WO2017061818A1 - 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법 - Google Patents

근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법 Download PDF

Info

Publication number
WO2017061818A1
WO2017061818A1 PCT/KR2016/011254 KR2016011254W WO2017061818A1 WO 2017061818 A1 WO2017061818 A1 WO 2017061818A1 KR 2016011254 W KR2016011254 W KR 2016011254W WO 2017061818 A1 WO2017061818 A1 WO 2017061818A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutant
seq
gene
substituted
base
Prior art date
Application number
PCT/KR2016/011254
Other languages
English (en)
French (fr)
Inventor
기창석
김영은
김승현
이승복
Original Assignee
사회복지법인 삼성생명공익재단
한양대학교 산학협력단
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 사회복지법인 삼성생명공익재단, 한양대학교 산학협력단, 서울대학교 산학협력단 filed Critical 사회복지법인 삼성생명공익재단
Publication of WO2017061818A1 publication Critical patent/WO2017061818A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention was made by task number HI12C0135 under the auspices of the Ministry of Health and Welfare, the research and management institution of the task is Korea Health Industry Development Institute, the research project name is "health medical research and development project”, the research title is "new nervous system rare diseases Biomarkers and Centers for Research on Development of Customized Treatment Technology ”, and the leading institutions are Sungkyunkwan University Industry-Academic Cooperation Group, Hanyang University Industry-Academic Cooperation Group, Seoul National University Industry-Academic Cooperation Group, and the research period is 2012.05.01 ⁇ 2018.03.31.
  • the present invention relates to a mutant gene as a diagnostic marker for amyotrophic lateral sclerosis and a diagnostic method using the same.
  • ALS Amyotrophic lateral sclerosis
  • the present inventors have tried to discover new causal genes for ALS in sporadic ALS patients and their parents using exome sequencing. As a result, new mutations for 10 genes were found in ALS patients, and in particular, the RAPGEF2 gene was identified as a new causal gene of ALS, and the present invention was completed by confirming that the new mutation could be usefully used for diagnosis of ALS. It was.
  • RAPGEF2 RAPGEF2 , IFT80 , SSH2 , XRCC3 , SPAG17 , PLEKHM2 , CLEC4C , FRAS1 , ADGRL3 , PSEN1 mutant genes as diagnostic markers for amyotrophic lateral sclerosis.
  • RapGEF2 IFT80, SSH2, XRCC3, SPAG17, CLEC4C, FRAS1, ADGRL3, PSEN1 mutant proteins as diagnostic markers for amyotrophic lateral sclerosis.
  • Still another object of the present invention is to provide a composition for diagnosing amyotrophic lateral sclerosis.
  • Still another object of the present invention is to provide a kit for diagnosing amyotrophic lateral sclerosis.
  • the present invention provides a diagnostic marker for Amyotrophic lateral sclerosis (ALS), (a) replacing guanine, which is the 4069th base in the base sequence of SEQ ID NO: 1, with adenine, 1883 The first base cytosine is substituted with thymine or the 3293 base guanine is substituted with adenine RAPGEF2 Mutant genes; (b) guanine, which is the 595th base in the nucleotide sequence of SEQ ID NO: 2, is replaced with adenine IFT80 Mutant genes; (c) guanine, the 1408th base in the nucleotide sequence of SEQ ID NO: 3, is replaced with thymine SSH2 Mutant genes; (d) guanine, the 598th base in the nucleotide sequence of SEQ ID NO: 4, is replaced with adenine XRCC3 Mutant genes; (e) guanine, which is the 2815th base in the nucle
  • PLEKHM2 Mutant genes (g) the adenine, guanine and adenine of the 629th to 631th bases are deleted from the nucleotide sequence of SEQ ID NO: 7; CLEC4C Mutant genes; (h) Cytosine, the 8393th base, is substituted with thymine in the nucleotide sequence of SEQ ID NO: 8 FRAS1 Mutant genes; (i) adenine, which is the 715th base, is substituted with guanine in the nucleotide sequence of SEQ ID NO: 9 ADGRL3 Mutant genes; And (j) thymine, which is the 497th base in the nucleotide sequence of SEQ ID NO: 10, is substituted with cytosine PSEN1 Mutant genes are selected from the group consisting of mutant genes.
  • the present invention provides a diagnostic marker for amyotrophic lateral sclerosis (a) in the base sequence of SEQ ID No. 1 sequence, replacing guanine, which is the 4069th base, with adenine, and the 1883th base cytosine thymine RAPGEF2 substituted with adenine or guanine as the 3293th base RapGEF2 mutant protein encoded from a mutant gene; (b) IFT80 where guanine, the 595th base, is substituted with adenine in the nucleotide sequence of SEQ ID NO: 2 IFT80 mutant protein encoded from a mutant gene; (c) mutation SSH2 the 1408th base guanine in the base sequence of SEQ ID No.
  • the present inventors have tried to discover new causal genes for ALS in sporadic ALS patients and their parents using exome sequencing. As a result, we found new mutations for 10 genes in ALS patients, especially RAPGEF2. The gene was identified as a new causal gene of ALS, and the new mutation was confirmed to be useful for diagnosing ALS.
  • ALS Amyotrophic lateral sclerosis
  • Lou Gehrig's disease a disease that selectively kills only motor neurons, also called Lou Gehrig's disease, and is called the upper motor neuron of the cerebral cortex and the lower motor neurons of the brain stem and spinal cord. All of the lower motor neurons are gradually destroyed.
  • Clinical symptoms begin with a slowing weakness and weakness in the extremities, and is a fatal disease that progresses and eventually leads to death within a few years due to respiratory paralysis.
  • novel mutations found in ALS patients in the present invention are RAPGEF2 c.4069G> A (p.Glu1357Lys), RAPGEF2 c.1883C> T (p.Thr628Ile), RAPGEF2 c.3293G> A (p.Arg1098His), FRAS1 c.8393C> T (p.Ala2798Val), SPAG17 c.2815G> T (p.Ala939Ser), XRCC3 c.598G> A (p.Val200Ile), IFT80 c.595G> A (p.Val199Ile), ADGRL3 c.715A> G (p.Ser239Gly), SSH2 c.1408G> T (p.Glu470 *), CLEC4C c.629_631delAGA (p.Lys210del), PLEKHM2 (c.1921 + 6C> T) and PSEN1 c.497T
  • PSEN1 c.497T> C is a variant previously reported in early-onset Alzheimer's dementia (EOAD), but is the first variant found in ALS patients.
  • VUS unknown significance
  • Ten of the eleven new VUSs found in the present invention were mutations affecting amino acids located in the exon region.
  • FRAS1 c.8393C> T p.Ala2798Val
  • RAPGEF2 c.4069G> A p.Glu1357Lys
  • RAPGEF2 c.1883C> T p.Thr628Ile
  • RAPGEF2 c.3293G> A p.Arg1098His
  • SPAG17 c.2815G> T p.Ala939Ser
  • XRCC3 c.598G> A p.Val200Ile
  • IFT80 c.595G> A p.Val199Ile
  • ADGRL3 c.715A> G p.Ser239Gly
  • XRCC3 c.598G> A is a missense mutation
  • RapGEF2 mutant protein of the present invention is substituted with lysine, glutamic acid, which is the 1357th amino acid residue, in the amino acid sequence of SEQ ID NO: 11, threonine, which is the 628th amino acid residue, by isoleucine, or Arginine, the 1098th amino acid residue, is a RapGEF2 mutant protein substituted with histidine;
  • the IFT80 mutant protein is an IFT80 mutant protein in which valine, which is the 199th amino acid residue in the amino acid sequence of SEQ ID NO: 12, is substituted with isoleucine;
  • the SSH2 mutant protein is an SSH2 mutant protein in which glutamic acid, the 470th amino acid residue in the amino acid sequence of SEQ ID NO: 13, is substituted with a stop codon;
  • the XRCC3 mutant protein is an XRCC3 mutant protein in which valine, the 200th amino acid residue in the amino acid sequence of SEQ ID NO:
  • T is a mutation in the intron region and does not produce mutant proteins.
  • the mutant gene and / or the mutant protein encoded therein found in the present invention can be very useful for identifying the genetic cause of ALS and diagnosing ALS.
  • the present invention provides a method for providing information necessary for the diagnosis of Amyotrophic Lateral Sclerosis comprising the following steps:
  • a RAPGEF2 mutant gene substituted with this adenine (b) an IFT80 mutant gene in which the 595th guanine in the nucleotide sequence of SEQ ID NO: 2 is substituted with adenine; (c) guanine, the 1408th base in the nucleotide sequence of SEQ ID NO: 3, is replaced with thymine SSH2 Mutant genes; (d) guanine, the 598th base in the nucleotide sequence of SEQ ID NO: 4, is replaced with adenine XRCC3 Mutant genes; (e) guanine, which is the 2815th base in the nucleotide sequence of SEQ ID NO: 5, is substituted with thymine SPAG17 Mutant genes; (f) Cytosine, the 1921 + 6th base, in the nucleotide sequence of SEQ ID NO: 6 is substituted with thymine.
