or virulence plasmid insertion or modification. Virulence of such a recombinant Gram-negative bacterial strain is usually attenuated by deletion of bacterial effector proteins having virulence activity which are transported by one or more bacterial proteins, which are part of a secretion system machinery.
  • effector proteins are deliverd by a secretion system machinery into a host cells where they excert therir virulence activity toward various host proteins and cellular machineries.
  • Many different effector proteins are known, transported by various secretion system types and displaying a large repertoire of biochemical activities that modulate the functions of host regulatory molecules.
  • Virulence of the recombinant Gram-negative bacterial strain used herein can be attenuated additionally by lack of a siderophore normally or occasionally produced by the Gram-negative bacterial strain so that the strain does not produce the siderophore e.g. is deficient in the production of the siderophore.
  • a recombinant virulence attenuated Gram- negative bacterial strain is used in the methods of the invention which lacks of a siderophore normally or occasionally produced by the Gram-negative bacterial strain so that the strain does not produce the siderophore e.g. is deficient in the production of a siderophore, more preferably a Yersinia strain, in particular Y. enterocolitica MRS40 AyopH,0,P,E,M,T, is used in the methods of the invention which lacks of a siderophore normally or occasionally produced by the Gram-negative bacterial strain so that the strain does not produce the siderophore e.g.
  • the recombinant virulence attenuated Gram-negative bacterial strain used in the methods of the invention preferably does not produce at least one, preferably at least two siderophores e.g. is deficient in the production of at least one, preferably at least two siderophores, more preferably the recombinant virulence attenuated Gram-negative bacterial strain used in the methods of the invention does not produce any siderophore.
  • siderophore refers to compounds with high affinity for iron e.g. small compounds with high affinity for iron.
  • Siderophores of Gram-negative bacteria are e.g. Enterobactin and dihydroxybenzoylserine synthetized by Salmonella, Escherichia, Klebsiella, Shigella, Serratia (but used by all enterobacteria), Pyoverdins synthetized by Pseudomonas, Vibriobactin synthetized by Vibrio, Acinetobactin and Acinetoferrin by Acinetobacter, Yersiniabactin and Aerobactin synthetized by Yersinia, Ornibactin synthetized by Burkholderia, Salmochelin synthetized by Salmonella, Aerobactin synthetized by Escherichia, Shigella, Salmonella, and Yersinia, Alcaligin synthetized by Bordetella, Bisucaberin synthetized by Vibrio.
  • Siderophores include hydroxamate, catecholate and mixed ligand siderophores.
  • Several siderophores have to date been approved for use in humans, mainly with the aim of treating iron overload.
  • Preferred siderophores are Deferoxamine (also known as desferoxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), Desferoxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer) and Deferiprone (Ferriprox).
  • Gram-negative bacterial strain deficient to produce an amino acid essential for growth and "auxotroph mutant” are used herein interchangeably and refer to Gram-negative bacterial strains which can not grow in the absence of at least one exogenously provided essential amino acid or a precursor thereof.
  • the amino acid the strain is deficient to produce is e.g. aspartate, meso-2,6-diaminopimelic acid, aromatic amino acids or leucine-arginine [1].
  • Such a strain can be generated by e.g. deletion of the aspartate-beta-semialdehyde
  • auxotroph mutant cannot grow in absence of exogenous meso-2,6-diaminopimelic acid [2].
  • the mutation e.g. deletion of the aspartate-beta- semialdehyde dehydrogenase gene is preferred herein for a Gram-negative bacterial strain deficient to produce an amino acid essential for growth of the present invention.
  • Gram-negative bacterial strain deficient to produce adhesion proteins binding to the eukaryotic cell surface or extracellular matrix refers to mutant Gram-negative bacterial strains which do not express at least one adhesion protein compared to the adhesion proteins expressed by the corresponding wild type strain.
  • Adhesion proteins may include e.g. extended polymeric adhesion molecules like pili/fimbriae or non-fimbrial adhesins.
  • Fimbrial adhesins include type-1 pili (such as E. coli Fim-pili with the FimH adhesin), P-pili (such as Pap-pili with the PapG adhesin from E.
  • Non-fimbrial adhesions include trimeric autotransporter adhesins such as YadA from Y. enterocolitica, BpaA (B.
  • the autotransporter YadA [3] binds to different froms of collagen as well as fibronectin, while the invasin InvA [4] binds to ⁇ -integrins in the eukaryotic cell membrane.
  • the Gram-negative bacterial strain is a Y. enterocolitica strain the strain is preferably deficient in InvA and/or YadA.
  • the term "family of Enterobacteriaceae" comprises a family of gram- negative, rod-shaped, facultatively anaerobic bacteria found in soil, water, plants, and animals, which frequently occur as pathogens in vertebrates. The bacteria of this family share a similar physiology and demonstrate a conservation within functional elements and genes of the respective genomes. As well as being oxidase negative, all members of this family are glucose fermenters and most are nitrate reducers.
  • Enter obacteriaceae bacteria of the invention may be any bacteria from that family, and specifically includes, but is not limited to, bacteria of the following genera: Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia, Proteus, Erwinia, Morganella, Providencia, or Yersinia.
  • the bacterium is of the Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Salmonella enterica, Salmonella bongori, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter cloacae, Enterobacter agglomerans, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Yersinia pseudotuberculosis, Yersinia pestis, Yersinia enterocolitica, Erwinia amylovora, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Providencia alcal
  • the Gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, Shigella, Pseudomonas, Chlamydia, Erwinia, Pantoea, Vibrio, Burkholderia, Ralstonia, Xanthomonas, Chromobacterium, Sodalis,
  • Desulfovibrio more preferably from the group consisting of the genera Yersinia, Escherichia, Salmonella, and Pseudomonas, most preferably from the group consisting of the genera Yersinia and Salmonella.
  • Yersinia as used herein includes all species of Yersinia, including Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis. Prefered is Yersinia enterocolitica.
  • Salmonella includes all species of Salmonella, including
  • Promoter refers to a nucleic acid sequence that regulates expression of a transcriptional unit.
  • a “promoter region” is a regulatory region capable of binding R A polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. Within the promoter region will be found a transcription initiation site
  • a promoter is operably linked to a structural gene if it controls the transcription of the gene and it is located on the same nucleic acid fragment as the gene.
  • the promoter is functional in said Gram-negative bacterial strain, i.e. the promoter is capable of expressing the fusion protein of the present invention, i.e. the promoter is capable of expressing the fusion protein of the present invention without further genetic engineering or expression of further proteins.
  • a functional promoter must not be naturally counter-regulated to the bacterial T3SS.
  • delivery refers to the transportation of a protein from a recombinant virulence attenuated Gram-negative bacterial strain to a eukaryotic cell, including the steps of expressing the heterologous protein in the recombinant virulence attenuated Gram-negative bacterial strain, secreting the expressed protein(s) from such recombinant virulence attenuated Gram-negative bacterial strain and translocating the secreted protein(s) by such recombinant virulence attenuated Gram-negative bacterial strain into the cytosol of the eukaryotic cell.
  • delivery signal or “secretion signal” which are used interchangeably herein refer to a polypeptide sequence which can be recognized by the secretion and translocation system of the Gram-negative bacterial strain and directs the delivery of a protein from the Gram-negative bacterial strain to eukaryotic cells.
  • delivery signal from a bacterial effector protein refers to a delivery signal from a bacterial effector protein functional in the recombinant Gram-negative bacterial strain, i.e. which allows an expressed heterologous protein in the recombinant Gram-negative bacterial strain to be secreted from such recombinant Gram-negative bacterial strain by a secretion system such as the type III secretion system or to be translocated by such recombinant Gram-negative bacterial strain into the cytosol of a eukaryotic cell by a secretion system such as the type III secretion system.
  • delivery signal from a bacterial effector protein also comprises a fragment of a delivery signal from a bacterial effector protein i.e. shorter versions of a delivery signal e.g. a delivery signal comprising up to 10, preferably up to 20, more preferably up to 50, even more preferably up to 100, in particular up to 140 amino acids of a delivery signal e.g. of a naturally occuring delivery signal.
  • a nucleotide sequence such as e.g.
  • a DNA sequence encoding a delivery signal from a bacterial effector protein may encode a full length delivery signal or a fragment therof wherein the fragment usually comprises usually up to 30, preferably up to 60, more preferably up to 150, even more preferably up to 300, in particular up to 420 nucleic acids.
  • the "secretion” of a protein refers to the transportation of a heterologous protein outward across the cell membrane of a recombinant virulence attenuated Gram- negative bacterial strain.
  • the “translocation” of a protein refers to the transportation of a heterologous protein from a recombinant virulence attenuated Gram-negative bacterial strain across the plasma membrane of a eukaryotic cell into the cytosol of such eukaryotic cell.
  • bacterial protein which is part of a secretion system machinery
  • T3SS type 3 secretion system
  • T4SS type 4 secretion system
  • T6SS type 6 secretion system
  • bacterial effector protein refers to bacterial proteins transported by secretion systems e.g. by bacterial proteins, which are part of a secretion system machinery into host cells. Such effector proteins are deliverd by a secretion system into a host cell where they excert e.g.virulence activity toward various host proteins and cellular machineries. Many different effector proteins are known, transported by various secretion system types and displaying a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. Secretion systems include type 3 secretion system (T3SS), type 4 secretion system (T4SS) and type 6 secretion system (T6SS).
  • T3SS type 3 secretion system
  • T4SS type 4 secretion system
  • T6SS type 6 secretion system
  • the recombinant virulence attenuated Gram-negative bacterial strain used herein usually comprises bacterial proteins constituting essential components of the bacterial type 3 secretion system (T3SS), type 4 secretion system (T4SS) and/or the type 6 secretion system (T6SS), preferably of the type 3 secretion system (T3SS).
  • T6SS effector protein or "bacterial T6SS effector protein” as used herein refers to proteins which are naturally injected by T6S systems into the cytosol of eukaryotic cells or bacteria and to proteins which are naturally secreted by T6S systems that might e.g form translocation pores into the eukaryotic membrane.
  • T4SS effector protein or "bacterial T4SS effector protein” as used herein refers to proteins which are naturally injected by T4S systems into the cytosol of eukaryotic cells and to proteins which are naturally secreted by T4S systems that might e.g form the translocation pore into the eukaryotic membrane.
  • T3SS effector protein or "bacterial T3SS effector protein” as used herein refers to proteins which are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins which are naturally secreted by T3S systems that might e.g form the translocation pore into the eukaryotic membrane (including pore-forming tranlocators (as Yersinia YopB and YopD) and tip-proteins like Yersinia LcrV).
  • pore-forming tranlocators as Yersinia YopB and YopD
  • tip-proteins like Yersinia LcrV tip-proteins like Yersinia LcrV.
  • proteins which are naturally injected by T3S systems into the cytosol of eukaryotic cells are used. These virulence factors will paralyze or reprogram the eukaryotic cell to the benefit of the pathogen.
  • T3S effectors display a large repertoire of biochemical activities and modulate the function of crucial host regulatory molecules [5,6] and include AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE,
  • recombinant virulence attenuated Gram-negative bacterial strain accumulating in a malignant solid tumor refers to a recombinant virulence attenuated Gram-negative bacterial strain which replicates within a malignant solid tumor thereby increasing the bacterial count of this recombinant virulence attenuated Gram- negative bacterial strain inside the malignant solid tumor.
  • the recombinant virulence attenuated Gram-negative bacterial strain after administration to the subject accumulates specifically in the malignant solid tumor i.e. accumulates specifically in the organ where the malignant tumor is present, wherein the bacterial counts of the recombinant virulence attenuated Gram-negative bacterial strain in organs where no malignant solid tumor is present is low or not detectable.
  • Salmonella will mostly invade tumor cells and reside inside such cells, while extracellular accumlations might still occur. Bacterial counts of the recombinant virulence attenuated
  • Gram-negative bacterial strain accumulated inside the malignant solid tumor can be e.g. in the range of 10 4 to 10 9 bateria per gram of tumor tissue.
  • malignant solid tumor or "malignant solid tumor indication” used herein refers to an abnormal mass of tissue that usually does not contain cysts or liquid areas.
  • Solid tumors may be benign (not cancer), or malignant (cancer).
  • Malignant solid tumors are treated with the methods of the present invention. Different types of malignant solid tumors are named for the type of cells that form them. Examples of malignant solid tumors are sarcomas, carcinomas, and lymphomas.
  • Leukemias cancers of the blood
  • NIH national cancer institute of the NIH
  • Malignant solid tumors include, but are not limited to, abnormal mass of cells which may stem from different tissue types such as liver, colon, colorectum, skin, breast, pancreas, cervix uteri, corpus uteri, bladder, gallbladder, kidney, larynx, lip, oral cavity, oesophagus, ovary, prostate, stomach, testis, thyroid gland or lung and thus include malignant solid liver, colon, colorectum, skin, breast, pancreas, cervix uteri, corpus uteri, bladder, gallbladder, kidney, larynx, lip, oral cavity, oesophagus, ovary, prostate, stomach, testis, thyroid gland or lung tumors.
  • tissue types such as liver, colon, colorectum, skin, breast, pancreas, cervix uteri, corpus uteri, bladder, gallbladder, kidney, larynx, lip, oral cavity, oesophagus, ovary, prostate,
  • Preferred malignant solid tumors which can be treated with the methods of the present invention are malignant solid tumors which stem from skin, breast, liver, pancreas, bladder, prostate and colon and thus inlcude malignant solid skin, breast, liver, pancreas, bladder, prostate and colon tumors.
  • Equally preferred malignant solid tumors which can be treated with the methods of the present invention are malignant solid tumors associated with liver cancer, such as hepatocellular carcinoma.
  • the term "bacterial effector protein which is virulent toward eukaryotic cells" as used herein refers to bacterial effector proteins, which are transported by secretion systems into host cells where they excert therir virulence activity toward various host proteins and cellular machineries.
  • T3SS type 3 secretion system
  • T4SS type 4 secretion system
  • T6SS type 6 secretion system
  • T3SS effector proteins which are virulent towards eukaryotic cells refers to proteins as Y. enterocolitica YopE, YopH, YopJ, YopM, YopO, YopP, YopT or Shigella flexneri OspF, IpgD, IpgBl or Salmonella enterica SopE, SopB, SptP or P. aeruginosa ExoS, ExoT, ExoU, ExoY or E. coli Tir, Map, EspF, EspG, EspH, EspZ.
  • T4SS effector proteins which are virulent towards eukaryotic cells refers to proteins as Legionella pneumophila LidA, SidC, SidG, SidH, SdhA, SidJ, SdjA, SdeA, SdeA, SdeC, LepA, LepB, WipA, WipB, YlfA, YlfB, VipA, VipF, VipD, VpdA, VpdB, DrrA, LegL3, LegL5, LegL7, LegLC4, LegLC8, LegC5, LegG2, CeglO, Ceg23, Ceg29 or Bartonella henselae BepA, BepB, BepC, BepD, BepE, BepF BepG or Agrobacterium tumefaciens VirD2, VirE2, VirE3, VirF or H.
  • T6SS effector proteins which are virulent towards eukaryotic cells refers to proteins as Vibrio cholerae VgrG proteins (as VgrGl).
  • T3SS effector protein which is virulent toward eukaryotic cells or "bacterial T3SS effector protein which is virulent toward eukaryotic cells” as used herein refers to proteins which are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins which are naturally secreted by T3S systems that might e.g form the translocation pore into the eukaryotic membrane, which are virulence factors toward eukaryotic cells i.e. to proteins which paralyze or reprogram the eukaryotic cell to the benefit of the pathogen.
  • Effectors display a large repertoire of biochemical activities and modulate the function of crucial host regulatory mechanisms such as e.g. phagocytosis and the actin cytoskeleton, inflammatory signaling, apoptosis, endocytosis or secretory pathways[5, 6] and include AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE,
  • T3SS effector genes of Yersinia which are virulent to a eukaryotic cell and can be deleted/mutated from e.g. Y. enterocolitica are YopE, YopH, YopM, YopO, YopP (also named YopJ), and YopT [7].
  • the respective effector genes which are virulent to a eukaryotic cell can be deleted/mutated from Shigella flexneri (e.g. OspF, IpgD, IpgBl), Salmonella enterica (e.g. SopE, SopB, SptP), P. aeruginosa (e.g ExoS, ExoT, ExoU, ExoY) or E.
  • coli e.g. Tir, Map, EspF, EspG, EspH, EspZ.
  • the nucleic acid sequences of these genes are available to those skilled in the art, e.g., in the Genebank Database (yopH, yopO, yopE, yopP, yopM, yopT from NC 002120 GI: 10955536; S flexneri effector proteins from AF386526.1 GL 18462515; S enterica effectors from NC 016810.1 GL378697983 or FQ312003.1 GL301156631; P. aeruginosa effectors from AE004091.2 GI: 110227054 or CP000438.1 GI: 115583796 and E. coli effector proteins from NC 011601.1 GL215485161).
  • genes are denoted by letters of lower case and italicised to be distinguished from proteins.
  • genes denoted by letters of lower case and italicised
  • a bacterial species name like E. coli
  • they refer to a mutation of the corresponding gene in the corresponding bacterial species.
  • YopE refers to the effector protein encoded by the yopE gene.
  • Y. enterocolitica yopE represents a Y.
  • enterocolitica having a mutaion in the yopE gene.
  • polypeptide peptide
  • protein polypeptidic
  • peptidic a series of amino acid residues connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
  • proteins which have an amino acid sequence comprising at least 10 amino acids, more preferably at least 20 amino acids.
  • heterologous protein includes naturally occurring proteins or parts thereof and also includes artificially engineered proteins or parts thereof.
  • heterologous protein refers to a protein or a part thereof other than the T3SS effector protein or N-terminal fragment thereof to which it can be fused.
  • heterologous protein as used herein refers to a protein or a part thereof, which do not belong to the proteome, i.e. the entire natural protein complement of the specific recombinant virulence attenuated Gram-negative bacterial strain provided and used by the invention, e.g. which do not belong to the proteome, i.e.
  • heterologous protein is of animal origin including human origin.
  • the heterologous protein is a human protein. More preferably the heterologous protein is selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins.
  • heterologous protein is selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR related proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins.
  • heterologous proteins selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, and ankyrin repeat proteins.
  • proteins involved in apoptosis or apoptosis regulation like animal, preferably human heterologous proteins involved in apoptosis or apoptosis regulation
  • the vector of the Gram-neagtive bacterial strain of the present invention comprises two second DNA sequences encoding the identical or two different heterologous proteins fused independently from each other in frame to the 3 'end of said first DNA sequence.
  • the vector of the Gram-neagtive bacterial strain of the present invention comprises three second DNA sequences encoding the identical or three different heterologous proteins fused independently from each other in frame to the 3 'end of said first DNA sequence.
  • the heterologous protein expressed by the recombinant virulence attenuated Gram-negative bacterial strain has usually a molecular weight of between 1 and 150kD, preferably between 1 and 120kD, more preferably between land lOOkDa, most preferably between 15 and lOOkDa.
  • the vector of the Gram-neagtive bacterial strain of the present invention comprises repeated domains of a heterologous protein or two or more domains of different heterologous proteins fused in frame to the 3 'end of said first DNA sequence.
  • heterologous proteins which belong to the same functional class of proteins refers to heterologous proteins which have the same function e.g. heterologous proteins having enzymatic activity, heterologous proteins which act in the same pathway such as e.g. cell cycle regulation, or share a common specific feature as e.g. belonging to the same class of bacterial effector proteins.
  • Functional classes of proteins are e.g. proteins involved in apoptosis or apoptosis regulation, proteins which act as cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small
  • a domain of a heterologous protein includes domains of naturally occurring proteins and also includes domains of artificially engineered proteins.
  • domain of a heterologous protein refers to a domain of a heterologous protein other than a domain of a T3SS effector protein or a domain other than a domain comprising the N-terminal fragment thereof to which it can be fused to achieve a fusion protein.
  • the domain of a heterologous protein as used herein refers to a domain of a heterologous protein, which do not belong to the proteome, i.e. the entire natural protein complement of the specific recombinant Gram-negative bacterial strain provided and used by the invention, e.g. which do not belong to the proteome, i.e. the entire natural protein complement of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella or Pseudomonas.
  • the domain of the heterologous protein is of animal origin including human origin.
  • the domain of the heterologous protein is a domain of a human protein.
  • the domain of the heterologous protein is a domain of a protein selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins.
  • the domain of the heterologous protein is a domain of a protein selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR related proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins.
  • domains of heterologous proteins selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, and ankyrin repeat proteins.
  • domains of proteins involved in apoptosis or apoptosis regulation like animal proteins involved in apoptosis or apoptosis regulation, preferably domains of human heterologous proteins involved in apoptosis or apoptosis regulation.
