WO2017082655A1 - 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물 - Google Patents

항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물 Download PDF

Info

Publication number
WO2017082655A1
WO2017082655A1 PCT/KR2016/012948 KR2016012948W WO2017082655A1 WO 2017082655 A1 WO2017082655 A1 WO 2017082655A1 KR 2016012948 W KR2016012948 W KR 2016012948W WO 2017082655 A1 WO2017082655 A1 WO 2017082655A1
Authority
WO
WIPO (PCT)
Prior art keywords
hmgcll1
malignant tumor
composition
polynucleotide
malignancy
Prior art date
Application number
PCT/KR2016/012948
Other languages
English (en)
French (fr)
Inventor
김종원
박종호
우영민
박인호
박경선
Original Assignee
에스디지노믹스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에스디지노믹스 주식회사 filed Critical 에스디지노믹스 주식회사
Priority to US15/775,080 priority Critical patent/US20180355359A1/en
Priority to EP16864581.0A priority patent/EP3375887A4/en
Publication of WO2017082655A1 publication Critical patent/WO2017082655A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/34—Allele or polymorphism specific uses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/03—Oxo-acid-lyases (4.1.3)
    • C12Y401/03004—Hydroxymethylglutaryl-CoA lyase (4.1.3.4)

Definitions

  • Chronic myeloid leukemia is a rare clonal myeloproliferative disorder characterized by the proliferation of all myeloid cells due to hematopoietic stem cell abnormalities. Hematopoietic stem cells (HSCs) are characterized by long-term survival and reduced apoptosis.
  • Chronic myeloid leukemia is a very rare hematologic cancer that typically has between 0.6 and 2 patients per 100,000 population, with a different incidence between Westerners and East Asians.
  • the BCR-ABL oncogene known as the major cause of development, is a gene that structurally encodes the activity of Bcr-Abl fusion tyrosine kinase (FTK) on the Philadelphia chromosome (Ph). It is known that Bcr-Abl FTK is an important molecular marker of chronic myeloid leukemia, and imatinib has been developed as a therapeutic agent for this.
  • the Bcr-Abl recombinant gene induces proliferation of cancer cells through continuous tyrosine kinase activity.
  • Imatinib binds to an active site corresponding to the position where ATP (adenosine triphosphate) binds to inhibit tyrosine kinase enzyme activity, thereby inducing an action mechanism that prevents the proliferation of cancer cells.
  • ATP adenosine triphosphate
  • the present inventors have studied a statistically relevant single nucleotide polymorphism between a patient group that is resistant to a target therapeutic agent for chronic myelogenous leukemia and a patient group that is not tolerant, and based on this, to predict or diagnose drug resistance in patients with chronic myelogenous leukemia. It was. As a result, it was confirmed that the expression levels of specific SNPs in the HMGCLL1 gene and isoform 3 of the HMGCLL1 gene correlated with drug resistance in patients with chronic myelogenous leukemia. Chronic myeloid leukemia cells and malignant tumors when the expression of the gene is inhibited The present invention was completed by identifying that the growth of cells is effectively inhibited.
  • One object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of malignancies comprising an agent that inhibits the expression of HMGCLL1 IS3.
  • Still another object of the present invention is to provide a method for determining drug resistance of malignant individuals using expression levels of HMGCLL1 IS3.
  • Still another object of the present invention is to provide a kit for diagnosing drug resistance containing the composition.
  • Still another object of the present invention is to provide a method for screening a malignant tumor therapeutic agent using the expression level of HMGCLL1 IS3.
  • Another object of the present invention to provide a method for predicting malignant tumors using the expression level of HMGCLL1 IS3.
  • Still another object of the present invention is to provide a kit for predicting prognosis of malignancies comprising the composition for predicting prognosis of malignancies.
  • Still another object of the present invention is to provide a method for determining drug resistance of a malignant tumor individual comprising determining the presence of at least one SNP among SEQ ID NOs: 9 to 16 and 33 to 173.
  • Still another object of the present invention is to provide a kit for diagnosing drug resistance containing the composition for predicting prognosis.
  • Figure 3 belongs to the candidate locus (6p12.1) in the experimental group and shows a validation (region) association plot (validation association plot) in the verification group.
  • Hapmap2 release 22 is shown based on CHB + JPT reference data and LD color is indicated based on r-square.
  • FIG. 5 depicts the location of each exon of the HMGCLL1 gene and the eight monobasic polymorphisms verified.
  • FIGS. 6A and 6B are plot results for cumulative incidence in Koreans and Westerners.
  • Figure 6a Cumulative Incidence Plot in Koreans
  • FIG. 6b Plot of Cumulative Incidence in Westerners.
  • 8A and 8B are graphs showing the results of comparing the effects of the HMGCLL1 IS3 siRNA and the target anticancer agent on the mutant cell line (K562 cell line inducing T315I mutation) showing target anticancer drug resistance.
  • Figure 11a and 11b is a graph showing the results of comparing the change in the cell cycle according to the treatment of HMGCLL1 IS3 siRNA in the CML cell line, Figure 11a shows the results performed on K526 cells, one of the CML cell line, Figure 11b shows the results performed on LAMA-84 cells, one of the CML cell lines.
  • FIGS. 12A to 12C are graphs showing the results of comparing the anticancer activity of HMGCLL1 IS3 siRNA against various cancer cells.
  • FIG. 12A shows the results of hematopoietic and lymphoid tissue cancer cell lines
  • FIGS. 12B and 12C show solid cancer cell lines. The results performed on the subjects are shown.
  • a method of determining whether the drug is resistant to a cancer drug is provided by measuring the expression level of the HMGCLL1 IS3.
  • HMGCLL1 The function of HMGCLL1 is to convert (S) -3-hydroxy-3-methylglutaryl-CoA to acetyl-CoA and acetoacetate via 3-hydroxymethyl-3-methylglutaryl CoA lyase outside mitochondria. It is known to catalyze the decomposition of. It is noteworthy that HMGCLL1 is similar in sequence to HMGCL (HMG-CoA lyase) and influences in a path complementary to HMGCR (HMG-CoA reductase).
  • the first exon region is a region consisting of bases 1 to 108
  • the second exon region is a region consisting of 109 to 198 bases
  • the third exon region 199 to Exon region 479 is a region consisting of bases 280 to 387
  • the exon region 5 is a region consisting of bases 388 to 483
  • Exon region 7 is a region consisting of bases 633 to 696
  • the exon region 8 is a region consisting of bases 697 to 885
  • the exon region 9 is a base consisting of 886 to 1011
  • Exon region 10 is composed of bases 1012 to 1113 base.
  • isoform 3 (IS3) of HMGCLL1 is a protein expressed in a form in which 2 and 5 exons are deleted in the HMGCLL1 cDNA, which is the first anticancer drug resistance to CML by the present inventors.
  • IS3 isoform 3
  • Specific base sequence or amino acid sequence information of each isoform of the HMGCLL1 gene is reported in a database such as NCBI.
  • the term "agent that inhibits the expression or activity of HMGCLL1 IS3" refers to an agent that reduces the expression or activity of HMGCLL1 IS3 in cancer cells, by reducing the expression or activity of HMGCLL1 IS3 in cancer cells It can be used for the purpose of preventing or treating cancer.
  • a compound, a nucleic acid, an aptamer, a peptide, a virus, or a vector including the nucleic acid may be included, which may target HMGCLL1 IS3 to inhibit the expression or activity of HMGCLL1 IS3.
  • the agent specifically binds to a polynucleotide such as antisense oligonucleotide, siRNA, RNA aptamer, or the like that inhibits the expression of HMGCLL1 IS3 mRNA, or an aptamer, antibody, peptide, which specifically binds to and inhibits its activity. Fragments of the antibodies, low molecular weight compounds and the like can be included.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-me pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosil HMC, 2-aminoadenine, 2 Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this.
  • the antisense nucleic acids of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cellular adsorption of the antisense nucleic acids.
  • Antisense oligonucleotides can be synthesized in vitro by conventional methods to be administered in vivo or to allow antisense oligonucleotides to be synthesized in vivo.
  • One example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I.
  • One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the recognition site (MCS). Such antisense RNA is desirable to ensure that there is a translation stop codon in the sequence so that it is not translated into the peptide sequence.
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 and WO 00/44914). siRNA is provided as an efficient gene knockdown method or gene therapy method because it can inhibit the expression of the target gene. siRNA was first discovered in plants, worms, fruit flies, and parasites, but has recently been applied to mammalian cell research using siRNA.
  • the siRNA has a double-stranded structure in which a sense strand (a sequence corresponding to the HMGCLL1 mRNA sequence) and an antisense strand (a sequence complementary to the HMGCLL1 mRNA sequence) are positioned opposite to each other when a molecule is used. Or it may have a single chain structure with self-complementary sense and antisense strands.
  • the siRNA is not limited to the complete pairing of double-stranded RNA portions paired with RNA, but paired by mismatch (the corresponding base is not complementary), bulge (the base does not correspond to one chain), and the like. Parts that do not achieve may be included.
  • the siRNA terminal structure can be either blunt or cohesive, as long as the expression of the HMGCLL1 gene can be suppressed by the RNAi effect.
  • the cohesive end structure is possible for both 3'-end protrusion structures and 5'-end protrusion structures.
  • the siRNA molecule may have a form in which a short nucleotide sequence (eg, about 5-15 nt) is inserted between a self-complementary sense and an antisense strand, in which case the siRNA formed by expression of the nucleotide sequence
  • the molecules form a hairpin structure by intramolecular hybridization, and form a stem-and-loop structure as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.
  • 19 to 40 consecutive including any one base sequence selected from the group consisting of SEQ ID NOs: 5 to 8, and capable of specifically binding to all or a portion of the base sequence of SEQ ID NO: 4 It may be to include a base.
  • RNA aptamer refers to a nucleic acid ligand molecule that binds to and has an antagonistic effect on a target mRNA by its ability to adopt a particular three-dimensional conformation.
  • the aptamers may be small nucleic acids of 15-50 bases in length that are folded into defined secondary and tertiary structures, such as stem-loop structures.
  • Aptamers are preferably bound to the target molecule with a kd of less than 10 ⁇ -6, 10 ⁇ -8, 10 ⁇ -10, or 10 ⁇ -12. Aptamers can bind to target molecules with very high specificity.
  • aptamers may be composed of multiple ribonucleotide units, deoxyribonucleotide units, or a mixture of two types of nucleotide residues.
  • Aptamers may further comprise one or more modified base, sugar or phosphate backbone units.
  • Aptamers are oligonucleic acid (eg, RNA) or peptide substances, for details see Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library”. Proc Natl Acad Sci USA. 95 (24): 142727 (1998).
  • Peptides capable of specifically binding to HMGCLL1 and inhibiting the activity of HMGCLL1 can be obtained by conventional methods known in the art, for example, by phage display (Smith GP, "Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface ".Science 228 (4705): 1315-1317 (1985); Smith GP, Petrenko VA,” Phage display ". Chem. Rev. 97 (2): 391-410 (1997)).
  • malignant tumor refers to a disease associated with cell death control, and refers to a disease caused by excessive proliferation of cells when a normal cell death balance is broken. These abnormally over-proliferating cells sometimes invade surrounding tissues and organs to form masses and destroy or modify the normal structure of the body, which is called malignancy or cancer.
  • tumor refers to a mass abnormally grown by autonomous overgrowth of body tissue, and may be classified into a benign tumor and a malignant tumor. Malignant tumors grow much faster than benign tumors and invade surrounding tissues, resulting in metastasis, which is life threatening.
  • the malignancy is not particularly limited as long as it can be treated by inhibiting the expression or activity of HMGCLL1 IS3, for example, hematopoietic and lymphoid tissue-derived malignancy, solid cancer, etc.
  • HMGCLL1 IS3 hematopoietic and lymphoid tissue-derived malignancy
  • solid cancer solid cancer
  • malignant tumors derived from various tissues such as hematopoietic and lymphoid tissue, autonomic ganglia, gallbladder, breast, central nervous system, liver, pancreas, skin, stomach, urinary system and the like.
  • prevention refers to any action that inhibits or delays the onset of a malignant tumor by administration of a pharmaceutical composition for preventing or treating a malignant tumor according to the present invention.
  • treatment refers to a cell that improves or progresses to a malignant tumor, such as delaying or stopping the growth of a malignant tumor by administration of a pharmaceutical composition for preventing or treating a malignant tumor according to the present invention. It means any action that beneficially alters, such as switching to normal cells.
  • compositions of the present invention in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and sterile injectable solutions, respectively, may be used according to conventional methods.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, sucrose, and the like in the stem cell extract.
  • Liquid preparations for oral use may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to water and liquid paraffin, which are commonly used to include suspensions, solutions, emulsions, and syrups. have.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. It can have one formulation.
  • the present invention provides a method for preventing or treating a malignant tumor, comprising administering the pharmaceutical composition to an individual except a human, who may develop or may develop a malignant tumor.
  • the term "individual” refers to horses, sheep, pigs, goats, camels, antelopes, dogs, etc., in which a malignant tumor may develop or is likely to develop by administration of the pharmaceutical composition according to the present invention. Include animals or humans.
  • the treatment method according to the present invention may be a method of treating animals except humans, but is not limited thereto. That is, in the case of human, considering that symptoms may be improved by administration of the therapeutic composition according to the present invention, it can be sufficiently used in the treatment of human.
  • the pharmaceutical composition may be appropriately administered to a subject according to conventional methods, routes of administration, and dosages used in the art, depending on the purpose or need.
  • routes of administration may be administered orally, parenterally, subcutaneously, intraperitoneally, pulmonary, and intranasally, and parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration.
  • an appropriate dosage and frequency of administration may be selected according to methods known in the art, and the amount and frequency of administration of the pharmaceutical composition of the present invention to be actually administered may include the type of symptom to be treated, route of administration, sex, and health condition , Diet, the age and weight of the individual, and the severity of the disease may be appropriately determined.
  • the term “pharmaceutically effective amount” means an amount sufficient to inhibit or mitigate the increase in vascular permeability at a reasonable benefit / risk ratio applicable to medical use, and the effective dose level may include the type and severity, age, It may be determined according to sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts.
  • the compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • the present invention provides a method for determining drug resistance of a malignant tumor individual.
  • the method of determining the drug resistance of the malignant individual includes (a) measuring the expression level of HMGCLL1 IS3 from a biological sample isolated from the individual suffering from the malignant tumor; And (b) comparing the measured expression level of HMGCLL1 IS3 with that of the control sample.
  • the present invention by studying the statistically related single-base polymorphism between the patient group and the patient group that is resistant to the target therapeutic agent of chronic myelogenous leukemia, based on the drug resistance of patients with chronic myelogenous leukemia An attempt was made to predict or diagnose the degree. As a result, it was confirmed that the expression level of specific SNPs and HMGCLL1 IS3 in the HMGCLL1 gene correlated with drug resistance in patients with chronic myeloid leukemia. When the expression of the gene was inhibited, the growth of chronic myeloid leukemia cells and malignant tumor cells It was found to be effectively suppressed.
  • genotyping of SNPs located in two candidate regions resulted in the occurrence of rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 and rs929679 finally present on chromosome 6.
  • Monobasic polymorphisms were derived and found to be monobasic polymorphisms associated with drug resistance in patients with chronic myelogenous leukemia (see Table 3).
  • Drugs used to determine drug resistance in patients with chronic myelogenous leukemia in the present invention preferably include but are not limited to imatinib, nilotinib and dasatinib for the treatment of chronic myelogenous leukemia It doesn't happen.
  • drug-tolerance means a low reactivity compared to the normal group to a certain amount of drug administered to the organism.
  • the expression level of HMGCLL1 IS3 in a biological sample can be determined by checking the amount of mRNA or protein thereof.
  • the separation of mRNA and protein from the biological sample can be performed using a known process, and the amount of mRNA and protein can be determined in various ways. It can be measured by
  • biological sample includes bodily fluids, ie, urine, saliva, blood, plasma, serum, and the like, which can be simply collected to detect differences in mRNA or protein levels of HMGCLL1 IS3.
  • mRNA level measurement is to determine the presence and expression level of mRNA of HMGCLL1 IS3 in a biological sample in order to detect HMGCLL1 IS3.
  • PCR competitive RT-PCR, real-time RT-PCR, RNase protection assay, RNase protection assay, Northern blotting, DNA chip, and the like, but are not limited thereto.
  • the detection methods can be used to compare the amount of mRNA expression in the control group and the amount of mRNA expression in the control subjects who do not exhibit drug resistance, and to determine whether the expression of HMGCLL1 is significantly increased in mRNA to the chronic myelogenous leukemia drug of the subject. Can be diagnosed for resistance.
  • Assays for measuring protein levels using the antibody include Western blot, Enzyme linked immunosorbent assay (ELISA), Radioimmunoassay (RIA), Radioimmunodiffusion, Ochterlony immunodiffusion, and rocket immunoelectrophoresis , Tissue immunostaining, immunoprecipitation, complement fixation assay, FACS, protein chips, and the like, but are not limited to the described methods.
  • the present invention provides a composition for diagnosing drug resistance that can be used in the method for determining drug resistance of the malignant tumor individual.
  • the composition may include an agent capable of measuring the expression level of HMGCLL1 IS3.
  • the term "agent capable of measuring the expression level of HMGCLL1 IS3" is used to amplify or detect the gene or to specifically detect or measure the expression level of the HMGCLL1 IS3 gene or protein.
  • Means used to bind and detect and may be, for example, primers, probes, aptamers, antibodies, peptides, fragments of the antibodies, small molecule compounds and the like.
  • primer refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which can form complementary templates and base pairs and for template strand copying. By a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. PCR conditions, sense and antisense primer lengths can be modified based on what is known in the art.
  • the base sequence is not particularly limited as long as the primer can amplify the HMGCLL1 IS3 gene by a PCR method, but may be a primer pair consisting of the base sequences of SEQ ID NOs: 174 and 175 as an example.
  • probe refers to a nucleic acid fragment, such as RNA or DNA, which corresponds to a few bases to several hundred bases that can achieve specific binding with a gene or mRNA, and oligonucleotide.
  • Probes single stranded DNA (single stranded DNA) probes, double stranded DNA (double stranded DNA) probes, RNA probes and the like can be produced in the form of, and can be labeled for easier detection.
  • the base sequence is not particularly limited as long as the probe can detect the HMGCLL1 IS3 gene by binding complementarily to the whole or partial sequence of the HMGCLL1 IS3 gene like the above-described primer.
  • the present invention provides a kit for diagnosing drug resistance comprising the composition for diagnosing drug resistance.
  • the kit of the present invention may be implemented in a microarray manner.
  • a probe is immobilized on the solid surface of the microarray.
  • the nucleotide sequence of the marker of the present invention which should be referenced when constructing a probe, can be found in GenBank.
  • the single nucleotide polymorphism site which is a marker of the present invention is GenBank SNP database rs10948926 (SEQ ID NO: 9), rs10948927 (SEQ ID NO: 10), rs9370435 (SEQ ID NO: 11), rs4546489 (SEQ ID NO: 12), rs4275061 (SEQ ID NO: 13), Probes can be designed with reference to the nucleotide sequences described in rs9475323 (SEQ ID NO: 14), rs9475327 (SEQ ID NO: 15), and rs9296791 (SEQ ID NO: 16) and the GenBank SNP database sequences of Example Table 6.
  • the probe is used as a hybridizable array element and is immobilized on a substrate.
  • Preferred gases include suitable rigid or semi-rigid supports such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries.
  • Said hybridization array element is arranged and immobilized on said gas. This immobilization is carried out by chemical bonding methods or by covalent binding methods such as UV.
  • the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface.
  • the hybridization array element may be coupled to the gas through a linker (eg, ethylene glycol oligomer and diamine).
  • the label of the probe can provide a signal that allows detection of hybridization, which can be linked to oligonucleotides.
  • Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioisotopes Elements (P32 and S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavidin, biotin And hapten with specific binding partners such as digoxigenin and chelating groups.
  • fluorophores e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)
  • chromophores e.g.
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as the nick translat bio method, the random prime DNA labeling systems booklet ("Amersham” (1989)), and the chination method (Maxam & Gilbert, Methods in Enzymology, 65: 499 (1986).) Labels may be fluorescent, radioactive, colorimetric, gravimetric, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, Hybridization Provides a signal that can be detected by high frequency, nanocrystals.
  • the nucleic acid sample to be analyzed can be prepared using mRNA obtained from various biosamples.
  • the hybridization reaction-based assay may be performed by labeling the cDNA to be analyzed instead of the probe.
  • suitable hybridization conditions can be determined in a series of procedures by an optimization procedure. This procedure is carried out by a person skilled in the art in order to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. Detailed conditions for hybridization can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); And M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc.
  • the high stringency conditions were hybridized to 65 ° C. in 0.5 M NaHPO 4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA, and 68 at 0.1 ⁇ standard saline citrate / 0.1% SDS. It means washing under the condition of °C.
  • high stringency conditions mean washing at 48 ° C. in 6 ⁇ SSC / 0.05% sodium pyrophosphate.
  • Low stringency means washing at 42 ° C. conditions, for example, at 0.2 ⁇ SSC / 0.1% SDS.
  • the kit of the present invention when the kit of the present invention is carried out on the basis of hybridization, specifically, (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention to a nucleic acid sample;
  • the drug resistance to chronic myelogenous leukemia patients can be determined by analyzing the intensity of the hybridization signal due to the hybridization process, ie, the target marker of the present invention in a sample. If the hybridization signal for the nucleotide sequence of s is stronger than that of the normal sample, it is considered to be resistant to chronic myelogenous leukemia drug.
  • the present invention provides a method for determining the likelihood of malignancy.
  • the method for determining the incidence of malignancy includes the steps of: (a) measuring the expression level of HMGCLL1 IS3 from a biological sample isolated from the individual with the malignancy; And (b) comparing the measured expression level of HMGCLL1 IS3 with that of the control sample.
  • the method for screening a malignant tumor therapeutic agent comprises the steps of: (a) treating a malignant tumor therapeutic agent candidate with an isolated malignant tumor sample in which HMGCLL1 IS3 is expressed; And (b) comparing the expression level of HMGCLL1 IS3 measured in the sample treated with the candidate with the expression level of HMGCLL1 IS3 measured in the control sample not treated with the candidate.
  • the term “candidate” refers to an unknown substance capable of treating the malignant tumor, thereby reducing the expression level of HMGCLL1 IS3, against a malignant tumor in which HMGCLL1 IS3 is expressed. do.
  • the candidates include, but are not limited to, chemicals, peptides, nucleotides, antisense-RNAs, and small interference RNAs (siRNAs).
  • Test materials can be obtained by a variety of combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the required synthetic library method, “1-bead 1-compound” library method, and synthetic library method using affinity chromatography screening. Methods of synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem.
  • the screening methods of the present invention can be carried out in a variety of ways, in particular in a high throughput manner according to various binding assays, expression assays or activity assay techniques known in the art.
  • Measurement of the expression level change of HMGCLL1 IS3 can be carried out through various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine , 102-108, CRC press), hybridization reaction using cDNA microarray (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) or in situ hybridization reaction (Sambrook et al. , Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)).
  • RNA is isolated from cells treated with a sample, and then a first-chain cDNA is prepared using oligo dT primers and reverse transcriptase. Subsequently, the first chain cDNA is used as a template, and PCR reaction is performed using the HMGCLL1 IS3-specific primer set.
  • HMGCLL1 IS3-specific primer sets are illustrated in SEQ ID NOs: 12 and 13. Then, PCR amplification products are electrophoresed, and the formed bands are analyzed to measure changes in the expression level of HMGCLL1 IS3.
  • the change in the expression level of HMGCLL1 IS3 gene is determined by measuring the expression level of HMGCLL1 IS3.
  • the method of measuring the amount of HMGCLL1 IS3 can be carried out according to various analytical methods.
  • antibodies that specifically bind to HMGCLL1 IS3 can be used to measure the amount of HMGCLL1 IS3 in various immunoassay formats.
  • the immunoassay formats include, but are not limited to, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood assay, sandwich assay, immunofluorescence staining and immunoaffinity purification. It is not limited.
  • the immunoassay or method of immunostaining is described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.
  • antibodies labeled with radioisotopes eg, C14, I125, P32 and S35
  • radioisotopes eg, C14, I125, P32 and S35
  • certain embodiments of the present invention comprise the steps of: (a) coating an unknown cell sample lysate to be analyzed on the surface of a solid substrate; (b) reacting the cell lysate with a HMGCLL1 IS3-specific antibody as a primary antibody; (c) reacting the resultant of step (b) with a secondary antibody to which an enzyme is bound; And (d) measuring the activity of the enzyme.
  • Suitable as the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates.
  • Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence, luminescence or infrared reaction, for example, alkaline phosphatase, ⁇ -galactosidase, hose Radish peroxidase, luciferase and cytochrome P450.
  • alkaline phosphatase When alkaline phosphatase is used as an enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS) Chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis) if colorimetric substrates such as -B1-phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used -N-methylacridinium nitrate), resorupin benzyl ether, luminol, Amflex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), TMB (tetramethylbenzidine),
  • certain embodiments of the invention comprise (a) coating an antibody against HMGCLL1 IS3 as a capturing antibody to the surface of a solid substrate; (b) reacting the capture antibody with the cell sample; (c) reacting the product of step (b) with a detecting antibody having a label that generates a signal and which specifically reacts with HMGCLL1 IS3; And (d) measuring the signal resulting from the label.
  • the detection antibody carries a label which generates a detectable signal.
  • the labels may include chemicals (eg biotin), enzymes (alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase and cytochrome P450), radioactive substances (eg C14, I125, P32 and S35). ), Fluorescent materials (eg, fluorescein), luminescent materials, chemiluminescent and fluorescence resonance energy transfer (FRET), including but not limited to various labels and labeling methods Ed Harlow and David Lane , Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.
  • Measurement of the final enzyme activity or signal in the ELISA method and the capture-ELISA method can be carried out according to various methods known in the art. Detection of these signals allows for quantitative analysis of HMGCLL1 IS3. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferin if luciferase is used.
  • the test substance is a candidate for preventing or treating chronic myelogenous leukemia and malignancy. Is determined.
  • the present invention provides a method of predicting malignancy.
  • the malignant tumor prognostic method comprises the steps of: (a) measuring the expression level of HMGCLL1 IS3 from a biological sample isolated from a subject having malignant tumor; And (b) comparing the measured expression level of HMGCLL1 IS3 with that of the control sample.
  • step (a) when the expression level of HMGCLL1 IS3 measured in step (a) is higher than that of the control sample, it may be determined that the prognosis of the subject is poor.
  • HMGCLL1 IS3 As described above, when the expression level of HMGCLL1 IS3 is increased, resistance to various anticancer drugs may be induced, so in patients with relatively high levels of HMGCLL1 IS3, the prognosis of the disease after chemotherapy is You can expect it to be bad.
  • the present invention provides a composition for predicting prognosis of malignancies that can be used in the malignant tumor prognosis prediction method.
  • the composition may include an agent capable of measuring the expression level of HMGCLL1 IS3.
  • the agent capable of measuring the expression level of the HMGCLL1 IS3 is the same as described above.
  • the present invention provides a kit for predicting prognosis of malignancies, comprising the composition for predicting prognosis of malignancies.
  • the present invention provides a method for determining drug resistance of a malignant tumor individual using drug resistance specific SNP.
  • the method for determining drug resistance of the malignant tumor individual is 26 in a polynucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 9 to 16 and 33 to 173, from a biological sample isolated from an individual having a malignant tumor. Detecting or amplifying a polynucleotide or complementary polynucleotide consisting of 2 to 51 consecutive bases including a single nucleotide polymorphism (SNP) located at a first base.
  • SNP single nucleotide polymorphism
  • the polynucleotide when the polynucleotide is detected or amplified, it may be determined that the subject has drug resistance to malignancy.
  • the present invention by studying the statistically related single-base polymorphism between the patient group and the patient group that is resistant to the target therapeutic agent of chronic myelogenous leukemia, based on the drug resistance of patients with chronic myelogenous leukemia An attempt was made to predict or diagnose the degree. As a result, it was confirmed that the expression level of specific SNPs and HMGCLL1 IS3 in the HMGCLL1 gene correlated with drug resistance in patients with chronic myeloid leukemia. When the expression of the gene was inhibited, the growth of chronic myeloid leukemia cells and malignant tumor cells It was found to be effectively suppressed.
  • genotyping of SNPs located in two candidate regions resulted in the occurrence of rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 and rs929679 finally present on chromosome 6.
  • Monobasic polymorphisms were derived and found to be monobasic polymorphisms associated with drug resistance in patients with chronic myelogenous leukemia (see Table 3).
  • RNA Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic (see PNAS). USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001) )).
  • the detection or amplification can be carried out by applying various methods known in the art used to identify specific sequences.
  • techniques applicable to the present invention include fluorescence phosphorylation hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand conformation analysis (SSCA, Orita et al., PNAS, USA 86: 2776 (1989)), RNase protection assay (Finkelstein et al., Genomics, 7: 167 (1990)), dot blot analysis, denaturation gradient gel electrophoresis (DGGE, Wartell et al., Nucl. Acids Res.
  • FISH fluorescence phosphorylation hybridization
  • PFGE analysis Southern blot analysis
  • single-strand conformation analysis SSCA, Orita et al., PNAS, USA 86: 2776 (1989)
  • RNase protection assay Finkelstein et al., Genomics, 7: 167 (1990)
  • dot blot analysis denaturation gradient gel electrophor
  • the present invention provides a composition for determining drug resistance that can be used in the method for determining drug resistance of a malignant tumor individual using the drug resistance specific SNP.
  • the agent may be a primer or a probe, which is the same as described above for the primer or probe.
  • the present invention provides a kit for determining drug resistance, comprising the composition for determining drug resistance.
  • the present invention provides a method for determining the incidence of malignancy using drug-resistant specific SNP.
  • the method for determining the incidence of malignancy is the 26th in the polynucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 9 to 16 and 33 to 173 from a biological sample isolated from the individual with the malignant tumor Detecting or amplifying a polynucleotide consisting of 2 to 51 consecutive bases comprising a single nucleotide polymorphism (SNP) located at a base or a complementary polynucleotide thereof.
  • SNP single nucleotide polymorphism
  • the polynucleotide when the polynucleotide is detected or amplified, it may be determined that the subject is more likely to develop a malignant tumor than the control subject.
  • a verification group (272 patient groups) was composed of European cohorts, and a MassARRAY system (Sequenom, Inc., San Diego, CA, USA) was used for 272 subjects. SNP genotype was analyzed. Patients with a high proportion of missing genotypes in the test group were excluded from the analysis. A total of 270 subjects (121 resistant, 135 non-resistant, 14 phenotypic information missing) were tested for the same Cox's proportional hazard model as the experimental group. rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 and rs9296791) showed a significant association.
  • the P value of the SNP was in the range of 0.036-0.049, and the SNP in the test group was in the range of 2.25E-05-7.61E-05.
  • the association direction in the European cohort was the same as the Korean cohort experimental group when the hazard ratio was confirmed.
  • rs9370435 which shows the most significant P value as a representative SNP
  • the frequency of the G allele was higher in the resistant group (0.37 vs 0.45) in the Korean test group
  • the frequency of the G allele in the European test group was also higher in the resistant group. The same tendency of higher frequency was seen in (0.29 vs 0.35).
  • haplotypes were constructed for eight SNPs (rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 and rs9296791) associated with drug resistance in patients with chronic myeloid leukemia.
  • the eight SNPs show a high linkage disequilibrium (LD) value, which indicates that the eight SNPs are dependent on each other.
  • LD linkage disequilibrium
  • These eight SNPs are located in intron 5 (between exon 6 and exon 7) of the HMGCLL1 gene at chromosome 6p12.1.
  • a single base polymorphism (SEQ ID NOs: 33 to 173) having a homozygous haplotype of the same pattern as 8 single base polymorphisms in Korean and Western people was further identified.
  • the single nucleotide polymorphisms are associated with eight single nucleotide polymorphisms with high association imbalance (LD) relationships (r2> 0.8).
  • LD association imbalance
  • 141 single nucleotide polymorphisms showing the same haplotype pattern with eight single nucleotide polymorphisms may also affect the target gene (HMGCLL1).
  • the quantitative polymerase chain reaction (QPCR) primers were prepared for quantification of the identified isoform-specific expression (FIGS. 7A and 7B).
  • the sequence of the primer for isoform 3 is as follows (see Table 8).
  • SNPs (rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327) associated with drug resistance using a MassARRAY system (Sequenom, Inc., San Diego, CA, USA) in a total of 120 healthy subjects Genotyping was performed for rs9296791) and a haplotype was constructed based on the results.
  • MassARRAY system Sequenom, Inc., San Diego, CA, USA
  • each group is three haplotype distributions (AA, AB, BB; AA is homogenous with haplotype of ACGTAATG, AB is haplotype with ACGTAATG haplotype and CTCAGGCA, BB is haplotype with CTCAGGCA)
  • This homogenous group was found to be distributed in a ratio of 0.37: 0.48: 0.15, and the expression level and statistical significance level quantified by QPCR for each isoform were confirmed, and isoform 3 showed the lowest P value. gave.
  • homozygotes homozygote
  • haplotypes were significantly correlated with the expression of specific isoforms of the gene (HMGCLL1). This fact indicates that the genotype of the haplotypes influences the selective splicing of the gene (HMGCLL1). Indicates that you can give.
  • a somatic mutation-induced cell line of T315I was prepared, and it was a 96-well containing DMEM medium containing 10% FBS, 100 units / mL penicillin and 100 ⁇ g / mL streptomycin. Plates were seeded at 3 ⁇ 10 3 cell numbers per well and then incubated at 37 ° C. and 5% CO 2.
  • HMGCLL1 Sequence of siRNA and corresponding C911 control sequence for knockdown of specific regions of the gene of interest target division siRNA sequence (5'-3 ')
  • HMGCLL1 Isoform 3Negative control, C911 Sense GGUACCACUCCUUGCUGCU (SEQ ID NO: 176) Antisense AGCAGCAAGGAGUGGUACC (SEQ ID NO: 177)
  • HMGCLL1 Isoform 3 Sense GGUACCACAGGUUGCUGCU (SEQ ID NO: 178) Antisense AGCAGCAACCUGUGGUACC (SEQ ID NO: 5)
  • HMGCLL1 IS3 siRNA when used alone or in combination with first-generation and second-generation anticancer agents, reduced the survival rate of the cell line induced by the somatic mutation of T315I.
  • HMGCLL1 IS3 siRNA in combination with the 1st generation / 2nd generation anticancer agent showed an effect of reducing the survival rate of the cell line to more improved levels.
  • the CML cell lines K562 and CML-T1 cell lines and normal lymphoblastoid cell lines (LCL) were placed in 96-well plates containing DMEM medium containing 10% FBS, 100 units / mL penicillin and 100 ⁇ g / mL streptomycin, respectively. Each well was inoculated with 3 ⁇ 10 3 cell numbers and then cultured at 37 ° C. and 5% CO 2.
  • HMGCLL1 IS3 siRNA confirmed anticancer activity on the CML cell line was intended to confirm through Phospho-CRKL analysis and cell cycle analysis.
  • Example 11-1 Phospho - CRKL analysis
  • HMGCLL1 IS3 siRNA inhibited CRKL phosphorylation in CML cell line, thereby inhibiting signaling by BCR-ABL1, stopping the cell cycle, and exhibiting anticancer activity.
  • Example 12 against various cancer cells HMGCLL1 IS3 siRNA Anticancer activity analysis
  • HMGCLL1 IS3 siRNA can show anticancer activity against hematopoietic and lymphoid tissues, autonomic ganglia, gallbladder, breast, central nervous system, liver, pancreas, skin, stomach and urinary system.
  • hematopoietic and lymphoid cancer cell lines LAMA84 (Chronic myeloid leukemia in blast crisis), KG-1 (Acute myeloid leukemia, FAB M2), HL-60 (Acute myeloid leukemia, FAB M2), NB-4 (Acute promyelocytic leukemia ), MOLM13 (Acute myeloid leukemia, FAB M5B), CCRF-CEM (T Acute lymphoblastic leukemia) and U-937 (Histiocytic lymphoma) and solid cancer cell lines IMR-32 (Neuroblastoma, KCLB, 10127), SNU-478 (Ampulla of Vater adenocarcinoma), MG-63 (Osteosarcoma), Hs578T (Breast Invasive ductal carcinoma, KCLB, 30126), U-87MG (Glioblastoma), SNU-886 (Hepatocellular carcinoma), MIA-PaCa-2 (
  • Each of the cultured cells was treated with two kinds of siRNAs (negative control siRNAs or IS3 siRNAs) having the base sequences of SEQ ID NOs: 5 and 176 to 178 at a concentration of 100 picomoles (pmol) based on 200,000 cells. After incubation by time, the survival rate of these cells was compared using CCK-8 assay. (FIGS. 12A-12C).
  • IS3 siRNA was found to reduce the survival rate of each cell line to a remarkable level.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 HMGCLL1 IS3의 발현을 억제하는 제제를 포함하는 악성종양의 예방 또는 치료용 약학 조성물, 티로신 키나아제 억제제에 대한 저항성을 나타내는 악성종양의 예방 또는 치료용 약학 조성물, HMGCLL1 IS3의 발현수준을 이용한 악성종양 개체의 약물내성 판단 방법, 상기 방법에 사용되는 약물내성 진단용 조성물 및 키트, HMGCLL1 IS3의 발현수준을 이용한 악성종양의 발병가능성 판단 방법, HMGCLL1 IS3의 발현수준을 이용한 악성종양 치료제의 스크리닝 방법, HMGCLL1 IS3의 발현수준을 이용한 악성종양 예후예측 방법, HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함하는 악성종양의 예후 예측용 조성물 및 키트, SNP를 이용한 악성종양 개체의 약물내성 판단 방법, 상기 방법에 사용되는 약물내성 진단용 조성물 및 키트, SNP를 이용한 악성종양의 발병가능성 판단 방법, SNP를 이용한 악성종양 예후예측 방법, 상기 방법에 사용되는 악성종양의 예후 예측용 조성물 및 키트에 관한 것이다. 본 발명의 방법을 이용하면 만성 골수성 백혈병 및 악성 종양 환자의 약물 내성도를 효과적으로 예측 또는 진단할 수 있으며 나아가 효율적인 약물 치료 및 약물 개발 연구에 활용할 수 있다.