  • biological sample includes, but is not limited to, a sample such as tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine isolated from an individual to be checked for amyotrophic lateral sclerosis. It is not.
  • the mRNA in step (i) can be detected using primers, probes and various known sequencing methods that specifically bind the mutant gene.
  • Methods for detecting mRNA include, but are not limited to, reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real time reverse transcriptase polymerase reaction, RNase protection assay, northern blot, DNA microarray chip, and the like. It doesn't happen.
  • mRNA may be detected using a reverse transcriptase polymerization reaction using a primer specific for a mutant gene used as a diagnostic marker or a DNA microarray chip using a probe specific for the gene.
  • the product is detected by electrophoresis to detect the presence of the mutant gene, and from there Atrophic lateral sclerosis can be diagnosed easily.
  • the DNA microarray chip uses a DNA chip in which the nucleic acid corresponding to the mutant gene or fragment thereof is attached to a substrate such as glass at a high density, and isolates the mRNA from the individual sample, and a fluorescent substance is formed at the end or the inside thereof.
  • Amyotrophic lateral sclerosis can be diagnosed by making labeled cDNA probes and hybridizing them to DNA chips.
  • the analysis method using the DNA micro array chip may include the following steps:
  • Suitable fluorescent materials for the above analysis method may be Cy3, Cy5, FITC (poly L-lysine-fluorescein isothiocyanate), RITC (rhodamine-B-isothiocyanate), rhodamine (rhodamine) and the like, but is not limited thereto.
  • the mutant protein in step (i) can be measured using an antibody that specifically binds to the mutant protein.
  • the amount of antigen-antibody complex formation can be detected in an individual suspected of developing a target disease, and whether or not the expression of a protein encoded by a mutant gene can be diagnosed as atrophic lateral sclerosis.
  • antigen-antibody complex refers to a combination of a protein encoded from a mutant gene and an antibody specific thereto, and the amount of antigen-antibody complex formed can be quantitatively determined through the signal intensity of a detection label. .
  • Protein expression can be measured using, for example, an ELISA.
  • ELISA is a direct ELISA using a labeled antibody that recognizes an antigen attached to a solid support, an indirect ELISA using a labeled antibody that recognizes a capture antibody in a complex of an antibody that recognizes an antigen attached to a solid support, attached to a solid support
  • Direct sandwich ELISA using another labeled antibody that recognizes the antigen in the antibody-antigen complex, a labeled antibody that recognizes the antibody after reacting with another antibody that recognizes the antigen in the complex of the antigen with the antibody attached to the solid support
  • Various ELISA methods are included, such as indirect sandwich ELISA using secondary antibodies.
  • Western blotting using one or more antibodies against the protein encoded from the mutant gene can be used.
  • the whole protein is isolated from the sample, electrophoresed to separate the protein according to size, and then transferred to the nitrocellulose membrane to react with the antibody.
  • Amyotrophic lateral sclerosis can be diagnosed by confirming the amount of the protein produced by the expression of the gene by checking the amount of the generated antigen-antibody complex using a labeled antibody.
  • immunohistochemical staining using one or more antibodies to the protein encoded by the mutant gene can be performed.
  • paraffin embedding blocks are made by methods well known in the art. These are sliced to a thickness of several micrometers and attached to glass slides to form tissue slice slides, whereby antibodies specific for proteins encoded from the mutant genes according to the present invention are reacted according to known methods. Thereafter, the unreacted antibody can be removed by washing, reacting with a coloring reagent for observing the immune response, and observing the expression of the protein under a microscope, thereby diagnosing amyotrophic lateral sclerosis.
  • a protein chip in which one or more antibodies against the protein encoded by the mutant gene is arranged at a predetermined position on the substrate and immobilized at high density may be used.
  • the method of analyzing a sample using a protein chip is to diagnose atrophic lateral sclerosis by separating the protein from the sample, hybridizing the separated protein with the protein chip to form an antigen-antibody complex, and confirming the presence of the protein. can do.
  • the present invention provides a composition for diagnosing amyotrophic lateral sclerosis comprising a detection agent capable of detecting the mRNA of the mutant gene of the present invention or a mutant protein encoded by the gene from a biological sample. .
  • the detection agent used to detect mRNA is a primer or probe that specifically binds to the mutant gene.
  • the probe or primer used in the composition for diagnosing amyotrophic lateral sclerosis has a sequence complementary to the mutant gene nucleotide sequence.
  • the term “complementary” means having complementarity enough to selectively hybridize to the above-described nucleotide sequence under certain specific hybridization or annealing conditions.
  • the term “complementary” has a different meaning from the term perfectly complementary, and the primers or probes of the present invention may be capable of selectively hybridizing to the above-described nucleotide sequence so long as one or more mismatches ( mismatch) may have a nucleotide sequence.
  • primer refers to a single that can serve as a starting point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable buffer at a suitable temperature. -Refers to stranded oligonucleotides. Suitable lengths of primers are typically 15-30 base pairs, although varying with various factors, such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form hybrid complexes that are sufficiently stable with the template.
  • the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the above-described nucleotide sequence as a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer.
  • the design of such primers can be easily carried out by those skilled in the art with reference to the above-described nucleotide sequence, for example, by using a program for primer design (eg, PRIMER 3 program).
  • probe refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can specifically hybridize to a target nucleotide sequence, naturally Present or artificially synthesized. Probes of the invention are preferably single chain and oligodioxyribonucleotides.
  • Nucleotide sequences of the markers of the present invention to be referred to in the preparation of primers or probes can be found in SEQ ID NOs: 1 to 10, and primers or probes can be designed with reference to these sequences.
  • the detection agent used to detect the protein in the present invention is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA (Peptide nucleic acid) or aptamer.
  • the protein detector used in the present invention is preferably an antibody specific for the protein encoded by the mutant gene of the present invention.
  • the antibody used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody.
  • Antibodies may be commonly used in the art, such as fusion methods (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,56) Or phage antibody library methods (Clackson et al, Nature , 352: 624-628 (1991) and Marks et al, J. Mol . Biol . , 222: 58, 1-597 (1991)).
  • fusion methods Kelman and Milstein, European Journal of Immunology, 6: 511-519 (1976)
  • recombinant DNA methods US Pat. No. 4,816,56
  • the present invention provides a kit for diagnosing amyotrophic lateral sclerosis comprising the composition for diagnosing amyotrophic lateral sclerosis.
  • the kit of the present invention is a microarray, a gene amplification kit or an immunoassay kit.
  • the kit of the present invention is a microarray
  • a probe is immobilized on the solid surface of the microarray.
  • the probe is used as a hybridizable array element and is immobilized on a substrate.
  • Preferred gases include suitable rigid or semi-rigid supports such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries.
  • Said hybridization array element is arranged and immobilized on said gas phase. This immobilization is carried out by chemical bonding methods or by covalent binding methods such as UV.
  • the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface.
  • the hybridization array element may be coupled to the gas through a linker (eg, ethylene glycol oligomer and diamine).
  • sample DNA applied to the microarray of the present invention can be labeled and hybridized with array elements on the microarray.
  • Hybridization conditions can vary. Detection and analysis of the degree of hybridization can be carried out in various ways depending on the labeling substance.
  • the label of the probe can provide a signal that allows detection of hybridization, which can be linked to oligonucleotides.
  • Suitable labels include fluorophores such as fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioisotopes (P 32 and S 35 ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavidin, Hapten has specific binding partners, such as, but not limited to, biotin, digoxigenin, and chelating groups Labels can be used in a variety of methods commonly practiced in the art, such as nick translation methods, randomization, and the like.
  • priming method Multiprime DNA labelling systems booklet, “Amersham” (1989)) and Kai National method (Maxam & Gilbert, methods in Enzymology , 65: 499 (1986)). It can be carried out through the cover of a fluorescent, radioactive, to It provides a measurement, weight measurement, X- ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency signal that can be detected by the nanocrystal.
  • a probe is used, the probe is hybridized with the cDNA molecule.
  • suitable hybridization conditions can be determined in a series of procedures by an optimization procedure. This procedure is carried out by a person skilled in the art in order to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength depend on various factors such as the length of the probe and the amount of guanine and cytosine and the target nucleotide sequence.
  • the hybridization signal coming out of the hybridization reaction is detected.
  • the hybridization signal can be performed by various methods, for example, depending on the type of label bound to the probe.
  • the probe is labeled by an enzyme
  • the substrate of the enzyme can be reacted with the hybridization product to confirm hybridization.
  • Combinations of enzymes / substrates that can be used include peroxidase (eg horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium).
  • Nitrate resorphin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), tetramethylbenzidine (TMB), ABTS (2 , 2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine; Alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrates; Glucose oxidase, t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate).
  • BCIP bromochloroindolyl
  • the probe When the probe is labeled with gold particles, it can be detected by silver dyeing using silver nitrate. Therefore, when the method for detecting the marker of the present invention is carried out on the basis of hybridization, specifically, (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention to a nucleic acid sample; (ii) detecting whether the hybridization reaction occurs.
  • the diagnostic kit of the present invention may be a gene amplification kit.