  • the term "repeated domains of a heterologous protein” as used herein refers to a fusion protein consisting of several repetitions of a domain of a heterologous protein, where these domains might either be directly fused to each other or where a variable linker e.g. a linker between 1 and 30, preferably between 2 and 15, more preferably between 3 and 10 amino acids might be introduced in between the domains.
  • repeated identical domains or repeated domains which have an amino acid sequence identity of more than 80 %, usually more than 85 %, preferably more than 90 %, even more preferably more than 95 %, in particular more than 96%, more particular more than 97%, even more particular more than 98 %, most particular more than 99% are used.
  • identical domains which have an amino acid identity of 100 %.
  • two repeated domains more preferably two repeated identical domains or two repeated domains having an amino acid sequence identity of more than 90 %, preferably more than 95%, most preferably 100 % are comprised by the fusion protein as referred herein. More than two, e.g. three, four, five or six repeated domains are also contemplated by the present invention.
  • two or more domains of different heterologous proteins refers to a fusion protein consisting of one or several repetitions of at least two domains of different heterologous proteins e.g. at least two domains of heterologous proteins having an amino acid sequence identity of 80%> or less, preferably 60%> or less, more preferably 40%> or less, where these different domains might either be directly fused to each other or where a variable linker e.g. a linker between 1 and 30, preferably between 2 and 15, more preferably between 3 and 10 amino acids might be introduced in between the domains.
  • two domains of different heterologous proteins are comprised by the fusion protein as referred herein. More than two, e.g. three, four, five or six domains of different heterologous proteins are also contemplated by the present invention.
  • the domain of a heterologous protein expressed by the recombinant Gram-negative bacterial strain has usually a molecular weight of between 1-50 kDa, preferably between 1-30 kDa, more preferably between 1-20 kDa, most preferably between 1-10 kDa.
  • proteins involved in apoptosis or apoptosis regulation include, but are not limited to, Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-xL, Apafl, Caspase 9, Caspase 3, Caspase 6, Caspase 7, Caspase 10, DFFA, DFFB, ROCKl, APP, CAD, ICAD, CAD, EndoG, AIF, HtrA2, Smac/Diablo, Arts, ATM, ATR, Bok/Mtd, Bmf, Mcl- 1 (S), IAP family, LC8, PP2B, 14-3-3 proteins, PKA, PKC, PI3K, Erkl/2, p90RSK, TRAF2, TRADD, FADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, MKK7, INK, FLIPs, FKHR, GSK3, CDKs and their inhibitors
  • proteins involved in apoptosis or apoptosis regulation include DIVA, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3, Bcl- B, Bcl-W, Ced-9, Al, NR13, Bfl-1, Caspase 1, Caspase 2, Caspase 4, Caspase 5, Caspase 8.
  • Proteins involved in apoptosis or apoptosis regulation are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis-prevention pathways and inhibitors of pro-survival signalling or pathways.
  • Pro-apoptotic proteins comprise proteins selected form the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apafl, Smac/Diablo, BNIP1, BNIP3, Bel- Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD, the Caspase family, and CDKs and their inhibitors like the INK4-family (pl6(Ink4a), pl5(Ink4b), pl8(Ink4c), pl9(Ink4d)) or selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf
  • Anti-apoptotic proteins comprise proteins selected form the group consisting of
  • Inhibitors of apoptosis-prevention pathways comprise proteins selected form the group consisting of Bad, Noxa and Cdc25A. Preferred are Bad and Noxa.
  • Inhibitors of pro-survival signalling or pathways comprise proteins selected form the group consisting of PTEN, ROCK, PP2A, PHLPP, JNK, p38. Preferred are PTEN, ROCK, PP2A and PHLPP.
  • the heterologous proteins involved in apoptosis or apoptosis regulation are selected from the group consisting of BH3 -only proteins, caspases and intracellular signalling proteins of death receptor control of apoptosis.
  • BH3-only proteins are preferred.
  • BH3-only proteins comprise proteins selected form the group consisting of Bad, BIM, Bid and tBid, Puma, Bik/Nbk, Bod, Hrk/Dp5, BNIPl, BNIP3, Bmf, Noxa, Mcl-1, Bcl-Gs, Beclin 1, Egl-1 and CED-13.
  • Preferred are Bad, BIM, Bid and tBid, in particular tBid.
  • Caspases comprise proteins selected form the group consisting of Caspase 1, Caspase 2, Caspase 3, Caspase 4, Caspase 5, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Caspase 10. Preferred are Caspase 3, Caspase 8 and Caspase 9.
  • Intracellular signalling proteins of death receptor control of apoptosis comprise proteins selected form the group consisting of FADD, TRADD, ASC, BAP31, GULPl/CED-6, CIDEA, MFG-E8, CIDEC, RIPK1/RIP1, CRADD, RIPK3/RIP3, Crk, SHB, CrkL, DAXX, the 14-3-3 family, FLIP, DFF40 and 45, PEA-15, SODD.
  • FADD and TRADD proteins selected form the group consisting of FADD, TRADD, ASC, BAP31, GULPl/CED-6, CIDEA, MFG-E8, CIDEC, RIPK1/RIP1, CRADD, RIPK3/RIP3, Crk, SHB, CrkL, DAXX, the 14-3-3 family, FLIP, DFF40 and 45, PEA-15, SODD.
  • FADD and TRADD proteins selected form the group consisting of FADD, TRADD, ASC, BAP31, GULPl/CED-6,
  • two heterologous proteins involved in apoptosis or apoptosis regulation are comprised by the Gram-negative bacterial strain and/or the vector of the present invention, wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis-prevention pathways or wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of pro-survival signalling or pathways.
  • Pro-apoptotic proteins encompassed by the present invention have usually an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and usually comprise at least one of BHl, BH2, BH3 or BH4 domaines, preferably comprise at least one BH3 domain.
  • pro-apoptotic proteins encompassed by the present invention have no enzymatic activity.
  • Anti-apoptotic proteins encompassed by the present invention have usually an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and comprises a combination of different BHl, BH2, BH3 and BH4 domains, preferably a combination of different BHl, BH2, BH3 and BH4 domains wherein a BHl and a BH2 domain is present, more preferably BH4-BH3-BH1-BH2, BH1-BH2, BH4-BH1-BH2 or BH3-BH1-BH2 (from N- to the C-teminus). Additionally, proteins containing at least one BIR domain are also encompassed.
  • Inhibitors of apoptosis-prevention pathways encompassed by the present invention have usually an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and usually comprise one BH3 domain.
  • BHl, BH2, BH3 or BH4 domaines are each usually between about 5 to about 50 amino acids in length.
  • the heterologous proteins involved in apoptosis or apoptosis regulation is selected from the group consisting of heterologous proteins involved in apoptosis or apoptosis regulation which are about 5 to about 200, preferably about 5 to about 150, more preferably about 5 to about 100, most preferably about 5 to about 50, in particular about 5 to about 25 amino acids in length.
  • the Gram-negative bacterial strain of the present invention is transformed with two domains of a heterologous proteins involved in apoptosis or apoptosis regulation, preferably two repeated, more preferably two identical repeated domains of a protein involved in apoptosis or apoptosis regulation or two domains of different proteins involved in apoptosis or apoptosis regulation, most preferably two identical repeated domains of a protein involved in apoptosis or apoptosis regulation.
  • the Gram- negative bacterial strain of the present invention is transformed with two domains of a heterologous proteins involved in apoptosis or apoptosis regulation, wherein one is a domain of a pro-apoptotic protein and the other is a domain of a protein which is an inhibitor of apoptosis-prevention pathways or wherein one is a domain of a a pro-apoptotic protein and the other domain is a domain of a protein which is an inhibitor of pro-survival signalling or pathways.
  • a particular preferred domain is the BH3 domain of apoptosis inducer tBID, more particular the BH3 domain comprising a sequence selected from the group consisting of SEQ ID NOs: 217, 218, 219 and 220, preferably SEQ ID NO: 219 or SEQ ID NO: 220.
  • the BH3 domain of apoptosis regulator BAX is equally preferred, more particular the BAX domain comprising a sequence selected from the group consisting of SEQ ID NOs: 221, 222, 223 and 224, preferably SEQ ID NO: 223 or SEQ ID NO: 224.
  • the human and murine sequences are given in SEQ ID NOs 217-224, but tBID and BAX BH3 domains of all other species are equally included.
  • the repeated domains of the heterologous proteins are the BH3 domain, preferably repeated BH3 domains of apoptosis inducer tBID, more preferably repeated BH3 domains of the apoptosis inducer tBID comprised by SEQ ID NO: 219 or SEQ ID NO: 220 or SEQ ID NO: 202, even more preferably two repeated BH3 domains of apoptosis inducer tBID, most preferably two repeated BH3 domains of the apoptosis inducer tBID comprised by SEQ ID NO: 219 or SEQ ID NO: 220 or SEQ ID NO: 202, in particular two repeated BH3 domains of apoptosis inducer tBID comprised by the sequence of SEQ ID NO: 202.
  • the Gram-negative bacterial strain and/or the vector of the present invention comprises a second DNA sequence encoding two repeated domains of a BH3 domain, more preferably two repeated BH3 domains of apoptosis inducer tBID.
  • the two repeated domains may be connected by a linker of 1-30 amino acid length, preferably 2-15 amino acids, more preferred 3-10 amino acids long.
  • the two or more domains of different heterologous proteins are domains of heterologous proteins which belong to the same functional class of proteins, preferably the different heterologous proteins of the two or more domains are different heterologous proteins from the class of proteins involved in apoptosis or apoptosis regulation.
  • the two or more domains of different heterologous proteins are the BH3 domain of apoptosis inducer tBID and the BH3 domain of apoptosis regulator BAX, in particular the fused BH3 domains comprised by the sequence of SEQ ID NO: 203 and 211.
  • the two domains of different heterologous proteins may be connected by a linker of 1-30 amino acid length, preferably 2-15 amino acids, more preferred 3-10 amino acids long.
  • the heterologous proteins is a pro-drug converting enzyme.
  • the recombinant virulence attenuated Gram-negative bacterial strain expresses, preferably expresses and secretes a pro-drug converting enzyme.
  • a prodrug converting enzyme as referred herein comprises enzymes converting non-toxic prodrugs into a toxic drug, preferably enzymes seleted from the group consiting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase, beta-galactosidase, carboxylesterases, nitroreductase, carboxypeptidases and beta-glucuronidases., more preferably enzymes seleted from the group consiting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase, and beta-galactosidase.
  • protease cleavage site refers to a specific amino acid motif within an amino acid sequence e.g. within an amino acid sequence of a protein or a fusion protein, which is cleaved by a specific protease, which recognizes the amino acid motif.
  • protease cleavage sites are amino acid motifs, which are cleaved by a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease (HRV 3C), TEV protease, TVMV protease, FactorXa protease and thrombin.
  • ubiquitin is used as protease cleavage site, i.e. the third DNA sequence encodes ubiquitin as protease cleavage site, which can be cleaved by a specific ubiquitin processing proteases at the N-terminal site, e.g. which can be cleaved by a specific ubiquitin processing proteases called Deubiquitinating enzymes at the N-terminal site endogeneously in the cell where the fusion protein has been delivered to.
  • Ubiquitin is processed at its C-terminus by a group of endogenous Ubiquitin-specific C-terminal proteases (Deubiquitinating enzymes, DUBs).
  • DUBs deubiquitinating enzymes
  • the cleavage of Ubiquitin by DUBs is supposed to happen at the very C-terminus of Ubiquitin (after G76).
  • an "individual,” “subject” or “patient” is a vertebrate.
  • the vertebrate is a mammal.
  • Mammals include, but are not limited to, primates (including human and non- human primates) and rodents (e.g., mice and rats).
  • rodents e.g., mice and rats.
  • a subject is a human.
  • mutation is used herein as a general term and includes changes of both single base pair and multiple base pairs. Such mutations may include substitutions, frame-shift mutations, deletions, insertions and truncations.
  • nuclear localization signal refers to an amino acid sequence that marks a protein for import into the nucleus of a eukaryotic cell and includes preferably a viral nuclear localization signal such as the SV40 large T-antigen derived NLS (PPKKKR V).
  • multiple cloning site refers to a short DNA sequence containing several restriction sites for cleavage by restriction endonucleases such as Acll, Hindlll, Sspl, MluCI, Tsp509I, Pcil, Agel, BspMI, BfuAI, SexAI, Mlul, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, Afllll, Spel, Bsrl, Bmrl, Bglll, Afel, Alul, Stul, Seal, Clal, BspDI, PI-SceI, Nsil, Asel, Swal, CspCI, Mfel, BssSI, BmgBI, Pmll, Dralll, Alel, EcoP15I, PvuII, AlwNI, BtsIMutI, TspRI, Ndel, Nlalll, CviAII, Fat
  • multiple cloning site as used herein further refers to a short DNA sequence used for recombination events as e.g in Gateway cloning strategy or for methods such as Gibbson assembly or topo cloning.
  • wild type strain or wild type of the Gram-negative bacterial strain as used herein refers to a naturally occuring variant or a naturally occuring variant containing genetic modifications allowing the use of vectors, such as deletion mutations in restriction
  • strains contain chromosomal DNA as well as in some cases (e.g. Y. enterocolitica, S.flexneri) an unmodified virulence plasmid.
  • Yersinia wild type strain refers to a naturally occuring variant (as Y. enterocolitica E40) or a naturally occuring variant containing genetic modifications allowing the use of vectors, such as deletion mutations in restriction endonucleases or antibiotic resistance genes (as Y. enterocolitica MRS40, the Ampicillin sensitive derivate of Y.
  • enterocolitica E40 These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV).
  • Y. enterocolitica subspecies palearctica refers to the low-pathogenic Y. enterocolitica strains, which are in contrast to the higher virulent strains of subspecies enterocolitica [12,13] .
  • Y. enterocolitica subsp. palearctica lack, in comparison to Y. enterocolitica subsp. enterocolitica, a high-pathogenicity island (HPI). This HPI encodes the iron siderophore called yersiniabactin [14].
  • HPI high-pathogenicity island
  • the lack of yersiniabactin in Y. enterocolitica subsp. palearctica renders this subspecies less pathogenic and dependent on induced systemic accessible iron for persistent infection in e.g. liver or spleen [14]. Iron can be made accessible for the bacteria in an individual e.g by pretreatment with deferoxamine, an iron chelator used to treat iron overload in patients [15].
  • the term "about” refers to a range of values ⁇ 10% of a specified value.
  • the phrase "about 200” includes ⁇ 10% of 200, or from 180 to 220.
  • the present invention provides a recombinant virulence attenuated Gram- negative bacterial strain transformed with a vector which comprises in the 5' to 3' direction: a promoter;
  • the method comprising administering to the subject said recombinant virulence attenuated Gram-negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the present invention provides a recombinant virulence attenuated Gram- negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, for use in a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram- negative bacterial strain accumulates in the malignant solid tumor, the method comprising administering to the subject said recombinant virulence attenuated Gram-negative bacterial strain, wherein the recombinant virulence attenuated Gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.
  • the recombinant virulence attenuated Gram- negative bacterial strain which is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or which is deficient in the production of at least one bacterial protein which is part of a secretion system machinery is transformed with a vector which comprises in the 5 ' to 3 ' direction:
  • the recombinant virulence attenuated Gram- negative bacterial strain or the recombinant virulence attenuated Gram-negative bacterial strain which is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or which is deficient in the production of at least one bacterial protein which is part of a secretion system machinery, is transformed with a vector which comprises in the 5 ' to 3 ' direction:
  • the DNA sequence encoding a heterologous protein is flanked on its 3' end by a DNA sequence homologous to the DNA sequence of the chromosome or of the endogenous virulence plasmid at the 3 ' end of the delivery signal from a bacterial effector protein or to a fragment therof.
  • this DNA sequence flanking the homologous protein on its 3' end is homologous to the DNA sequence and is lying within lOkbp on the chromosome or on an endogenous virulence plasmid at the 3' end of the delivery signal from a bacterial effector protein or to a fragment therof.
  • this nucleotide sequence flanking the homologous protein on its 3' end is homologous to the DNA sequence and is within the same operon on the chromosome or on an endogenous virulence plasmid as the delivery signal from a bacterial effector protein or a fragment therof.
  • transformation is usually performed so that the fused first and the second DNA sequence are inserted by homologous recombination on an endogenous virulence plasmid or a
  • chromosome preferably on an endogenous virulence plasmid, of the recombinant virulence attenuated Gram-negative bacterial strain, and the fused first and the second DNA sequence is operably linked to a promoter of an endogenous virulence plasmid or of a chromosomee e.g. of a chromosomal pathogenicity island.
  • the fused first and the second DNA sequence is operably linked to a promoter of an endogenous virulence plasmid.
  • the first DNA sequence comprises a delivery signal or fragment thereof from a bacterial effector protein, preferably a fragment thereof, which provides for homologous recombination at the homologous site at the chromosome or at an endogenous virulence plasmid to result in the second DNA sequence be placed in frame to the 3 'end of the chromosomal or endogenous virulence plasmid delivery signal which is opratively linked to the endogenous promoter.
  • the recombinant virulence attenuated Gram- negative bacterial strain or the recombinant virulence attenuated Gram-negative bacterial strain which is deficient in the production of at least one bacterial effector protein which is virulent toward eukaryotic cells or which is deficient in the production of at least one bacterial protein which is part of a secretion system machinery is transformed with a nucleotide molecule, preferably a DNA nucleotide molecule, comprising a nucleotide sequence encoding a heterologous protein and a nucleotide sequence which is homologous or identical to a nucleotide sequence encoding a delivery signal from a bacterial effector protein or which is homologous or identical to a nucleotide sequence encoding a fragment of a delivery signal from a bacterial effector protein, wherein the delivery signal from a bacterial effector protein is encoded on the chromosome or on an endogenous
  • the nucleotide sequence which is homologous or identical to a nucleotide sequence of a delivery signal from a bacterial effector protein or to a fragment thereof is located on the 5' end of the nucleotide sequence encoding a heterologous protein. More preferably the nucleotide sequence encoding a heterologous protein is flanked on its 3' end by a nuceleotide sequence homologous to the DNA sequence of the chromosome or of the endogenous virulence plasmid at the 3' end of the delivery signal from a bacterial effector protein or to a fragment therof.
  • this nucleotide sequence flanking the homologous protein on its 3' end is homologous to the DNA sequence lying within lOkbp on the chromosome or on an endogenous virulence plasmid at the 3' end of the delivery signal from a bacterial effector protein or to a fragment therof.
  • homologous protein on its 3' end is homologous to the DNA sequence is within the same operon on the chromosome or on an endogenous virulence plasmid as the delivery signal from a bacterial effector protein or a fragment therof.
  • transformation is usually performed so that the nucleotide sequence encoding a heterologous protein is inserted on an endogenous virulence plasmid or a chromosome of the recombinant virulence attenuated Gram-negative bacterial strain at the 3 'end of a delivery signal from a bacterial effector protein encoded by the chromosome or the endogenous virulence plasmid, wherein the heterologous protein fused to the delivery signal is expressed and secreted.
  • the endogenous virulence plasmid for insertion is pYV (plasmid of Yersinia Virulence).
  • the endogenous location for insertion is one of the gene clusters called Spil or Spill (for Salmonella pathogenicity island), a position where an effector protein is elsewhere encoded or alternatively one of the Salmonella virulence plasmids (SVPs).
  • the first and the second DNA sequence or the nucleotide molecule are inserted on an endogenous virulence plasmid at the native site of a bacterial effector protein e.g. at the native site of a virulence factor, preferably in case the recombinant virulence attenuated Gram-negative bacterial strain is a Yersinia strain, at the native site of YopE or another Yop (YopH, YopO, YopP, YopM, YopT), prefereably at the native site of YopE or in case the recombinant virulence attenuated Gram-negative bacterial strain is a Salmonella strain at the native site of an effector protein encoded within Spil, Spill or encoded elswhere, preferably at the native site of an effector protein encoded within Spil or Spill, more preferably at the native site of SopE or SteA.
  • the first and the second DNA sequence or the nucleotide molecule are operably linked to a native promoter of a bacterial effector protein present on an endogenous virulence plasmid e.g. in case the recombinant virulence attenuated Gram-negative bacterial strain is a Yersinia strain to a native promoter from a Yersinia virulon gene as outlined below, more preferably to the native YopE promoter or another Yop (YopH, YopO, YopP, YopM, YopT) promoter, prefereably to the native YopE promoter or in case the recombinant virulence attenuated Gram-negative bacterial strain is a Salmonella strain to a native promoter from Spil or Spill pathogenicity island or from an effector protein elsewhere encoded as outlined below, more preferably to the native SopE, InvB or SteA promoter.
  • the recombinant virulence attenuated Gram- negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas. In one embodiment the recombinant virulence attenuated Gram-negative bacterial strain is selected from the group consisting of the genera Yersinia and Salmonella. Preferably the recombinant virulence attenuated Gram-negative bacterial strain is a Yersinia strain, more preferably a Yersinia enterocolitica strain.
  • Yersinia enterocolitica E40 (0:9, biotype 2) [16] or Ampicilline sensitive derivates therof as Y. enterocolitica MRS40 (also named Y. enterocolitica subsp. palearctica MRS40) as described in [17].
  • Y. enterocolitica E40 and its derivate Y. enterocolitica MRS40 as described in [17] is identical to Y. enterocolitica subsp. palearctica E40 and its derivate Y. enterocolitica subsp. palearctica MRS40 as described in [12,14,18].