Description

항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물
본 발명은 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물에 관한 것으로, 보다 구체적으로, 본 발명은 HMGCLL1 IS3의 발현을 억제하는 제제를 포함하는 악성종양의 예방 또는 치료용 약학 조성물, 티로신 키나아제 억제제에 대한 저항성을 나타내는 악성종양의 예방 또는 치료용 약학 조성물, HMGCLL1 IS3의 발현수준을 이용한 악성종양 개체의 약물내성 판단 방법, 상기 방법에 사용되는 약물내성 진단용 조성물 및 키트, HMGCLL1 IS3의 발현수준을 이용한 악성종양의 발병가능성 판단 방법, HMGCLL1 IS3의 발현수준을 이용한 악성종양 치료제의 스크리닝 방법, HMGCLL1 IS3의 발현수준을 이용한 악성종양 예후예측 방법, HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함하는 악성종양의 예후 예측용 조성물 및 키트, SNP를 이용한 악성종양 개체의 약물내성 판단 방법, 상기 방법에 사용되는 약물내성 진단용 조성물 및 키트, SNP를 이용한 악성종양의 발병가능성 판단 방법, SNP를 이용한 악성종양 예후예측 방법, 상기 방법에 사용되는 악성종양의 예후 예측용 조성물 및 키트에 관한 것이다.
만성 골수성 백혈병(chronic myeloid leukemia, CML)은 희귀한 클로날 골수 증식성 질환(clonal myeloproliferative disorder)으로 조혈모 세포의 이상으로 모든 골수계의 세포가 증식하는 것을 특징으로 하는 질환이며, 향상된 증식능과 조혈줄기세포(hematopoietic stem cells, HSCs)의 장기간 생존 및 세포사멸(apoptosis) 감소와 같은 특징을 나타낸다. 만성 골수성 백혈병(CML)은 일반적으로 인구 100,000명 당 0.6-2명 정도의 환자가 있는 매우 드문 혈액암에 속하며, 서양인과 동아시아인 사이에 발병률이 다르게 나타난다.
주요 발병 원인으로 알려진 BCR-ABL 종양유전자(oncogene)는 필라델피아 염색체(Philadelphia chromosome, Ph)에서 구조적으로 Bcr-Abl 융합 티로신 키나아제(fusion tyrosine kinase, FTK)의 활성을 암호화 하는 유전자이다. Bcr-Abl FTK가 만성 골수성 백혈병의 중요한 분자 마커임이 알려졌고, 이를 표적으로 하는 치료제로 이매티닙(imatinib)이 개발되었다. Bcr-Abl 재조합 유전자는 지속적인 티로신 키나아제(tyrosine kinase) 활성을 통해 암세포의 증식을 유도한다. 이매티닙은 ATP(adenosine triphosphate)가 결합하는 위치에 해당하는 활성지역(active site)에 결합하여 티로신 키나아제 효소 활성을 방해함으로써 암세포의 증식을 막는 작용기작을 유도한다. 하지만 해당 약물이 개발되고 시간이 경과함에 따라 이매티닙에 대한 약물 내성을 보이는 환자들이 점점 보고 되고 있다.
Bcr-Abl 융합(fusion) 유전자에 생성된 점 돌연변이(point mutation)가 이매티닙 내성 발생의 요인으로 밝혀지고 있지만 해당 점 돌연변이를 가지고 있지 않은 환자에게서도 이매티닙 내성이 발생하고 있으며 아직 이에 대한 정확한 원인 및 해결책은 밝혀지지 않았다. 1차 만성 골수성 백혈병의 표적치료제인 이매티닙에 이어 점 돌연변이의 존재로 이에 내성을 보이는 환자들을 대상으로 2차 표적치료제 닐로티닙(nilotinib), 다사티닙(dasatinib)등이 개발되어 환자들에 적용되고 있지만, 약물내성을 극복하는 다른 전략의 필요성이 대두되고 있다.
최근 동일한 발암요인에 대해서도 개인이 가지는 유전적 감수성에 따라 위험도가 달라지며 이러한 개인 및 인종간의 감수성을 구분 짓는 가장 중요한 표지자로 단일염기다형성(single nucleotide polymorphism, SNP)이 제시되고 있다. 단일염기다형성이란 개인과 개인 간의 DNA에 존재하는 한 염기쌍의 차이(single base-pair variation)를 말하는 것으로 DNA 염기서열 다형성(polymorphism)중에서 가장 많이 존재하는 형태이다(약 1 kb 당 1개). 단일염기다형성은 가장 높은 빈도를 보이는 변이형태일 뿐만 아니라, 상당히 안정적이고 낮은 변이율을 보인다는 점에서 유전체(genome) 상의 유전적 표지인자로서 사용될 수 있다. 이는 단일염기다형성이 유전자에서 일어나는 다른 종류의 다양성들에 대한 정보를 제공해 준다는 것을 시사한다. 예를 들면 연관불균형(linkage disequilibrium) 분석을 통하여 선택된 단일염기다형성들이 연관불균형을 이루고 있다면, 그 단일염기다형성들 내에 일어나는 유전자상의 변화들도 같은 연관불균형을 이루고 있기 때문에, 그 단일염기다형성은 유전자상의 돌연변이와 같은 변화로 어떠한 질병이 나타나게 되었는지를 확인할 수 있는 중요한 단서로서의 의미를 지니게 된다. 이러한 연관불균형은 유전체 DNA의 재조합의 중요부분을 예측할 수 있으므로 다음 세대로의 유전 그리고 유전적 질병에 대하여도 예측할 수 있는 실마리를 제공한다.
전장유전체연관분석(genome-wide association analysis)에 의해 만성 림프성 백혈병(chronic lymphocytic leukemia), 급성 림프구성 백혈병(acute lymphoblastic leukemia)및 골수성 종양과 관련된 치료법 등 특정 형태의 혈액종양(hematologic malignancies)과 유전적 변이 사이의 연관성이 밝혀진바 있다. 만성 골수성 백혈병과 관련하여 BCL2 유전자 다형성이 CML 감수성과 관련이 있다는 선행 연구가 있다.
본 발명자들은 만성 골수성 백혈병의 표적 치료제에 대하여 내성을 보이는 환자군과 내성을 보이지 않는 환자군 사이에 통계적으로 연관성이 있는 단일염기다형성을 연구하여, 이를 토대로 만성 골수성 백혈병 환자의 약물 내성도를 예측 또는 진단하고자 하였다. 그 결과, HMGCLL1 유전자내의 특정 SNP들과 HMGCLL1 유전자의 아이소폼 3의 발현 수준이 만성 골수성 백혈병 환자의 약물 내성과 상관성이 있음을 확인하였으며, 상기 유전자의 발현을 억제시키는 경우 만성 골수성 백혈병 세포 및 악성 종양 세포의 성장이 효과적으로 억제되는 것을 규명함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 HMGCLL1 IS3의 발현을 억제하는 제제를 포함하는 악성종양의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 HMGCLL1 IS3의 발현을 억제하는 제제를 포함하는 티로신 키나아제 억제제에 대한 저항성을 나타내는 악성종양의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 HMGCLL1 IS3의 발현수준을 이용한 악성종양 개체의 약물내성 판단 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 사용되는 약물내성 진단용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 조성물을 포함하는 약물내성 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 HMGCLL1 IS3의 발현수준을 이용한 악성종양의 발병가능성 판단 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 HMGCLL1 IS3의 발현수준을 이용한 악성종양 치료제의 스크리닝 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 HMGCLL1 IS3의 발현수준을 이용한 악성종양 예후예측 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함하는 악성종양의 예후 예측용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 악성종양의 예후 예측용 조성물을 포함하는 악성종양의 예후 예측용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 9 내지 16 및 33 내지 173중 적어도 하나의 SNP의 존재여부를 결정하는 단계를 포함하는 악성종양 개체의 약물내성 판단 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 사용되는 약물내성 진단용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 약물내성 진단용 조성물을 포함하는 약물내성 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 9 내지 16 및 33 내지 173중 적어도 하나의 SNP의 존재여부를 결정하는 단계를 포함하는 악성종양의 발병가능성 판단 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 9 내지 16 및 33 내지 173중 적어도 하나의 SNP의 존재여부를 결정하는 단계를 포함하는 악성종양 예후예측 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 사용되는 악성종양의 예후 예측용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 예후 예측용 조성물을 포함하는 약물내성 진단용 키트를 제공하는 것이다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 만성 골수성 백혈병 및 악성종양 환자의 약물 내성과 연관성이 있는 유전자 및 단일염기다형성 마커를 제공한다.
(b) 본 발명은 상기 마커를 이용한 만성 골수성 백혈병 및 악성종양 환자에 대한 약물 내성 진단용 키트, 상기 만성 골수성 백혈병 및 악성종양 치료제의 스크리닝 방법 및 만성 골수성 백혈병 및 악성종양의 예방 또는 치료용 약제학적 조성물을 제공한다.
(c) 본 발명의 마커를 이용하면 만성 골수성 백혈병 및 악성종양 환자의 약물 내성도를 효과적으로 예측 또는 진단할 수 있으며 나아가 효율적인 약물 치료 및 약물 개발 연구에 활용할 수 있다.
도 1은 본 발명의 실험군(Discovery set)에서 만성 골수성 백혈병에 대한 전장유전체분석(genome-wide association analysis) 결과를 맨하탄 플롯(Manhattan plot)으로 도시한 것이다.
도 2는 유전적 동질성(genetic homogeneity)을 확인하고, 계층(stratification)을 평가하기 위하여 다차원 척도법(multidimensional scaling, MDS)을 이용하여 샘플의 인구 구조를 분석한 결과를 도시한 것이다.
도 3은 실험군에서의 후보유전자좌(6p12.1)에 속하고 검증군에서 검증(validation) 연관플롯(regional association plot)을 나타낸 것이다.
도 4는 6p12.1에 위치한 HMGCLL1에 대한 연관불균형플롯(LD plot)에 해당한다. Hapmap2 release 22 CHB+JPT reference data를 기준으로 도시화 하였으며, r-square 기준으로 LD color를 표시하였다.
도 5는 HMGCLL1 유전자의 각 엑손 및 연관성이 검증된 8개의 단일염기다형성의 위치를 도시화 하였다.
도 6a 및 6b는 한국인과 서양인에서의 누적발병률(cumulative incidence)에 대한 플롯 결과이다. 도 6a. 한국인에서의 누적발병률 플롯, 도 6b. 서양인에서의 누적발병률 플롯.
도 7a는 HMGCLL1에서 나타날 수 있는 아이소폼의 구조를 나타내는 개략도이다.
도 7b는 해당 아이소폼을 정량하기 위한 프라이머 결합 위치와 정량한 결과값을 나타낸다.
도 8a 및 8b는 표적 항암제 내성을 나타내는 변이 세포주(T315I 변이를 유도한 K562 세포주)에 미치는 HMGCLL1 IS3 siRNA와 표적 항암제의 효과를 비교한 결과를 나타내는 그래프이다.
도 9a 내지 9c는 CML 세포주와 정상 림프구 세포에 미치는 HMGCLL1 IS3 siRNA와 항암제의 효과를 비교한 결과를 나타내는 그래프로서, 도 9a는 CML 세포주의 하나인 K526 세포를 대상으로 수행한 결과를 나타내고, 도 9b는 CML 세포주의 하나인 CML T1 세포를 대상으로 수행한 결과를 나타내며, 도 9c는 정상 림프구 세포를 대상으로 수행한 결과를 나타낸다.
도 10은 CML 세포주의 하나인 K526 세포에서 HMGCLL1 IS3 siRNA와 표적 항암제의 처리에 따른, pCrkL/CrkL 비율의 변화를 비교한 결과를 나타내는 그래프이다.
도 11a 및 11b는 CML 세포주를 대상으로 HMGCLL1 IS3 siRNA의 처리에 따른 세포주기의 변화를 비교한 결과를 나타내는 그래프로서, 도 11a는 CML 세포주의 하나인 K526 세포를 대상으로 수행한 결과를 나타내고, 도 11b는 CML 세포주의 하나인 LAMA-84 세포를 대상으로 수행한 결과를 나타낸다.
도 12a 내지 12c는 다양한 암세포에 대한 HMGCLL1 IS3 siRNA의 항암활성을 비교한 결과를 나타내는 그래프로서, 도 12a는 조혈 및 림프 조직 암세포주를 대상으로 수행한 결과를 나타내고, 도 12b 및 12c는 고형암 세포주를 대상으로 수행한 결과를 나타낸다.
본 발명자들은 CML에 대한 표적항암제의 내성 유발에 관여하는 유전적 요인을 규명할 수 있었다. 즉, 상기 내성유발에 8개의 SNP(rs10948926(서열번호 9), rs10948927(서열번호 10), rs9370435(서열번호 11), rs4546489(서열번호 12), rs4275061(서열번호 13), rs9475323(서열번호 14), rs9475327(서열번호 15) 및 rs9296791(서열번호 16))가 관여함을 확인하였다. 상기 각 SNP는 염색체 6p12.1 위치 HMGCLL1 유전자의 인트론 5(엑손 6번과 엑손 7번 사이)에 위치한다.
본 발명자들의 연구에 따르면, 상기 각 SNP는 서로 의존적으로 연관되어 있고, 이와 동일한 패턴의 동형의(homozygous) 일배체형을 갖는 SNP가 존재함을 발견하였다. 본 발명자들의 연구에 따르면, 서열번호 33 내지 173의 염기서열을 갖는 총 141개의 SNP가 상기 8개의 SNP와 서로 의존적으로 연관되어 있다.
따라서, 본 발명의 한 구현예에 따르면, 상기 서열번호 9 내지 16 및 33 내지 173으로 나타내지는 서열을 갖는 SNP의 존재여부를 결정함으로써 암의 약물내성 여부를 판단하는 방법이 제공된다. 또한 본 발명의 한 구현예는 상기 SNP를 검출하기 위한 조성물과 키트를 제공한다. 상기 조성물과 키트는 상기 SNP를 타켓 서열로 하여 타겟서열에 상보적으로 결합할 수 있는 염기서열을 포함하는 프라이머 서열, 프로브 서열, 및 polymerase를 포함한다. 본 발명의 또 다른 구현예는 상기 방법, 조성물, 키트를 이용하여 결정한 약물내성에 관한 정보를 이용하여 적절한 치료방법을 결정하는 것을 제공한다.
또한, 본 발명자들은 상기 SNP로 구성된 일배체형의 분포가 HMGCLL1 유전자의 특정 아이소폼의 발현과 유의적으로 연관됨을 확인하였다. 특히, 상기 SNP는 HMGCLL1의 아이소폼 3(isoform 3, IS3, 서열번호 2 및 3)의 발현과 직접적으로 연관됨을 확인하였다.
따라서, 본 발명의 한 구현예에 따르면, 상기 HMGCLL1 IS3의 발현 정도를 측정함으로써 암 치료약물에 대한 내성을 갖는 지의 여부를 결정하는 방법이 제공된다.
본 발명의 또 다른 구현예에 따르면, HMGCLL1 IS3의 발현 정도를 측정하함으로써 암의 예후를 예측하는 방법이 제공된다.
따라서, 위의 방법 중 적어도 하나를 이용하여 내성 여부를 결정한 결과에 따라, 적절한 치료법을 환자에게 제시할 수 있다. 예를 들어, 암 진단 환자의 시료에 대해 위의 방법을 실시하여 상기 SNP를 갖는 것으로 결정된 경우, 그 환자의 효과적인 암 치료에 적절한 치료법를 처방할 수 있다. 예를 들어, 1차 항암치료제를 이용한 치료시기 및 2차 항암치료제를 이용하기에 적합한 치료 시기 등을 합리적으로 결정할 수 있다.
본 발명자들은 또한, 놀랍게도, HMGCLL1 IS3 억제제가 항암제에 대한 내성이 유발된 CML에 대한 치료효과를 나타낼 뿐만 아니라 내성이 유발되지 않은 CML에 대하여도 치료효과를 나타냄을 확인하였다. 억제제로서 HMGCLL1 IS3의 siRNA를 이용한 실험에서 CML의 발병을 유도하는 BCR-ABL1에 의한 신호전달을 억제하고, 세포주기를 중지시켜서, 항암 활성을 나타내는 것도 확인할 수 있었다.
또한, 더욱 놀랍게도, 상기 HMGCLL1 IS3 siRNA가 CML이 아닌 다른 악성 종양에 대하여도, 항암활성을 나타내는 것을 확인할 수 있었다. 예를 들면 억제제로서 HMGCLL1 IS3의 siRNA를 이용한 실험에서, 조혈 및 림프 조직, 자율신경절, 쓸개관, 유방, 중추신경계, 간, 췌장, 피부, 위, 비뇨기계 등의 다양한 조직으로 부터 유래된 암세포에 대하여도 모두 유의한 항암활성을 나타냄을 확인하였다.
이처럼, HMGCLL1 IS3의 발현을 억제함으로써, 다양한 암조직에 대하여 항암활성을 나타내는 효과는 지금까지 전혀 보고되지 않았고, 본 발명자에 의하여 최초로 규명되었다.
본 발명의 한 구현예에 따르면, HMGCLL1 IS3 (3-Hydroxymethyl-3-Methylglutaryl-CoA Lyase Like 1 isoform 3)의 발현 또는 활성을 억제하는 제제를 포함하는, 악성종양의 예방 또는 치료용 약학 조성물이 제공된다.
용어의 정의
본 명세서에서 사용된 용어 "HMGCLL1(3-Hydroxymethyl-3-Methylglutaryl-CoA Lyase Like 1)"이란, 페로시좀(Peroxisome) 관련 경로 및 부타노에이트 대사(butanoate metabolism) 경로에 관여하는 단백질 또는 상기 단백질을 코딩하는 유전자를 의미한다. 상기 HMGCLL1 유전자는 10개의 엑손영역을 포함하는데, 상기 엑손영역의 결실에 따라, 다양한 종류의 아이소폼 형태로 발현될 수 있다.
HMGCLL1의 기능은 미토콘드리아(mitochondria) 외에서 3-하이드록시메틸-3-메틸글루타릴 CoA 리아제를 통해 (S)-3-하이드록시-3-메틸글루타릴-CoA를 아세틸-CoA와 아세토아세테이트로의 분해를 촉매한다고 알려져 있다. 주목할 만 한 점은 HMGCLL1은 HMGCL(HMG-CoA lyase)와 서열이 유사하고, HMGCR(HMG-CoA reductase)와 서로 상보적인 경로(pathway) 내에 영향을 준다.
HMGCL과 연관되어 있다고 알려진 질병으로는 3-하이드록시-3-메틸글루타릴 CoA 리아제(3-Hydroxy-3-Methylglutaryl-CoA Lyase) 결핍증으로 상염색체 열성 유전되고, HMG-CoA lyase의 결핍으로 케톤(ketone) 형성의 장애가 발생하여 저혈당이 있으면서 케톤이 증가하지 않거나 덜 증가하게 된다.
상기 HMGCLL1 유전자의 구체적인 염기서열 또는 단백질의 아미노산 서열 정보는 NCBI와 같은 database에 보고되어 있다. 예를 들면, GenBank Accession Nos: NC_000006.12, NC_000075.6, NC_005107.4 등으로 보고되어 있다. 예시적으로, 본 발명에서는 서열번호 1의 염기서열로 구성된 HMGCLL1의 cDNA를 제공한다. 상기 서열번호 1의 HMGCLL1 cDNA에 있어서, 1번 엑손영역은 1번 내지 108번 염기로 구성된 영역이고, 2번 엑손영역은 109번 내지 198번 염기로 구성된 영역이며, 3번 엑손영역은 199번 내지 279번 염기로 구성된 영역이고, 4번 엑손영역은 280번 내지 387번 염기로 구성된 영역이며, 5번 엑손영역은 388번 내지 483번 염기로 구성된 영역이고, 6번 엑손영역은 484번 내지 632번 염기로 구성된 영역이며, 7번 엑손영역은 633번 내지 696번 염기로 구성된 영역이고, 8번 엑손영역은 697번 내지 885번 염기로 구성된 영역이며, 9번 엑손영역은 886번 내지 1011번 염기로 구성된 영역이고, 10번 엑손영역은 1012번 내지 1113번 염기로 구성된 영역이다.
본 명세서에서 사용된 HMGCLL1의 아이소폼 3(isoform 3, IS3)은 상기 HMGCLL1 cDNA중 2번 엑손과 5번 엑손이 결실된 형태로 발현되는 단백질로서, 본 발명자들에 의해 처음으로 CML에 대한 항암제 내성에 중요한 역할을 수행할 뿐만 아니라, 상기 HMGCLL1 IS3의 발현을 억제시키면, 다양한 종류의 암을 치료하는 효과를 나타낼 수 있다는 것이 밝혀졌다. 상기 HMGCLL1 유전자의 각 아이소폼의 구체적인 염기서열 또는 단백질의 아미노산 서열 정보는 정보는 NCBI와 같은 database에 보고되어 있다. 예를 들면, 각 아이소폼의 아미노산 서열은 GenBank Accession Nos: NP_061909, NP_001035865, NP_001274675, NP_001274670, NP_001274682, NP_001274670 또는, ENSP00000309737 [ENSEMBL], Q8TB92-5 [UNIPROT] 등으로 보고되어 있다.