  • amplification refers to a reaction that amplifies a nucleic acid molecule.
  • Various amplification reactions have been reported in the art, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR.
  • real-time PCR differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase) chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications.
  • DD-PCR differential display PCR
  • RACE rapid amplification of cDNA ends
  • IPCR inverse polymerase chain reaction
  • TAIL-PCR thermal asymmetric interlaced PCR
  • the diagnostic kit of the present invention When the diagnostic kit of the present invention is carried out using a primer, a gene amplification reaction is performed to examine the presence or absence of the nucleotide sequence of the marker of the present invention. Therefore, in principle, the present invention performs a gene amplification reaction using primers that bind to mRNA or cDNA as a template of mRNA in a sample.
  • RNA total RNA is isolated from the sample. Isolation of total RNA can be carried out according to conventional methods known in the art. See Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere. , C. et al., Plant Mol . Biol . Rep. , 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); and Chomczynski, P. et al ., Anal Biochem 162:.. 156 (1987)).
  • TRIzol can be used to easily isolate total RNA in cells.
  • cDNA is synthesized from the isolated mRNA and amplified. Since the total RNA of the present invention is isolated from human samples, the end of the mRNA has a poly-A tail, and cDNA can be easily synthesized using oligo dT primers and reverse transcriptases using these sequence characteristics. PNAS USA, 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001). Then, the synthesized cDNA is amplified by a gene amplification reaction.
  • Primers used in the present invention are hybridized or annealed to one site of the template to form a double chain structure.
  • Suitable nucleic acid hybridization conditions for forming such a double-chain structure include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization , A Practical Approach, IRL Press, Washington, DC (1985).
  • Various DNA polymerases can be used for amplification of the present invention and include “Clenow” fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase.
  • the polymerase is a thermostable DNA polymerase obtainable from various bacterial species, which include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Include.
  • the amplification reaction When carrying out the polymerization reaction, it is preferable to provide an excess amount of components necessary for the reaction to the reaction vessel. Excess of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components.
  • dATP, dCTP, dGTP and dTTP, such as Mg + 2 to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer ensures that all enzymes are close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.
  • Annealing in the present invention is carried out under stringent conditions allowing specific binding between the target nucleotide sequence and the primer.
  • Stringent conditions for annealing are sequence-dependent and vary depending on the surrounding environmental variables.
  • the cDNA of the nucleotide sequence of the marker of the present invention thus amplified is analyzed by a suitable method to examine the presence of the nucleotide sequence of the marker of the present invention.
  • a suitable method to examine the presence of the nucleotide sequence of the marker of the present invention is examined by gel electrophoresis of the amplification reaction product described above, and by observing and analyzing the resulting band.
  • the nucleotide sequence of the marker of the present invention is found in a raw sample, it is determined that the possibility of amyotrophic lateral sclerosis is high.
  • the kit of the present invention may be carried out in an immunoassay mode, that is, in an antigen-antibody reaction mode.
  • the antibody or aptamer specifically binds to the marker of the present invention described above.
  • the antibody used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody.
  • the immunoassay format includes radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, and immunoassay. Including but not limited to fluorescent staining and immunoaffinity purification.
  • the immunoassay or method of immunostaining is described in Enzyme Immunoassay, E. T.
  • an antibody labeled with a radioisotope detects a marker molecule of the invention. It can be used to.
  • certain embodiments of the present invention comprise the steps of: (a) coating an unknown cell sample lysate to be analyzed on the surface of a solid substrate; (b) reacting said cell lysate with an antibody against a marker as a primary antibody; (c) reacting the resultant of step (b) with a secondary antibody to which an enzyme is bound; And (d) measuring the activity of the enzyme.
  • Suitable as the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates.
  • Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence, luminescence or infrared reaction, for example, alkaline phosphatase, ⁇ -galactosidase, hose Radish peroxidase, luciferase and cytochrome P450.
  • alkaline phosphatase When alkaline phosphatase is used as the enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS) as a substrate Chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis) if colorimetric substrates such as -B1-phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used -N-methylacridinium nitrate), resorupin benzyl ether, luminol, Amflex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), TMB (tetramethyl
  • certain embodiments of the invention comprise (a) coating an antibody against a marker of the invention as a capturing antibody on the surface of a solid substrate; (b) reacting the capture antibody with the sample; (c) reacting the resultant of step (b) with a detecting antibody which has a label generating a signal and which specifically reacts with the mutant protein of the present invention; And (d) measuring the signal resulting from the label.
  • the detection antibody carries a label which generates a detectable signal.
  • the label may include chemicals (eg biotin), enzymes (alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase and cytochrome P450), radioactive substances (eg C 14 , I 125 , P 32 and S 35 ), fluorescent materials (eg, fluorescein), luminescent materials, chemiluminescent, and fluorescence resonance energy transfer (FRET). Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.
  • Measurement of the final enzyme activity or signal in the ELISA method and the capture-ELISA method can be carried out according to various methods known in the art. Detection of these signals allows for qualitative or quantitative analysis of the markers of the invention. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferin if luciferase is used.
  • an aptamer that specifically binds to the marker of the present invention may be used instead of the antibody.
  • Aptamers are oligonucleic acid or peptide molecules, the general contents of which are described in Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine”. J Mol Med . 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library”. Proc Natl Acad Sci USA . 95 (24): 142727 (1998).
  • muscular dystrophy By analyzing the intensity of the final signal by the above-described immunoassay, muscular dystrophy can be diagnosed.
  • the present invention is a marker for atrophic lateral sclerosis, RAPGEF2 , IFT80 , SSH2 , XRCC3 , SPAG17 , PLEKHM2 , CLEC4C , FRAS1 , ADGRL3 , PSEN1 mutant genes and mutant proteins encoded by the gene and atrophic lateral amplification using the same Provide a method for diagnosing sclerosis.
  • Amyotrophic lateral sclerosis markers of the present invention are new mutations found in Korean ALS patients and are very rare or unreported mutations with a frequency of less than 0.1% in previously reported databases and are not found in normal controls. There is no variation.
  • mutant gene and / or the mutant protein encoded therein found in the present invention can be very useful for identifying the genetic cause of ALS and diagnosing ALS.
  • FIG. 1 is PSEN1 in sALS Trio -7 De novo variant of the gene (c.497T>C; p.Leu166Pro) was analyzed.
  • Figure 2 shows the results of analyzing a new mutation (c.8393C>T; p.Ala2798Val) of the FRAS1 gene in sALS trio-2.
  • Figure 3 shows the results of analysis of new mutations (c.4069G>A; p.Glu1357Lys) of the RAPGEF2 gene in sALS trio-3.
  • RAPGEF2 c.4069G> A mutation was 52% (25/48) of the total reads of the initiator, indicating a heterozygous allele.
  • RAPGEF2 gene sequencing at the progenitor shows heterozygous substitution at G-to-A at nucleotide position 4069.
  • Figure 4 shows the results of analyzing the new mutation (c.629_631delAGA; p.Lys210del) of the CLEC4C gene in sALS Trio-4.
  • Figure 5 shows the results of analyzing the new mutation (c.1921 + 6C> T) of the PLEKHM2 gene in sALS trio-8.
  • Figure 6 shows the results of analyzing the novel mutations (c.1408G>T; p.Glu470 *) of the SSH2 gene in sALS trio-11.
  • FIG. 8 shows the results of analysis of novel mutations (c.595G>A; p.Val199Ile) of the IFT80 gene in sALS trio-13.
  • Figure 9 shows the results of analysis of new mutations (c.715A>G; p.Ser239Gly) of the ADGRL3 gene in sALS trio-15.
  • ADGRL3 gene sequencing at the progenitor resulted in a heterozygous substitution at A-to-G at nucleotide position 715.
  • FIG. 11 is a schematic of the variants analyzed in the RAPGEF2 gene.
  • CAP_ED effector domain of the transcription factor CAP family
  • REM Ras Exchange Motif
  • PDZ_signaling PDZ domain
  • RasGEF guanine nucleotide exchange factor for Ras-like small GTPases.
  • TGER tissue-specific Gene Expression and Regulation
  • Figure 13 is the result of measuring the tissue expression level of the IFT80 gene adopted from Tissue-specific Gene Expression and Regulation (http://bioinfo.wilmer.jhu.edu/tiger/).
  • FIG. 14 is adopted from TGER (Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/) SSH2 It is the result of measuring the tissue expression level of a gene.
  • FIG 15 is the result of measuring the tissue expression level of the SPAG17 gene adopted from TGER (Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/).
  • Figure 16 is the result of measuring the tissue expression level of the XRCC3 gene adopted from TGER (Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/).
  • ALS patients and their parents who visited the Hanyang University Neurology ALS Clinic have been included in the ALS Trio study since January 2013. All patients were born in Korea. For clinical diagnosis, neurological evaluations were performed for each patient, including electromyography, clinical examination and appropriate imaging methods. All ALS patients were diagnosed by neurologists who specialize in neuromuscular disease and were found to meet the revised El Escorial criteria (32, 113). The ALS trio study included five patients with definite ALS, eight patients predicted to be ALS, one PLS plus, and one pure lower motor neuron disease (LMND). Such as spinal muscular atrophy, Kennedy syndrome, monometic atrophy, Hirayama syndrome, and multifocal motor neuropathy not considered in the ALS spectrum Patients diagnosed with the condition were excluded from this study.