  • the recombinant virulence attenuated Gram-negative bacterial strain is a Salmonella strain, more preferably a Salmonella enterica strain. Most preferred is Salmonella enterica Serovar Typhimurium SL1344 as described by the Public health England culture collection (NCTC 13347).
  • the recombinant virulence attenuated Gram- negative bacterial strain is a strain which does not produce a siderophore e.g. is deficient in the production of a siderophore, preferably does not produce siderophores e.g. is deficient in the production of any siderophore.
  • a strain is for example Y. enterocolitica subsp.
  • the delivery signal from a bacterial effector protein comprises a bacterial effector protein or a N-terminal fragment thereof.
  • the delivery signal from a bacterial effector protein is a bacterial T3SS effector protein comprising a bacterial T3SS effector protein or a N-terminal fragment thereof wherein the T3SS effector protein or a N-terminal fragment thereof may comprise a chaperone binding site.
  • a T3SS effector protein or a N-terminal fragment thereof which comprises a chaperone binding site is particular useful as delivery signal in the present invention.
  • T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, YopE, ExoS, SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC, SifA, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, Ospl, IpaH, SspHl,VopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2, HopAOl, HopPtoD2, HopUl, GALA family of proteins, AvrBs2, AvrDl, AvrBS3, YopO, YopP, YopE, Yop
  • T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, YopE, ExoS, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM, YopT, whereof most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of IpgBl , SopE, SopB, SptP, OspF, IpgD, YopH, YopO, YopP, YopE, YopM, YopT, in particular YopE or an N-terminal fragment thereof.
  • T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, SteA, SipA, SipB, SipD, SopA, SopB, SopD, IpgB 1 , IpgD, SipC, SifA, SifB, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir,
  • T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, SteA, SifB, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopT, whereof equally most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of IpgBl, SopE, SopB, SptP, SteA, SifB, OspF, IpgD, YopH, YopO, YopP, YopE, and YopT, in particular SopE, SteA, or YopE or an N-terminal fragment thereof, more particular SteA
  • the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises the bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the N-terminal fragment thereof includes at least the first 10, preferably at least the first 20, more preferably at least the first 100 amino acids of the bacterial T3SS effector protein.
  • the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises the bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the bacterial T3SS effector protein or the N-terminal fragment thereof comprises a chaperone binding site.
  • T3SS effector proteins or a N-terminal fragment thereof, which comprise a chaperone binding site comprise the following combinations of chaperone binding site and T3SS effector protein or N-terminal fragment thereof: SycE -YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO-YopO, SycN/YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF, SycD- YopB, SycD-YopD.
  • a YopE or an N- terminal fragment thereof comprising the SycE chaperone binding site such as an N-terminal fragment of a YopE effector protein containing the N-terminal 138 amino acids of the YopE effector protein designated herein as YopEi_i 3 8 and as shown in SEQ ID NO.
  • the recombinant virulence attenuated Gram- negative bacterial strain is a Yersinia strain and the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises a YopE effector protein or an N-terminal part, preferably the Y. enterocolitica YopE effector protein or an N-terminal part thereof .
  • the SycE binding site is comprised within the N-terminal part of the YopE effector protein.
  • an N-terminal fragment of a YopE effector protein may comprise the N-terminal 12, 16, 18, 52, 53, 80 or 138 amino acids [19-21].
  • YopEi_i 3 8 an N-terminal fragment of a YopE effector protein containing the N-terminal 138 amino acids of the YopE effector protein e.g. as described in Forsberg and Wolf-Watz [22] designated herein as YopEi_i 3 8 and as shown in SEQ ID NO.: 2.
  • the recombinant virulence attenuated Gram- negative bacterial strain is a Salmonella strain and the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises a SopE or SteA effector protein or an N-terminal part thereof, preferably the Salmonella enterica SopE or SteA effector protein or an N-terminal part thereof .
  • the chaperon binding site is comprised within the N-terminal part of the SopE effector protein.
  • an N- terminal fragment of a SopE effector protein protein may comprise the N-terminal 81 or 105 amino acids.
  • Most preferred is the full length SteA and an N-terminal fragment of a SopE effector protein containing the N-terminal 105 amino acids of the effector protein e.g. as described in SEQ ID NO. 142 or 143.
  • polypeptide sequences from e.g. various portions of the Yop proteins can be fused in- frame to a reporter enzyme such as the calmodulin-activated adenylate cyclase domain (or Cya) of the Bordetella pertussis cyclolysin. Delivery of a Yop- Cya hybrid protein into the cytosol of eukaryotic cells is indicated by the appearance of cyclase activity in the infected eukaryotic cells that leads to the accumulation of cAMP.
  • preferred delivery signals of the present invention consists of at least the minimal sequence of amino acids of a T3SS effector protein that is capable of delivering a protein.
  • the present invention provides recombinant virulence attenuated Gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain, which is deficient in producing at least one bacterial effector protein which is virulent toward eukaryotic cells, accumulates in the malignant solid tumor.
  • the recombinant virulence attenuated Gram-negative bacterial strains are deficient in producing at least one, preferably at least two, more preferably at least three, even more preferably at least four, in particular at least five, more particular at least six, most particular all bacterial effector proteins which are virulent toward eukaryotic cells i.e recombinant virulence attenuated Gram-negative bacterial strains which are deficient in producing at least one preferably at least two, more preferably at least three, even more preferably at least four, in particular at least five, more particular at least six, most particular all functional bacterial effector proteins which are virulent toward eukaryotic cells such that the resulting recombinant virulence attenuated Gram-negative bacterial strain produces less bacterial effector proteins or produces bacterial effector proteins to a lesser extent compared to the non virulence attenuated Gram-negative bacterial wild type strain i.e.
  • the recombinant virulence attenuated Gram-negative bacterial strains for use in a method of treating a malignant solid tumor in a subject is deficient in the production of all effector proteins which are virulent toward eukaryotic cells and the delivery signal from a bacterial effector protein is the delivery signal from a bacterial T3SS effector protein and the heterologous protein is selected from the group consisting of proteins involved in apoptosis or apoptosis regulation.
  • such a mutant Gram-negative bacterial strain i.e. such a recombinant virulence attenuated Gram-negative bacterial strain which is deficient in producing at least one bacterial effector protein which is virulent toward eukaryotic cells e.g. such a mutant Yersinia strain
  • such effector-encoding genes include YopE, YopH, YopO/Y pkA, YopM, YopP/Y opJ and YopT as far as a Yersinia strain is concerned.
  • such effector-encoding genes include AvrA, CigR, GogB, GtgA, GtgE, PipB,
  • the mutation can be generated in the promoter region of an effector-encoding gene so that the expression of such effector gene is abolished.
  • the mutation can also be generated in the coding region of an effector-encoding gene such that the catalytic activity of the encoded effector protein is abolished.
  • the "catalytic activity" of an effector protein refers normally to the anti-target cell function of an effector protein, i.e., toxicity. Such activity is governed by the catalytic motifs in the catalytic domain of an effector protein.
  • the approaches for identifying the catalytic domain and/or the catalytic motifs of an effector protein are well known by those skilled in the art. See, for example, [24,25].
  • one preferred mutation of the present invention is a deletion of the entire catalytic domain.
  • Another preferred mutation is a frameshift mutation in an effector-encoding gene such that the catalytic domain is not present in the protein product expressed from such "frameshifted" gene.
  • a most preferred mutation is a mutation with the deletion of the entire coding region of the effector protein.
  • Other mutations are also contemplated by the present invention, such as small deletions or base pair substitutions, which are generated in the catalytic motifs of an effector protein leading to destruction of the catalytic activity of a given effector protein.
  • the mutations that are generated in the genes of the functional bacterial effector proteins may be introduced into the particular strain by a number of methods.
  • One such method involves cloning a mutated gene into a "suicide" vector which is capable of introducing the mutated sequence into the strain via allelic exchange.
  • a "suicide" vector is described by [26].
  • mutations generated in multiple genes may be introduced successively into a Gram-negative bacterial strain giving rise to polymutant, e.g a sixtuple mutant recombinant strain.
  • polymutant e.g a sixtuple mutant recombinant strain.
  • the order in which these mutated sequences are introduced is not important. Under some circumstances, it may be desired to mutate only some but not all of the effector genes.
  • the present invention further contemplates polymutant Yersinia other than sixtuple-mutant Yersinia, e.g., double-mutant, triple-mutant, quadruple-mutant and quintuple- mutant strains.
  • the secretion and translocation system of the instant mutant strain needs to be intact.
  • a preferred recombinant virulence attenuated Gram-negative bacterial strain of the present invention is a sixtuple-mutant Yersinia strain in which all the effector-encoding genes are mutated such that the resulting Yersinia no longer produce any functional effector proteins.
  • Such sixtuple-mutant Yersinia strain is designated as AyopH,0,P,E,M,T for Y. enter ocolitica.
  • Such a sixtuple-mutant can be produced from the Y. enterocolitica MRS40 strain giving rise to Y. enterocolitica MRS40 AyopH,0,P,E,M,T, (also named Y.
  • Y. enterocolitica MRS40 AyopH,0,P,E,M,T Aasd also named Y.
  • Vectors which can be used according to the invention to transform a Gram-negative bacterial strain depend on the Gram-negative bacterial strains used as known to the skilled person. Promoter, heterologous protein and protease cleavage site as described herein can be used for the vector of the recombinant virulence attenuated Gram-negative bacterial strain.
  • Vectors which can be used according to the invention include expression vectors (including synthetic or otherwise generated modified versions of endogenous virulence plasmids), vectors for chromosomal or virulence plasmid insertion and DNA fragments for chromosomal or virulence plasmid insertion. Expression vectors which are useful in e.g.
  • Yersinia, Escherichia, Salmonella or Pseudomonas strain are e.g pUC, pBad, pACYC, pUCP20 and pET plasmids.
  • Vectors for chromosomal or virulence plasmid insertion which are useful in e.g. Yersinia, Escherichia, Salmonella or Pseudomonas strain are e.g pK GlOl .
  • DNA fragments for chromosomal or virulence plasmid insertion refer to methods used in e.g. Yersinia,
  • Escherichia, Salmonella or Pseudomonas strain as e.g. lambda-red genetic engineering.
  • Vectors for chromosomal or virulence plasmid insertion or DNA fragments for chromosomal or virulence plasmid insertion may insert the first, second and/or third DNA sequence of the present invention so that the first, second and/or third DNA sequence is operably linked to an endogenous promoter of the recombinant virulence attenuated Gram-negative bacterial strain.
  • an endogenous promoter can be encoded on the endogenous bacterial DNA (chromosomal or plasmid DNA) and only the first and second DNA sequence will be provided by the engineered vector for chromosomal or virulence plasmid insertion or DNA fragment for chromosomal or virulence plasmid insertion.
  • a vector for chromosomal or virulence plasmid insertion or a nucleotide molecule such as e.g.
  • a DNA sequence for chromosomal or virulence plasmid insertion is used, an endogenous promoter and the delivery signal from a bacterial effector protein can be encoded on the endogenous bacterial DNA (chromosomal or plasmid DNA) and only the nucleotide molecule such as e.g. a DNA sequence encoding the heterologous protein will be provided by a vector for chromosomal or virulence plasmid insertion or by a nucleotide molecule such as e.g. a DNA sequence for chromosomal or virulence plasmid insertion.
  • a promoter is not necessarily needed to be comprised by the vector used for transformation of the recombinant virulence attenuated Gram-negative bacterial strains i.e. the recombinant virulence attenuated Gram-negative bacterial strains of the present invention may be transformed with a vector which dose not comprise a promoter.
  • the vector of the present invention comprises in the 5 ' to 3 ' direction:
  • a preferred vector e.g. a preferred expression vector for Yersinia is selected from the group consisting of pBad Si l and pBad_Si_2.
  • pBad_Si2 was constructed by cloning of the SycE- YopEi_i38 fragment containing endogenous promoters for YopE and SycE from purified pYV40 into Kpnl/Hindlll site of pBad-MycHisA (Invitrogen).
  • pBad Sil is equal to pBad_Si2 but encodes EGFP amplified from pEGFP-Cl (Clontech) in the NcoI/BgUI site under the Arabinose inducible promoter.
  • a preferred vector e.g. a preferred expression vector for Salmonella is selected from the group consisting of pSi_266, pSi_267, pSi_268 and pSi_269.
  • Plasmids pSi_266, pSi_267, pSi_268 and pSi_269 containing the corresponding endogenous promoter and the SteAi_ 2 o fragment (pSi_266), the full length SteA sequence (pSi_267), the SopEi_ 8 i fragment (pSi_268) or the So Ei_io5 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into Ncol/Kpnl site of pBad-MycHisA (Invitrogen).
  • the vectors of the instant invention may include other sequence elements such as a 3' termination sequence (including a stop codon and a poly A sequence), or a gene conferring a drug resistance which allows the selection of transformants having received the instant vector.
  • the vectors of the present invention may be transformed by a number of known methods into the recombinant virulence attenuated Gram-negative bacterial strains.
  • the methods of transformation for introducing a vector include, but are not limited to, electroporation, calcium phosphate mediated transformation, conjugation, or combinations thereof.
  • a vector can be transformed into a first bacteria strain by a standard electroporation procedure.
  • Such a vector can be transferred from the first bacteria strain into the desired strain by conjugation, a process also called "mobilization".
  • Transformant i.e., Gram-negative bacterial strains having taken up the vector
  • antibiotics antibiotics
  • the promoter of the vector of the recombinant virulence attenuated Gram-negative bacterial strain of the invention can be a native promoter of a T3SS effector protein of the respective strain or a compatible bacterial strain or a promoter used in expression vectors which are useful in e.g. Yersinia, Escherichia,
  • Such promoters are the T7 promoter, Plac promoter or the arabinose inducible Ara-bad promoter.
  • the promoter can be from a Yersinia virulon gene.
  • a "Yersinia virulon gene” refers to genes on the Yersinia pYV plasmid, the expression of which is controlled both by temperature and by contact with a target cell.
  • Such genes include genes coding for elements of the secretion machinery (the Ysc genes), genes coding for translocators (YopB, YopD, and LcrV), genes coding for the control elements (YopN, TyeA and LcrG), genes coding for T3SS effector chaperones (SycD, SycE, SycH, SycN, SycO and SycT), and genes coding for effectors (YopE, YopH, YopO/Y pkA, YopM, YopT and YopP/Y op J) as well as other pYV encoded proteins as VirF and YadA.
  • the Ysc genes genes coding for elements of the secretion machinery
  • the Ysc genes genes coding for translocators (YopB, YopD, and LcrV)
  • genes coding for the control elements YopN, TyeA and LcrG
  • the promoter is the native promoter of a T3SS functional effector encoding gene. If the recombinant virulence attenuated Gram- negative bacterial strain is a Yersinia strain the promoter is selected from any one of YopE, YopH, YopO/Y pkA, YopM and YopP/Y opJ. More preferably, the promoter is from YopE or SycE.
  • the promoter can be from Spil or Spill pathogenicity island or from an effector protein elsewhere encoded.
  • genes include genes coding for elements of the secretion machinery, genes coding for translocators, genes coding for the control elements, genes coding for T3SS effector chaperones, and genes coding for effectors as well as other proteins encoded by SPI-1 or SPI-2.
  • the promoter is the native promoter of a T3SS functional effector encoding gene. If the recombinant virulence attenuated Gram-negative bacterial strain is a Salmonella strain the promoter is selected from any one of the effector proteins. More preferably, the promoter is from SopE, InvB or SteA.
  • the vector e.g the expression vector comprises a DNA sequence encoding a protease cleavage site.
  • Generation of a functional and generally applicable cleavage site allows cleaving off the delivery signal after translocation.
  • the delivery signal can interfere with correct localization and/or function of the translocated protein within the target cells the introduction of a protease cleavage site between the delivery signal and the protein of interest provides for the first time delivery of almost native proteins into eukaryotic cells.
  • the protease cleavage site is an amino acid motif which is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease 3C, TEV protease, TVMV protease, FactorXa protease and thrombin, more preferably an amino acid motif which is cleaved by TEV protease.
  • a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease 3C, TEV protease, TVMV protease, FactorXa protease and thrombin, more preferably an amino acid motif which is cleaved by TEV protease.
  • the protease cleavage site is an amino acid motif which is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease 3C, TEV protease, TVMV protease, FactorXa protease, ubiquitin processing protease, called Deubiquitinating enzymes, and thrombin. Most preferred is an amino acid motif which is cleaved by TEV protease or by an ubiquitin processing protease.
  • the heterologous protein is cleaved from the delivery signal from a bacterial T3SS effector protein by a protease.
  • Preferred methods of cleavage are methods wherein: a) the protease is translocated into the eukaryotic cell by a recombinant virulence attenuated Gram-negative bacterial strain as described herein which expresses a fusion protein which comprises the delivery signal from the bacterial T3SS effector protein and the protease as heterologous protein; or
  • the protease is expressed constitutively or transiently in the eukaryotic cell.
  • the vector comprises a further DNA sequence encoding a labelling molecule or an acceptor site for a labelling molecule.
  • the further DNA sequence encoding a labelling molecule or an acceptor site for a labelling molecule is usually fused to the 5' end or to the 3' end of the second DNA sequence.
  • a preferred labelling molecule or an acceptor site for a labelling molecule is selected from the group consisting of enhanced green fluourescent protein (EGFP), coumarin, coumarin ligase acceptor site, resorufm, resurofm ligase acceptor site, the tetra-Cysteine motif in use with FlAsH/ReAsH dye (life technologies). Most preferred is resorufin and a resurofm ligase acceptor site or EGFP.
  • EGFP enhanced green fluourescent protein
  • coumarin coumarin
  • coumarin ligase acceptor site resorufm
  • resurofm ligase acceptor site the tetra-Cysteine motif in use with FlAsH/ReAsH dye (life technologies).
  • Most preferred is resorufin and a resurofm ligase acceptor site or EGFP.
  • a labelling molecule or an acceptor site for a labelling molecule will lead to the attachment of a labelling molecule to the heterologous protein of interest, which will then be delivered as such into the eukaryotic cell and enables tracking of the protein by e.g. live cell microscopy.
  • the vector comprises a further DNA sequence encoding a peptide tag.
  • the further DNA sequence encoding a peptide tag is usually fused to the 5 ' end or to the 3 ' end of the second DNA sequence.
  • a preferred peptide tag is selected from the group consisting of Myc-tag, His-tag, Flag-tag, HA tag, Strep tag or V5 tag or a combination of two or more tags out of these groups. Most preferred is Myc-tag, Flag-tag, His-tag and combined Myc- and His-tags.
  • the use of a peptide tag will lead to traceability of the tagged protein e.g by immunofluorescence or Western blotting using anti-tag antibodies.
  • a peptide tag allows affinity purification of the desired protein either after secretion into the culture supernatant or after translocation into eukaryotic cells, in both cases using a purification method suiting the corresponding tag (e.g. metal-chelate affinity purification in use with a His-tag or anti-Flag antibody based purification in use with the Flag- tag).
  • the vector comprises a further DNA sequence encoding a nuclear localization signal (NLS).
  • the further DNA sequence encoding a nuclear localization signal (NLS) is usually fused to the 5 'end or to the 3 'end of the second DNA sequence wherein said further DNA sequence encodes a nuclear localization signal (NLS).
  • a preferred NLS is selected from the group consisting of SV40 large T-antigen NLS and derivates thereof [27] as well as other viral NLS. Most preferred is SV40 large T-antigen NLS and derivates thereof.
  • the vector comprises a multiple cloning site.
  • the multiple cloning site is usually located at the 3 'end of the first DNA sequence and/or at the 5 'end or 3 'end of the second DNA sequence.
  • One or more than one multiple cloning sites can be comprised by the vector.
  • a preferred multiple cloning site is selected from the group of restriction enzymes consisting of Xhol, Xbal, Hindlll, Ncol, Notl, EcoRI, EcoRV, BamHI, Nhel, Sad, Sail, BstBI. Most preferred is Xbal, Xhol, BstBI and Hindlll.
  • the fused protein expressed from the first and second and optional third DNA sequences of the vector is also termed as a "fusion protein” or a "hybrid protein", i.e., a fused protein or hybrid of delivery signal and a heterologous protein.
  • the fusion protein can also comprise e.g. a delivery signal and two or more different heterologous proteins.
  • the present invention contemplates methods for delivering heterologous proteins as hereinabove described into cells of a malignant solid tumor.
  • the proteins may be delivered i.e. translocated into the cell of a malignant solid tumor at the time of administering the recombinant virulence attenuated Gram-negative bacterial strain to a subject or may be delivered i.e. translocated into the cell of a malignant solid tumor at a later time e.g. after the the recombinant virulence attenuated Gram-negative bacterial strain has reached the site of the malignant solid tumor and/or has reached the site of the malignant solid tumor and has replicated as described above.