본 발명의 한 구현예에 따르면, HMGCLL1 IS3의 cDNA는 서열번호 2의 염기서열을 갖는다. 상기 서열번호 2의 염기서열 중에서, 1번째 엑손영역은 1번 내지 108번 염기로 구성된 영역이고, 2번째 엑손영역(HMGCLL1 cDNA의 3번 엑손영역)은 109번 내지 189번 염기로 구성된 영역이며, 3번째 엑손영역(HMGCLL1 cDNA의 4번 엑손영역)은 190번 내지 297번 염기로 구성된 영역이고, 4번째 엑손영역(HMGCLL1 cDNA의 6번 엑손영역)은 298번 내지 446번 염기로 구성된 영역이고, 5번째 엑손영역(HMGCLL1 cDNA의 7번 엑손영역)은 447번 내지 510번 염기로 구성된 영역이며, 6번째 엑손영역(HMGCLL1 cDNA의 8번 엑손영역)은 511번 내지 699번 염기로 구성된 영역이고, 7번째 엑손영역은 700번 내지 825번 염기로 구성된 영역이며, 8번째 엑손영역은 826번 내지 927번 염기로 구성된 영역이다.
본 발명의 구현예에 따라 약물내성 여부의 결정, 암 예후 예측, 항암 치료제의 스크리닝을 목적으로 한 타켓으서의 HMGCLL1 IS3은 서열번호 2의 염기서열로부터 발현되는 서열번호 3의 아미노산 서열에 대하여 적어도 85%, 적어도 86%, 적어도 87%, 적어도 88%, 적어도 89%, 적어도 90%, 적어도 91%, 적어도 92%, 적어도 93%, 적어도 94%, 적어도 95%, 적어도 96%, 적어도 97%, 적어도 98%, 적어도 99%의의 서열 동일성 (sequence identity)을 갖는 것일 수 있다.
본 명세서에서 사용된 용어 "HMGCLL1 IS3의 발현 또는 활성을 억제하는 제제"란, 암세포 내에서 HMGCLL1 IS3의 발현 또는 활성을 감소시키는 제제를 의미하는 것으로서, 암세포 내에서 HMGCLL1 IS3의 발현 또는 활성을 감소시켜서 암 발병을 예방 또는 치료하기 위한 목적으로 사용될 수 있다. 예를 들어, HMGCLL1 IS3을 표적으로 하여 HMGCLL1 IS3의 발현 또는 활성을 억제할 수 있는 화합물, 핵산, 앱타머, 펩타이드, 바이러스 또는 상기 핵산을 포함하는 벡터 등이 포함될 수 있다. 구체적으로 상기 제제는 HMGCLL1 IS3 mRNA의 발현을 억제하는 안티센스 올리고뉴클레오타이드, siRNA, RNA 앱타머 등과 같은 폴리뉴클레오티드, 또는 HMGCLL1 IS3 단백질에 특이적으로 결합하여, 이의 활성을 억제하는 앱타머, 항체, 펩타이드, 상기 항체의 단편, 저분자 화합물 등이 포함될 수 있다.
본 명세서에서 사용된 용어 "안티센스 올리고뉴클레오타이드"란, 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 본 발명의 구현예들에 있어서, 상기 안티센스 올리고뉴클레오타이드는 HMGCLL1 mRNA에 상보적이고 HMGCLL1 mRNA에 결합할 수 있는 DNA 또는 RNA가 될 수 있고, 이는 HMGCLL1 mRNA의 번역, 세포질내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해하는 할 수 있다. 상기 안티센스 올리고뉴클레오타이드의 길이는 특별히 제한되지 않으나, 일 예로서, 6 내지 100 염기가 될 수 있고, 다른 예로서 8 내지 60 염기가 될 수 있으며, 또 다른 예로서 10 내지 40 염기가 될 수 있다.
상기 안티센스 핵산은 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다(De Mesmaeker et al., Curr Opin Struct Biol., 5(3):343-55(1995)). 핵산 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스 핵산은 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 핵산은 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-me 피리미딘(특히 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6 (6-아미노헥실)아데닌, 2,6-디아미노퓨린 등이 있다. 또한 본 발명의 안티센스 핵산은 상기 안티센스 핵산의 활성 및 세포 흡착성을 향상시키는 하나 이상의 모이어티(moiety) 또는 컨쥬게이트(conjugate)와 화학적으로 결합될 수 있다. 콜레스테롤 모이어티, 콜레스테릴 모이어티, 콜릭산, 티오에테르, 티오콜레스테롤, 지방성 사슬, 인지질, 폴리아민, 폴리에틸렌 글리콜 사슬, 아다맨탄 아세트산, 팔미틸 모이어티, 옥타데실아민, 헥실아미노-카르보닐-옥시콜에스테롤 모이어티 등의 지용성 모이어티 등이 있고 이에 제한되지는 않는다. 지용성 모이어티를 포함하는 올리고뉴클레오티드와 제조 방법은 본 발명의 기술 분야에서 이미 잘 알려져 있다(미국특허 제5,138,045호, 제5,218,105호 및 제5,459,255호). 상기 변형된 핵산은 뉴클레아제에 대한 안정성을 증가시키고 안티센스 핵산과 표적 mRNA와의 결합 친화력을 증가시킬 수 있다.
안티센스 올리고뉴클레오타이드의 경우 통상의 방법으로 시험관에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스 올리고뉴클레오타이드가 합성되도록 할 수 있다. 시험관에서 안티센스 올리고뉴클레오타이드를 합성하는 한 예는 RNA 중합효소 I를 이용하는 것이다. 생체 내에서 안티센스 RNA가 합성되도록 하는 한 가지 예는 인식부위(MCS)의 기원이 반대 방향에 있는 벡터를 사용하여 안티센스 RNA가 전사되도록 하는 것이다. 이런 안티센스 RNA는 서열 내에 번역 중지 코돈이 존재하도록 하여 펩타이드 서열로 번역되지 않도록 하는 것이 바람직하다.
본 명세서에서 사용된 용어 "siRNA"란, RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다(참조: WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 및 WO 00/44914). siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는 유전자치료 방법으로 제공된다. siRNA는 식물, 벌레, 초파리 및 기생충에서 처음으로 발견되었으나, 최근에 siRNA를 개발/이용하여 포유류 세포 연구에 응용되었다. 대체로, 상기 siRNA는 분자가 이용되는 경우, 센스 가닥(HMGCLL1 mRNA 서열에 상응하는(corresponding) 서열)과 안티센스 가닥(HMGCLL1 mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있으며, 또는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. 상기 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 또한, siRNA 말단 구조는 HMGCLL1 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3'-말단 돌출 구조와 5'-말단 돌출 구조 모두 가능하다. 상기 siRNA 분자는, 자기-상보성(self-complementary) 센스 및 안티센스 가닥 사이에 짧은 뉴클레오타이드 서열(예컨대, 약 5-15 nt)이 삽입된 형태를 가질 수 있으며, 이 경우 뉴클레오타이드 서열의 발현에 의해 형성된 siRNA 분자는 분자내 혼성화에 의하여 헤어핀 구조를 형성하게 되며, 전체적으로는 스템-앤드-루프 구조를 형성하게 된다. 이 스템-앤드-루프 구조는 인 비트로 또는 인 비보에서 프로세싱되어 RNAi를 매개할 수 있는 활성의 siRNA 분자를 생성한다.
본 발명의 구현예들에 있어서, 상기 siRNA는 HMGCLL1 IS3의 mRNA에 결합할 수 있는 것이 될 수 있는데, 이의 서열은 특별히 이에 제한되지 않으나, 일 예로서, 서열번호 2의 HMGCLL1 IS3의 cDNA에서 3번째 엑손(HMGCLL1 cDNA의 4번 엑손) 및 4번째 엑손(HMGCLL1 cDNA의 6번 엑손)으로부터 유래된 부위(서열번호 2의 190번 내지 446번 염기영역)의 전체 또는 일부에 특이적으로 결합할 수 있는 염기서열로 구성된 것이 될 수 있고, 다른 예로서, 서열번호 2의 HMGCLL1 IS3 cDNA의 상기 3번째 엑손과 4번째 엑손의 연결부위에 포함된 서열번호 4의 염기서열로부터 유래된 부위의 전체 또는 일부에 특이적으로 결합할 수 있는 염기서열로 구성된 것이 될 수 있으며, 또 다른 예로서, 서열번호 5 내지 8의 염기서열로 구성된 것이 될 수 있다.
서열번호 4: 5'-AGAAGTGACTAGCTTTGTGTCTTCCAGATGGGTACCACAGGTTGCTGCTGGAGCTACTGAGATATCAGTTTTTGGAGCTG-3'
서열번호 5: 5'-AGCAGCAACCUGUGGUACC-3'
서열번호 6: 5'-AACCUGUGGUACCCA-3'
서열번호 7: 5'-GCAGCAACCUGUGGU-3'
서열번호 8: 5'-CUCCAGCAGCAACCU-3'
또 다른 예로서, 서열번호 5 내지 8로 구성된 군으로부터 선택되는 어느 하나의 염기서열을 포함하고, 서열번호 4의 염기서열의 전체 또는 일부에 특이적으로 결합할 수 있는, 19 내지 40개의 연속적인 염기를 포함하는 것이 될 수 있다.
본 명세서에서 사용된 용어 "RNA 앱타머"란, 특정의 3차원 입체형태를 채택하는 능력에 의해 표적 mRNA와 결합하여 이에 대해 길항 효과를 갖는 핵산 리간드 분자를 의미한다. 전형적으로 앱타머는 규정된 이차 및 삼차 구조, 예컨대 스템-루프구조로 접혀지는 15-50 염기 길이의 작은 핵산일 수 있다. 앱타머는 10^-6, 10^-8, 10^-10, 또는 10^-12 보다 적은 kd로 표적 분자와 결합하는 것이 바람직하다. 앱타머는 매우 고도의 특이성을 가지는 표적 분자와 결합할 수 있다. 또한, 앱타머는 다수의 리보뉴클레오티드 단위, 데옥시리보뉴클레오티드 단위, 또는 두 가지 유형의 뉴클레오티드 잔기의 혼합물로 구성될 수 있다. 앱타머는 하나 이상의 변형된 염기, 당 또는 포스페이트 주쇄 단위를 추가로 포함할 수 있다. 앱타머는 올리고 핵산 (예컨대, RNA) 또는 펩타이드 물질이며, 이에 대한 상세한 내용은 Bock LC et al., Nature 355 (6360):5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24):142727 (1998)에 기재되어 있다.
본 명세서에서 사용된 용어 "항체"란, 생체의 면역계에서 혈액이나 림프를 순환하면서 외부 물질인 항원이 침입한 경우 이에 반응하는 물질을 말하며, 림프조직에서 형성되는 글로불린계 단백질로 면역글로불린이라고도 불린다. 항체는 B 세포가 생산해서 체액으로 흘려보내는 단백질로 항원과 특이적으로 결합하며, 하나의 항체 분자에는 두 개의 중사슬 (heavy chain)과 두 개의 경사슬 (light chain)이 있으며, 각각의 중사슬과 경사슬은 그의 N-터미널 말단에 가변영역을 갖고 있다. 각각의 가변영역은 3 개의 상보성 결정부위 (Complementarity determining region: CDR)와 4 개의 구조 형성부위 (framework regions: FRs)로 구성되는데, 상보성 결정 부위들은 항체의 항원 결합 특이성을 결정하고, 가변영역의 구조형성 부위들로 유지되는 비교적 짧은 펩티드 서열로 존재한다.
본 발명의 구현예들에 있어서, 상기 항체는 HMGCLL1에 특이적으로 결합하여 활성을 억제하는 폴리클로날 또는 모노클로날 항체이며, 바람직하게는 모노클로날 항체이다. HMGCLL1에 대한 항체는 당업계에서 통상적으로 실시되는 방법들, 예를 들어, 융합 방법(Kohler and Milstein, European Journal of Immunology, 6:511-519(1976)), 재조합 DNA 방법(미국 특허 제4,816,56호) 또는 파아지 항체 라이브러리 방법(Clackson et al, Nature, 352:624-628(1991) 및 Marks et al, J. Mol. Biol., 222:58, 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; 및 Coligan , CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY, 1991에 상세하게 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로서 삽입된다. 예를 들어, 단일클론 항체를 생산하는 하이브리도마 세포의 제조는 불사멸화 세포주를 항체-생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있으며 용이하게 실시할 수 있다. 폴리클로날 항체는 HMGCLL1 항원을 적합한 동물에게 주사하고, 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성(affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
HMGCLL1에 특이적으로 결합하여 HMGCLL1의 활성을 억제할 수 있는 펩타이드는 당업계에 공지된 통상의 방법, 예를 들어 파아지 디스플레이 방식으로 얻을 수 있다(Smith GP, "Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface". Science 228 (4705):1315?1317(1985); Smith GP, Petrenko VA, "Phage display". Chem. Rev. 97(2):391?410(1997)).
본 명세서에서 사용된 용어 "악성종양"이란, 세포의 사멸 조절과 관련된 질병으로서, 정상적인 세포 사멸 균형이 깨지는 경우 세포가 과다 증식하게 됨으로써 생기는 질병을 일컫는다. 이러한 비정상적 과다 증식 세포들은, 경우에 따라 주위 조직 및 장기에 침입하여 종괴를 형성하고, 체내의 정상적인 구조를 파괴하거나 변형시키게 되는데, 이러한 상태를 악성종양 또는 암이라고 한다. 일반적으로, 종양 (tumor)이라 하면 신체 조직의 자율적인 과잉 성장에 의해 비정상적으로 자란 덩어리를 의미하며, 양성 종양 (benign tumor)과 악성 종양 (malignant tumor)으로 구분할 수 있다. 악성 종양은 양성 종양에 비해 성장속도가 매우 빠르고, 주변 조직에 침윤하면서 전이 (metastasis)가 일어나 생명을 위협하게 된다.
본 발명의 구현예들에 있어서, 상기 악성종양은 HMGCLL1 IS3의 발현 또는 활성을 억제함에 의하여 치료될 수 있는 한 특별히 이에 제한되지 않으나, 일 예로서, 조혈 및 림프 조직유래 악성종양, 고형암 등이 될 수 있고, 다른 예로서, 조혈 및 림프 조직, 자율신경절, 쓸개관, 유방, 중추신경계, 간, 췌장, 피부, 위, 비뇨기계 등의 다양한 조직으로 부터 유래된 악성종양이 될 수 있다.
특히, 본 발명에 따른 악성종양은 티로신 키나아제 억제제에 대한 저항성을 나타내는 악성종양이 될 수 있는데, 이외에도 다양한 항암제의 처리에 의하여 항암제 내성을 나타내도록 변이된 악성종양이 될 수 있다.
본 명세서에서 사용된 용어 "예방"이란, 본 발명에 따른 악성종양의 예방 또는 치료용 약학 조성물의 투여로 악성종양을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 명세서에서 사용된 용어 "치료"란, 본 발명에 따른 악성종양의 예방 또는 치료용 약학 조성물의 투여로 악성종양의 성장을 지연 또는 중지시키는 등 악성종양을 호전시키거나 악성종양으로 진행되는 세포를 정상 세포로 전환하는 등 이롭게 변경하는 모든 행위를 의미한다.
상기 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 추가로 포함할 수 있는데, 상기 담체는 비자연적인 담체가 될 수 있다. 상기 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
한편, 본 발명의 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제제화하여 사용될 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 줄기세포 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는 데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
상기 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.
본 발명의 상기 약학 조성물에 포함된 HMGCLL1 IS3 억제제의 함량은 특별히 이에 제한되지 않으나, 최종 조성물 총 중량에 대하여 0.0001 내지 50 중량%로 포함할 수 있고, 바람직하게는 0.001 내지 10 중량%의 함량으로 포함할 수 있다.
상기 본 발명의 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있는데, 본 명세서에서 사용된 용어 "약학적으로 유효한 양"이란, 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하다.
본 발명의 약학 조성물의 투여량은 사용목적, 질환의 중독도, 환자의 연령, 체중, 성별, 기왕력, 또는 유효성분으로서 사용되는 물질의 종류 등을 고려하여 당업자가 결정할 수 있다. 예를 들어, 본 발명의 약학 조성물은 성인 1인당 약 0.1 ng 내지 약 100 mg/kg, 바람직하게는 1 ng 내지 약 10 mg/kg로 투여할 수 있고, 본 발명의 조성물의 투여빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있다.
다른 양태로서, 본 발명은 상기 약학 조성물을 악성종양이 발병되거나 또는 발병될 가능성이 있는, 인간을 제외한 개체에 투여하는 단계를 포함하는 악성종양의 예방 또는 치료방법을 제공한다.
본 명세서에서 사용된 용어 "개체"는 본 발명에 따른 약학 조성물의 투여에 의해 증상이 호전될 수 있는 악성종양이 발병되거나 발병될 가능성이 있는 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물 또는 인간을 포함한다. 본 발명에 따른 약학 조성물을 개체에게 투여함으로써, 악성종양을 효과적으로 예방 및 치료할 수 있다. 본 발명에 따른 상기 치료방법은 인간을 제외한 동물을 치료하는 방법일 수 있으나, 이에 제한되지 않는다. 즉, 인간의 경우 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있음을 고려할 때, 인간의 치료에 있어서도 충분히 사용될 수 있다.
본 명세서에서 사용된 용어 , "투여"는 어떠한 적절한 방법으로 대상에게 본 발명의 약학적 조성물을 도입하는 것을 말하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
상기 약학적 조성물은 목적 또는 필요에 따라 당업계에서 사용되는 통상적인 방법, 투여 경로, 투여량에 따라 적절하게 개체에 투여될 수 있다. 투여 경로의 예로는 경구, 비경구, 피하, 복강 내, 폐 내, 및 비강 내로 투여될 수 있으며, 비경구 주입에는 근육 내, 정맥 내, 동맥 내, 복강 내 또는 피하투여가 포함된다. 또한 당업계에 공지된 방법에 따라 적절한 투여량 및 투여 횟수가 선택될 수 있으며, 실제로 투여되는 본 발명의 약학적 조성물의 양 및 투여 횟수는 치료하고자 하는 증상의 종류, 투여 경로, 성별, 건강 상태, 식이, 개체의 연령 및 체중, 및 질환의 중증도와 같은 다양한 인자에 의해 적절하게 결정될 수 있다.
본 발명에서의 용어 "약학적으로 유효한 양"은 의학적 용도에 적용 가능한 합리적인 수혜/위험 비율로 혈관 투과성 증가를 억제 또는 완화하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
다른 실시양태로서, 본 발명은 악성종양 개체의 약물내성 판단 방법을 제공한다.
구체적으로, 상기 악성종양 개체의 약물내성 판단 방법은 (a) 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및 (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함한다.
상기 방법에 있어서, (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 시료의 것 보다 높은 수준인 경우, 상기 개체가 악성종양에 대해 약물내성을 갖는 것으로 판단할 수 있다.
본 발명의 일 실시예에 의하면, 만성 골수성 백혈병의 표적 치료제에 대하여 내성을 보이는 환자군과 내성을 보이지 않는 환자군 사이에 통계적으로 연관성이 있는 단일염기다형성을 연구하여, 이를 토대로 만성 골수성 백혈병 환자의 약물 내성도를 예측 또는 진단하고자 하였다. 그 결과, HMGCLL1 유전자내의 특정 SNP들과 HMGCLL1 IS3의 발현 수준이 만성 골수성 백혈병 환자의 약물 내성과 상관성이 있음을 확인하였으며, 상기 유전자의 발현을 억제시키는 경우 만성 골수성 백혈병 세포 및 악성 종양 세포의 성장이 효과적으로 억제되는 것을 규명하였다.