  • LMND pure lower motor neuron disease
  • ALSFRS-R To assess objectively the response to treatment or disease progression during follow-up, the doctor used ALSFRS-R to determine the extent of functional impairment for diagnosis.
  • ALSFRS-R includes language skills, saliva secretion, swallowing, handwriting, food cutting and instrumentation (with or without gastroesophageal surgery), dressing and hygiene, rotation and bed adjustment in bed, walking, climbing stairs, dyspnea, and breathing. ) And 12 questions evaluating respiratory failure.
  • the score for each item was summed up to score between 0 and 48. Progression was calculated as ⁇ FS (48-ALSFRS-R at diagnosis time to onset) and patients were divided into three groups (slow (cut-off value ⁇ 0.66), medium (0.66-1.00), and fast ( > 1.00)].
  • Sporadic ALS has been defined as when the initiator exhibits signs such as progressive upper or lower motor neuron damage and does not have a clinically affected family history in the same lineage. This study was approved by the Institutional Review Board of Hanyang University Hospital (# HYI-10-01-3) and Samsung Seoul Hospital (# 2013-04-131-002). I have written a consent form. We have prescreened the SOD1 gene, and no pathological variation has been found in all progenitors.
  • ALS Trio study A total of 184 ALS patients who visited the ALS Clinic at Hanyang University Hospital in Seoul were included in the ALS Trio study as a validation set. All ALS patients were diagnosed by neurologists who specialize in neuromuscular disease in accordance with the revised El Escorial criteria that meet the probable or definite ALS criteria. Patients were prescreened for the SOD1 gene and no pathological variation was found. Parental information was obtained before the start of the study.
  • Genomic DNA was isolated from peripheral blood leukocytes using the Wizard Genomic DNA Purification Kit (Promega, Madison, Wis.) According to the manufacturer's instructions. DNA was confirmed by 1% agarose gel electrophoresis and PicoGreen® dsDNA Assay (Invitrogen, Life Technologies, Waltham, Mass.). If possible, the DNA should be intact with an OD 260/280 ratio of 1.8-2.0. SureSelect sequencing libraries were prepared according to manufacturer's instructions using an Agilent SureSelect all Exon kit 50Mb (Agilent, Santa Clara, Calif.), Including The Bravo automated liquid handler.
  • Agilent SureSelect all Exon kit 50Mb Agilent SureSelect all Exon kit 50Mb (Agilent, Santa Clara, Calif.), Including The Bravo automated liquid handler.
  • SureSelect hyb # 1, # 2, # 3, and # 4 reagents were mixed to make hybridization buffer. Amplified DNA fragments were concentrated to 750 ng in 3.4 ⁇ l. SureSelect block # 1, # 2, and # 3 reagents (Agilent) were added to 750 ng of DNA. Hybridization buffer and DNA blocker mix were incubated at 95 ° C. for 5 minutes using a gene amplifier and then at 65 ° C. for 10 minutes. RNase blocks (Agilent) were added to the SureSelect oligo capture library (Agilent). Capture libraries were incubated at 65 ° C. for 2 minutes.
  • Hybridization buffer first, followed by DNA blocker mix, was added to the capture library, and the mixture was incubated at 65 ° C. for 24 hours using a gene amplifier. 50 ml streptavidin-coated Dynal MyOne Streptavidin T1 (Invitrogen) was washed three times with 200 ml SureSelect binding buffer (Agilent) and then resuspended in 200 ⁇ l binding buffer. Hybridization mixture was added to the bead suspension and incubated for 30 minutes with mixing at room temperature.
  • the beads were washed with 500 ⁇ l SureSelect Wash Buffer # 1 (Agilent) for 15 minutes at room temperature and then washed three times with 500 ⁇ l SureSelect Wash Buffer # 2 (Agilent) for 10 minutes at 65 ° C. DNA was eluted for 5 minutes at room temperature with 30ul water.
  • the reaction was purified by AMPure XP beads (Beckman Coulter, Brea, Calif.). Captured libraries were added to add index tags using Herculase II Fusion DNA Polymerase (Finnzymes, Life Technologies). The quality of the amplified library was evaluated by capillary electrophoresis (Bioanalyzer, Agilent).
  • QPCR quantitative polymerase chain reaction
  • SYBR Green PCR master mix Applied Biosystems, Life Technologies
  • 6 libraries tagged in equimolar amounts in the pool were combined.
  • Cluster formation was performed using a cBot automated cluster generation system (illumine, San Diego, Calif.) And sequencing with a unit length of 2 ⁇ 100 bp using a HiSeq 2500 sequencing system (illumina).
  • Reading results were mapped to GRCh37 / hg19 build using Burrows-Wheeler Aligner (BWA) 0.7.10 (114).
  • Picard-tools 1.114 was used to mark duplicate reads (http://picard.sourceforge.net/).
  • the GATK (v3.2-2) IndelRealigner was used to adjust the reading around the insertion / deletion position.
  • the quality of the readings was measured using a GATK BaseRecalibrator. Genotypes were generated simultaneously for all samples by GATK HaplotypeCaller. Mutation quality score adjustment was performed using a GATK Variant Recalibrator, and filtered at 99.7 truth sensitivity level.
  • dbSNP141 To identify rare variations, the dbSNP141, the NHLBI Exome Sequencing Project (http://evs.gs.washington.edu/EVS/) and the 1000 Genome Project (http://www.1000genomes.org/) were identified. Annotation of the variants was performed using an in-house custom-made script (Table 1).
  • the new variant was identified by the parent being homozygous for the reference sequence and the heterozygous promoter.
  • ALS and FTD causes Genes Phenotype gene RefSeq Gene description Chromosome location Genetic form ALS SPG11 NM_025137.3 Spastic paraplegia 11 15q14 AR ALS VAPB NM_004738.4 VAMP (vesicle-associated membrane protein) -associated protein B and C 20q13.3 AD ALS ALS2 NM_020919.3 Amyotrophic lateral sclerosis 2 2q33.1 AD ALS ANG NM_001145.4 Angiogenin, ribonuclease, RNase A family, 5 14q11.1 AD ALS DAO NM_001917.4 D-amino-acid oxidase 12q24 AD ALS FIG4 NM_014845.5 FIG4 phosphoinositide 5-phosphatase 6q21 AD ALS OPTN NM_021980.4 Optineurin 10p13 AD ALS SETX NM_015046.5 Senataxin 9q34.13 AD FTD MAPT NM
  • HSP causes Genes for Differential Diagnosis of ALS Phenotype gene Locus name Gene description Chromosome location Genetic form Uncomplicated HSP ATL1 SPG3A Atlastin GTPase 1 14q22.1 AD Uncomplicated HSP SPAST SPG4 Spastin 2p24-p21 AD Uncomplicated HSP NIPA1 SPG6 Non-imprinted in Prader-Willi / Angelman syndrome 1 15q11.2 AD Uncomplicated HSP KIAA0196 SPG8 KIAA0196 8q24.13 AD Uncomplicated HSP KIF5A SPG10 Kinesin family member 5A 12q13.13 AD Uncomplicated HSP RTN2 SPG12 Reticulon 2 19q13.32 AD Uncomplicated HSP HSPD1 SPG13 Heat shock protein 60kDa protein1 (chaperonin) 2q33.1 AD Complicated HSP BSCL2 SPG17 Berardinelli-Seip congenital lipodystrophy 2
  • AD autosomal dominant
  • AR autosomal recessive
  • N / A not applicable.
  • Novel mutations causing substitution of all amino acids according to filtering criteria were evaluated through Sanger sequencing on father, mother and progenitor DNA samples. All exon and exon-intron boundaries of the target genes were amplified by PCR using primers (Table 6). PCR was performed using the gene amplifier model GeneAmp PCR system 9700 (Applied Biosytems, Foster City, Calif.) Under the following conditions: 32 cycles denatured at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and extended at 72 ° C. for 30 seconds. . Amplicon (5 ⁇ l) was treated with 2U Shrimp alkaline phosphatase and 10U exonuclease I (USB Corp., Cleveland, OH) at 37 ° C.
  • Cycle sequencing was performed using a Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA) on an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
  • the naming of the variants was specified according to GenBank's reference sequence. The notation for mutations in the present invention followed the recommendation of the Association of Human Genome Variants (http://www.hgvs.org/mutnomen/), where the nucleotide corresponding to A of the ATG initiation codon is +1.
  • Sorting Intolerant From Tolerant (SIFT) (126) and Polymorphism Phenotyping 2 (PolyPhen-2 v2.2.2) (127, 128) servers are non-synonymous single for protein structure, function and phenotype and sequence conservation. nucleotide polymorphism) was used to predict the effect of substitution. Mutations were classified as "probably damaging" when the probability score was above 0.85 in PolyPhen-2 and “possibly damaging” when above 0.15. The remaining mutations were classified as benign. In SIFT, the effect of a specific amino acid substitution is expressed as a normalization probability, and if the score is 0.05 or less, it means that the amino acid substitution will affect the structure of the protein.