  • the time of delivery can be regulated e.g by the promoter used to express the heterologous proteins in the recombinant virulence attenuated Gram-negative bacterial strain.
  • a constitutive promoter or, more preferred, an endogenous promoter of a bacterial effector protein might drive the heterologous protein.
  • an artificially inducible promoter as the arabinose inducible promoter, might drive the heterologous protein.
  • arabinose will be administered to a subject once bacteria have reached and accumulated at the desired site. Arabinose will then induce the bacterial expression of the protein to be delivered.
  • a fusion protein which comprises a delivery signal from a bacterial effector protein and the heterologous protein is expressed by the recombinant virulence attenuated Gram-negative bacterial strain and is translocated into the cell of a malignant solid tumor;
  • cleaving the fusion protein so that the heterologous protein is cleaved from the delivery signal from the bacterial effector protein inside of the cell of a malignant solid tumor.
  • At least two fusion proteins which comprise each a delivery signal from a bacterial effector protein and a heterologous protein are expressed by the recombinant virulence attenuated Gram-negative bacterial strain and are translocated into the eukaryotic cell by the methods of the present inventions.
  • the recombinant virulence attenuated Gram-negative bacterial strain can be cultured so that a fusion protein is expressed which comprises the delivery signal from the bacterial effector protein and the heterologous protein according to methods known in the art (e.g. FDA,
  • Bacteriological Analytical Manual (BAM), chapter 8: Yersinia enterocolitica).
  • BAM Bacteriological Analytical Manual
  • the recombinant virulence attenuated Gram-negative bacterial strain can be cultured in Brain Heart infusion broth e.g. at 28°C.
  • bacteria can be grown at 37°C.
  • the cell of a malignant solid tumor is contacted with two recombinant virulence attenuated Gram-negative bacterial strains of i), wherein the first recombinant virulence attenuated Gram-negative bacterial strain expresses a first fusion protein which comprises the delivery signal from the bacterial T3SS effector protein and a first heterologous protein and the second recombinant virulence attenuated Gram-negative bacterial strain expresses a second fusion protein which comprises the delivery signal from the bacterial effector protein and a second heterologous protein, so that the first and the second fusion protein are translocated into the cell of a malignant solid tumor.
  • This embodiment provided for co-infection of e.g a cell of a malignant solid tumor with two bacterial strains as a valid method to deliver e.g. two different hybrid proteins into single cells to address their functional interaction.
  • Those skilled in the art can also use a number of assays to determine whether the delivery of a fusion protein is successful.
  • the fusion protein may be detected via
  • determination can also be based on the enzymatic activity of the protein being delivered, e.g., the assay described by [16].
  • the present invention also provides a pharmaceutical composition comprising a recombinant virulence attenuated Gram-negative bacterial strain for use in a method of treating a malignant solid tumor in a subject, wherein the recombinant virulence attenuated Gram-negative bacterial strain accumulates in the malignant solid tumor.
  • the recombinant virulence attenuated Gram-negative bacteria can be compounded for convenient and effective administration in an amount that is sufficient to treat the subject as pharmaceutical composition with a suitable pharmaceutically acceptable carrier.
  • a unit dosage form of the recombinant virulence attenuated Gram-negative bacteria or of the pharmaceutical composition to be administered can, for example, contain the recombinant virulence attenuated Gram-negative bacteria in an amount from about 10 5 to about 10 9 bacteria per ml, preferably about 10 6 to about 10 8 bacteria per ml, more preferably about 10 7 to about 10 8 bacteria per ml, most preferably about 10 8 bacteria per ml.
  • an effective amount of a bacterium or bacteria is meant to be an amount of a bacterium or bacteria, high enough to significantly positively modify the condition to be treated but low enough to avoid serious side effects (at a reasonable benefit/risk ratio), within the scope of sound medical judgment.
  • An effective amount of a bacterium will vary with the particular goal to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy and the specific bacterium employed. The effective amount of a bacterium will thus be the minimum amount, which will provide the desired effect. Usually an amount from about 10 5 to about 10 9 bacteria e.g.
  • bacteria/m 2 body surface preferably from about 10 5 to about 10 9 bacteria/m 2 body surface, preferably from about 10 6 to about 10 8 bacteria e.g. from about 10 6 to about 10 8 bacteria/m 2 body surface, more preferably from about 10 7 to about 10 8 bacteria e.g. from
  • a single dose of the recombinant virulence attenuated Gram-negative bacterial strain to administer to a subject, e.g. to a human to treat a malignant solid tumor is usually from about 10 4 to about 10 10 bacteria e.g. from about 10 4 bacteria/m 2 body surface to about 10 10 bacteria/m 2 body surface, preferably from about 10 5 to about 10 9 bacteria e.g. from about 10 5 to about 10 9 bacteria/m 2 body surface, more preferably from about 10 6 to about 10 8 bacteria e.g. from about 10 6 to about 10 8 bacteria/m 2 body surface, even more preferably from about
  • 10 7 to about 108 bacteria e.g. from about 107 to about 108 bacteria/m 2 body surface, most preferably 10 8 bacteria e.g. 10 8 bacteria/m 2 body surface of total recombinant virulence attenuated Gram-negative bacteria.
  • substances which can serve as pharmaceutical carriers are sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethycellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols such as propylene glycol, glycerine, sorbitol, manitol, and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline; cranberry extracts and phosphate buffer solution; skim milk powder; as well as other non-toxic compatible substances used in pharmaceutical formulations such as Vitamin C, estrogen and echinacea, for example.
  • sugars such as lac
  • Modes of adminstration of the recombinant virulence attenuated Gram-negative bacteria to a subject may be selected from the group consisting of intravenous, intratumoral, intraperitoneal and per-oral administration. Although this invention is not intended to be limited to any particular mode of application, intravenous or intratumoral administration of the bacteria or the pharmaceutiacal compositions is preferred.
  • the active ingredients which comprise bacteria may be required to be coated in a material to protect said organisms from the action of enzymes, acids and other natural conditions which may inactivate said organisms.
  • they should be coated by, or administered with, a material to prevent inactivation.
  • bacteria may be co-administered with enzyme inhibitors or in liposomes.
  • Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP) and trasylol.
  • Liposomes include water-in-oil-in- water P40 emulsions as well as conventional and specifically designed liposomes which transport bacteria, such as Lactobacillus, or their by-products to an internal target of a host subject.
  • bacteria such as Lactobacillus
  • One bacterium may be administered alone or in conjunction with a second, different bacterium. Any number of different bacteria may be used in conjunction.
  • in conjunction with is meant together, substantially simultaneously or sequentially.
  • the compositions may be also administered in the form of tablet, pill or capsule, for example, such as a freeze-dried capsule comprising the bacteria or the pharmaceutiacal compositions of the present invention or as frozen solution of bacteria or the pharmaceutiacal compositions of the present invention containing DMSO or glycerol.
  • Another preferred form of application involves the preparation of a lyophilized capsule of the bacteria or the pharmaceutiacal compositions of the present invention. Still another preferred form of application involves the preparation of a heat dried capsule of the bacteria or the pharmaceutiacal compositions of the present invention.
  • the recombinant virulence attenuated Gram-negative bacteria or the pharmaceutical composition to be administered can be administered by injection.
  • forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion.
  • a coating such as lecithin
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the recombinant virulence attenuated Gram- negative bacterial strain is co-administered with a siderophore to the subject.
  • Siderophores which can be co-administered are siderophores including hydroxamate, catecholate and mixed ligand siderophores.
  • Preferred siderophores are Deferoxamine (also known as desferoxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), Desferoxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer) and
  • Deferiprone (Ferriprox), more preferred is Deferoxamine.
  • Deferoxamine is a bacterial siderophore produced by the Actinobacteria Streptomyces pilosus and is commercially available from e.g. Novartis Pharma Sau AG (Switzerland).
  • Co-administration with a siderophore can be before, simultaneous to or after administration of the recombinant virulence attenuated Gram-negative bacterial strain.
  • a siderophore is administered before the administration of recombinant virulence attenuated Gram-negative bacterial strain, more preferabyly is administered at least 1 hour, preferably at least 6 hours, more preferably at least 12, hours, in particular at least 24 hours before the administration of the recombinant virulence attenuated Gram-negative bacterial strain to the subject.
  • the subject is pretreated with desfreoxamine 24h prior to infection with the recombinant virulence attenuated Gram-negative bacterial strain in order to allow bacterial growth.
  • a siderophore is co-administered at a single dose from about 0.5xl0 "5 Mol to about lxl 0 "3 Mol, more preferably from about lxlO "5 Mol to about lxl 0 "4 Mol preferably from about 3.5xl0 "5 Mol to about 1. lxlO "4 Mol per kg of body weight.
  • desferoxamine is co-administered at single dose from about 20 mg to about 60 mg preferably from about 20 mg to about 60 mg per kg of body weight.
  • Dosis regimens of the administration of the recombinant virulence attenuated Gram-negative bacterial strain or the pharmaceutical composition described herein will vary with the particular goal to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of concurrent therapy and the specific bacterium employed, as known to the skilled person.
  • the recombinant virulence attenuated Gram-negative bacterial strain is usually administered to the subject according to a dosing regimen consisting of a single dose every 2-20 days, preferably every 6-10 days, more preferably every 7-9 days, preferably according to a dosing regimen consisting of a single dose every 2-8 weeks, preferably every 2-6 weeks, more preferably every 3-4 weeks.
  • the period of administration is usually about 20 to about 60 days, preferably about 30-40 days.
  • the period of administration is usually about 8 to about 32 weeks, preferably about 8 to about 24 weeks, more preferably about 12 to about 16 weeks.
  • kits for treating malignant solid tumors, preferably in human.
  • kits generally will comprise the recombinant virulence attenuated Gram-negative bacterial strain or the pharmaceutical composition described herein, and instructions for using the kit.
  • kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) including one of the separate elements to be used in a method described herein.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers are formed from a variety of materials such as glass or plastic.
  • E. coli Top 10 used for plasmid purification and cloning
  • E. coli SmlO ⁇ pir used for conjugation
  • E. coli BW19610 [28] used to propagate pK GlOl
  • Ampicillin was used at a concentration of 200 ⁇ g/ml ⁇ Yersinia) or 100 ⁇ g/ml (E. coli) to select for expression vectors.
  • Streptomycin was used at a concentration of 100 ⁇ g/ml to select for suicide vectors. Y.
  • enterocolitica MRS40 (0:9, biotype 2) [17] a non Ampicillin resistant E40-derivate [16] and strains derived thereof were routinely grown on Brain Heart Infusion (BHI; Difco) at RT.
  • BHI Brain Heart Infusion
  • Nalidixic acid was added (35 ⁇ g/ml) and all Y. enterocolitica asd strains were additionally supplemented with 100 ⁇ g/ml meso-2,6-Diaminopimelic acid (mDAP, Sigma Aldrich).
  • S. enterica SL1344 were routinely grown on LB agar plates and in LB broth at 37°C. Ampicillin was used at a concentration of 100 ⁇ g/ml to select for expression vectors in S. enterica.
  • Y. enterocolitica Genetic manipulations of Y. enterocolitica has been described [29,30]. Briefly, mutators for modification or deletion of genes in the pYV plasmids or on the chromosome were constructed by 2-fragment overlapping PCR using purified pYV40 plasmid or genomic DNA as template, leading to 200-250 bp of flanking sequences on both sides of the deleted or modified part of the respective gene. Resulting fragments were cloned in pKNGlOl [26] in E. coli BW19610 [28]. Sequence verified plasmids were transformed into E. coli SmlO ⁇ pir, from where plasmids were mobilized into the corresponding Y.
  • enterocolitica strain Mutants carrying the integrated vector were propagated for severeal generations without selection pressure. Then sucrose was used to select for clones that have lost the vector. Finally mutants were identified by colony PCR. Specific mutators (pSi_408, pSi_419) are listed in Table III.
  • Plasmid pBad_Si2 or pBad Sil (Fig. 9) were used for cloning of fusion proteins with the N-terminal 138 amino acids of YopE (SEQ ID No. 2).
  • pBad_Si2 was constructed by cloning of the SycE-YopEi_i 3 8 fragment containing endogenous promoters for YopE and SycE from purified pYV40 into Kpnl/Hindlll site of pBad-MycHisA (Invitrogen). Additional modifications include removal of the NcoI/BgUI fragment of pBad-MycHisA by digestion, Klenow fragment treatment and religation.
  • BBa_B1006 A bidirectional transcriptional terminator (BBa_B1006; iGEM foundation) was cloned into Kpnl cut and Klenow treated (pBad_Si2) or Bglll cut site (pBad Sil). Further at the 3' end of YopEi_i 3 8 the following cleavage sites were added: Xbal-XhoI-BstBI-(Hindlll) (Fig. 9 B).
  • pBad Sil is equal to pBad_Si2 but encodes EGFP amplified from pEGFP-Cl (Clontech) in the NcoI/BgUI site under the Arabinose inducible promoter.
  • Plasmids pSi_266, pSi_267, pSi_268 and pSi_269 containing the corresponding endogenous promoter and the SteAi_ 2 o fragment (pSi_266), the full length SteA sequence (pSi_267), the SopEi_ 8 i fragment (pSi_268) or the SopEi_i 0 5 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into Ncol/Kpnl site of pBad-MycHisA (Invitrogen).
  • a universal cDNA library (Clontech) was used if not otherwise stated (Figs. 14A to N), zebrafish genes were amplified from a cDNA library (a kind gift of M. Affolter).
  • Ligated plasmids were cloned in E. coli Top 10. Sequenced plasmids were electroporated into the desired Y. enterocolitica or S. enterica strain using settings as for standard E. coli electroporation.
  • GTTAAAGCTTTCAAGATGTGATTAATGAAGAAATG 317 cagtTTCGAACCCATAAAAAAGCCCTGTC
  • Yop secretion Induction of the yop regulon was performed by shifting the culture to 37°C in BHI-Ox (secretion-permissive conditions) [31]. As carbon source glucose was added (4 mg/ml).
  • Total cell and supernatant fractions were separated by centrifugation at 20 800 g for 10 min at 4°C.
  • the cell pellet was taken as total cell fraction. Proteins in the supernatant were precipitated with trichloroacetic acid 10% (w/v) final for 1 h at 4°C. After centrifugation (20 800 g for 15 min) and removal of the supernatant, the resulting pellet was washed in ice-cold Acetone over-night. The samples were centrifuged again, the supernatant was discarded and the pellet was air-dried and resuspened in lx SDS loading dye.
  • HeLa Ccl2, swiss 3T3 fibroblast cells, 4T1, B16F10 and D2A1 were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS and 2mM L-Glutamine (cDMEM).
  • DMEM Dulbecco's modified Eagle's medium
  • cDMEM 2mM L-Glutamine
  • HUVECs were isolated and cultivated as described [33].
  • Jurkat and 4T1 cells were cultured in RPMI 1640 supplemented with 10% FCS and 2mM L-Glutamine. Y.
  • enterocolitica were grown in BHI with additives overnight at RT, diluted in fresh BHI to an OD 6 oo of 0.2 and grown for 2h at RT before a temperature shift to a 37°C waterbath shaker for further 30 min or for lh in case of delivery of EGFP. Finally, the bacteria were collected by centrifugation (6000 rcf, 30 sec) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. S.
  • enterica were grown in LB with additives overnight at 37°C and either diluted 1 :40 in fresh LB and grown for 2.5h at 37°C (Spil T3SS inducting conditions) or the overnight culture was further incubated at 37°C (Spill T3SS inducing conditions). Finally, the bacteria were collected by centrifugation (6000 rcf, 30 sec) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L- glutamine. Cells seeded in 96-well (for Immunofluorescence) or 6-well (for Western blotting) plates were infected at indicated MOIs in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine.
  • the OD 6 oo of the strains was set and the two bacterial suspensions were mixed in a tube at a ratio of 1 : 1 (if not otherwise indicated) before addition to the cells.
  • the cells were washed twice with ice-cold PBS and collected by scraping in a small volume of ice-cold PBS. After centrifugation (16 000 rcf, 5 min, 4°C) the pellet was dissolved in 0.002% digitonin supplemented with a protease inhibitor cocktail (Roche complete, Roche).
  • the dissolved pellets were incubated for 5 minutes on ice and then centrifuged (16 000 rcf, 25 min, 4°C). Supernatants were collected and analyzed for total protein content by Bradford BCA assay (Pierce) before SDS PAGE and Western blotting using an anti-Myc (Santa Cruz, 9E11) or anti-Ink4C (Cell Signaling) antibody.
  • cDMEM was changed to DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine and 100 uM 3-Isobutyl-l- methylxanthin (IBMX, Sigma Aldrich). 60 min p.i. Gentamicin was added and cells were further incubated at 37°C for another 90 min. Determination of cAMP was performed using a competitive ELISA according to the manufacturers instructions (Amersham, cAMP Biotrak, RPN225).
  • Disulfide bonds were reduced with tris(2- carboxyethyl)phosphine at a final concentration of 10 mM at 37 °C for 1 h.
  • Free thiols were alkylated with 20 mM iodoacetamide (Sigma) at room temperature for 30 min in the dark. The excess of iodoacetamide was quenched with N-acetyl cysteine at a final concentration of 25 mM for 10 min at room temperature.
  • Lys-C endopeptidase (Wako) was added to a final enzyme/protein ratio of 1 :200 (w/w) and incubated for 4 h at 37 °C.
  • the solution was subsequently diluted with 0.1 M ammoniumbicarbonate (Sigma) to a final concentration below 2 M urea and digested overnight at 37 °C with sequencing-grade modified trypsin (Promega) at a protein-to-enzyme ratio of 50: 1.
  • Peptides were desalted on a C18 Sep-Pak cartridge (Waters) and dried under vacuum. Phosphopeptides were isolated from 2 mg of total peptide mass with Ti0 2 as described previously [34]. Briefly, dried peptides were dissolved in an 80% acetonitrile (ACN)-2.5% trifluoroacetic acid (TFA) solution saturated with phthalic acid.
  • ACN 80% acetonitrile
  • TFA trifluoroacetic acid
  • Peptides were added to the same amount of equilibrated Ti0 2 (5- ⁇ bead size, GL Sciences) in a blocked Mobicol spin column (MoBiTec) that was incubated for 30 min with end-over-end rotation. The column was washed twice with the saturated phthalic acid solution, twice with 80% ACN and 0.1% TFA, and finally twice with 0.1% TFA. The peptides were eluted with a 0.3 M NH 4 OH solution. The pH of the eluates was adjusted to be below 2.5 with 5%> TFA solution and 2 M HC1. Phosphopeptides were again desalted with microspin CI 8 cartridges (Harvard Apparatus).
  • Mass spectrometry analysis was performed on a dual pressure LTQ-Orbitrap mass spectrometer equipped with a nanoelectrospray ion source (both Thermo Fisher Scientific). Each MSI scan (acquired in the Orbitrap) was followed by collision- induced dissociation (CID, acquired in the LTQ) of the 20 most abundant precursor ions with dynamic exclusion for 30 seconds. For phosphopeptide analysis the 10 most abundant precursor ions were subjected to CID with enabled multistage activation. Total cycle time was approximately 2 s. For MSI, 10 6 ions were accumulated in the Orbitrap cell over a maximum time of 300 ms and scanned at a resolution of 60,000 FWHM (at 400 m/z).
  • MS2 scans were acquired using the normal scan mode, a target setting of 10 4 ions, and accumulation time of 25 ms. Singly charged ions and ions with unassigned charge state were excluded from triggering MS2 events. The normalized collision energy was set to 32%, and one microscan was acquired for each spectrum. Label-free quantification and database searching. The acquired raw-files were imported into the Progenesis software tool (Nonlinear Dynamics, Version 4.0) for label-free quantification using the default parameters. MS2 spectra were exported directly from Progenesis in mgf format and searched using the MASCOT algorithm (Matrix Science, Version 2.4) against a decoy database [35] containing normal and reverse sequences of the predicted SwissProt entries of Homo sapiens (www.
  • the search criteria were set as follows: full tryptic specificity was required (cleavage after lysine or arginine residues unless followed by proline), 2 missed cleavages were allowed, carbamidomethylation (C) was set as fixed modification and phosphorylation (S,T,Y) or oxidation (M) as a variable modification for Ti02 enriched or not enriched samples, respectively. Finally, the database search results were exported as an xml-file and imported back to the Progenesis software for MSI feature assignment.
  • a csv-file containing the MSI peak abundances of all detected features was exported and for not enriched samples, a csv-file containing all protein measurements based on the summed feature intensities of all identified peptides per protein was created.
  • the Progenesis software was set that proteins identified by similar sets of peptides are grouped together and that only non-conflicting peptides with specific sequences for single proteins in the database were employed for protein quantification. Both files were further processed using the in-house developed SafeQuant vl .O R script (unpublished data, available at https://github.com/eahrne/SafeQuant/).
  • the software sets the identification level False Discovery Rate to 1% (based on the number of decoy protein sequence database hits) and normalizes the identified MSI peak abundances (Extracted Ion Chromatogram, XIC) across all samples, i.e. the summed XIC of all confidently identified peptide features is scaled to be equal for all LC-MS runs.
  • all quantified phosphopeptides/proteins are assigned an abundance ratio for each time point, based on the median XIC per time point. The statistical significance of each ratio is given by its q-value (False Discovery Rate adjusted p-values), obtained by calculating modified t- statistic p-values [36] and adjusting for multiple testing [37].
  • Sequence alignment was performed using EMBL-EBI web based ClustalW2 multiple sequence alignment tool at htt ://www. ebi .ac.uk ⁇ ools/msa/ clustalw2/.