또한, 임상적으로 만성 골수성 백혈병 진단을 받은 환자 총 474명(한국인 환자 202명, 서양인 환자 272명)의 피험자를 대상으로 전장유전체연관분석(genome-wide association analysis)을 수행하였다(표 1 참조). 통계적 방법으로 Cox’s proportional hazard additive model을 사용하였으며, 약물반응에 대한 반응 지표로써 약물(imatinib)을 복용한 후 완전 분자학적 반응(Complete molecular response)에 도달하는 여부에 따라 내성을 보이는 만성 골수성 백혈병 환자군과 내성을 보이지 않은 환자군으로 나누어 약물 내성 환자군에 특이적으로 나타나는 유전자가 6번 염색체에 존재하는 HMGCLL1 유전자인 것을 확인하였고, 이 부분은 이제까지 만성 골수성 백혈병 환자군의 약물 내성과 연관성에 대해 알려지지 않은 새로운 유전자 부위임을 밝혔다. 특히, 두 개의 후보 지역(염색체 6번과 염색체 16번)에 위치한 SNP들에 대해 유전자형 분석을 수행함으로써 최종적으로 염색체 6번에 존재하는 rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 및 rs929679의 단일염기다형성을 도출하였고, 이들이 만성 골수성 백혈병 환자의 약물 내성과 연관성이 있는 단일염기다형성임을 밝혔다(표 3 참조). 아울러, 한국인과 서양인에서 상기 8개의 단일염기다형성과 동일한 패턴의 동형의(homozygous) 일배체형을 갖는 총 141개의 단일염기다형성을 추가 확인하였고, 이들은 상기 8개의 단일염기다형성과 높은 연관불균형(Linkage disequilibrium, LD) 관계(r2>0.8)로 서로 높은 연관 관계에 있음을 의미한다. 이는 상기 8개의 단일염기다형성과 함께 동일한 일배체형의 패턴을 보이는 141개의 단일염기다형성 또한 타겟 유전자(HMGCLL1)에 영향을 줄 수 있음을 암시한다.
본 발명의 전장유전체연관분석은 가능한 많은 만성 골수성 백혈병 환자군을 대상으로 약물 내성에 대해 평가하였을 뿐만 아니라, 한국인과 유럽계 캐나다인을 대상으로 수행함으로써 인종 간의 유의성도 검증하였다.
본 발명에서 도출한 단일염기다형성의 ACGTAATG 일배체형이 만성 골수성 백혈병 환자군 내에서 약물반응과 유의하게 연관되어 있고, 이들 일배체형의 분포는 해당 유전자(HMGCLL1)의 특정 아이소폼의 발현과 유의적으로 연관이 되어 있음을 확인하였다. 아울러, HMGCLL1 IS3의 발현 수준이 만성 골수성 백혈병 약물 내성과 연관되어 있음을 실험적으로 규명하였다.
본 발명에서 만성 골수성 백혈병 환자의 약물 내성 판단에 이용되는 약물은 바람직하게는 만성 골수성 백혈병에 대한 치료제인 이매티닙(imatinib), 닐로티닙(nilotinib) 및 다사티닙(dasatinib)을 포함하나 이에 한정되는 것은 아니다.
본 명세서에서 사용된 용어 "약물 내성(Drug-Tolerance)"이란, 유기체에 투여한 일정량의 어떤 약물에 대하여 정상군에 비해 낮은 반응성을 나타내는 것을 의미한다.
생물학적 시료 중의 HMGCLL1 IS3의 발현 수준은 mRNA 또는 이의 단백질 양을 확인함으로써 알 수 있으며, 생물학적 시료에서 mRNA와 단백질을 분리하는 과정은 공지의 공정을 이용하여 수행할 수 있으며, mRNA와 단백질의 양은 다양한 방법으로 측정할 수 있다.
본 명세서에서 사용된 용어 "생물학적 시료"란, 간단히 채취하여 HMGCLL1 IS3의 mRNA 또는 이의 단백질 수준의 차이를 검출할 수 있는 체액 즉, 뇨, 타액, 혈액, 혈장, 혈청 등을 포함한다.
본 명세서에서 사용된 용어 "mRNA 수준 측정이란, HMGCLL1 IS3을 검출하기 위하여 생물학적 시료에서 HMGCLL1 IS3의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로 mRNA의 양을 측정한다. 이를 위한 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR, 실시간 RT-PCR, RNase 보호 분석법(RNase protection assay), 노던블랏팅(Nothern blotting), DNA 칩 등이 있으나 이로 제한되는 것은 아니다.
상기 검출 방법들을 통하여 약물 내성을 보이지 않는 환자 대조군에서의 mRNA 발현양과 대상자에서의 mRNA 발현양을 비교할 수 있고, HMGCLL1 IS3에서 mRNA로의 유의한 발현양의 증가여부를 판단하여 대상자의 만성 골수성 백혈병 약물에 대한 내성 여부를 진단할 수 있다.
본 명세서에서 사용된 용어 "단백질 수준 측정"이란, 생물학적 시료에서 HMGCLL1 IS3에서 발현된 단백질의 존재 여부와 발현 정도를 확인하는 과정을 의미하며, 일 예로서, 상기 유전자의 단백질에 대하여 특이적으로 결합하는 항체를 이용하여 단백질의 양을 확인할 수 있다.
상기 항체를 이용하여 단백질 수준을 측정하는 분석방법으로는 웨스턴 블랏, ELISA(Enzyme linked immunosorbent assay), RIA(Radioimmunoassay), 방사면역 확산법(Radioimmunodiffusion), 오크털로니(Ouchterlony) 면역확산법, 로켓 면역전기영동, 조직면역염색, 면역침전분석(Immunoprecipitation), 보체고정분석(Complement fixation assay), FACS, 단백질 칩 등이 있으며, 기재된 방법으로 제한되는 것은 아니다.
또 다른 실시양태로서, 본 발명은 상기 악성종양 개체의 약물내성 판단 방법에 사용될 수 있는 약물내성 진단용 조성물을 제공한다. 구체적으로, 상기 조성물은 HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함할 수 있다.
본 명세서에서 사용된 용어 "HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제"란, HMGCLL1 IS3 유전자 또는 단백질의 발현수준을 확인 또는 측정하기 위하여, 상기 유전자를 증폭 또는 검출하거나, 상기 단백질에 특이적으로 결합하여 검출하는데 사용되는 수단을 의미하며, 예를 들어, 프라이머, 프로브, 앱타머, 항체, 펩타이드, 상기 항체의 단편, 저분자 화합물 등이 될 수 있다.
본 명세서에서 사용된 용어 "프라이머"란, 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.
본 발명에 있어서, 상기 프라이머는 상기 HMGCLL1 IS3 유전자를 PCR 방법으로 증폭시킬 수 있는 한 그의 염기서열이 특별히 제한되지 않으나, 일 예로서 서열번호 174 및 175의 염기서열로 구성된 프라이머 쌍이 될 수 있다.
본 명세서에서 사용된 용어 "프로브"란, 유전자 또는 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하는데, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있고, 보다 용이하게 검출하기 위하여 라벨링될 수 있다.
본 발명에 있어서, 상기 프로브는 상술한 프라이머와 마찬가지로 상기 HMGCLL1 IS3 유전자의 전체 또는 부분서열과 상보적으로 결합하여 상기 HMGCLL1 IS3 유전자를 검출할 수 있는 한 그의 염기서열이 특별히 제한되지 않는다.
또 다른 실시양태로서, 본 발명은 상기 약물내성 진단용 조성물을 포함하는, 약물내성 진단용 키트를 제공한다.
본 발명의 키트는 마이크로어레이 방식으로 실시될 수도 있다. 본 발명의 키트를 마이크로어레이 방식으로 실시하는 경우에는, 마이크로어레이의 고상표면에 프로브가 고정화 되어 있다.
본 발명의 키트에서 이용되는 프로브는 상기 나열한 본 발명의 SNP들을 포함하는 각 유전자상의 10-100개의 연속 뉴클레오타이드 서열에 상보적인 서열을 갖는다.
프로브 제작 시 참조하여야 하는 본 발명 마커의 뉴클레오타이드 서열은 GenBank에서 확인할 수 있다. 예컨대, 본 발명의 마커인 단일염기다형성 부위는 GenBank SNP 데이터베이스 rs10948926(서열번호 9), rs10948927(서열번호 10), rs9370435(서열번호 11), rs4546489(서열번호 12), rs4275061(서열번호 13), rs9475323(서열번호 14), rs9475327(서열번호 15) 및 rs9296791(서열번호 16)에 기재된 뉴클레오타이드 서열과 실시예 표 6의 GenBank SNP 데이터베이스 서열을 참조하여 프로브를 디자인할 수 있다.
본 발명의 마이크로어레이에 있어서, 상기한 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기체(substrate) 상에 고정화된다. 바람직한 기체는 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함한다. 상기한 혼성화 어레이 요소는 상기의 기체 상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기체에 결합될 수 있다.
한편, 본 발명의 구현예에 따른 마이크로어레이에 적용되는 시료 DNA는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화된다. 혼성화 조건은 다양하게 할 수 있다. 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.
프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단(예컨대, 플루오리신(fluorescein), 피코에리트린(phycoerythrin), 로다민, 리사민(lissamine), 그리고 Cy3와 Cy5 (Pharmacia)), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 및 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translat 바이오 방법, 무작위 프라이밍 방법(Mult prime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
분석 대상이 되는 핵산 시료는 다양한 생시료(biosamples)에서 얻은 mRNA를 이용하여 제조할 수 있다. 프로브 대신에 분석 대상이 되는 cDNA를 표지하여 혼성화 반응-기초 분석을 실시할 수도 있다.
프로브를 이용하는 경우, 프로브를 cDNA 분자와 혼성화시킨다. 본 발명에서, 적합한 혼성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어, 온도, 성분의 농도, 혼성화 및 세척 시간, 완충액 성분 및 이들의 pH 및 이온세기 등의 조건은 프로브의 길이 및 GC 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 혼성화를 위한 상세한 조건은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다. 예를 들어, 상기 엄격조건 중에서 고 엄격조건은 0.5 M NaHPO4, 7% SDS(sodium dodecyl sulfate), 1 mM EDTA에서 65℃ 조건으로 혼성화하고, 0.1 x SSC(standard saline citrate)/0.1% SDS에서 68℃ 조건으로 세척하는 것을 의미한다. 또는, 고 엄격조건은 6 x SSC/0.05% 소듐 파이로포스페이트에서 48℃ 조건으로 세척하는 것을 의미한다. 저 엄격조건은 예를 들어, 0.2 x SSC/0.1% SDS에서 42℃ 조건으로 세척하는 것을 의미한다.
혼성화 반응 이후에, 혼성화 반응을 통하여 나오는 혼성화 시그널을 검출한다. 혼성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 혼성화 반응 결과물과 반응시켜 혼성화 여부를 확인할 수 있다. 이용될 수 있는 효소/기질의 조합은, 퍼옥시다아제(예컨대, 호스래디쉬 퍼옥시다아제)와 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl and pyrocatecN-l), TMB(tetra methyl benzidine), ABTS(2,2-Azino-di-[3-ethylbenzthiazoline sulfate]), o-페닐렌디아민(OPD미노에틸나프톨/파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphtN-l-AS-B1-pN-spNate)노에틸ECF 기질; 글루코스 옥시다아제와 t-NBT(nitroblue tetrazolium) 및 m-PMS(phenzaine methosulfate) 등이다. 프로브가 금 입자로 표지된 경우에는 실버 나이트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다. 따라서, 본 발명의 키트를 혼성화에 기초하여 실시하는 경우에는, 구체적으로 (i) 본 발명의 마커의 뉴클레오티드 서열에 대하여 상보적인 서열을 가지는 프로브를 핵산 시료에 혼성화시키는 단계; (ii) 상기 혼성화 반응 발생 여부를 검출하는 단계를 포함한다. 혼성화 과정에 의한 혼성화 시그널의 세기를 분석함으로써, 만성 골수성 백혈병 환자에 대한 약물 내성도를 판단할 수 있다. 즉, 시료에서 본 발명의 타겟 마커의 뉴클레오티드 서열에 대한 혼성화 시그널이 정상 시료보다 강하게 나오는 경우에는 만성 골수성 백혈병 약물에 대하여 내성을 나타내는 것으로 판단된다.
또 다른 실시양태로서, 본 발명은 악성종양의 발병가능성 판단 방법을 제공한다.
구체적으로, 상기 악성종양의 발병가능성 판단 방법은 (a) 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및 (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함한다.
상기 방법에 있어서, (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 개체로부터 분리된 시료의 것 보다 높은 수준인 경우, 상기 개체가 대조군 개체보다 악성종양이 발병될 가능성이 높은 것으로 판단할 수 있다.
또 다른 실시양태로서, 본 발명은 악성종양 치료제의 스크리닝 방법을 제공한다.
구체적으로, 상기 악성종양 치료제의 스크리닝 방법은 (a) HMGCLL1 IS3가 발현되는 분리된 악성종양 시료에 악성종양 치료제 후보물질을 처리하는 단계; 및 (b) 상기 후보물질이 처리된 시료에서 측정된 HMGCLL1 IS3의 발현수준을, 후보물질이 처리되지 않은 대조군 시료에서 측정된 HMGCLL1 IS3의 발현수준과 비교하는 단계를 포함한다.
본 명세서에서 사용된 용어 "후보물질"이란, HMGCLL1 IS3가 발현되는 악성종양에 대하여, 상기 악성종양을 치료할 수 있고, 이에 의하여 HMGCLL1 IS3의 발현수준을 감소시키는 효과를 나타낼 수 있는 미지의 물질을 의미한다. 상기 후보물질은 화학물질, 펩타이드, 뉴클레오타이드, 안티센스-RNA, siRNA(small interference RNA)를 포함하나, 이에 한정되는 것은 아니다.
본 발명의 스크리닝 방법에 의해 분석되는 시험 물질은 단일 화합물 또는 화합물들의 혼합물일 수 있다. 시험 물질은 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있다. 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다. 합성 화합물 라이브러리는 Maybridge Chemical Co.(UK), Comgenex(USA), Brandon Associates(USA), Microsource(USA) 및 Sigma-Aldrich(USA)에서 상업적으로 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(USA) 및 MycoSearch(USA)에서 상업적으로 구입 가능하다.
시험 물질은 당업계에 공지된 다양한 조합 라이브러리 방법에 의해 얻을 수 있으며, 예를 들어, 생물학적 라이브러리, 공간 어드레서블 패러럴 고상 또는 액상 라이브러리(spatially addressable parallel solid phase or solution phase libraries), 디컨볼루션이 요구되는 합성 라이브러리 방법, “1-비드 1-화합물” 라이브러리 방법, 그리고 친화성 크로마토그래피 선별을 이용하는 합성 라이브러리 방법에 의해 얻을 수 있다. 분자 라이브러리의 합성 방법은, DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 등에 개시되어 있다.
본 발명의 스크리닝 방법은 다양한 방식으로 실시할 수 있으며, 특히 당업계에 공지된 다양한 결합 분석(binding assay), 발현 분석 또는 활성 분석 기술들에 따라 고속(high throughput) 방식으로 실시할 수 있다.
HMGCLL1 IS3의 발현량 변화의 측정은 당업계에 공지된 다양한 방법을 통해 실시될 수 있다. 예를 들어, RT-PCR(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), 노던 블롯팅(Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine, 102-108, CRC press), cDNA 마이크로어레이를 이용한 혼성화 반응(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)) 또는 인 시투(in situ) 혼성화 반응(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001))을 이용하여 실시할 수 있다.
RT-PCR 프로토콜에 따라 실시하는 경우에는 우선, 시료를 처리한 세포에서 총 RNA를 분리한 다음, 올리고 dT 프라이머 및 역전사효소를 이용하여 제1쇄 cDNA를 제조한다. 이어, 제1쇄 cDNA를 주형으로 이용하고, HMGCLL1 IS3-특이적 프라이머 세트를 이용하여 PCR 반응을 실시한다. HMGCLL1 IS3-특이적 프라이머 세트는 서열목록 제12서열 및 제13서열에 예시되어 있다. 그런 다음, PCR 증폭 산물을 전기영동하고, 형성된 밴드를 분석하여 HMGCLL1 IS3의 발현량 변화를 측정한다.
본 발명의 일 구현예에 따르면, HMGCLL1 IS3 유전자의 발현량 변화는 HMGCLL1 IS3의 발현량을 측정하여 결정한다.
HMGCLL1 IS3의 양을 측정하는 방법은 다양한 분석 방법에 따라 실시할 수 있다. 예를 들어, HMGCLL1 IS3에 특이적으로 결합하는 항체를 이용하여 다양한 면역분석 포맷으로 HMGCLL1 IS3의 양을 측정할 수 있다.
이러한 면역분석은 종래에 개발된 다양한 정량적 면역분석 프로토콜에 따라 실시될 수 있다. 상기 면역분석 포맷은 방사능면역분석, 방사능면역침전, 면역침전, ELISA(enzyme-linked immunosorbent assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석 또는 면역염색의 방법은 Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay(ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; 및 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다.
예를 들어, 본 발명의 방법이 방사능면역분석 방법에 따라 실시되는 경우, 방사능동위원소(예컨대, C14, I125, P32 및 S35)로 레이블링된 항체가 HMGCLL1 IS3을 검출하는 데 이용될 수 있다.
본 발명의 방법이 ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시예는 (a) 분석하고자 하는 미지의 세포 시료 분해물을 고체 기질의 표면에 코팅하는 단계; (b) 일차항체로서 HMGCLL1 IS3-특이적 항체와 상기 세포 분해물을 반응시키는 단계; (c) 상기 단계 (b)의 결과물을 효소가 결합된 이차항체와 반응시키는 단계; 및 (d) 상기 효소의 활성을 측정하는 단계를 포함한다.
상기 고체 기질로 적합한 것은 탄화수소 폴리머(예컨대, 폴리스틸렌 및 폴리프로필렌), 유리, 금속 또는 젤이며, 가장 바람직하게는 마이크로타이터 플레이트이다.
상기 이차항체에 결합된 효소는 발색반응, 형광반응, 발광반응 또는 적외선 반응을 촉매하는 효소를 포함하나, 이에 한정되지 않으며, 예를 들어, 알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제, 루시퍼라아제 및 사이토크롬 P450을 포함한다. 상기 이차항체에 결합하는 효소로서 알칼린 포스파타아제가 이용되는 경우에는, 기질로서 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphthol-AS-B1-phosphate) 및 ECF(enhanced chemifluorescence)와 같은 발색반응 기질이 이용되고, 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl and pyrocatechol), TMB(tetramethylbenzidine), ABTS(2,2‘-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌, 글루코스 옥시다아제와 t-NBT(nitroblue tetrazolium) 및 m-PMS(phenzaine methosulfate)과 같은 기질이 이용될 수 있다.
본 발명의 방법이 캡처-ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시예는 (a) 포획항체(capturing antibody)로서 HMGCLL1 IS3에 대한 항체를 고체 기질의 표면에 코팅하는 단계; (b) 포획항체와 세포 시료를 반응시키는 단계; (c) 상기 단계 (b)의 결과물을 시그널을 발생시키는 레이블이 결합되어 있고, HMGCLL1 IS3에 특이적으로 반응하는 검출항체(detecting antibody)와 반응시키는 단계; 및 (d) 상기 레이블로부터 발생하는 시그널을 측정하는 단계를 포함한다.