  • ToppGene Prioritization software 129 was used to prioritize specific genes with new mutations.
  • the gene list is based on transcripts (gene expression), protein bodies (protein domains and interactions), regulomes (TFBS and miRNA), ontologies, phenotypes, and Bibliomes (PubMed literature co-citation) This is compared with the published literature on the ALS mechanism. Combined similarity scores and p-values were used to prioritize candidate genes in the present invention.
  • RAPGEF2 for exon and flanking regions of 184 ALS patients using targeted next generation sequencing Genetic analysis was performed (Table 7). Libraries were indexed, pooled and sequenced in an illumina Miseq sequencing system (amplicon size 425bp, paired-ends, read length 250 bp, coverage> 5000x). Reading results were mapped to GR37 / hg19 build using BWA 0.7.5 (114). Picard-tools 1.84 was used to mark duplicate reads (http://picard.sourceforge.net/). Realignment and recalibration were performed using the GATK RealignerTargetCreator, IndelRealigner, and BaseRecalibrator. Genotypes were analyzed for all samples using the GATK Unified Genotyper.
  • Novel mutations were found in the RAPGEF2 gene using matrix assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) and primers designed in the present invention for 364 healthy Korean controls with age and sex. Was screened (Table 8). Samples processed on each 38-well chip within about 30 minutes were analyzed using MassARRAY Analyzer Compact (Sequenom, San Diego, Calif.). Data was automatically collected via SpectroACQUIRE software (Sequenom) and reviewed by the TrafficLights module of the MassARRAY Typer software. Detailed information about the peak height in each experiment and the probability value and peak probability statistics for each cell based on signal-to-noise were reviewed for each sample as needed.
  • MALDI-TOF MS matrix assisted laser desorption / ionization time-of-flight mass spectrometry
  • PSEN1 In the gene, one previously reported mutation from sALS trio-7 was found. This is thymine substituted for cytosine at the 497th nucleotide position, which replaces leucine with arginine at codon 166; c.497T> C (p.Leu166Pro) (FIG. 1). PSEN1 at the outset Mutant reading of c.497T> C is 46% (37/81) of the total reading, indicating heterozygosity of the allele. Mutations were identified as the occurrence of new mutations through Sanger sequencing, heterozygotes were found in the progeny and not in the parent. PSEN1 c.497T> C has previously been reported in early-onset Alzheimer's dementia (EOAD) (130).
  • EOAD early-onset Alzheimer's dementia
  • VUS unknown significance
  • Figures 2-9 Eight of the nine new VUS variants were located in the exon region and affected the amino acid sequence.
  • the initiator of sALS trio-12 was shown to have two new VUSs: PAG17 c.2815G> T (p.Ala939Ser) and XRCC3 c.598G> A (p.Val200Ile).
  • Inframe deletion CLEC4C c.629_631delAGA (p.Lys210del) has been identified in sALS trio-4, a nonsense variant SSH2 c.1408G> T (p.Glu470 *) was identified in sALS trio-11.
  • Nonsense mutations are expected to produce premature stop codons at the mRNA level. The rest were intron mutations located in the flanking region near the exon boundary (PLEKHM2 c.1921 + 6C> T).
  • the total frequency of new mutation incidence was 0.6 (9/15), including previously reported mutations and VUS.
  • Candidate genes were evaluated using ToppGene software combining human gene annotations and literature with mouse phenotype data (129). The analysis was performed using 22 ALS-FTD causative genes listed in Table 2 as training gene sets and 9 genes with new VUS found as test gene sets. According to the analysis, RAPGEF2 The gene was highly related to the ALS-FTD gene, which is known to have a p-value of 0.05 or less. In particular, the previously known ALS-FTD gene and RAPGEF2 Genes showed statistically significant association between biological mechanisms and site of expression (p-values all ⁇ 0.05) (Table 12). Therefore, we decided to focus on the RAPGEF2 gene.
  • RAPGEF2 Targeted next generation sequencing was performed on the genes.
  • two missense VUSs were found from two persons: c.1883C> T (p.Thr628Ile) from HS-374 and c.3293G> A (p.Arg1098His) from HS-477 (FIG. 10).
  • RAPGEF2 in 1 Trio Case and 2 Sporadic ALS Patients in this Study A total of three mutations were found in the gene (3/199, 1.5%).
  • the c.1883C> T (p.Thr628Ile) mutation is located in the UBQ superfamily domain, while the c.3293G> A (p.Arg1098His) and c.4069G> A (p.Glu1357Lys) mutations are located 3'- outside of the RasGEF domain. Located in the distal region (FIG. 11).
  • Clinical information for the 15 initiators of the ALS trio is summarized in Table 13.
  • Mean age of onset was 34.2 years (range, 19-49 years).
  • Fourteen patients (93.3%) developed symptoms in the extremities and one patient developed symptoms in the breathing brain area.
  • the mean ALSFRS-R at diagnosis was 40.5 and the average delta-FS was 0.57. No patient died during the follow-up period.
  • the ALS Trio-12 progeny developed in the breathing brain developed symptoms rapidly after onset and received non-invasive respiratory therapy and gastrostomy 10 months later.
  • PSEN1 The origin of sALS trio-7 with a c.497T> C (p.Leu166Pro) variant of the gene was a 28-year-old man with a history of gait impairment and lower limb spasms for 24 months. Cognitive impairment, including psychomotor impairment and spatial perception, was preceded by rigid gait disorder. Neurological examination showed severe stiffness in the lower extremities and bilateral hyperactive deep tendon reflexes, Hoffmann signs, and Wabinski signs. The Mini Mental State Examination (MMSE) hit 26/30. Close-up neuropsychological examinations showed cognitive decline in all areas including attention, speech, memory, and prefrontal function. EMG did not show active denervation and chronic denervation. Brain and spinal MRI results showed diffuse cerebral cortical atrophy. No laboratory findings suggest secondary causes of dementia or cognitive impairment. According to Gordon and Pringle criteria, it was diagnosed as primary lateral sclerosis with dementia involving the nerves of the lower extremities (18, 131).
  • RAPGEF2 The initiation of sALS Trio-3 with a c.4069G> A (p.Glu1357Lys) mutation in the gene was a 36-year-old woman with progressive dyskinesia in the right hand and lower limb for 7 months. One year later, a dyspnea developed. There was no family history of neuromuscular disease. Neurological examination revealed muscular atrophy and weakness in the tongue, arms and legs. Fasciculation was clearly observed in the limbs, with left and right overactive deep tendon reflexes, signs of Hoffman and Wabbinski, and intermittent spasticity of the ankle. Basic blood tests showed no significant abnormalities. EMG showed active and chronic denervation in the extremities. Brain MRI showed no abnormal findings. According to the revised E1-Escorial criteria, there were clinically definite ALS cases in which there were upper motor neurological signs in three areas.
  • FRAS1 The onset of sALS trio-2 with c.8393C> T (p.Ala2798Val) mutation in the gene developed in upper extremity at age 36.
  • ALSFRS-R was 45/48 and delta-FS was 1.43.
  • CLEC4C The origin of sALS Trio-4 with c.629_631delAGA (p.Lys210del) mutations in the gene was a 21-year-old woman who developed the upper extremity at 19 years of age and has a slow-moving dyskinesia. At diagnosis, the patient's ALSFRS-R was 46/48 and the delta-FS was 0.1. The patient survived 23 months after onset of symptoms.
  • PLEKHM2 The origin of sALS trio-8 with c.1921 + 6C> T mutations in the gene was a 39-year-old man who started symptoms at 38 years of age, and his dysfunction progressed slowly in the upper limb. At diagnosis, the patient's ALSFRS-R was 39/48 and the delta-FS was 0.89. The patient survived 15 months after onset of symptoms.
  • IFT80 The onset of sALS trio-13 with a c.595G> A (p.Val199Ile) mutation in the gene developed in lower extremity at age 41.
  • the patient's ALSFRS-R was 37/48 and the delta-FS was 0.73.
  • ADGRL3 The onset of sALS trio-15 with a c.715A> G (p.Ser239Gly) mutation in the gene developed in the lower extremity at age 43.
  • the patient's ALSFRS-R was 43/48 and the delta-FS was 0.25.
  • PLS primary lateral sclerosis
  • LMND lower motor neuron disease
  • rEEC revised El Escorial criteria
  • UE upper extremity
  • LE lower extremity
  • ALSFRS-R the ALS functional rating scale-revised
  • delta-FS delta-functional rating
  • FVC forced vital capacity
  • NIV non-invasive ventilation.
  • PSEN1 Deletion of gene exon 9 is known to be associated with early congenital anortic paralysis (138-140).