  • mice 6 week old C57B1/6 and BALB/c mice were ordered from Janvier Labs. After at least one week of accommodation, mice were infected with Y. enterocolitica MRS40 ⁇ or S. typhimurium AaroA by injection into the tail vein. Throughout the experiment, mice were scored for behavior and physical appearance, and surface temperature, as well as body weight was measured. The inoculum i.v. administered to the mice was validated by dilution plating. On respective days postinfection, mice were sacrificed by C0 2 inhalation. A blood sample was immediately isolated through aspiration from the heart. Liver, spleen, lung and the tumor were isolated and their weight determined. The organs and the tumor were homogenized. CFU in each sample was determined by spotting of serial dilutions onto LB agar plates containing nalidixic acid (35 ug/ml).
  • mice were administered an 8 mg/ml desferal solution (10 ml/kg) through i.p. injection.
  • mice were infected with Y. enterocolitica MRS40 or Y. enterocolitica MRS40 ⁇ (2xl0 5 , lxlO 6 or lxl 0 7 bacteria) by injection into the tail vein.
  • the inoculum i.v. administered to the mice was validated by dilution plating.
  • tumor progression was followed by daily measurements of tumor length and width with digital calipers. Tumor volume was determined as 0.523xlenghtxwidth 2 .
  • mice were sacrificed by C0 2 inhalation.
  • a blood sample was immediately isolated through aspiration from the heart. Liver, spleen, lung and the tumor were isolated and their weight determined. The organs and the tumor were homogenized. CFU in each sample was determined by spotting of serial dilutions onto LB agar plates containing nalidixic acid (35 ug/ml).
  • enterocolitica pYV40 virulence plasmid contains the endogenous promoters of YopE and of its chaperone SycE (Fig. 9). Therfore, SycE and any YopEi_i 3 8 fusion protein are induced by a rapid temperature shift from growth at RT to 37°C. Culture time at 37°C will affect fusion protein amount present in bacteria.
  • a multiple cloning site (MCS) was added at the 3' end of YopEi_i38 (Fig. 9 B) followed by a Myc and a 6xHis tag and a Stop codon.
  • the background strain was carefully selected.
  • a Y. enterocolitica strain that was deleted for all known effectors, Yop H, O, P, E, M and T (named ⁇ ) [40].
  • an auxotroph mutant that cannot grow in absence of exogenous meso-2,6-diaminopimelic acid [41].
  • This strain was deleted for the aspartate-beta-semialdehyde dehydrogenase gene (Aasd), and classified as biosafety level 1 by the Swiss safety agency (amendment to AO 10088/2).
  • enterocolitica is known to infect many different cell types [45], we followed YopEi_i 3 8- Myc delivery into various cell lines. The same homogenous anti-Myc IF staining was observed in infected murine fibroblasts, Jurkat cells and HUVECs (Fig. 11). Even more, tuning the MOI up or down allows modulating the protein amount delivered (Fig. 2 C), while still most of the cells remain targeted. A low bacterial number will not result in few cells with lots of delivered protein but rather with most cells containing a low amount of delivered protein (Fig. 2 C).
  • YopEi_i38 As YopE itself localized to the cytoplasm (Fig. 2 A), it is of special interest to test if the YopEi_i38 fragment hampers localization of nuclear fusion proteins. We therefore added the SV40 NLS to the C-terminus (and N-terminus, similar results) of YopEi_i 3 8-EGFP (SEQ ID No. 39 and SEQ ID No. 38, respectively). While YopEi_i 38 -EGFP (SEQ ID No. 37) led to a weak cytoplasmic staining, YopEi_i 3 8-EGFP-NLS gave rise to a stronger nuclear EGFP signal in HeLa cells infected (Fig. 3).
  • enterocolitica strain HeLa cells were infected with both strains at once. To allow analysis of the translocated fraction of proteins only, infected HeLa cells were lysed at 2 h p.i. (Fig. 4) with Digitonin, which is known not to lyse the bacteria ([52]; see Fig. 11 for control).
  • Western blot analysis revealed the presence of the YopEi_i 3 8-2xTEV-cleavage-site-ETl-Myc or YopEi_i 3 8-2xTEV-cleavage-site-Flag-INK4C- Myc only when cells had been infected with the corresponding strain (Fig. 4 A and C).
  • a shifted band could be observed (Fig. 4 A and C).
  • This band corresponds to ETl-Myc (Fig. 4 C) or Flag-INK4C (Fig. 4 A) with the N-terminal remnants of the TEV cleavage site, most likely only one Serine.
  • the same cleaved ETl-Myc or Flag-INK4C fragment became visible, indicating that the TEV protease delivered via T3SS is functional and that single cells had been infected by both bacterial strains (Fig. 4 A and C).
  • TEV protease dependent cleavage might need optimization dependent on the fusion protein [53,54].
  • TEV protease dependent removal of the YopEi_i 3 s appendage after translocation hence provides for the first time a T3SS protein delivery of almost native heterologous proteins, changing the amino acid composition by only one N-terminal amino acid.
  • SopE from Salmonella enterica is a well-characterized guanine nucleotide exchange factor (GEF) that interacts with Cdc42, promoting actin cytoskeletal remodeling [55].
  • GEF guanine nucleotide exchange factor
  • T3SS dependent protein delivery happens immediately after infection is initiated by centrifugation.
  • T3SS proteins forming the translocation pore into the eukaryotic cell membrane was deleted (YopB, see [56]) (Fig. 11).
  • SopE translocation is followed by translocation of SptP, which functions as a GTPase activating protein (GAP) for Cdc42 [57].
  • GAP GTPase activating protein
  • the type III effector SopB protects epithelial cells from apoptosis by sustained activation of Akt [59].
  • the translocation of YopEi_i 38 -Myc or YopEi_i 3 8-SopE had no effect on Akt
  • the translocation of YopEi_i 38 -SopB (SEQ ID No. 6) induced a strong phosphorylation of Akt at T308 and S473, reflecting the active form (Fig. 6 B).
  • Similar results were obtained with the SopB-homolog from S. flexneri (IpgD, SEQ ID No. 9).
  • our results show that the YopEi_i 38 -based delivery system functions for all T3S effectors tested so far, and that it allows investigating proteins involved in the control of central cellular functions including the cytoskeleton, inflammation and cell survival.
  • a number of bacteria including Agrobacterium tumefaciens, Legionella pneumophila and Bartonella henselae, use type IV secretion to inject effectors into cells.
  • type IV effector BepA from B. henselae could be translocated into HeLa cells using our tool.
  • Full length BepA (SEQ ID No. 10) and BepA E305 -end (SEQ ID No. 11) containing the C- terminal Bid domain were cloned and cells were infected with the respective strains.
  • BepA was shown to induce the production of cyclic AMP (cAMP) [60], the level of cAMP in HeLa cells was measured after infection.
  • cAMP cyclic AMP
  • translocated tBID was functional and delivered at relevant levels. This validated the translocation tool to study the role of proteins in the regulation of apoptosis, a central aspect of cell biology.
  • Y. enterocolitica Figs. 12, 13 and 22 proteins from cell cycle regulation (Mad2 (SEQ ID No. 15), CDK1 (SEQ ID No. 14), INK4A (SEQ ID No. 16), INK4B (SEQ ID No. 17) and INK4C (SEQ ID No. 18)) as well as parts thereof (INK4A 84-103 (SEQ ID No. 158), pl07 657-662 (SEQ ID No. 159), p21 141-160 (SEQ ID No.
  • this further includes for delivery by S. enterica (Fig. 21) proteins from cell cycle regulation (Mad2 (SEQ ID No. 168-169), CDK1 (SEQ ID No. 170- 171), INK4A (SEQ ID No. 164-165) and INK4C (SEQ ID No. 166-167)). While those proteins have not been functionally validated, the possibility of T3SS dependent secretion of diverse eukaryotic proteins in combination with the possible removal of the YopE appendage opens up new vistas on the broad applicability of T3SS in cell biology and therapeutic applications, especially for treatment of malignat solid tumors.
  • Phosphorylation is a wide-spread post-translational modification which can either activate or inactivate biological processes and is therefore a suitable target to study signaling events [65]. Despite this, no systems-level analysis of phosphorylation in apoptosis is available today.
  • the STRING database was used to create a protein-protein interaction network of the tBid phosphoproteome [66] (Fig. 8 A).
  • 27 proteins known to be related to mitochondrial apoptosis were added to the network, building a central cluster.
  • only few proteins from the tBid phosphoproteome are connected to this central cluster indicating that many proteins undergo a change in phosphorylation that were so far not directly linked to apoptotic proteins.
  • To characterize the biological functions covered by the tBid phosphoproteome we performed a gene ontology analysis using the functional annotation tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID, http :// david.
  • HDAC1 for example is a histone deacetylase playing a role in regulation of transcription. It has been shown that HDAC1 can modulate transcriptional activity of NF-kB, a protein also participating in apoptosis. We additionally identified a cluster of proteins involved in R A processing which has previously been shown to play an important role in the regulation of apoptosis [69].
  • HNRPK mediates a p53/TP53 response to DNA damage and is necessary for the induction of apoptosis [70].
  • phosphorylation of proteins involved in protein translation is also affected.
  • Several eukaryotic initiation factors i.e. EIF4E2, EIF4B, EIF3A, EIF4G2
  • EIF4E2 eukaryotic initiation factors
  • EIF4B eukaryotic initiation factors
  • EIF3A eukaryotic initiation factors
  • EIF4G2 eukaryotic initiation factors
  • phosphorylation of many proteins involved in cytoskeleton remodeling e.g. PXN, MAP1B9 are altered upon tBid delivery. This is in concordance with the observation that the morphology of cells changes dramatically upon tBid delivery ( Figure 8 B).
  • tBID delivery induces a rapid apoptotic response also indicated by rupture of the mitochondrial integrity (Fig. 8 B).
  • tBid induced apoptosis affects hundreds of phosphorylation events participating in diverse cellular processes. While many identified proteins have been related to apoptosis, only few were known to be phosphorylated upon apoptosis induction. The phosphoproteomic approach thus provides a useful resource for further studies on apoptosis.
  • heterologous fusion proteins consisting of repeated identical or variable protein domains can translocate via type III secretion
  • murine apoptosis inducers for delivery by Y. enterocolitica to YopEi_i3 8 .
  • murine tBID codon optimized for Y. enterocolitica; SEQ ID No. 194
  • the BH3 domains of murine tBID or murine BAX in both cases codon optimized for Y. enterocolitica; SEQ ID No. 200 and 201
  • YopEi_i 3 8 for delivery by Y. enterocolitica.
  • the heterologous fusion protein consisted in one case of murine BH3 domain of tBID fused to itself, resulting in YopEi_i 3 8-(tBID-BH3) 2 (SEQ ID No. 202).
  • the heterologous fusion proteins consisted of murine BH3 domain of tBID fused to murine BH3 domain of BAX, resulting in YopEi_i 3 8-(tBID-BH3)-(BAX-BH3) (SEQ ID No. 203).
  • the codon was optimized for Y. enterocolitica.
  • Yops Yersinia outer proteins
  • Yops are encoded on the "Yersinia virulence plasmid" (pYV), a about 70kbp sized plasmid, on which the complete type 3 secretion system (T3SS) as well as other virulence players are encoded (Fig. 24).
  • YopH, O, P, E, M and T are the six effector proteins, which are delivered to host cells by the bacterial type three secretion system in order to modulate and dampen the immune system.
  • Each Yop has a specific biochemical activity in the host cell.
  • YopT cleaves off the C-terminal Cysteine of Rho GTPases and thus removes the isporenyl group anchoring the GTPases to the membrane.
  • YopE acts as GTPase activating protein (GAP) for Rho GTPases, deactivating them. This results in decreased phagocytosis and inhibition of release of IL-1 beta by immune cells [71].
  • GAP GTPase activating protein
  • YopO acts as guanidine nucleotide dissociation inhibitor (GDI), deactivating Rho GTPases. YopO further has a serine/threonine kinase domain acting in a not yet defined way on the actin cytoskeleton [71].
  • YopH is a tyrosine phsophatase acting on focal adhesion proteins as Focal adhesion kinase (Fak), paxillin and others, thus strongly preventing phagocytosis by macrophages and neutrophils [71].
  • YopP termed YopJ in Y. pseudotuberculosis or Y. pestis, was found to inactivate the MAPK/NFkB pathway in immune cells, preventing TNFa and IL-8 release from immune cells stimulated by the presence of the bacteria. Furthermore, YopP was found to induce apoptosis in immune cells, which might be related to the effect sin the MAPK pathway, which in its activated state protects cells from apoptosis [71].
  • YopM ribosomal S6 kinase 1 (RSK1) and protein kinase C-like 2 (PRK2). It seems as if YopM could stimulate phosphorylation of RSK1 and thus affects downstream targets, as e.g cell cycle progression [71]. By deleting one or several of these Yops, the defense mechanism of the bacteria against the immune system are dramatically affected [72]. Mutation of respective yops was confirmed by PCR on the respective region, and by in vitro secretion assay (Fig. 25). Analysis of in vitro secretion by SDS-PAGE and Coomassie-blue staining confirmed absence of full-length ⁇ , ⁇ , ⁇ and YopE.
  • a Y. enterocolitica strain with deletions in asd (aspartate semialdehyde dehydrogenase) was constructed.
  • the mutation in asd leads to a complete loss of growth capability without addition of meso-diamino-pimelic acid.
  • This allows generating antibiotic free plasmid maintenance systems based on the presence of asd on the respective plasmid.
  • other auxotroph mutants might be used.
  • mice In order to assess the acute toxicity, a dose-escalation study on healthy immuno-competent mice (C57BL/6) was performed. In this experiments, Y. enterocolitica subsp. palearctica MRS40 AyopH, ⁇ , ⁇ , ⁇ , ⁇ , ⁇ Aasd (replication deficient due to Aasd and further virulence attenuated due to AyopH, ⁇ , ⁇ , ⁇ , ⁇ ) was compared to S. typhimurium AaroA (growth attenuated due to AaroA, as used by other [73-75]). Acute toxicity post infection was assessed based on weight gain or weight loss of the mice following i.v. injection of bacteria.
  • bacterial counts in various organs was determined by organ homogenization, serial dilution and plating. As acute toxicity was assessed and bacterial growth was not of main interest, no desferoxamine pretreatment was applied. Four different bacterial loads were tested for each strain (10 5 , 10 6 , 10 7 , 10 8 cfu per animal). Y. enterocolitica subsp. palearctica MRS40 AyopH, ⁇ , ⁇ , ⁇ , ⁇ , T Aasd did not lead to a weight reduction at the two lower doses (10 5 , 10 6 cfu) (Fig. 26). At the dose of 10 7 bacteria, the weight dropped by about 6% within the first 24h, before stabilization and continuing raise.
  • mice In the dose-escalation experiments on acute toxicity done with immunocompetent mice Y. enterocolitica ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ Aasd showed to be safely tolerated up to 10 8 bacteria per mouse upon i.v. administration. Such a dose might be used as well in human clinical trials [77], with a weight difference from mice to man of several thousand fold. As mice are known to sense gram-negative bacteria the same way as humans via TLR4 and tend to respond similarly to the same lipid A stimulus [78], an initial toxicity due to a septic shock caused by lipid A in human patients is unlikely at the bacterial loads used so far in clinical trials [77].
  • an immune response will be launched to fight the bacteria.
  • the immune system Upon bacterial, accumulation and growth at the site of solid tumors [76,80-82]), the immune system will, after initial dissemination of the bacteria, be triggered at the tumor site. While a septic shock and acute toxicity in patients has to be avoided by reducing the initial bacterial load and/or reducing the endotoxicity of the bacteria by lipid A modifier ions, the immune system stimulation at the site of the tumor is highly desired, as it assists clearance of the cancerous tissue (immunotherapy, immunosensitization). The current pilot phase 11 clinical trial (EudraCT No. 2005-005775-15) with S. enterica builds on this immunotherapeutic effect and the natural toxicity of the bacteria [83].
  • Immunosensitization is one of the key mechanisms of genetically non-equipped Salmonella acting on tumors, as e.g. Salmonella choleraesuis accumulates in tumors and induces neutrophil infiltration and an antitumor immune response [84]. Furthermore, the immune system activation at the tumor site has shown not to prevent a multiple application of bacteria in oncotherapy [85].
  • the immune response triggered by bacterial cancer therapeutics has to be subdivided into a non-desired acute phase, which has to be kept low, and a desired later-stage activation, which assists tumor eradication.
  • This can either be reached by administration of high doses of lower endotoxic bacteria or by administering lower levels of normal endotoxic bacteria, which have increased capacity to colonize and replicate in solid tumors [79].
  • mice were i.v. infected with 2x10 5 cfu Y. enterocolitica subsp. palearctica MRS40 or Y. enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ .
  • mice were pretreated 24h prior to infection with desfreoxamine.
  • Mice infected with the wt Y. enterocolitica subsp. palearctica MRS40 strain had increased scoring for physical appearance and behavior (Fig. 31-32) and exhibited significant weight loss over the first 48 of infection (Fig. 33), which urged us to sacrifice all of the mice in this group already at day 2 post infection.
  • mice infected with the virulence attenuated Y. enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ strain did not show significant weight loss and scored normally for physical appearance and behavior (Fig. 31-33) still at day 4 post infection.
  • mice infected with the wt strain (Y. enterocolitica subsp. palearctica MRS40) living bacteria were detected in all organs assessed, and furthermore in the blood (Fig. 35). While wt bacteria were found present in the malignant solid tumor, equally high or higher counts were found in other organs, highest in the spleen (Fig. 35). In sharp contrast, in mice infected with Y. enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ living bacteria were mainly found in the malignant solid tumor at day 1 post infection, with low bacterial counts observed in spleen, liver and lung.
  • Y. enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ thus accumulated at day 4 post infection with a ration of about (minimally) one million fold at the site of the malignant solid tumor as compared to spleen or liver (when calculating the ration against the detection limit).
  • mice were i.v. infected with 2x10 5 cfu Y. enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ . In order to allow bacterial growth, mice were pretreated 24h prior to infection with desfreoxamine. Mice infected with the virulence attenuated Y.
  • enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ strain did not show significant weight loss and scored normally for physical appearance and behavior still at day 8 post infection.
  • enterocolitica subsp. palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ living bacteria were exclusively found in the malignant solid tumor at day 8 post infection (Fig. 36).
  • palearctica MRS40 ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ thus accumulated at day 8 post infection with a ration of about (minimally) several 10 ⁇ 00 fold at the site of the malignant solid tumor as compared to spleen or liver (when calculating the ration against the detection limit).
  • strains transformed with different pro-apoptotic proteins have been generated according to Table IV.
  • Shortening the delivered proteins to the essential domains required for signaling could increase the efficiency of cell killing (Fig. 37). Without being bound by theory, this increase in efficacy is likely to be related to increased amount of protein production and following delivery via T3SS due to smaller size of the delivered protein.
  • Introduction of a linker between the YopE part and the BH3 domain of tBID decreased efficacy, as well as extending the BH3 domain by 4 further amino acids (SEQ ID No. 209) (Fig. 37).
  • the IC50 half maximal inhibitory concentration
  • MOI eukaryotic cell
  • the fused tBID BH3 domains In order to reach an increase in cell killing activity, the fused tBID BH3 domains must simultaneously act side by side upon delivery by the T3SS into eukaryotic cells. In case only one tBID BH3 domain in the YopEi_i38-(tBID BH3) 2 construct would be functional, at best the same efficiency as with YopEi_i38-tBID BH3 might be expected.
  • YopEi_i 3 8-(tBID BH3) 2 (SEQ ID No. 202) for in vivo studies, we cloned YopEi_i 3 8-(tBID BH3) 2 (SEQ ID No. 202) by homologous recombination on the Yersinia virulence plasmid pYV at the native site of YopE and under the native YopE promoter (using mutator plamids pSI_408 and pSI_419).
  • Such mutators contain the DNA sequence coding for the desired protein, flanked by 200-250 bp of sequences on both sides corresponding to the site of the respective gene, where the integration shall take place.
  • plasmids are transformed into E. coli SmlO ⁇ pir, from where plasmids were mobilized into the corresponding Y. enterocolitica strain. Mutants carrying the integrated vector were propagated for severeal generations without selection pressure. Then sucrose was used to select for clones that have lost the vector. Finally mutants were identified by colony PCR.
  • the endogenous proteins for the transport by the T3SS (called “Yersinia outer proteins", Yops) are encoded by Y. enterocolitica on this 70kb plasmid, named plasmid of Yersinia Virulence (pYV), which further encodes the T3SS apparatus.
  • YopEi_i 38 -(tBID BH3) SEQ ID No. 138 or 200
  • YopEi_i 38 -(tBID BH3) 2 SEQ ID No. 202
  • Yersinia strains encoding YopEi_i 38 -(tBID BH3) (SEQ ID No. 138 or 200) or YopEi_i 38 -(tBID BH3) 2 (SEQ ID No. 202) on the Yersinia virulence plasmid pYV at the native site of YopE and under the native YopE promoter were assessed for their capacity of inducing apoptosis in cancerous cells (including 4T1 and B16F10 cells, Fig. 38).
  • the IC50 half maximal inhibitory concentration
  • MOI eukaryotic cell
  • YopEi_i 38 -(tBID BH3) 2 SEQ ID No. 202
  • YopEi_i 38 -tBID BH3 SEQ ID No. 138 or 200
  • the fused tBID BH3 domains must simultaneously act side by side upon delivery by the T3SS into eukaryotic cells.
  • tBID BH3 domain in the YopEi_i 38 -(tBID BH3) 2 construct would be functional, at best the same efficiency as with YopEi_i 38 -tBID BH3 might be expected.
  • YopEi_i 38 -(tBID BH3) 2 SEQ ID No. 202
  • Yersinia strains encoding YopEi_i 38 -(tBID BH3) 2 (SEQ ID No. 202) on the Yersinia virulence plasmid pYV at the native site of YopE and under the native YopE promoter were compared for their capacity of inducing apoptosis in cancerous cells to expression plasmid (pBad-MycHisA based) derived delivery of YopEi_i 38 -(tBID BH3) 2 .
  • YopEi_i 3 8-(tBID BH3) 2 (SEQ ID No. 202) delivered to tumor cells in vivo
  • enterocolitica ⁇ pYV-YopEi_i38-(tBID BH3) 2 once the tumor had reached a size of 150-250 mm3.
  • the day of the i.v. injection of bacteria was defined as day 0.
  • Tumor volume was measured over the following days (day 0 to day 9 post i.v. injection of bacteria) with calipers.
  • the tumor volume was normalized to the tumor volume at day 0 to compensate for any initial heterogeneity in tumor size.
  • Treatment with Y. enterocolitica ⁇ pYV- YopEi_i38-(tBID BH3) 2 showed an impact on tumor volume progression, with statistically significant tumor reduction at day 8, 9 and 10 post bacterial administration (Fig. 41).
  • Y. enterocolitica AHOPEMT alone was found not to impact tumor progression in the 4T1 murine cancer model (Fig. 42).
  • enterocolitica MRS40 a strain with low levels of pathogenicity, confers a
  • enterocolitica yopE affects the function of the YopE type III secretion signal.
  • T3SS secretion system
  • Yersinia enterocolitica for delivery into eukaryotic cells role of the SycE chaperone binding domain of YopE. J Bacteriol 182, 4811-4821 (2000).
  • YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. Embo J 15, 5812-5823 (1996).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2016/078084 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors Ceased WO2017085233A1 (en)