상기 검출 항체는 검출 가능한 시그널을 발생시키는 레이블을 가지고 있다. 상기 레이블은 화학물질(예컨대, 바이오틴), 효소(알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제 및 사이토크롬 P450), 방사능물질((예컨대, C14, I125, P32 및 S35), 형광물질(예컨대, 플루오레신), 발광물질, 화학발광물질( chemiluminescent) 및 FRET(fluorescence resonance energy transfer)을 포함하나, 이에 한정되는 것은 아니다. 다양한 레이블 및 레이블링 방법은 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있다.
상기 ELISA 방법 및 캡처-ELISA 방법에서 최종적인 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 이러한 시그널이 검출은 HMGCLL1 IS3의 정량적 분석을 가능하게 한다. 만일, 레이블로서 바이오틴이 이용된 경우에는 스트렙타비딘으로, 루시퍼라아제가 이용된 경우에는 루시페린으로 시그널을 용이하게 검출할 수 있다.
HMGCLL1 IS3의 발현 양을 측정하여 상기 HMGCLL1 IS3의 발현 양이 대조군과 비교하여 하향-조절(down-regulation)되는 것으로 측정되는 경우에는 상기 시험물질은 만성 골수성 백혈병 및 악성종양의 예방 또는 치료용 후보물질로 판정된다.
또 다른 실시양태로서, 본 발명은 악성종양 예후예측 방법을 제공하다.
구체적으로, 상기 악성종양 예후예측 방법은 (a) 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및 (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함한다.
상기 방법에 있어서, (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 시료의 것 보다 높은 수준인 경우, 상기 개체의 예후가 나쁠 것으로 판단할 수 있다.
상술한 바와 같이, HMGCLL1 IS3의 발현수준이 증가된 경우에는, 다양한 항암제에 대하여 내성이 유발될 수 있기 때문에, 상기 HMGCLL1 IS3가 비교적 높은 수준으로 발현되는 환자의 경우에는, 항암 치료후 질환의 예후가 좋지 않을 것으로 예측할 수 있다.
또 다른 실시양태로서, 본 발명은 상기 악성종양 예후예측 방법 에 사용될 수 있는 악성종양의 예후 예측용 조성물을 제공한다. 구체적으로, 상기 조성물은 HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함할 수 있다.
상기 HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제는 상술한 바와 동일하다.
또 다른 실시양태로서, 본 발명은 상기 악성종양의 예후 예측용 조성물을 포함하는, 악성종양의 예후 예측용 키트를 제공한다.
또 다른 실시양태로서, 본 발명은 약물내성 특이적인 SNP를 사용한 악성종양 개체의 약물내성 판단 방법을 제공한다.
구체적으로, 상기 악성종양 개체의 약물내성 판단 방법은 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함한다.
상기 방법에 있어서, 상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 상기 개체가 악성종양에 대해 약물내성을 갖는 것으로 판단할 수 있다.
본 발명의 일 실시예에 의하면, 만성 골수성 백혈병의 표적 치료제에 대하여 내성을 보이는 환자군과 내성을 보이지 않는 환자군 사이에 통계적으로 연관성이 있는 단일염기다형성을 연구하여, 이를 토대로 만성 골수성 백혈병 환자의 약물 내성도를 예측 또는 진단하고자 하였다. 그 결과, HMGCLL1 유전자내의 특정 SNP들과 HMGCLL1 IS3의 발현 수준이 만성 골수성 백혈병 환자의 약물 내성과 상관성이 있음을 확인하였으며, 상기 유전자의 발현을 억제시키는 경우 만성 골수성 백혈병 세포 및 악성 종양 세포의 성장이 효과적으로 억제되는 것을 규명하였다.
또한, 임상적으로 만성 골수성 백혈병 진단을 받은 환자 총 474명(한국인 환자 202명, 서양인 환자 272명)의 피험자를 대상으로 전장유전체연관분석(genome-wide association analysis)을 수행하였다(표 1 참조). 통계적 방법으로 Cox’s proportional hazard additive model을 사용하였으며, 약물반응에 대한 반응 지표로써 약물(imatinib)을 복용한 후 완전 분자학적 반응(Complete molecular response)에 도달하는 여부에 따라 내성을 보이는 만성 골수성 백혈병 환자군과 내성을 보이지 않은 환자군으로 나누어 약물 내성 환자군에 특이적으로 나타나는 유전자가 6번 염색체에 존재하는 HMGCLL1 유전자인 것을 확인하였고, 이 부분은 이제까지 만성 골수성 백혈병 환자군의 약물 내성과 연관성에 대해 알려지지 않은 새로운 유전자 부위임을 밝혔다. 특히, 두 개의 후보 지역(염색체 6번과 염색체 16번)에 위치한 SNP들에 대해 유전자형 분석을 수행함으로써 최종적으로 염색체 6번에 존재하는 rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 및 rs929679의 단일염기다형성을 도출하였고, 이들이 만성 골수성 백혈병 환자의 약물 내성과 연관성이 있는 단일염기다형성임을 밝혔다(표 3 참조). 아울러, 한국인과 서양인에서 상기 8개의 단일염기다형성과 동일한 패턴의 동형의(homozygous) 일배체형을 갖는 총 141개의 단일염기다형성을 추가 확인하였고, 이들은 상기 8개의 단일염기다형성과 높은 연관불균형(Linkage disequilibrium, LD) 관계(r2>0.8)로 서로 높은 연관 관계에 있음을 의미한다. 이는 상기 8개의 단일염기다형성과 함께 동일한 일배체형의 패턴을 보이는 141개의 단일염기다형성 또한 타겟 유전자(HMGCLL1)에 영향을 줄 수 있음을 암시한다.
본 발명의 방법에 있어서, 상기 폴리뉴클레오티드는 악성종양 개체에 대한 약물 내성을 판단하고자하는 대상자(subject)로부터 다양한 소스에서 얻을 수 있으며, 예컨대, 대상자의 혈액으로부터 얻을 수 있다.
본 발명의 방법에서 출발물질이 gDNA인 경우, gDNA의 분리는 당업계에 공지된 통상의 방법에 따라 실시될 수 있다(참조: Rogers & Bendich (1994)). 출발물질이 mRNA인 경우에는, 당업계에 공지된 통상의 방법에 총 RNA를 분리하여 실시된다 (참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons(1987); 및 Chomczynski, P. et al., Anal. Biochem. 162:156(1987)). 분리된 총 RNA는 역전사효소를 이용하여 cDNA로 합성된다. 상기 총 RNA는 동물세포로부터 분리된 것이기 때문에, mRNA의 말단에는 폴리-A 테일을 갖고 있으며, 이러한 서열 특성을 이용한 올리고 dT 프라이머 및 역전사 효소를 이용하여 cDNA을 용이하게 합성할 수 있다 (참조: PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)).
본 발명의 방법에 있어서, 상기 검출 또는 증폭은 특정 서열을 규명하는 데 이용되는 당업계에 공지된 다양한 방법을 응용하여 실시될 수 있다. 예를 들어, 본 발명에 응용될 수 있는 기술은, 형광 인 시투 혼성화 (FISH), 직접적 DNA 서열결정, PFGE 분석, 서던 블롯 분석, 단일-가닥 컨퍼메이션 분석 (SSCA, Orita et al., PNAS, USA 86:2776(1989)), RNase 보호 분석 (Finkelstein et al., Genomics, 7:167(1990)), 닷트 블롯 분석, 변성 구배 젤 전기영동 (DGGE, Wartell et al., Nucl.Acids Res., 18:2699(1990)), 뉴클레오타이드 미스매치를 인식하는 단백질 (예: E. coli의 mutS 단백질)을 이용하는 방법 (Modrich, Ann. Rev. Genet., 25:229-253(1991)), 및 대립형-특이 PCR을 포함하나, 이에 한정되는 것은 아니다.
또 다른 실시양태로서, 본 발명은 상기 약물내성 특이적인 SNP를 사용한 악성종양 개체의 약물내성 판단 방법에 사용될 수 있는 약물내성 판단용 조성물을 제공한다.
구체적으로, 상기 조성물은 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 포함를 포함할 수 있다.
상기 제제는 프라이머 또는 프로브가 될 수 있으며, 상기 프라이머 또는 프로브에 대하여는 상술한 바와 동일하다.
또 다른 실시양태로서, 본 발명은 상기 약물내성 판단용 조성물을 포함하는, 약물내성 판단용 키트를 제공한다.
또 다른 실시양태로서, 본 발명은 약물내성 특이적인 SNP를 사용한 악성종양의 발병가능성 판단 방법을 제공한다.
구체적으로, 상기 악성종양의 발병가능성 판단 방법은 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함한다.
상기 방법에 있어서, 상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 상기 개체가 대조군 개체보다 악성종양이 발병될 가능성이 높은 것으로 판단할 수 있다.
또 다른 실시양태로서, 본 발명은 약물내성 특이적인 SNP를 사용한 악성종양 예후예측 방법을 제공한다.
구체적으로, 상기 악성종양 예후예측 방법은 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함한다.
상기 방법에 있어서, 상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 항암 치료후 질환의 예후가 좋지 않을 것으로 예측할 수 있다.
또 다른 실시양태로서, 본 발명은 상기 약물내성 특이적인 SNP를 사용한 악성종양 예후예측 방법에 사용될 수 있는 악성종양의 예후 예측용 조성물을 제공한다.
구체적으로, 상기 조성물은 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 포함를 포함할 수 있다.
상기 제제는 프라이머 또는 프로브가 될 수 있으며, 상기 프라이머 또는 프로브에 대하여는 상술한 바와 동일하다.
또 다른 실시양태로서, 본 발명은 상기 악성종양의 예후 예측용 조성물을 포함하는, 악성종양의 예후 예측용 키트를 제공한다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예
실시예 1: 피검자군(subjects)의 선정
전장유전체분석연구를 위한 피검자는 삼성의료원 연구원 및 성균관대학교의 승인을 받아 모집하였으며, 각각 임상적으로 만성 골수성 백혈병 진단을 받은 환자군으로 구성된 한국인 실험군(KOR discovery set), 유럽계 검증군(CEU validation set)의 피검자 집단을 구성하였으며, 사전 동의를 받아 연구를 수행하였다.
첫 번째 피검자 집단은 한국인으로 구성된 실험군으로서 만성 골수성 백혈병(CML) 환자 202명으로 구성되었고 이 중 약물반응에 대한 반응 지표로써 약물(imatinib)을 복용한 후 완전 분자학적 반응(Complete molecular response)에 도달하는 여부에 따라 내성을 보이는 만성 골수성 백혈병 환자군 104명, 내성을 보이지 않은 환자군 98명으로 구성되었다. 결측빈도를 확인하였을 때 결측빈도가 높은 1명의 샘플을 제외한 201명의 각 환자군에서 완전 분자학적 반응이 나타나는 시기에 대한 중앙값은 내성을 보이는 환자군에서는 572.5(days), 내성을 보이지 않는 환자군에서는 502(days)로써 내성을 보이는 환자군에서 완전 분자학적 반응이 늦게 나타나는 것을 알 수 있다.
두 번째 피검자 집단은 유럽계 캐나다인으로 구성된 검증군으로서 만성 골수성 백혈병 환자 272명으로 구성되었고 이 중 약물반응에 대한 반응 지표로써 약물(imatinib)을 복용 한 후 완전 분자학적 반응에 도달하는 여부에 따라 내성을 보이는 만성 골수성 백혈병 환자군 122명, 내성을 보이지 않은 환자군 136명, 내성여부를 알 수 없는 환자군 14명으로 구성되었다. 서로 다른 인종 검증군을 대상으로 검증연구를 실시하였다(표 1 참조). 하기 표 1은 실험군과 검증군에서 사용한 검체 수를 나타낸 것으로 CML에 대한 반응군 및 비반응군으로 나누어 나타내었다.
실험군과 검증군에서 사용한 검체 수
Response(1) Non-response(0) Missing(-9) Total
KOR Discovery 97 104 0 201
CEU Validation 135 121 14 270
Total 233 225 14 471
검증연구 단계에서 결측빈도가 높은 2명의 샘플을 제외한 270명의 각 환자군에서 완전 분자학적 반응이 나타나는 시기에 대한 중앙값은 내성을 보이는 환자군 에서는 1197(days), 내성을 보이지 않는 환자군에서는 693(days)로써 내성을 보이는 환자군에서 완전 분자학적 반응이 늦게 나타나는 것을 알 수 있다(표 2 참조).
실험군과 검증군에서 CMR이 나타난 시기(Days)
Response(1) Non-response(0) Missing(-9)
KOR Discovery(N=201) Mean 602.05 739.25
Median 502 572.5
CEU Validation(N=270) Mean 1012.92 1373.33 813.08
Median 693 1197 577
실시예 2: SNP 지노타이핑 ( genotyping )
상기 피검자군에서 말초 혈액 샘플 채취는 치료 과정 중 이루어졌으며, 정제된 이중가닥 지놈 DNA 산출물은 QIAamp DNA blood Maxi Kit(Qiagen Inc., Valencia, CA, USA)를 이용하여 결정되었으며, 50 ng/㎕로 표준화 하였고, 각 샘플마다 표준화된 지놈 DNA 5 ㎕를 Affymetrix 6.0 분석의 주형(template)으로 사용하였다.
실험군의 DNA 샘플 전체는 Affymetrix Genome-Wide Human SNP Array 6.0(Affymetrix, Inc., Santa Clara, CA, USA)을 이용하여 총 906,530개의 SNP의 유전자형을 분석하였다. 지노타이핑 후, 잘못된 유전자형 클러스터 패턴은 육안 검사로 제외시켰고, 결측 유전자형(missing genotype) 비율이 5% 이상인 샘플도 분석에서 제외시켰다. 또한 5% 이상의 결측 유전자형(missing genotype)을 갖는 39,033개의 SNP, 소수 대립 형질 빈도(minor allele frequency, MAF)가 1% 이하인 198,553개의 SNP들을 순차적으로 제외시켰다. 결과적으로, 201명의 환자군에서 총 637,886개의 상염색체(autosomal) SNP에 대해 분석을 수행하였다.
실험군의 유전자형 분석을 검증하기 위하여 유럽인 코호트를 대상으로 검증군(환자군 272명)을 구성하였으며, 상기 검증군의 피검자 272명을 대상으로 MassARRAY 시스템(Sequenom, Inc., San Diego, CA, USA)을 이용하여 프라이머 디자인에 실패한 4개의 SNP를 제외하고 총 25개의 SNP 유전자형을 분석하였다. 검증군에서의 분석은 실험군과 동일한 정도 관리(quality control)를 적용하였다.
실시예 3: 통계분석
유전적 동질성(genetic homogeneity)을 확인하고, 계층(stratification)을 평가하기 위하여 다차원 척도법(multidimensional scaling, MDS)을 이용하여 샘플의 인구 구조를 분석하였다. 다차원 척도법(MDS) 분석을 위하여 국제 햅맵 프로젝트(International HapMap Project)에서 동아시아인(일본인; JPT, 중국인; CHB), 서양인(CEU) 및 아프리카인(YRI)에 대한 Affymetrix 6.0 데이터를 사용하였으며, 지놈 인플레이션 계수(genomic inflation factor, λ)는 중앙값 카이-제곱 통계(median chi-squared statistic)에 기초하여 계산하였다. SNP 마커와 약물 내성 여부 사이의 민감성을 확인하기 위해 Cox’s proportional hazard model을 통하여 측정하였다.
검증 연구를 위한 유전자 위치 선택을 위하여 최소한 P 값 < 5.0E-05이고, 5개 이상의 SNP가 1 Mb 이내에서 P < 0.0001 값을 갖는 후보 부위를 검색하였다. 해당 부위에 대해 유럽인 코호트에서 검증을 실시하였다. 연관 분석을 포함한 모든 통계 분석은 PLINK 버전 1.07과 R 버전 3.0.2를 사용하여 수행되었다. 연관불균형(linkage disequilibrium, LD) 구조는 HaploView 버전 4.1.10를 이용하여 평가했다. 또한 후보 부위의 도식화를 위하여 SNAP(SNP Annotation and Proxy Search) 2.2를 사용하였다.
또한, 본 발명자들은 추가 분석을 위한 유전체 영역의 분석 범위를 증가시키기 위하여 SNP 결측치 추정(SNP imputation)을 수행하였다. IMPUTE2 프로그램 버전 2.3.0은 Affymetrix 6.0 어레이에서 다루지 못한 다형적 SNP를 추정(impute)하기 위하여 사용되었다. 또한 결측치 추정을 위한 일배체형 평가(haplotype estimation)는 SHAPEITv2.r727을 사용하였고, SNP 결측치 추정(imputation)에 사용된 참조 패널(reference panel)은 국제 햅맵 프로젝트(International HapMap Project) 데이터(Phase Ⅱ Public Release #22 NCBI Build 36)로부터 알려진 90개의 일본인, 중국인(JPT+CHB) 일배체형(haplotype)과 1000 지놈 프로젝트 데이터(Phase I integrated variant set release (SHAPEIT2) in NCBI build 37 (hg19) coordinates)를 사용하였다.
실시예 4: 분석 결과
실시예 4-1: 실험군 (Discovery set)
첫 번째 피검자 집단인 실험군으로서 201명의 만성 골수성 백혈병 환자군을 대상으로 약물(imatinib)을 복용한 후 완전 분자학적 반응(Complete molecular response)에 도달하는 여부에 따라 내성을 보이는 만성 골수성 백혈병 환자군 104명, 내성을 보이지 않은 환자군 97명으로 구성된 피검자군에 대하여 637,886개의 SNP (MAF > 1%) 유전자형을 평가하였다. 다차원 척도법(MDS) 분석은 한국인에서 나타나는 유전적 변이가 International HapMap Project 데이터의 일본인(JPT) 및 중국인(CHB)의 변이와 일치하지만(overlap), 서양인(CEU) 및 아프리카인(YRI)의 변이와는 뚜렷하게 구별된다는 것을 나타냈다.
한국인 실험군(discovery set, n=201)에 대한 전장유전체연관분석에서 2개의 유전자좌가 유의한 기준(최소 P value < 5.0E-05, 1Mb 내에서 5개 이상의 SNP에 대한 P < 0.0001)을 만족하였다. 상기 2개의 유전자좌는 6p12.1 과 16q23.3이다. 각각의 유전자좌에 대하여 최소 P 값이 2.25E-05 내지 4.64E-06으로 관찰되었다. 잠재적으로 약물내성과 연관된 후보 유전자인 HMGCLL1, GFRAL, BMP5, CDH13 및 HSBP1등을 포함하는 주석 유전자(annotated genes)는 상기 유전자좌 근처에 위치한다.
실시예 4-2: 검증군 (Validation set)
실험군의 유전자형 분석을 검증하기 위하여 유럽인 코호트를 대상으로 검증군(환자군 272명)을 구성하였으며, 상기 검증군의 피검자 272명을 대상으로 MassARRAY system (Sequenom, Inc., San Diego, CA, USA)를 이용하여 SNP 유전자형을 분석하였다. 검증군에서 결측 유전자형(missing genotype) 비중이 높은 환자들은 분석에서 제외되었다. 총 270명(내성군 121명, 비 내성군 135명, 표현형정보의 결손 14명)의 검증군에 대해 실험군과 동일한 Cox’s proportional hazard model 통계분석을 수행하여 유전자좌 6p12.1에서 8개의 SNP(rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 및 rs9296791)이 유의한 관련성을 나타내었다.
검증군에서 SNP의 P값은 0.036-0.049의 범위에 속하였으며, 해당 SNP들은 실험군에서 P 값은 2.25E-05-7.61E-05 범위에 속하였다. 유럽인 코호트에서의 연관 방향은 위험률(hazard ratio)을 확인해 보았을 때 한국인 코호트인 실험군과 연관 방향이 동일하였다. 대표적인 SNP로 가장 유의한 P 값을 보인 rs9370435을 살펴보면, 한국인 실험군에서 G 대립유전자(allele)의 빈도는 내성군에서 더 높았고(0.37 vs 0.45), 유럽인 검증군에는 G 대립유전자의 빈도가 역시 내성군에서 더 높은 빈도의 동일한 경향성 보였다(0.29 vs 0.35). 위험률(hazard ratio)은 한국인 실험군에서 0.52(95% 신뢰구간(confidence interval, CI), 0.38-0.71), 유럽인 검증군에서 0.75(95% 신뢰구간(confidence interval, CI), 0.57-0.98)을 나타내었다. 표 3은 본 발명에서 염색체 6번(6p12.1)에서 검증군을 통해 검증된 8개의 SNP들로써 실험군과 검증군 각각에서의 빈도와 통계적인 유의수준 위험률(Hazard ratio)을 나타낸다.
Figure PCTKR2016012948-appb-T000001
8개 SNP 서열
No dbSNP 위치 서열(5'-3') 및 서열번호