  • Target gene sequencing through Sanger sequencing is generally known as a useful method for finding mutations, but due to the various phenotypic variability, genetic heterogeneity, and multiple molecular mechanisms of disease, it is the cause of many neurodegenerative diseases. Difficulties in determining genes and mutations. Therefore, it is of diagnostic utility to perform full exome sequencing after testing for common causal genes in the absence of specific target genes.
  • ASD autism spectrum disorders
  • ALS amyotrophic lateral sclerosis
  • RAPGEF2 Ras guanine nucleotide exchange factor 2 gene was identified as a candidate gene for ALS.
  • a new missense mutation c.4069G> A p.Glu1357Lys
  • two additional missense mutations of the RAPGEF2 gene were found in 184 independent sALS patient groups; c.1883C> T (p.Thr628Ile) and c.3293G> A (p.Arg1098His).
  • Experimental analysis results of the present invention are RAPGEF2 Suggests that the gene is the causal gene for sALS.
  • the three variants of the RAPGEF2 gene were absent in 100 control groups of the same race and 75 autologous disease controls. And allelic frequencies of mutations were extremely rare ( ⁇ 0.1%) in dbSNP141, the 1000 Genome project (all and East Asians), and the Exome Aggregation Consortium (ExAC). Second, the known pathogenesis of ALS and RAPGEF2 in analyzes based on comparisons of published literature, transcripts, proteins, regulators, ontologies and phenotype databases Comparison of the genes revealed that the RAPGEF2 gene had a statistically significant relationship with ALS.
  • RapGEF2 protein is a GTP / GDP-regulatory switch that determines inactive GDP- and active GTP-binding states and is one of the members of the RAS family with GTPase function in signaling (144).
  • RapGEF2 comprises several domains including cyclic nucleotide-binding domain (CNBD), Ras exchange domain, PDZ domain, Ras associated domain and Rap GEF domain (145).
  • the GEF domain of RapGEF2 is responsible for regulating GTP exchange in Rap1 and Rap2, a family member close to Rap1 (146). Other domains appear to regulate its activity, stability and location (147, 148).
  • RapGEF2 is abundantly expressed in the brain of rats and is present in many synaptic plasma vesicles, suggesting that RapGEF2 will play a role in synapses (FIG. 12). (149).
  • early brain development and neuronal morphogenesis have been reported to be associated with RapGEF2 function (150–152).
  • RapGEF2 is involved in the MAPK and Rap1 signaling pathways.
  • Rag1 signaling is involved in neuronal migration and is regulated by Cdk5 (153). Recent studies have reported that Cdk5-dependent regulation of RapGEF2 plays an important role in neuronal migration and neural circuitry in the cerebral cortex (145).
  • the present inventors of sALS-13 IFT80 A new variant c.595G> A was found from the gene.
  • the IFT80 (Intraflagellar transport 80) gene is located on chromosome 3q25.33 and consists of 21 exons. This gene encodes an intraflagellar transport complex B protein and plays an essential role in motor and sensory cilia. Mutations in the IFT80 gene cause asphyxiating thoracic dystrophy 2 (ATD2) and short-rib polydactyly syndrome (SRP) type III (154). IFT80 is abundantly expressed in soft tissues and kidneys (FIG. 13). Recently, Wang et al. Found that IFT80 expression is increased in the palate and trabecular bone, and that immunohistochemical analysis of the mouse tibia regulates the Hh and Wnt signaling pathways, suggesting that IFT80 is essential for chondrocyte differentiation. 155).
  • SSH2 Slingshot protein phosphatase 2
  • SSH2 Slingshot protein phosphatase 2
  • ARC activity-regulated cytoskeleton-associated protein
  • NMDAR N-methyl-D-aspartate receptor
  • Trio of sALS- 4 CLEC4C C.629_631delAGA Trio of sALS- 4 CLEC4C C.629_631delAGA, an inframe deletion in the gene, was found.
  • the CLEC4C (C-type lectin domain family 4, member C) gene is located on chromosome 12p13.2-p12.3 and consists of seven exons.
  • the protein family members of this gene share a common protein fold structure and have a variety of functions such as cell adhesion, cell signaling, glycoprotein turnover, and roles in inflammatory and immune responses.
  • Type 2 transmembrane proteins play an important role in dendritic cell function (158).
  • Recently, studies using transgenic mice have reported that antigen delivery to plasmacytoid dendritic cells via CLEC4C is an effective method for the treatment of autoimmune diseases or inducing immunological resistance useful in inhibiting unwanted antibody responses (159). ).
  • Trio of sALS- 8 PLEKHM2 An intron mutation, c.1921 + 6C> T, was found in the gene.
  • the PLEKHM2 [Pleckstrin homology domain containing, family (with RUN domain) member 2] gene is located on chromosome 1q36.21 and consists of 21 exons. PLEKHM2 is abundantly expressed in the thymus (FIG. 17). This gene inhibits kinesin recruitment during Salmonella infection, and PLEKHM2 activity is essential for localization and maintenance of Salmonella-containing vacuoles (160).
  • FRAS1 The Fraser extracellular matrix complex subunit 1 (FRAS1 ) gene is located on chromosome 4q21.21 and consists of 74 exons. FRAS1 is abundantly expressed in the small intestine and skin (FIG. 18). This gene encodes an extracellular matrix protein and has the function of regulating organogenesis during epidermal basement membrane adhesion and developmental time (161). FRAS1 Mutations in genes are responsible for Fraser syndrome, which indicates multisystem malformation, including cryptophthalmos, syndactyly and kidney defects (162).
  • the ADGRL3 (Adhesion G protein-coupled receptor L3) gene is also known as LPHN3 (latrophilin 3). This gene is located on chromosome 4q13.1 and consists of 27 exons and is expressed in the brain, placenta and eyes (FIG. 19). This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCRs). Latrophylline has a long N-terminal extracellular sequence comprising seven transmembrane regions plus 19 amino acid signaling peptides and a serine / threonine-rich glycosylation region (163).
  • ADGRL3 is the most specific latropyline in the brain (163). According to a recent study, ADGRL3 It has been reported that genes are associated with attention-deficit / hyperactivity disorder (ADHD) (164). researchers say ADGRL3 Genetic variations have been found to be expressed in key brain regions related to concentration and activity, affect metabolism of neural circuits associated with ADHD, and are associated with responses to stimulants (164).
  • ADHD attention-deficit / hyperactivity disorder
  • SPAG17 Sperm associated antigen 17 gene is located on chromosome 1p12 and consists of 56 exons. SPAG17 is abundantly expressed in the lungs (FIG. 15). SPAG17-deficient mice lose the motility of nasal and tracheal cilia, decrease nasal mucus clearance, respiratory failure due to accumulation of water in the lungs, destruction of alveolar epithelium, development of hydrocephalus and ventricular dilatation , Failure to suck and newborn death.
  • XRCC3 Chinese hamster cells 3
  • XRCC3 Chinese hamster cells 3
  • HR homologous recombination pathway
  • XRCC3 Gene mutations inhibit post-injury repair mechanisms, resulting in sensitive chromosomal instability and a positive positive for many other DNA damaging agents (168).
  • RAPGEF2 was selected as a candidate for a new causal gene.
  • RAPGEF2 Genetic analysis revealed two missense mutations from two patients; c.1883C> T and c.3293G> A. In addition, three RAPGEF2 mutations were not found in self disease control exome data from 100 Korean normal controls and 75 non-ALS patients.
  • the present invention is the first study to discover novel mutations in Korean sALS trio through whole exome sequencing.
  • the results of the present invention provide further knowledge about the causes of ALS.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 근위축성측삭경화증에 대한 마커로서 RAPGEF2, IFT80, SSH2, XRCC3, SPAG17, PLEKHM2, CLEC4C, FRAS1, ADGRL3, PSEN1 돌연변이 유전자 및 돌연변이 단백질과 이를 이용한 근위축성측삭경화증의 진단 방법을 제공한다. 본 발명의 근위축성측삭경화증 마커는 한국인 ALS 환자로부터 발견한 새로운 변이로서 종전에 보고된 데이터베이스에서 0.1% 미만의 빈도로 나타난 매우 드문 변이이거나 보고된 바 없는 변이이며, 정상 대조군에서는 발견되지 않는 변이이다. 본 발명에서 발견한 돌연변이 유전자 및/또는 이로부터 코딩되는 돌연변이 단백질은 ALS의 유전학적 원인을 밝히고 ALS를 진단하는데 매우 유용하게 사용될 수 있다. 본 발명에서 발견한 돌연변이 유전자 및/또는 이로부터 코딩되는 돌연변이 단백질에 대하여 유전자 또는 단백질 검사를 실시함으로써 근위축성측삭경화증을 조기 진단할 수 있으며, 적절한 치료방법을 조기에 적용하여 치료효과를 극대화할 수 있고, 나아가 정확한 병인에 따른 맞춤치료를 가능하게 할 수 있다.

Description

근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법
본 발명은 대한민국 보건복지부의 지원 하에서 과제번호 HI12C0135에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국보건산업진흥원, 연구사업명은 “보건의료연구개발사업”, 연구과제명은 “신경계 희귀질환의 신규 바이오마커 및 맞춤형 치료기술 개발 중개연구센터”, 주관기관은 성균관대학교 산학협력단, 한양대학교 산학협력단, 서울대학교 산학협력단, 연구기간은 2012.05.01 ~ 2018.03.31이다.