Priority Applications (24)

Application Number Priority Date Filing Date Title
RS20210926A RS62152B1 (sr) 2015-11-19 2016-11-17 Bakterije oslabljene virulencije za lečenje malignih solidnih tumora
HK18115218.4A HK1256137B (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
US15/773,524 US11166987B2 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
PL16797930T PL3377094T3 (pl) 2015-11-19 2016-11-17 Bakterie o atenuowanej wirulencji do leczenia złośliwych guzów litych
EP21170509.0A EP3903813A1 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
EP16797930.1A EP3377094B1 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
SI201631290T SI3377094T1 (sl) 2015-11-19 2016-11-17 Virulentno oslabljene bakterije za zdravljenje malignih solidnih tumorjev
HRP20211191TT HRP20211191T1 (hr) 2015-11-19 2016-11-17 Bakterije oslabljene virulencije za tretiranje malignih solidnih tumora
SG11201803643TA SG11201803643TA (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
CA3003563A CA3003563A1 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
KR1020187016568A KR102736981B1 (ko) 2015-11-19 2016-11-17 악성 고형 종양 치료를 위한 병독성 약독화된 박테리아
EA201890868A EA201890868A1 (ru) 2015-11-19 2016-11-17 Бактерии с ослабленной вирулентностью для лечения злокачественных солидных опухолей
JP2018526167A JP7060503B2 (ja) 2015-11-19 2016-11-17 悪性固形腫瘍の治療のための弱毒化細菌
BR112018009753-5A BR112018009753B1 (pt) 2015-11-19 2016-11-17 Usos de uma cepa bacteriana gram-negativa recombinante de virulência atenuada e de uma composição farmacêutica compreendendo a referida cepa bacteriana
LTEP16797930.1T LT3377094T (lt) 2015-11-19 2016-11-17 Susilpninto virulentiškumo bakterijos, skirtos piktybinių solidinių navikų gydymui
SM20210423T SMT202100423T1 (it) 2015-11-19 2016-11-17 Batteri a virulenza attenuta per il trattamento di tumori solidi maligni
IL259052A IL259052B2 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
CN201680079454.XA CN108472348B (zh) 2015-11-19 2016-11-17 用于治疗恶性实体肿瘤的减毒细菌
ES16797930T ES2880431T3 (es) 2015-11-19 2016-11-17 Bacterias de virulencia atenuada para el tratamiento de tumores sólidos malignos
AU2016358257A AU2016358257B2 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors
BR122023024697-7A BR122023024697A2 (pt) 2015-11-19 2016-11-17 Usos de uma cepa bacteriana gram-negativa recombinante de virulência atenuada e de uma composição farmacêutica compreendendo a referida cepa bacteriana
DK16797930.1T DK3377094T3 (da) 2015-11-19 2016-11-17 Virulenssvækkede bakterier til behandling af ondartede solide tumorer
ZA2018/03902A ZA201803902B (en) 2015-11-19 2018-06-12 Virulence attenuated bacteria for treatment of malignant solid tumors
CY20211100666T CY1124564T1 (el) 2015-11-19 2021-07-22 Εξασθενημενης λοιμογονικοτητας βακτηριδια για θεραπεια κακοηθων συμπαγων ογκων