1 rs10948926 6:55366347 TCATGAATATGAACTGAATTCTCTT[A/C]TTTGACAAGCGGCCAAAGCCAGCTT(서열번호 9)
2 rs10948927 6:55366392 CAGCTTCTGGACTTCTGCTCTTCTC[C/T]AACAATCTATTACAGTGGTTCTCAA(서열번호 10)
3 rs9370435 6:55369916 TAGTCTGTAAAAACATGATATAAAA[C/G]AAGACGTGAAGTGTTTCAGTCTTTA(서열번호 11)
4 rs4546489 6:55370236 TTGCTACATTCATGTGGAATACACC[A/T]TTCTGTAAGCAACACAAAATAACAT(서열번호 12)
5 rs4275061 6:55371577 ATAGTGAGGTTGGCAACTTGGATAC[A/G]CCAAAAAGAATCTGCAAAGTGCTTC(서열번호 13)
6 rs9475323 6:55371939 CTCCTGAAACTGGTGACCCCAAGCC[A/G]TTACTGCAGGTAAAGGACATTTCAC(서열번호 14)
7 rs9475327 6:55372270 TGAATATGTTCCCAATGATCTGGGC[C/T]GGACACTTCAGGTAATACTTCATGT(서열번호 15)
8 rs9296791 6:55376167 ACGTTATGTACAGTTCTGAGCGTGT[A/G]TTAAAAATGTGTACACATGCATGTG(서열번호 16)
실시예 5: Fine mapping
본 발명에서는 만성 골수성 백혈병 환자의 약물 내성과 연관된 단일염기다형성 8개의 SNP(rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 및 rs9296791)에 대해 일배체형(haplotype)을 구성하였다. 8개의 SNP는 높은 연관불균형(linkage disequilibrium, LD)값을 나타내고, 그 값은 8개의 SNP가 서로 의존적으로 연관되어 있음을 나타낸다. 이 8개의 SNP는 염색체 6p12.1 위치 HMGCLL1 유전자의 인트론 5(엑손 6번과 엑손 7번 사이)에 위치하고 있다.
만성 골수성 백혈병 환자의 임상학적 약물(imatinib) 반응과 기능적 직접 연관되어 있는 유전적 변이(Functional variants)를 찾기 위해서 ACGTAATG와 CTCAGGCA 일배체형을 동형의(homozygous) 유전자 형태로 갖는 내성을 보이지 않는 환자군(response) 8명, 내성을 보이는 환자군(non-response)에서 7명, 총 15명의 한국인 환자군과 동일한 조건의 내성을 보이지 않는 환자군(response) 8명, 내성을 보이는 환자군(non-response)에서 7명, 총 15명의 서양인 환자군에 대해 타겟 서열분석(Targeted sequencing)을 수행하였다. 한국인과 서양인을 합쳐 총 30명의 환자군에 대해 타겟 서열 분석을 수행하였다. 타겟 서열분석은 차세대 염기서열 분석 방법 중 하나인 Ion Torrent Personal Genome Machine™ (PGM™) 플랫폼을 활용하였고, 캡쳐 방식으로 PCR-based enrichment 방법인 Ampliseq을 사용하였다.
기본적인 데이터 분석(data analysis)은 Torrent Suite 4.0.2를 활용하였고 리드 맵핑(read mapping)은 hg19 레퍼런스 지놈에 TMAP을 사용하여 수행하였다. 변이는 VariantCaller(v4.0-r76860)를 통하여 수행한 후 ANNOVAR를 통해 각 변이들에 주석을 추가 하였다.
Ampliseq 결과로부터는, 단백질 서열의 변화와 직접적으로 관련된 변이(Coding variant; exonic variant)는 확인하지 못하였지만, 엑손 주변에 위치하여 유전자의 전사에 영향을 줄 수 있는 단일염기다형성(SNP)을 확인하였다. 또한 인트론에 위치한 8개의 단일염기다형성은 엑손 6번과 엑손 7번을 포함하는 큰 LD 블록 안에 위치함을 확인하였고, 해당변이가 타겟 유전자(HMGCLL1)에 영향을 줄 수 있음을 암시한다.
본 발명의 단일염기다형성을 증폭시킬 수 있는 MassARRAY 프라이머 쌍
SNP 프라이머 서열(5'-3')
rs10948927 정방향 ACGTTGGATGAAAGCCAGCTTCTGGACTTC(서열번호 17)
rs10948927 역방향 ACGTTGGATGAGCACCAAGGTGATTCTGTG(서열번호 18)
rs9475327 정방향 ACGTTGGATGGCCCTCAAACTAAACCCAAC(서열번호 19)
rs9475327 역방향 ACGTTGGATGGGAACATGAAGTATTACCTG(서열번호 20)
rs9475323 정방향 ACGTTGGATGTGAGTCCAAACCTATTCCTG(서열번호 21)
rs9475323 역방향 ACGTTGGATGGATCTCCTGAAACTGGTGAC(서열번호 22)
rs4546489 정방향 ACGTTGGATGCATAGGAGCTACTTTGCTAC(서열번호 23)
rs4546489 역방향 ACGTTGGATGGGCATGTTATTTTGTGTTG(서열번호 24)
rs10948926 정방향 ACGTTGGATGAAGTCCAGAAGCTGGCTTTG(서열번호 25)
rs10948926 역방향 ACGTTGGATGAGTGAGAAAAGGCCTCTACC(서열번호 26)
rs4275061 정방향 ACGTTGGATGTAATGATGGACCCAAAGCCC(서열번호 27)
rs4275061 역방향 ACGTTGGATGCTTAAAGGAAGCACTTTGCAG(서열번호 28)
rs9370435 정방향 ACGTTGGATGGGTAAGGTTATTAAAGACTG(서열번호 29)
rs9370435 역방향 ACGTTGGATGGTATTTGTGCTTGTTGAGGTC(서열번호 30)
rs9296791 정방향 ACGTTGGATGCCACACACTCACTGAAACAC(서열번호 31)
rs9296791 역방향 ACGTTGGATGGTCCCAGACGTTATGTACAG(서열번호 32)
또한, 한국인과 서양인에서 8개의 단일염기다형성과 동일한 패턴의 동형의(homozygous) 일배체형을 갖는 단일염기다형성 총 141개의 단일염기다형성(서열번호 33 내지 173)을 추가 확인하였다. 해당 단일염기다형성들은 8개의 단일염기다형성과 높은 연관불균형(LD) 관계(r2 > 0.8)로 서로 높은 연관 관계에 있음을 의미한다. 즉, 8개의 단일염기다형성과 함께 동일한 일배체형의 패턴을 보이는 141개의 단일염기다형성 또한 타겟 유전자(HMGCLL1)에 영향을 줄 수 있음을 암시한다.
Figure PCTKR2016012948-appb-T000002
Figure PCTKR2016012948-appb-I000001
Figure PCTKR2016012948-appb-I000002
Figure PCTKR2016012948-appb-I000003
NA: Not Available
r2는 일배체형(Haplotype)을 대표하는 rs10948926 과 해당 변이 사이의 관계를 확인.
1000G, HapMap database는 SNAP(SNP Annotation and Proxy Search)에서 Proxy Search를 통해 확인함.
실시예 6: 누적발병률 플롯(Cumulative incidence plot)
도 6은 실시예 4 분석결과로써 한국인과 서양인에서의 누적발병률(cumulative incidence)을 그래프로 표현하였다. 누적발병률 플롯(cumulative incidence plot)은 이매티닙 약물을 처방받은 환자가 MR4.5 사건(event, complete molecular response)이 발생하고, 약물처방을 중단한 시점을 고려하여 표현한 그래프에 해당한다. 본 그래프는 R survival 패키지를 활용하여 표현하였으며, 환자들이 위험인자(risk factor)에 해당하는 ACGTAATG 일배체형을 갖고 있는 경우(AA/AB; AA는 ACGTAATG의 일배체형이 homogenous하게 갖는 군, AB는 ACGTAATG 일배체형과 CTCAGGCA의 일배체형을 갖는 군)와 갖고 있지 않은 경우(BB; CTCAGGCA의 일배체형을 homogenous하게 갖는 군)로 표현하였다. 한국인에서 누적발병률은 P value = 0.00177, 서양인에서 누적발병률 P value = 0.0308 로 유의한 유의수준을 보여 주었다. 즉, 본 발명자들이 확인한 ACGTAATG 일배체형을 가지고 있는 경우(AA/AB)가 환자군 내에서 약물반응과 유의하게 연관되어 있음을 보여주고 있다.
실시예 7: 선택적 스플라이싱 (Alternative splicing) QPCR
본 발명에서는 단일염기다형성의 유전적 다양성이 해당 유전자(HMGCLL1)의 발현에 영향을 주는 것을 확인하기 위하여 NCBI(National Center for Biotechnology Information), Ensembl (joint scientific project between the European Bioinformatics Institute and the Wellcome Trust Sanger Institute)과 UniProt (Universal Protein Resource) 데이터베이스를 확인하여 유전자에 존재하는 5종류 이상의 아이소폼을 확인하였다(표 7).
Figure PCTKR2016012948-appb-T000003
상기 확인된 아이소폼별 발현양(expression) 정량을 위한 QPCR(quantitative polymerase chain reaction) 프라이머(primer)를 제작하였다(도 7a 및 7b). 아이소폼 3에 대한 프라이머의 서열은 다음과 같다(표 8 참조).
아이소폼 3의 발현양을 정량할 수 있는 QPCR 프라이머 쌍
타겟 프라이머 서열(5'-3')
아이소폼 3 정방향 TACCACAGGTTGCTGCTGGAG(서열번호 174)
역방향 TGCAGACTTAACAACCTCCTCAA(서열번호 175)
총 120명의 건강한 정상인을 대상으로 MassARRAY 시스템(Sequenom, Inc., San Diego, CA, USA)을 이용하여 약물 내성과 연관된 단일염기다형성 8개의 SNP(rs10948926, rs10948927, rs9370435, rs4546489, rs4275061, rs9475323, rs9475327 및 rs9296791)에 대해 지노타이핑(genotyping)을 수행하였고 그 결과를 바탕으로 일배체형(haplotype)을 구성하였다. 각 그룹의 분포는 세 가지의 일배체형 분포(AA, AB, BB; AA는 ACGTAATG의 일배체형이 homogenous하게 갖는 군, AB는 ACGTAATG 일배체형과 CTCAGGCA의 일배체형을 갖는 군, BB는 CTCAGGCA의 일배체형이 homogenous하게 갖는 군)에 따라 0.37:0.48:0.15의 비로 분포함을 확인하였고 각 아이소폼별 QPCR을 통해 정량한 발현양 값과 통계적인 유의수준을 확인한 결과, 아이소폼 3가 가장 낮은 P 값을 보여 주었다. 특히 동형접합체(homozygote)끼리 비교한 결과 P 값 = 0.04735(Wilcoxon rank sum test)로 일배체형에 따라 해당 아이소폼의 발현양이 관련되어 있음을 확인하였다. 즉, 일배체형의 분포는 해당 유전자(HMGCLL1)의 특정 아이소폼의 발현과 유의적으로 연관이 되어 있음을 확인하였고 이 사실은 해당 일배체형의 유전자형이 유전자(HMGCLL1)의 선택적 스플라이싱에 영향을 줄 수 있다는 사실을 나타낸다.
실시예 8: siRNA 형질감염
본 발명에서는 만성 골수성 백혈병 세포주(K562)와 siRNA(small interfering RNA)를 사용하여 in vitro 실험을 진행하여 QPCR를 통해 확인한 아이소폼이 세포 내에서 얼마나 중요한 역할을 하는지 확인하였다. QPCR을 통해 정량한 유전자의 각 아이소폼별 발현양과 유전자형(genotype)사이에 통계적으로 연관성이 있는지 확인하였다. 구체적으로 QPCR을 통해 아이소폼 발현양을 정량한 결과 통계적으로 다음과 같이 유의한 사실을 확인하였다. Homogeneous한 유전자형을 갖는 샘플군에서 QPCR 정량을 통해 HMGCLL1 mRNA 총 발현양 차이를 확인하였을 때, ACGTAATG 일배체형을 homogeneous 하게 갖는 군(AA)과 갖지 않는 군(BB)에서 P value = 0.009764 로 유의한 유의수준을 보여 주었다. 또한, 아이소폼 3에 선택적으로 확인한 결과 ACGTAATG 일배체형을 homogeneous하게 갖는 군(AA)과 갖지 않는 군(BB)에서 P value = 0.02431 유의한 결과를 보여 주었다. 해당 아이소폼을 정량하기 위한 프라이머 결합 위치와 정량한 결과값은 도 7b에 표현하였다. 각 그래프는 프로그램 R 패키지를 활용하였다.
실시예 9: T315I의 somatic mutation 세포주에 대한 HMGCLL1 IS3 siRNA의 효과
Clontech의 Guide-it CRISPR/Cas9 System을 이용하여 T315I의 somatic mutation이 유발된 세포주를 제작하고, 이를 10% FBS, 100 units/mL 페니실린 및 100 μg/mL 스트렙토마이신을 포함하는 DMEM 배지가 담겨진 96웰 플레이트에, 각 웰당 3 × 103 세포수로 접종한 다음, 37℃ 및 5% CO2의 조건으로 배양하였다.
상기 배양된 세포주에, HMGCLL1 IS3 siRNA와, 1세대 항암제(Imatinib) 또는 2세대 항암제(nilotinib 또는 dasatinib)를 각각 또는 조합하여 처리하고, 상기 세포주의 생존율을 비교하였다(도 8a 및 8b). 이때, 상기 siRNA는 하기 서열번호 5 및 176 내지 178의 염기서열을 갖는 2종류의 siRNA(음성대조군 siRNA 또는 IS3 siRNA)를 사용하였고, 상기 Imatinib, Nilotinib 및 Dasatinib는 각각 600 nM, 70nM 및 10nM의 농도로 세포주에 처리하였으며, 상기 세포주의 생존율을 CCK-8 assay (Cell counting Kit-8, water-soluble tetrazolium salt, WST-8)를 통해 확인하였다.
HMGCLL1 해당 유전자의 특정 부위 억제(knockdown)을 위한 siRNA의 서열과 해당 C911 대조군 서열
타겟 구분 siRNA 서열(5'-3')
HMGCLL1 Isoform 3Negative control, C911 Sense GGUACCACUCCUUGCUGCU(서열번호 176)
Antisense AGCAGCAAGGAGUGGUACC(서열번호 177)
HMGCLL1 Isoform 3 Sense GGUACCACAGGUUGCUGCU(서열번호 178)
Antisense AGCAGCAACCUGUGGUACC(서열번호 5)
도 8a 및 8b에서 보듯이, 1세대 및 2세대 항암제 단독으로는 상기 T315I의 somatic mutation이 유발된 세포주의 생존율에 영향을 주지 못함을 확인하였다.
이에 반하여, HMGCLL1 IS3 siRNA를 사용할 경우에는, 상기 siRNA를 단독으로 사용하거나 또는 1세대/2세대 항암제와 조합하여 사용할 경우 모두, 상기 T315I의 somatic mutation이 유발된 세포주의 생존율을 감소시키는 효과를 나타내었다, 특히, HMGCLL1 IS3 siRNA를 1세대/2세대 항암제와 조합하여 사용할 경우에는 더욱 향상된 수준으로 상기 세포주의 생존율을 감소시키는 효과를 나타냄을 확인하였다.
실시예 10: CML의 세포주에 대한 HMGCLL1 IS3 siRNA의 효과
CML의 세포주인 K562 및 CML-T1 세포주와 및 정상의 LCL(lymphoblastoid cell line)을 각각 10% FBS, 100 units/mL 페니실린 및 100 μg/mL 스트렙토마이신을 포함하는 DMEM 배지가 담겨진 96웰 플레이트에, 각 웰당 3 × 103 세포수로 접종한 다음, 37℃ 및 5% CO2의 조건으로 배양하였다.
상기 배양된 각 세포주에, HMGCLL1 IS3 siRNA와, 1세대 항암제(Imatinib)를 각각 또는 조합하여 처리하고, 상기 세포주의 생존율을 비교하였다(도 9a 내지 9c). 이때, 상기 siRNA는 서열번호 5 및 176 내지 178의 염기서열을 갖는 것을 사용하였고, 상기 Imatinib은 0.6 μM의 농도로 각 세포주에 처리하였으며, 상기 세포주의 생존율을 CCK-8 assay을 통해 확인하였다.
도 9a 내지 9c에서 보듯이, CML의 세포주인 K562 및 CML-T1 세포주는 HMGCLL1 IS3 siRNA와 Imatinib에 의해 생존율이 감소되었으나, 정상의 LCL의 생존율은 HMGCLL1 IS3 siRNA에 의하여 영향을 받지 않음을 확인하였다.
실시예 11: HMGCLL1 IS3 siRNA의 작용효과 분석
상기 항암활성이 확인된 HMGCLL1 IS3 siRNA가 CML 세포주에 미치는 효과를 Phospho-CRKL 분석 및 세포주기 분석을 통해 확인하고자 하였다.
실시예 11-1: Phospho - CRKL 분석
CML의 세포주인 K562에 HMGCLL1 IS3 siRNA와, 1세대 항암제(Imatinib)를 각각 또는 조합하여 처리하고, 상기 처리된 세포주를 대상으로 Phospho-CrkL (Tyr207) Colorimetric Cell-Based enzyme linked immunosorbent assay (ELISA) Kit를 사용하여, 인산화된 CRKL와 CRKL의 비율(phospho CrkL/CrkL ratio)를 산출하고, 이를 비교하였다(도 10).
도 10에서 보듯이, K562에 HMGCLL1 IS3 siRNA와, 1세대 항암제(Imatinib)를 처리한 경우, 유사한 수준으로 인산화된 CRKL와 CRKL의 비율이 감소되었고, 상기 siRNA와 Imatinib을 함께 처리한 K562에서는 인산화된 CRKL와 CRKL의 비율이 가장 낮은 수준으로 감소되어, 상승효과를 나타냄을 확인하였다.
실시예 11-2: 세포주기 분석
CML의 세포주인 K562 세포 및 LAMA-84 세포에 서열번호 5 및 176 내지 178의 염기서열을 갖는 2종류의 siRNA(음성대조군 siRNA 또는 IS3 siRNA)를 처리하고, 각 세포를 고정시켰으며, 이들 세포를 대상으로 PI 염색을 수행한 다음, FACSVerse (BD Biosciences, Franklin Lakes, NJ, USA)에 적용하여, G0/G1 phase에 위치한 세포의 비율을 측정하였다(도 11a 및 11b).
도 11a 및 11b에서 보듯이, CML의 세포주인 K562 세포 및 LAMA-84 세포 모두, IS3 siRNA를 처리한 경우에 G0/G1 phase에 위치한 세포의 비율이 증가됨을 확인하였다.
이처럼, G0/G1 phase에 위치한 세포의 비율이 증가되었다는 것은 세포주기가 중지됨을 의미하는 것으로 분석되었다.
상기 결과를 종합하면, HMGCLL1 IS3 siRNA는 CML의 세포주에서 CRKL의 인산화를 저해함으로써, BCR-ABL1에 의한 신호전달을 억제하고, 세포주기를 중지시켜서, 항암 활성을 나타냄을 알 수 있었다.
실시예 12: 다양한 암세포에 대한 HMGCLL1 IS3 siRNA의 항암활성 분석
조혈 및 림프 조직, 자율신경절, 쓸개관, 유방, 중추신경계, 간, 췌장, 피부, 위, 비뇨기계 등의 대표적인 암 세포주에 대하여, HMGCLL1 IS3 siRNA가 항암활성을 나타낼 수 있는지 확인하고자 하였다.
구체적으로, 조혈 및 림프 조직 암세포주인 LAMA84 (Chronic myeloid leukemia in blast crisis), KG-1 (Acute myeloid leukemia, FAB M2), HL-60 (Acute myeloid leukemia, FAB M2), NB-4 (Acute promyelocytic leukemia), MOLM13 (Acute myeloid leukemia, FAB M5B), CCRF-CEM (T Acute lymphoblastic leukemia) 및 U-937 (Histiocytic lymphoma)와 고형암 세포주인 IMR-32 (Neuroblastoma ,KCLB, 10127), SNU-478 (Ampulla of Vater adenocarcinoma), MG-63 (Osteosarcoma), Hs578T (Breast Invasive ductal carcinoma, KCLB, 30126), U-87MG (Glioblastoma), SNU-886 (Hepatocellular carcinoma), MIA-PaCa-2 (Pancreatic ductal adenocarcinoma), SK-MEL-2 (Malignant melanoma), RD (Embryonal rhabdomyosarcoma), Hs 746T (Gastric adenocarcinoma) 및 J-82 (Bladder carcinoma)를 96웰 마이크로플레이트를 기준으로 한 웰당 3,000~5,000개씩 세포주를 분주하였고, 체내와 유사한 환경의 37℃, 5% CO2 습윤배양기에서 3일간 배양하였다.
상기 배양된 각 세포에 서열번호 5 및 176 내지 178의 염기서열을 갖는 2종류의 siRNA(음성대조군 siRNA 또는 IS3 siRNA)를 세포수 20만개를 기준 100피코몰(pmol)의 농도로 처리하고, 72시간 까지 배양한 후, CCK-8 assay를 이용하여 이들 세포의 생존율을 비교하였다. (도 12a 내지 12c).
도 12a 내지 12c에서 보듯이, 모든 조혈 및 림프 조직 암세포주와 고형암 세포주에서, IS3 siRNA는 현저한 수준으로 각 세포주의 생존율을 감소시킴을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (43)