본 특허출원은 2015년 10월 7일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2015-0141113호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법에 관한 것이다.
근위축성측삭경화증(Amyotrophic lateral sclerosis; ALS)은 성인에서 발병하는 신경 퇴행성 질환으로 점진적인 대뇌 겉질, 숨뇌, 및 척수의 운동 신경 소실로 인해 발생한다. 약 10%의 환자에서는 가족력이 있는 가족성 ALS이며, 90% 가량의 환자는 가족력 없이 산발적으로 발생한다. 현재까지 SOD1, TARDBP, FUS, C9orf72 등을 비롯하여 여러 유전자들의 돌연변이가 ALS의 원인으로 보고되었으나, 가족성 ALS 환자 중 1/3과 산발성 ALS 환자의 약 90%에서는 유전적 원인이 밝혀지지 않았다. 최근 신경계 질환에서 산발성 환자 및 건강한 부모를 대상으로 환자에서만 발견되는 신규 변이(de novo variant)를 확인함으로써 질환의 원인이 되는 새로운 유전자를 발굴하는 연구가 대두되고 있다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
[선행기술문헌]
1. Charcot J, Joffroy A. Arch Physiol Norm Pathol 1869;2:744-760
2. Cleveland DW, Rothstein JD. Nat Rev Neurosci 2001;2:806-819
3. Brain L, Walton JN. Oxford university press, London, 1969
4. Wijesekera LC, Leigh PN. Orphanet J Rare Dis 2009;4:3
5. Rowland LP, Shneider NA. N Engl J Med 2001;344:1688-1700
6. Kinsley L, Siddique T. Amyotrophic Lateral Sclerosis Overview. GeneReviews®http://www.ncbi.nlm.nih.gov/books/NBK1450/, Seattle, University of Washington, 2001
7. Traynor BJ, Codd MB, Corr B, Forde C, Frost E, Hardiman O. Neurology 1999;52:504-509
8. Abhinav K et al., Neuroepidemiology 2007;29:44-48
9. Manjaly ZR et al., Amyotroph Lateral Scler 2010;11:439-442
10. Forbes RB, Colville S, Swingler RJ. Age Ageing 2004;33:131-134
11. Gouveia LO, de Carvalho M. Amyotroph Lateral Scler 2007;8:323-327
12. Haverkamp LJ, Appel V, Appel SH. Brain 1995;118 ( Pt 3):707-719
13. Swinnen B, Robberecht W. Nat Rev Neurol 2014;10:661-670
14. Chio A, Calvo A, Moglia C, Mazzini L, Mora G. J Neurol Neurosurg Psychiatry 2011;82:740-746
15. Pinto S, Pinto A, De Carvalho M. Eura Medicophys 2007;43:505-509
16. Turner MR et al., J Neurol Sci 2010;294:81-85
17. Shoesmith CL, Findlater K, Rowe A, Strong MJ. J Neurol Neurosurg Psychiatry 2007;78:629-631
18. Gordon PH et al., Neurology 2006;66:647-653
19. Phukan J, Pender NP, Hardiman O. Lancet Neurol 2007;6:994-1003
20. A VB. Allg Z Psychiat Psychischgerichtliche Med 1932;96:364-366
21. Bak TH, Hodges JR. J Neurol 2001;248:260-270
22. Jeong Y et al., Neurology 2005;64:734-736
23. Talbot PR et al., J Neurol Neurosurg Psychiatry 1995;58:541-547
24. Mioshi E et al., Neurology 2014;82:149-155
25. Gilbert RM et al., Mov Disord 2010;25:1868-1875
26. Annesi G et al., Ann Neurol 2005;58:803-807
27. DeJesus-Hernandez M et al., Neuron 2011;72:245-256
28. Lindquist SG et al., Clin Genet 2013;83:279-283
29. Hensman Moss DJ et al., Neurology 2014;82:292-299
30. Isaacs JD et al., J Neurol Neurosurg Psychiatry 2007;78:750-753
31. Baltadzhieva R, Gurevich T, Korczyn AD. Curr Opin Neurol 2005;18:487-493
32. Brooks BR, Miller RG, Swash M, Munsat TL. Amyotroph Lateral Scler Other Motor Neuron Disord 2000;1:293-299
33. de Carvalho M et al., Clin Neurophysiol 2008;119:497-503
34. Cedarbaum JM et al., J Neurol Sci 1997;152 Suppl 1:S1-9
35. Cedarbaum JM et al., J Neurol Sci 1999;169:13-21
36. A controlled trial of recombinant methionyl human BDNF in ALS: The BDNF Study Group (Phase III). Neurology 1999;52:1427-1433
37. Cudkowicz ME et al., Neurology 2003;61:456-464
38. Groeneveld GJ et al., Ann Neurol 2003;53:437-445
39. Franchignoni F, Mandrioli J, Giordano A, Ferro S. Amyotroph Lateral Scler Frontotemporal Degener 2015:1-7
40. Franchignoni F et al., J Neurol Neurosurg Psychiatry 2013;84:1340-1345
41. Harwood CA, McDermott CJ, Shaw PJ. Amyotroph Lateral Scler 2009;10:191-204
42. Gallo V et al., Ann Neurol 2009;65:378-385
43. Roelofs-Iverson RA et al., Neurology 1984;34:393-395
44. Armon C. Neuroepidemiology 2003;22:217-228
45. Chio A et al., Brain 2005;128:472-476
46. Kasarskis EJ et al., Amyotroph Lateral Scler 2009;10:35-41
47. Pasinelli P, Brown RH. Nat Rev Neurosci 2006;7:710-723
48. Kiernan MC et al., The Lancet 2011;377:942-955
49. Watkins JC, Evans RH. Annu Rev Pharmacol Toxicol 1981;21:165-204
50. Heath PR, Shaw PJ. Muscle Nerve 2002;26:438-458
51. Maher P, Davis JB. J Neurosci 1996;16:6394-6401
52. Meldrum B, Garthwaite J. Trends Pharmacol Sci 1990;11:379-387
53. Liu R et al., Ann Neurol 1998;44:763-770
54. Menzies FM et al., Brain 2002;125:1522-1533
55. Damiano M et al., J Neurochem 2006;96:1349-1361
56. Rizzardini M et al., Brain Res Bull 2006;69:465-474
57. Bruijn LI et al., Science 1998;281:1851-1854
58. Sreedharan J et al., Science 2008;319:1668-1672
59. Kwiatkowski TJ et al., Science 2009;323:1205-1208
60. Renton AE, Chio A, Traynor BJ. Nat Neurosci 2014;17:17-23
61. Sreedharan J, Brown RH, Jr. Ann Neurol 2013;74:309-316
62. Andersen PM, Al-Chalabi A. Nat Rev Neurol 2011;7:603-615
63. Al-Chalabi A, Lewis CM. Hum Hered 2011;71:281-288
64. Rosen DR et al., Nature 1993;362:59-62
65. Neumann M et al., Science 2006;314:130-133
66. Maruyama H et al., Nature 2010;465:223-226
67. Johnson JO et al., Neuron 2010;68:857-864
68. Fecto F et al., Arch Neurol 2011;68:1440-1446
69. Wu CH et al., Nature 2012;488:499-503
70. Deng HX et al., Nature 2011;477:211-215
71. Luty AA et al., Ann Neurol 2010;68:639-649
72. Kim HJ et al., Nature 2013;495:467-473
73. Chio A et al., Neurology 2008;70:533-537
74. Andersen PM. Curr Neurol Neurosci Rep 2006;6:37-46
75. Wang J, Xu G, Borchelt DR. Neurobiol Dis 2002;9:139-148
76. Gurney ME et al., Science 1994;264:1772-1775
77. Boillee S et al., Science 2006;312:1389-1392
78. Cudkowicz ME et al., Ann Neurol 1997;41:210-221
79. Andersen PM et al., Brain 1996;119 ( Pt 4):1153-1172
80. Chio A et al., Neurology 2012;79:1983-1989
81. Buratti E, Baralle FE. Front Biosci 2008;13:867-878
82. Winton MJ et al., J Biol Chem 2008;283:13302-13309
83. Vance C et al., Science 2009;323:1208-1211
84. Renton AE et al., Neuron 2011;72:257-268
85. Majounie E et al., Lancet Neurol 2012;11:323-330
86. Wojciechowska M, Krzyzosiak WJ. Hum Mol Genet 2011;20:3811-3821
87. Chew J et al., Science 2015
88. Johnson JO et al., Nat Neurosci 2014;17:664-666
89. Buratti E et al., J Biol Chem 2005;280:37572-37584
90. Rademakers R, van Blitterswijk M. Neuron 2014;84:241-243
91. Smith BN et al., Neuron 2014;84:324-331
92. Cirulli ET et al., Science 2015;347:1436-1441
93. Freischmidt A et al., Nat Neurosci 2015
94. Kwon MJ et al., Neurobiol Aging 2012;33:1017 e1017-1023
95. Kim HJ et al., Neurobiol Aging 2014;35:1957.e1957-1958
96. Jang JH et al., Neurobiol Aging 2013;34:1311.e1317-1319
97. Crow JF. Nat Rev Genet 2000;1:40-47