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15195490.6 2015-11-19
EP15195490 2015-11-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP21170509.0A Previously-Filed-Application EP3903813A1 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors

Publications (1)

Publication Number Publication Date
WO2017085233A1 true WO2017085233A1 (en) 2017-05-26

Family

ID=54697464

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/078084 Ceased WO2017085233A1 (en) 2015-11-19 2016-11-17 Virulence attenuated bacteria for treatment of malignant solid tumors

Country Status (24)

Country Link
US (1) US11166987B2 (https=)
EP (2) EP3377094B1 (https=)
JP (1) JP7060503B2 (https=)
KR (1) KR102736981B1 (https=)
CN (1) CN108472348B (https=)
AU (1) AU2016358257B2 (https=)
BR (2) BR112018009753B1 (https=)
CA (1) CA3003563A1 (https=)
CY (1) CY1124564T1 (https=)
DK (1) DK3377094T3 (https=)
EA (1) EA201890868A1 (https=)
ES (1) ES2880431T3 (https=)
HR (1) HRP20211191T1 (https=)
HU (1) HUE055132T2 (https=)
IL (1) IL259052B2 (https=)
LT (1) LT3377094T (https=)
PL (1) PL3377094T3 (https=)
PT (1) PT3377094T (https=)
RS (1) RS62152B1 (https=)
SG (1) SG11201803643TA (https=)
SI (1) SI3377094T1 (https=)
SM (1) SMT202100423T1 (https=)
WO (1) WO2017085233A1 (https=)
ZA (1) ZA201803902B (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022090211A1 (en) * 2020-10-27 2022-05-05 T3 Pharmaceuticals Ag Bacteria based protein delivery
WO2025037284A3 (en) * 2023-08-17 2025-03-27 Baccine Ltd. Genetically modified bacteria for multi-modal secretion of a neoantigen

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102648293B1 (ko) 2014-05-21 2024-03-15 우니페르시테트 바젤 세균 기반 단백질 전달
IL259050B2 (en) 2015-11-19 2024-03-01 Univ Basel Bacteria-based protein delivery
EP3957645A1 (en) 2016-12-20 2022-02-23 Universität Basel Virulence attenuated bacteria based protein delivery
KR102110993B1 (ko) * 2018-12-20 2020-05-14 한국생명공학연구원 클레브시엘라 아에로제네스(Klebsiella aerogenes) 균주를 유효성분으로 포함하는 암 진단, 예방 또는 치료용 조성물
CN114712496B (zh) * 2022-04-29 2023-10-13 中山大学·深圳 一种展示新抗原的细菌衍生外膜囊泡疫苗及制备方法和在制备癌症免疫治疗试剂盒中的应用
CN116064877B (zh) * 2023-02-09 2024-09-20 宁夏大学 利用lamp技术快速检测阴沟肠杆菌的试剂盒及方法
CN116855496B (zh) * 2023-07-05 2024-08-16 郑州大学 含有干扰序列siRNA-HIF-1α的表达质粒在制备抗肝细胞癌药物中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002077249A2 (en) * 2001-03-26 2002-10-03 Universite Catholique De Louvain Type iii bacterial strains for use in medicine

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5965381A (en) 1998-03-06 1999-10-12 Ludwig Institute For Cancer Research Delivery of proteins into eukaryotic cells with recombinant yersinia
WO2000002996A2 (en) 1998-07-10 2000-01-20 Cornell Research Foundation, Inc. Recombinant constructs and systems for secretion of proteins via type iii secretion systems
AU2001294834A1 (en) 2000-09-26 2002-04-08 Beth Israel Deaconess Medical Center Recombinant bcg vaccines for the prevention and treatment of cancer
EP1565185A4 (en) 2002-11-07 2011-01-05 Technion Res & Dev Foundation NEUROPROTECTIVE IRON CHELATORS AND PHARMACEUTICAL COMPOSITIONS THEREWITH
FR2862312B1 (fr) 2003-11-13 2006-02-17 Univ Grenoble 1 Outil de transfert et de production de proteines mettant en oeuvre le systeme de secretion de type iii de pseudomonas
EP1943344A2 (en) 2005-10-04 2008-07-16 The Ludwig Institute for Cancer Research Methods for stimulating an immune response using bacterial antigen delivery system
WO2008019183A2 (en) 2006-05-18 2008-02-14 The Regents Of The University Of California Biopolymer and protein production using type iii secretion systems of gram negative bacteria
TW200819540A (en) * 2006-07-11 2008-05-01 Genelux Corp Methods and compositions for detection of microorganisms and cells and treatment of diseases and disorders
EP2268313A2 (en) 2008-03-17 2011-01-05 Universitätsklinikum Münster Yopm as delivery vehicle for cargo molecules and as biological therapeutic for immunomodulation of inflammatory reactions
AU2012267176B2 (en) 2011-06-08 2017-06-15 Chelation Partners Incorporated Metal chelating compositions and methods for controlling the growth or activities of a living cell or organism
US9127284B2 (en) * 2012-05-04 2015-09-08 The University Of Hong Kong Modified bacteria and their uses thereof for the treatment of cancer or tumor
EP3049526B1 (en) 2013-09-24 2021-02-24 Medicenna Therapeutics, Inc. Interleukin-4 receptor-binding fusion proteins and uses thereof
US10143743B2 (en) 2013-11-18 2018-12-04 Yale University Non-replicating bacterial nanoparticle delivery system and methods of use
KR102648293B1 (ko) 2014-05-21 2024-03-15 우니페르시테트 바젤 세균 기반 단백질 전달
IL259050B2 (en) 2015-11-19 2024-03-01 Univ Basel Bacteria-based protein delivery
EP3957645A1 (en) 2016-12-20 2022-02-23 Universität Basel Virulence attenuated bacteria based protein delivery

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002077249A2 (en) * 2001-03-26 2002-10-03 Universite Catholique De Louvain Type iii bacterial strains for use in medicine

Non-Patent Citations (87)