  1. HMGCLL1 IS3(3-Hydroxymethyl-3-Methylglutaryl-CoA Lyase Like 1 isoform 3)의 발현 또는 활성을 억제하는 제제를 포함하는, 악성종양의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서,
    상기 제제는 HMGCLL1 IS3의 mRNA에 특이적으로 결합하여, 이의 해독을 억제하는 폴리뉴클레오티드인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  3. 제2항에 있어서,
    상기 폴리뉴클레오티드는 안티센스 올리고뉴클레오타이드 또는 siRNA인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  4. 제2항에 있어서,
    상기 폴리뉴클레오티드는 HMGCLL1 IS3의 mRNA에서 HMGCLL1 IS3를 코딩하는 서열번호 2 염기서열의 190번 내지 446번 염기영역의 전체 또는 일부에 특이적으로 결합하는 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  5. 제2항에 있어서,
    상기 폴리뉴클레오티드는 서열번호 4의 염기서열로부터 유래된 부위의 전체 또는 일부에 특이적으로 결합하는 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  6. 제2항에 있어서,
    상기 폴리뉴클레오티드는 서열번호 5 내지 8로 구성된 군으로부터 선택되는 어느 하나의 염기서열을 포함하는 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  7. 제2항에 있어서,
    상기 폴리뉴클레오티드는 서열번호 5 내지 8로 구성된 군으로부터 선택되는 어느 하나의 염기서열을 포함하고, 서열번호 4의 염기서열의 전체 또는 일부에 특이적으로 결합할 수 있는, 19 내지 40개의 연속적인 염기를 포함하는 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  8. 제1항에 있어서,
    상기 제제는 HMGCLL1 IS3 단백질에 특이적으로 결합하여, 이의 활성을 억제하는 앱타머, 항체, 펩타이드, 상기 항체의 단편, 저분자 화합물 및 이들의 조합으로 구성된 군으로부터 선택되는 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  9. 제1항에 있어서,
    상기 악성종양은 혈액암(hematologic malignancy)인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  10. 제1항에 있어서,
    상기 악성종양은 악성림프종(lymphoid malignancy)인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  11. 제1항에 있어서,
    상기 악성종양은 고형암(solid cancer)인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  12. 제11항에 있어서,
    상기 고형암은 신경암(neuroblastoma ), 선암(adenocarcinoma), 골육종(osteosarcoma), 유방 침윤성 도관암(breast Invasive ductal carcinoma), 악성뇌교종(glioblastoma), 간암(hepatocellular carcinoma), 췌장관암(pancreatic ductal adenocarcinoma), 악성흑색종(malignant melanoma), 배아성 횡문근육종(embryonal rhabdomyosarcoma), 위선암(gastric adenocarcinoma), 방광암(bladder carcinoma) 및 이들의 조합으로 구성된 군으로부터 선택되는 암인 것인, 악성종양의 예방 또는 치료용 약학 조성물.
  13. HMGCLL1 IS3의 발현 또는 활성을 억제하는 제제를 포함하는, 티로신 키나아제 억제제에 대한 저항성을 나타내는 악성종양의 예방 또는 치료용 약학 조성물.
  14. (a) 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및
    (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함하는, 악성종양 개체의 약물내성 판단 방법.
  15. 제14항에 있어서,
    상기 (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 시료의 것 보다 높은 수준인 경우, 상기 개체가 악성종양에 대해 약물내성을 갖는 것으로 판단하는 것인, 방법.
  16. HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함하는, 약물내성 진단용 조성물.
  17. 제16항에 있어서,
    상기 제제는 HMGCLL1 IS3의 mRNA 또는 단백질 수준을 측정하는 제제인 것인, 약물내성 진단용 조성물.
  18. 제16항에 있어서,
    상기 mRNA 수준을 측정하는 제제는 프라이머 또는 프로브인 것인, 약물내성 진단용 조성물.
  19. 제16항에 있어서,
    상기 단백질 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 앱타머, 항체, 펩타이드, 상기 항체의 단편, 저분자 화합물 및 이들의 조합으로 구성된 군으로부터 선택되는 것인, 약물내성 진단용 조성물.
  20. 제16항 내지 제19항 중 어느 한 항의 조성물을 포함하는, 약물내성 진단용 키트.
  21. (a) 악성종양의 발병이 의심되는 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및
    (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함하는, 악성종양의 발병가능성 판단 방법.
  22. 제21항에 있어서,
    상기 (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 개체로부터 분리된 시료의 것 보다 높은 수준인 경우, 상기 개체가 대조군 개체보다 악성종양이 발병될 가능성이 높은 것으로 판단하는 것인, 방법.
  23. (a) HMGCLL1 IS3이 발현되는 분리된 악성종양 시료에 악성종양 치료제 후보물질을 처리하는 단계; 및
    (b) 상기 후보물질이 처리된 시료에서 측정된 HMGCLL1 IS3의 발현수준을, 후보물질이 처리되지 않은 대조군 시료에서 측정된 HMGCLL1 IS3의 발현수준과 비교하는 단계를 포함하는, 악성종양 치료제의 스크리닝 방법.
  24. 제23항에 있어서,
    상기 (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 시료에서 측정된 것보다 상대적으로 낮은 수준인 경우, 상기 후보물질이 악성종양 치료효과를 나타내는 것으로 판정하는 것인, 방법.
  25. (a) 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터 HMGCLL1 IS3의 발현수준을 측정하는 단계; 및
    (b) 상기 측정된 HMGCLL1 IS3의 발현수준을 대조군 시료의 것과 비교하는 단계를 포함하는, 악성종양 예후예측 방법.
  26. 제25항에 있어서,
    상기 (a) 단계에서 측정된 HMGCLL1 IS3의 발현수준이 대조군 시료의 것 보다 높은 수준인 경우, 상기 개체의 예후가 나쁠 것으로 판단하는 것인, 방법.
  27. HMGCLL1 IS3의 발현수준을 측정할 수 있는 제제를 포함하는, 악성종양의 예후 예측용 조성물.
  28. 제27항에 있어서,
    상기 제제는 HMGCLL1 IS3의 mRNA 또는 단백질 수준을 측정하는 제제인 것인, 약물내성 진단용 조성물.
  29. 제28항에 있어서,
    상기 mRNA 수준을 측정하는 제제는 프라이머 또는 프로브인 것인, 약물내성 진단용 조성물.
  30. 제28항에 있어서,
    상기 단백질 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 앱타머, 항체, 펩타이드, 상기 항체의 단편, 저분자 화합물 및 이들의 조합으로 구성된 군으로부터 선택되는 것인, 약물내성 진단용 조성물.
  31. 제27항 내지 제30항 중 어느 한 항의 조성물을 포함하는, 악성종양의 예후 예측용 키트.
  32. 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함하는, 악성종양 개체의 약물내성 판단 방법.
  33. 제32항에 있어서,
    상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 상기 개체가 악성종양에 대해 약물내성을 갖는 것으로 판단하는 것인, 방법.
  34. 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 포함하는, 약물내성 진단용 조성물.
  35. 제34항에 있어서,
    상기 제제는 프라이머 또는 프로브인 것인, 약물내성 진단용 조성물.
  36. 제34항 또는 제35항의 조성물을 포함하는, 약물내성 진단용 키트.
  37. 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함하는, 악성종양의 발병가능성 판단 방법.
  38. 제37항에 있어서,
    상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 상기 개체가 대조군 개체보다 악성종양이 발병될 가능성이 높은 것으로 판단하는 것인, 방법.
  39. 악성종양이 발병된 개체로부터 분리된 생물학적 시료로부터, 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭하는 단계를 포함하는, 악성종양 예후예측 방법.
  40. 제39항에 있어서,
    상기 폴리뉴클레오티드가 검출 또는 증폭되는 경우, 상기 개체의 예후가 나쁠 것으로 판단하는 것인, 방법.
  41. 서열번호 9 내지 16 및 33 내지 173으로 구성된 군으로부터 선택되는 염기서열로 구성되는 폴리뉴클레오티드에서 26번째 염기에 위치한 SNP(single nucleotide polymorphism)를 포함하는 2 내지 51개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 포함하는, 악성종양의 예후 예측용 조성물.
  42. 제41항에 있어서,
    상기 제제는 프라이머 또는 프로브인 것인, 악성종양의 예후 예측용 조성물.
  43. 제41항 또는 제42항의 조성물을 포함하는, 악성종양의 예후 예측용 키트.
PCT/KR2016/012948 2015-11-10 2016-11-10 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물 WO2017082655A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/775,080 US20180355359A1 (en) 2015-11-10 2016-11-10 Methods for determining resistance to anticancer therapy and composition used therefor
EP16864581.0A EP3375887A4 (en) 2015-11-10 2016-11-10 METHOD FOR DETERMINING THE RESISTANCE TO ANTICREBREPHERIC AND COMPOSITION USED THEREFOR