* Cited by examiner, † Cited by third party
Title
AEPFELBACHER, M.; TRASAK, C.; RUCKDESCHEL, K.: "Effector functions ofpathogenic Yersinia species", THROMB HAEMOST, vol. 98, 2007, pages 521 - 529
ALTO, N. M. ET AL.: "Identification of a bacterial type III effector family with G protein mimicry functions", CELL, vol. 124, 2006, pages 133 - 145
ALTO, N. M.; DIXON, J. E.: "Analysis of Rho-GTPase mimicry by a family of bacterial type III effector proteins", METHODS ENZYMOL, vol. 439, 2008, pages 131 - 143
BENSIMON, A. ET AL.: "ATM-dependent and -independent dynamics of the nuclear phosphoproteome after DNA damage", SCI SIGNAL, vol. 3, 2010, pages RS3
BLANCO-TORIBIO, A.; MUYLDERMANS, S.; FRANKEL, G.; FERNANDEZ, L. A.: "Direct injection of functional single-domain antibodies from E. coli into human cells", PLOS ONE, vol. 5, 2010, pages E15227
BOYD, A. P.; LAMBERMONT, I.; CORNELIS, G. R.: "Competition between the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the SycE chaperone binding domain of YopE", J BACTERIOL, vol. 182, 2000, pages 4811 - 4821
BRENNER, D.; MAK, T. W.: "Mitochondrial cell death effectors", CURR OPIN CELL BIOL, vol. 21, 2009, pages 871 - 877
CAO, H. D. ET AL.: "Attenuated Salmonella typhimurium carrying TRAIL and VP3 genes inhibits the growth of gastric cancer cells in vitro and in vivo", TUMORI, vol. 96, 2010, pages 296 - 303
CARRINGTON, J. C.; DOUGHERTY, W. G.: "A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing", PROC NATL ACAD SCI USA, vol. 85, 1988, pages 3391 - 3395
CAUSSINUS, E.; KANCA, O.; AFFOLTER, M.: "Fluorescent fusion protein knockout mediated by anti-GFP nanobody", NAT STRUCT MOL BIOL, vol. 19, 2011, pages 117 - 121
CHALAH, A.; KHOSRAVI-FAR, R.: "The mitochondrial death pathway", ADV EXP MED BIOL, vol. 615, 2008, pages 25 - 45
CLAIRMONT, C. ET AL.: "Biodistribution and genetic stability of the novel antitumor agent VNP20009, a genetically modified strain of Salmonella typhimurium", J INFECT DIS, vol. 181, 2000, pages 1996 - 2002
CORNELIS, G. R.: "The type III secretion injectisome", NAT REV MICROBIOL, vol. 4, 2006, pages 811 - 825
CORNELIS, G.; VANOOTEGEM, J. C.; SLUITERS, C.: "Transcription of the yop regulonfrom Y. enterocolitica requires trans acting pYV and chromosomal genes", MICROB PATHOG, vol. 2, 1987, pages 367 - 379
DEHIO, C.; MEYER, M.; BERGER, J.; SCHWARZ, H.; LANZ, C.: "Interaction of Bartonella henselae with endothelial cells results in bacterial aggregation on the cell surface and the subsequent engulfment and internalisation of the bacterial aggregate by a unique structure, the invasome", J CELL SCI, vol. 110, 1997, pages 2141 - 2154
DENECKER, G. ET AL.: "Effect of low- and high-virulence Yersinia enterocolitica strains on the inflammatory response of human umbilical vein endothelial cells", INFECT IMMUN, vol. 70, 2002, pages 3510 - 3520
DIEPOLD, A. ET AL.: "Deciphering the assembly of the Yersinia type III secretion injectisome", EMBO, vol. J29, 2010, pages 1928 - 1940
FELDMAN, M. F.; MULLER, S.; WUEST, E.; CORNELIS, G. R.: "SycE allows secretion of YopE-DHFR hybrids by the Yersinia enterocolitica type III Ysc system", MOL MICROBIOL, vol. 46, 2002, pages 1183 - 1197
FENSTERLE J ET AL: "Cancer immunotherapy based on recombinant Salmonella enterica serovar Typhimurium aroA strains secreting prostate-specific antigen and cholera toxin subunit B", CANCER GENE THERAPY, APPLETON & LANGE, GB, vol. 15, no. 2, 1 February 2008 (2008-02-01), pages 85 - 93, XP002473595, ISSN: 0929-1903, DOI: 10.1038/SJ.CGT.7701109 *
FIDLER, I. J.: "Biological behavior of malignant melanoma cells correlated to their survival in vivo", CANCER RES, vol. 35, 1975, pages 218 - 224
FORBES, N. S.: "Engineering the perfect (bacterial) cancer therapy", NAT REV CANCER, vol. 10, 2010, pages 785 - 794
FORBES, N. S.; MUNN, L. L.; FUKUMURA, D.; JAIN, R. K.: "Sparse initial entrapment of systemically injected Salmonella typhimurium leads to heterogeneous accumulation within tumors", CANCER RES, vol. 63, 2003, pages 5188 - 5193
FORSBERG, A.; WOLF-WATZ, H.: "Genetic analysis of the yopE region of Yersinia spp.: identification of a novel conserved locus, yerA, regulating yopE expression", J BACTERIOL, vol. 172, 1990, pages 1547 - 1555
FUCHS, Y.; STELLER, H.: "Programmed cell death in animal development and disease", CELL, vol. 147, 2011, pages 742 - 758
GENTSCHEV IVAYLO ET AL: "Use of a recombinant Salmonella enterica serovar Typhimurium strain expressing C-Raf for protection against C-Raf induced lung adenoma in mice", BMC CANCER, BIOMED CENTRAL, LONDON, GB, vol. 5, no. 1, 9 February 2005 (2005-02-09), pages 15, XP021004758, ISSN: 1471-2407, DOI: 10.1186/1471-2407-5-15 *
GRAY, D. C.; MAHRUS, S.; WELLS, J. A.: "Activation of specific apoptotic caspases with an engineered small-molecule-activated protease", CELL, vol. 142, 2010, pages 637 - 646
GROSDENT, N.; MARIDONNEAU-PARINI, I.; SORY, M. P.; CORNELIS, G. R.: "Role ofYops and adhesins in resistance of Yersinia enterocolitica to phagocytosis", INFECT IMMUN, vol. 70, 2002, pages 4165 - 4176
HAKANSSON, S. ET AL.: "The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity", EMBO J, vol. 15, 1996, pages 5812 - 5823
HARDT, W. D.; CHEN, L. M.; SCHUEBEL, K. E.; BUSTELO, X. R.; GALAN, J. E. S.: "typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells", CELL, vol. 93, 1998, pages 815 - 826
HENRICHS, T. ET AL.: "Target-directed proteolysis at the ribosome", PROC NATL ACAD SCI U S A, vol. 102, 2005, pages 4246 - 4251
HOANG, T. T.; WILLIAMS, S.; SCHWEIZER, H. P.; LAM, J. S.: "Molecular genetic analysis of the region containing the essential Pseudomonas aeruginosa asd gene encoding aspartate-beta-semialdehyde dehydrogenase", MICROBIOLOGY, vol. 143, 1997, pages 899 - 907
HOFFMAN, R. M.: "Tumor-seeking Salmonella amino acid auxotrophs", CURR OPIN BIOTECHNOL, vol. 22, 2011, pages 917 - 923
HOWARD, S. L. ET AL.: "Application of comparative phylogenomics to study the evolution of Yersinia enterocolitica and to identify genetic differences relating to pathogenicity", J BACTERIOL, vol. 188, 2006, pages 3645 - 3653
HUANG DA, W. ET AL.: "DAVID gene ID conversion tool", BIOINFORMATION, vol. 2, 2008, pages 428 - 430
HUANG DA, W.; SHERMAN, B. T.; LEMPICKI, R. A.: "Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists", NUCLEIC ACIDS RES, vol. 37, 2009, pages 1 - 13
IRIARTE, M.; CORNELIS, G. R.: "YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells", MOL MICROBIOL, vol. 29, 1998, pages 915 - 929
IRIARTE, M.; STAINIER, I.; CORNELIS, G. R.: "The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors", INFECT IMMUN, vol. 63, 1995, pages 1840 - 1847
ISAKSSON, E. L. ET AL.: "The membrane localization domain is required for intracellular localization and autoregulation of YopE in Yersinia pseudotuberculosis", INFECT IMMUN, vol. 77, 2009, pages 4740 - 4749
ISBERG, R. R.; VOORHIS, D. L.; FALKOW, S.: "Identification of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells", CELL, vol. 50, 1987, pages 769 - 778
KANIGA, K.; DELOR, I.; CORNELIS, G. R.: "A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica", GENE, vol. 109, 1991, pages 137 - 141
KAPUST, R. B. ET AL.: "Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency", PROTEIN ENG, vol. 14, 2001, pages 993 - 1000
KAPUST, R. B.; TOZSER, J.; COPELAND, T. D.; WAUGH, D. S.: "The PI' specificity of tobacco etch virus protease", BIOCHEM BIOPHYS RES COMMUN, vol. 294, 2002, pages 949 - 955
KUDRYASHEV, M. ET AL.: "In situ structural analysis of the Yersinia enterocolitica injectisome", ELIFE, vol. 2, 2013, pages E00792
LEE, C. H.; WU, C. L.; SHIAU, A. L.: "Endostatin gene therapy delivered by Salmonella choleraesuis in murine tumor models", J GENE MED, vol. 6, 2004, pages 1382 - 1393
LEE, C. H.; WU, C. L.; SHIAU, A. L.: "Salmonella choleraesuis as an anticancer agent in a syngeneic model of orthotopic hepatocellular carcinoma", INT J CANCER, vol. 122, 2008, pages 930 - 935
LEE, V. T.; ANDERSON, D. M.; SCHNEEWIND, O.: "Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone", MOL MICROBIOL, vol. 28, 1998, pages 593 - 601
LI, H. ET AL.: "The phosphothreonine lyase activity of a bacterial type III effector family", SCIENCE, vol. 315, 2007, pages 1000 - 1003
LI, H.; ZHU, H.; XU, C. J.; YUAN, J.: "Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis", CELL, vol. 94, 1998, pages 491 - 501
LIANG, H.; GAO, H.; MAYNARD, C. A.; POWELL, W. A.: "Expression of a self-processing, pathogen resistance-enhancing gene construct in Arabidopsis", BIOTECHNOL LETT, vol. 27, 2005, pages 435 - 442
MASSA, P. E.; PANICCIA, A.; MONEGAL, A.; DE MARCO, A.; RESCIGNO, M.: "Salmonella engineered to express CD20-targeting antibodies and a drug-converting enzyme can eradicate human lymphomas", BLOOD, vol. 122, 2013, pages 705 - 714
METCALF, W. W.; JIANG, W.; WANNER, B. L.: "Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers", GENE, vol. 138, 1994, pages 1 - 7
MILLER, S. I.; ERNST, R. K.; BADER, M. W.: "LPS, TLR4 and infectious disease diversity", NAT. REV. MICROBIOL., vol. 3, 2005, pages 36 - 46
MOTA, L. J.; CORNELIS, G. R.: "The bacterial injection kit: type III secretion systems", ANN MED, vol. 37, 2005, pages 234 - 249
MOTA, L. J.; JOURNET, L.; SORG, I.; AGRAIN, C.; CORNELIS, G. R.: "Bacterial injectisomes: needle length does matter", SCIENCE, vol. 307, 2005, pages 1278
MULDER, B.; MICHIELS, T.; SIMONET, M.; SORY, M. P.; CORNELIS, G.: "Identification of additional virulence determinants on the pYV plasmid of Yersinia enterocolitica W227", INFECT IMMUN, vol. 57, 1989, pages 2534 - 2541
NAGARAJ, N. ET AL.: "Deep proteome and transcriptome mapping of a human cancer cell line", MOL SYST BIOL, vol. 7, 2011, pages 548
NEUBAUER, H.; ALEKSIC, S.; HENSEL, A.; FINKE, E. J.; MEYER, H.: "Yersinia enterocolitica 16S rRNA gene types belong to the same genospecies but form three homology groups", INT J MED MICROBIOL, vol. 290, 2000, pages 61 - 64
NORRIS, F. A.; WILSON, M. P.; WALLIS, T. S.; GALYOV, E. E.; MAJERUS, P. W.: "SopB, a protein required for virulence of Salmonella dublin, is an inositol phosphate phosphatase", PROC NATL ACAD SCI U S A, vol. 95, 1998, pages 14057 - 14059
PAPAGIANNAKOPOULOS, T.; SHAPIRO, A.; KOSIK, K. S.: "MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells", CANCER RES, vol. 68, 2008, pages 8164 - 8172
PELLUDAT, C.; HOGARDT, M.; HEESEMANN, J.: "Transfer of the core region genes of the Yersinia enterocolitica WA-C serotype O:8 high-pathogenicity island to Y. enterocolitica MRS40, a strain with low levels of pathogenicity, confers a yersiniabactin biosynthesis phenotype and enhanced mouse virulence", INFECT IMMUN, vol. 70, 2002, pages 1832 - 1841
PERKINS, D. N.; PAPPIN, D. J.; CREASY, D. M.; COTTRELL, J. S.: "Probability-based protein identification by searching sequence databases using mass spectrometry data", ELECTROPHORESIS, vol. 20, 1999, pages 3551 - 3567
PULLIAINEN, A. T. ET AL.: "Bacterial effector binds host cell adenylyl cyclase to potentiate Galphas-dependent cAMP production", PROC NATL ACAD SCI U S A, vol. 109, 2012, pages 9581 - 9586
RAMAMURTHI, K. S.; SCHNEEWIND, O.: "A synonymous mutation in Yersinia enterocolitica yopE affects the function of the YopE type III secretion signal", J BACTERIOL, vol. 187, 2005, pages 707 - 715
SARKER, M. R.; NEYT, C.; STAINIER, I.; CORNELIS, G. R.: "The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD", J BACTERIOL, vol. 180, 1998, pages 1207 - 1214
SCHMUTZ, C. ET AL.: "Systems-Level Overview of Host Protein Phosphorylation During Shigella flexneri Infection Revealed by Phosphoproteomics", MOL CELL PROTEOMICS, vol. 12, 2013, pages 2952 - 2968
SCHULTE, R. ET AL.: "Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation ofRel p65-p65 homodimers", FASEB J, vol. 14, 2000, pages 1471 - 1484
SCHWERK, C.; SCHULZE-OSTHOFF, K.: "Regulation of apoptosis by alternative pre-mRNA splicing", MOL CELL, vol. 19, 2005, pages 1 - 13
SHARMA, S. ET AL.: "Deployment of the Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells", PLANT J, vol. 74, 2013, pages 701 - 712
SKURNIK, M.; WOLF-WATZ, H.: "Analysis of the yopA gene encoding the Yopl virulence determinants of Yersinia spp", MOL MICROBIOL, vol. 3, 1989, pages 517 - 529
SMYTH, G. K.: "Linear models and empirical bayes methods for assessing differential expression in microarray experiments", STAT APPL GENET MOL BIOL, 2004, pages 3
SORY, M. P.; CORNELIS, G. R.: "Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells", MOL MICROBIOL, vol. 14, 1994, pages 583 - 594
STEBBINS, C. E.; GALAN, J. E.: "Structural mimicry in bacterial virulence", NATURE, vol. 412, 2001, pages 701 - 705
SZKLARCZYK, D. ET AL.: "The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored", NUCLEIC ACIDS RES, vol. 39, 2011, pages D561 - 568
THAMM, D. H. ET AL.: "Systemic administration of an attenuated, tumor-targeting Salmonella typhimurium to dogs with spontaneous neoplasia: phase I evaluation", CLIN CANCER RES, vol. 11, 2005, pages 4827 - 4834
THOMSON, N. R. ET AL.: "The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081", PLOS GENET, vol. 2, 2006
TING, L. ET AL.: "Normalization and statistical analysis of quantitative proteomics data generated by metabolic labeling", MOL CELL PROTEOMICS, vol. 8, 2009, pages 2227 - 2242
TOSO, J. F. ET AL.: "Phase I study of the intravenous administration of attenuated Salmonella typhimurium to patients with metastatic melanoma", J CLIN ONCOL, vol. 20, 2002, pages 142 - 152
TROSKY, J. E.; LIVERMAN, A. D.; ORTH, K.: "Yersinia outer proteins: Yops", CELL MICROBIOL, vol. 10, 2008, pages 557 - 565
TRULZSCH, K.; SPORLEDER, T.; IGWE, E. I.; RUSSMANN, H.; HEESEMANN, J.: "Contribution of the major secreted yops of Yersinia enterocolitica O:8 to pathogenicity in the mouse infection model", INFECT IMMUN, vol. 72, 2004, pages 5227 - 5234
VIZCAINO, J. A. ET AL.: "The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013", NUCLEIC ACIDS RES, vol. 41, 2013, pages D1063 - 1069
WAUGH, D. S.: "An overview of enzymatic reagents for the removal of affinity tags", PROTEIN EXPR PURIF, vol. 80, 2011, pages 283 - 293
WEBER, W. ET AL.: "Macrolide-based transgene control in mammalian cells and mice", NAT BIOTECHNOL, vol. 20, 2002, pages 901 - 907
WOLKE, S.; ACKERMANN, N.; HEESEMANN, J.: "The Yersinia enterocolitica type 3 secretion system (T3SS) as toolbox for studying the cell biological effects of bacterial Rho GTPase modulating T3SS effector proteins", CELL MICROBIOL, vol. 13, 2011, pages 1339 - 1357
YONEDA, Y. ET AL.: "A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 T-antigen directs the transport of IgM into the nucleus efficiently", EXP CELL RES, vol. 201, 1992, pages 313 - 320
YOON, W. S.; CHAE, Y. S.; HONG, J.; PARK, Y. K.: "Antitumor therapeutic effects of a genetically engineered Salmonella typhimurium harboring TNF-alpha in mice", APPL MICROBIOL BIOTECHNOL, vol. 89, 2011, pages 1807 - 1819
ZHANG, M.; SWOFFORD, C. A.; FORBES, N. S.: "Lipid A controls the robustness of intratumoral accumulation of attenuated Salmonella in mice", INT J CANCER, vol. 135, 2014, pages 647 - 657
ZHENG, L. M. ET AL.: "Tumor amplified protein expression therapy: Salmonella as a tumor-selective protein delivery vector", ONCOL RES, vol. 12, 2000, pages 127 - 135

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022090211A1 (en) * 2020-10-27 2022-05-05 T3 Pharmaceuticals Ag Bacteria based protein delivery
US12516089B2 (en) 2020-10-27 2026-01-06 T3 Pharmaceuticals Ag Bacteria based protein delivery
WO2025037284A3 (en) * 2023-08-17 2025-03-27 Baccine Ltd. Genetically modified bacteria for multi-modal secretion of a neoantigen

Also Published As

Publication number Publication date
CN108472348A (zh) 2018-08-31
KR102736981B1 (ko) 2024-12-02
IL259052B2 (en) 2024-03-01
AU2016358257A1 (en) 2018-05-10
PL3377094T3 (pl) 2021-12-13
ES2880431T3 (es) 2021-11-24
US20190015497A1 (en) 2019-01-17
EP3377094B1 (en) 2021-04-28
BR112018009753B1 (pt) 2024-02-20
BR122023024697A2 (pt) 2023-12-26
CY1124564T1 (el) 2022-07-22
SMT202100423T1 (it) 2021-09-14
US11166987B2 (en) 2021-11-09
HRP20211191T1 (hr) 2021-10-29
AU2016358257B2 (en) 2023-08-17
IL259052A (en) 2018-07-31
LT3377094T (lt) 2021-08-10
HUE055132T2 (hu) 2021-11-29
HK1256137A1 (en) 2019-09-13
BR112018009753A2 (pt) 2018-11-13
EP3903813A1 (en) 2021-11-03
PT3377094T (pt) 2021-07-08
KR20180081583A (ko) 2018-07-16
CA3003563A1 (en) 2017-05-26
JP7060503B2 (ja) 2022-04-26
CN108472348B (zh) 2022-12-27
EP3377094A1 (en) 2018-09-26
IL259052B1 (en) 2023-11-01
SI3377094T1 (sl) 2021-09-30
EA201890868A1 (ru) 2018-12-28
ZA201803902B (en) 2019-03-27
SG11201803643TA (en) 2018-06-28
BR112018009753A8 (pt) 2019-02-26
DK3377094T3 (da) 2021-08-02
JP2019500026A (ja) 2019-01-10
RS62152B1 (sr) 2021-08-31

Similar Documents

Publication Publication Date Title
EP3377094B1 (en) Virulence attenuated bacteria for treatment of malignant solid tumors
US20240401065A1 (en) Bacteria-Based Protein Delivery
US11702663B2 (en) Bacteria-based protein delivery
WO2018115140A2 (en) Virulence attenuated bacteria based protein delivery
HK1256137B (en) Virulence attenuated bacteria for treatment of malignant solid tumors
CA3005380C (en) Bacteria-based protein delivery
EA040558B1 (ru) Бактерии с ослабленной вирулентностью для лечения злокачественных солидных опухолей
HK1256138B (en) Bacteria-based protein delivery
HK1236208A1 (en) Bacteria-based protein delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16797930

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3003563

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 201890868

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 259052

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 11201803643T

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2016358257

Country of ref document: AU

Date of ref document: 20161117

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018526167

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018009753

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187016568

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020187016568

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2016797930

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 112018009753

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180514