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20150157539 2015-11-10
KR10-2015-0157539 2015-11-10

Publications (1)

Publication Number Publication Date
WO2017082655A1 true WO2017082655A1 (ko) 2017-05-18

Family

ID=58695759

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/012948 WO2017082655A1 (ko) 2015-11-10 2016-11-10 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물

Country Status (4)

Country Link
US (1) US20180355359A1 (ko)
EP (1) EP3375887A4 (ko)
KR (2) KR101997320B1 (ko)
WO (1) WO2017082655A1 (ko)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102261925B1 (ko) * 2018-12-05 2021-06-04 건국대학교 글로컬산학협력단 메타분석 및 생물경로 기반 기계 학습을 이용한 맞춤형 항암제 내성 예측 방법
WO2020212650A1 (en) * 2019-04-18 2020-10-22 Turun Yliopisto Method for predicting response to treatment with tyrosine kinase inhibitors and related methods
KR102178432B1 (ko) * 2019-05-13 2020-11-13 연세대학교 산학협력단 침윤성 뇌암의 진단용 조성물
WO2023167544A1 (ko) * 2022-03-03 2023-09-07 서울대학교산학협력단 Fam167a를 포함하는 bcr-abl 비의존성 타이로신 키나아제 억제제 내성을 진단하기 위한 바이오마커 및 fam167a를 타겟으로 하는 만성 골수성 백혈병 예방 또는 치료용 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090192102A1 (en) * 2006-12-08 2009-07-30 Bader Andreas G miR-21 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
WO2012024612A1 (en) * 2010-08-20 2012-02-23 Pangea Biosciences, Inc. Cancer diagnostic and cancer therapeutic
US20130315858A1 (en) * 2010-09-13 2013-11-28 The Children's Hospital Of Philadelphia Common and Rare Genetic Variations Associated with Common Variable Immunodeficiency (CVID) and Methods of Use Thereof for the Treatment and Diagnosis of the Same
US20140045915A1 (en) * 2010-08-31 2014-02-13 The General Hospital Corporation Cancer-related biological materials in microvesicles

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8178503B2 (en) * 2006-03-03 2012-05-15 International Business Machines Corporation Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090192102A1 (en) * 2006-12-08 2009-07-30 Bader Andreas G miR-21 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
WO2012024612A1 (en) * 2010-08-20 2012-02-23 Pangea Biosciences, Inc. Cancer diagnostic and cancer therapeutic
US20140045915A1 (en) * 2010-08-31 2014-02-13 The General Hospital Corporation Cancer-related biological materials in microvesicles
US20130315858A1 (en) * 2010-09-13 2013-11-28 The Children's Hospital Of Philadelphia Common and Rare Genetic Variations Associated with Common Variable Immunodeficiency (CVID) and Methods of Use Thereof for the Treatment and Diagnosis of the Same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIANG ET AL.: "Analysis of p53 Transactivation Domain Mutants Reveals Acadl 1 as a Metabolic Target Important for p53 Pro-Survival Function", CELL REPORTS, vol. 10, no. 7, 24 February 2015 (2015-02-24), pages 1096 - 1109, XP055381672 *
See also references of EP3375887A4 *

Also Published As

Publication number Publication date
EP3375887A4 (en) 2019-04-10
KR101997320B1 (ko) 2019-07-09
KR20180109811A (ko) 2018-10-08
KR20170055435A (ko) 2017-05-19
EP3375887A1 (en) 2018-09-19
US20180355359A1 (en) 2018-12-13

Similar Documents

Publication Publication Date Title
WO2017082655A1 (ko) 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물
WO2012081898A2 (ko) 위암의 예후 예측용 마커 및 이를 이용하는 위암의 예후 예측 방법
WO2016018087A1 (ko) Egfr-표적제제에 대한 감수성 예측용 신규한 바이오 마커 및 이의 용도
WO2009113814A2 (ko) 간암 진단용 단백질성 마커
WO2021101339A1 (ko) 직장암의 선행화학방사선 표준 치료 반응 예측 및 치료 후 예후 예측을 위한 조성물 및 표준 치료 후 예후가 매우 나쁜 환자를 예측하는 방법 및 조성물
WO2016036172A1 (ko) 단백질 키나제 억제제에 대한 감수성 예측용 바이오 마커 및 이의 용도
WO2018169145A1 (ko) 진행성 위암 환자의 수술 후 예후 또는 항암제 적합성 예측 시스템
WO2014027831A1 (ko) 방광암 예후 진단 마커
WO2013187730A1 (ko) Ｓｌｉｔ-Ｒｏｂｏ 시스템을 이용한 골절 또는 골다공증의 예방 또는 치료용 조성물
WO2019146841A1 (ko) 간암의 진단 및 예후 예측용 바이오 마커 및 이의 용도
WO2017061818A1 (ko) 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법
WO2022098086A1 (ko) 비기능성 전사체를 이용한 parp 저해제 또는 dna 손상 약물 감수성 판정방법
WO2015108328A1 (ko) 대장암 마커로서의 신규 ntrk1 융합유전자 및 이의 용도
WO2019225923A1 (ko) 질환의 진단용 조성물
WO2021230663A1 (ko) 초기 유방암 환자의 예후 예측 방법
WO2022191566A1 (ko) 췌장암의 진단용 조성물
WO2011118994A2 (ko) 간암 진단 마커 및 치료제로서의 엔엘케이
WO2018088826A2 (ko) 대장암 전이 진단 또는 예후 예측용 조성물 및 이의 용도
WO2023101457A1 (ko) 담도암의 예방 또는 치료용 조성물
WO2020130467A2 (ko) Cd8+ 메모리 t 세포 매개성 질환의 예방 또는 치료용 약학 조성물
WO2023204522A1 (ko) 심근경색과 연관된 유전자 다형성 및 그의 용도
WO2022149911A1 (ko) 전이성 고형암 환자의 예후 진단 및 치료 전략 결정용 전이기간 특이적 마커
US20150354006A1 (en) Markers for acute lymphoblastic leukemia
WO2022169342A2 (ko) 암 전이 억제용 약학 조성물
WO2024039196A1 (ko) 암의 진단, 전이가능성 또는 예후 예측용 바이오 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16864581

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016864581

Country of ref document: EP