98. Roach JC et al., Science 2010;328:636-639
99. Conrad DF et al., Nat Genet 2011;43:712-714
100. Kong A et al., Nature 2012;488:471-475
101. Littler M, Morton NE. J Med Genet 1990;27:307-310
102. Ivanchuk SM, Myers SM, Eng C, Mulligan LM. Hum Mol Genet 1996;5:2023-2026
103. O'Roak BJ et al., Nature 2012;485:246-250
104. Gratten J, Visscher PM, Mowry BJ, Wray NR. Nat Genet 2013;45:234-238
105. Veltman JA, Brunner HG. Nat Rev Genet 2012;13:565-575
106. Vissers LE et al., Nat Genet 2010;42:1109-1112
107. Alexander MD et al., Ann Neurol 2002;52:680-683
108. Chio A et al., Neurobiol Aging 2011;32:553 e523-556
109. DeJesus-Hernandez M et al., Hum Mutat 2010;31:E1377-1389
110. Chesi A et al., Nat Neurosci 2013;16:851-855
111. Calvo A et al., Neurobiol Aging 2014;35:1513 e1517-1513 e1511
112. Kim YE et al., Neurobiol Aging 2015;36:1604.e1617-1609
113. Mitchell JD. J Neurol 2000;247:7-12
114. Li H, Durbin R. Bioinformatics 2009;25:1754-1760
115. Olkowski ZL. Neuroreport 1998;9:239-242
116. Droppelmann CA et al., Amyotroph Lateral Scler Frontotemporal Degener 2013;14:444-451
117. Takahashi Y et al., Am J Hum Genet 2013;93:900-905
118. Couthouis J et al., Hum Mol Genet 2012;21:2899-2911
119. Al-Chalabi A et al., Hum Mol Genet 1999;8:157-164
120. Ticozzi N et al., Ann Neurol 2010;68:102-107
121. Leung CL et al., Brain Pathol 2004;14:290-296
122. Teyssou E et al., Neurobiol Aging 2014;35:1213.e1219-1213.e1212
123. Sabatelli M et al., Amyotroph Lateral Scler 2012;13:580-584
124. van Blitterswijk M et al., PLoS One 2012;7:e48983
125. Munch C et al., Neurology 2004;63:724-726
126. Ng PC et al., Nucleic Acids Res 2003;31:3812-3814
127. Ramensky V, Bork P, Sunyaev S. Nucleic Acids Res 2002;30:3894-3900
128. Adzhubei IA et al., Nat Methods 2010;7:248-249
129. Chen J et al., Nucleic Acids Res 2009;37:W305-311
130. Ezquerra M, Carnero C, Blesa R, Oliva R. Arch Neurol 2000;57:485-488
131. Pringle CE et al., Brain 1992;115 ( Pt 2):495-520
132. Dumanchin C et al., J Med Genet 1998;35:672-673
133. Portet F et al., Neurology 2003;61:1136-1137
134. Golan MP et al., Exp Neurol 2007;208:264-268
135. Ataka S et al., Arch Neurol 2004;61:1773-1776
136. Hattori S et al., Neurosci Lett 2004;368:319-322
137. Raman A et al., J Neurol Sci 2007;260:78-82
138. Brooks WS et al., Brain 2003;126:783-791
139. Verkkoniemi A et al., Neurology 2000;54:1103-1109
140. Crook R et al., Nat Med 1998;4:452-455
141. Sanders SJ et al., Nature 2012;485:237-241
142. Neale BM et al., Nature 2012;485:242-245
143. Iossifov I et al., Neuron 2012;74:285-299
144. Rebhun JF, Castro AF, Quilliam LA. J Biol Chem 2000;275:34901-34908
145. Ye T, Ip JP, Fu AK, Ip NY. Nat Commun 2014;5:4826
146. de Rooij J et al., J Biol Chem 1999;274:38125-38130
147. Pham N, Rotin D. J Biol Chem 2001;276:28478-28483
149. Ohtsuka T et al., Biochem Biophys Res Commun 1999;265:38-44
150. Hisata S et al., J Cell Biol 2007;178:843-860
151. Bilasy SE et al., Eur J Neurosci 2009;29:1994-2008
152. Lee KJ et al., Neuron 2011;69:957-973
153. Utreras E et al., Neurochem Int 2013;62:848-853
154. Beales PL et al., Nat Genet 2007;39:727-729
155. Wang C, Yuan X, Yang S. Exp Cell Res 2013;319:623-632
156. Niwa R et al., Cell 2002;108:233-246
157. Fromer M et al., Nature 2014;506:179-184
158. Riboldi E et al., J Biol Chem 2011;286:35329-35333
159. Chappell CP et al., J Immunol 2014;192:5789-5801
160. Boucrot E et al., Science 2005;308:1174-1178
161. Petrou P et al., J Biol Chem 2005;280:10350-10356
162. McGregor L et al., Nat Genet 2003;34:203-208
163. Sugita S et al., J Biol Chem 1998;273:32715-32724
164. Arcos-Burgos M et al., Mol Psychiatry 2010;15:1053-1066
165. Teves ME et al., Am J Respir Cell Mol Biol 2013;48:765-772
166. Teves ME et al., PLoS One 2015;10:e0125936
167. Zhang B et al., , Wang M, Tang D, Li Y, Xu M, Gu M, Cheng Z, Yu H. J Exp Bot 2015
168. Brenneman MA et al., Mol Cell 2002;10:387-395
169. van Blitterswijk M et al., Hum Mol Genet 2012;21:3776-3784
본 발명자들은 산발성 ALS 환자 및 그들의 부모를 대상으로 엑솜 서열 확인법을 이용하여 ALS에 대한 새로운 원인 유전자를 발굴하고자 연구 노력하였다. 그 결과, ALS 환자에서 10개 유전자에 대한 신규 변이를 발견하였으며, 특히 RAPGEF2 유전자가 ALS의 새로운 원인 유전자임을 규명하였고, 상기 신규 변이가 ALS 진단에 유용하게 이용될 수 있음을 확인함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 근위축성측삭경화증에 대한 진단 마커로서 RAPGEF2, IFT80, SSH2, XRCC3, SPAG17, PLEKHM2, CLEC4C, FRAS1, ADGRL3, PSEN1 돌연변이 유전자를 제공하는데 있다.
본 발명의 다른 목적은 근위축성측삭경화증에 대한 진단 마커로서 RapGEF2, IFT80, SSH2, XRCC3, SPAG17, CLEC4C, FRAS1, ADGRL3, PSEN1 돌연변이 단백질을 제공하는데 있다.
본 발명의 또 다른 목적은 근위축성측삭경화증의 진단에 필요한 정보를 제공하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 근위축성측삭경화증 진단용 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 근위축성측삭경화증 진단용 키트를 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 근위축성측삭경화증(Amyotrophic lateral sclerosis; ALS)에 대한 진단 마커로서 (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자; (f) 서열목록 제6서열의 염기서열에서 1921+6번째 염기인 시토신이 티민으로 치환된 PLEKHM2 돌연변이 유전자; (g) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자; (h) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자; (i) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자; 및 (j) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자로 구성된 군으로부터 선택되는 돌연변이 유전자를 제공한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 근위축성측삭경화증에 대한 진단 마커로서 (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자로부터 암호화되는 RapGEF2 돌연변이 단백질; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자로부터 암호화되는 IFT80 돌연변이 단백질; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자로부터 암호화되는 SSH2 돌연변이 단백질; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자로부터 암호화되는 XRCC3 돌연변이 단백질; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자로부터 암호화되는 SPAG17 돌연변이 단백질; (f) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자로부터 암호화되는 CLEC4C 돌연변이 단백질; (g) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자로부터 암호화되는 FRAS1 돌연변이 단백질; (h) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자로부터 암호화되는 ADGRL3 돌연변이 단백질; 및 (i) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자로부터 암호화되는 PSEN1 돌연변이 단백질로 구성된 군으로부터 선택되는 돌연변이 단백질을 제공한다.
본 발명자들은 산발성 ALS 환자 및 그들의 부모를 대상으로 엑솜 서열 확인법을 이용하여 ALS에 대한 새로운 원인 유전자를 발굴하고자 연구 노력하였다. 그 결과, ALS 환자에서 10개 유전자에 대한 신규 변이를 발견하였으며, 특히 RAPGEF2 유전자가 ALS의 새로운 원인 유전자임을 규명하였고, 상기 신규 변이가 ALS 진단에 유용하게 이용될 수 있음을 확인하였다.
근위축성측삭경화증(Amyotrophic lateral sclerosis; ALS)은 운동신경세포만 선택적으로 사멸하는 질환으로 루게릭병으로도 불리우며, 대뇌 겉질의 상위운동신경세포(upper motor neuron)와 뇌간 및 척수의 아래운동신경세포(lower motor neuron) 모두가 점차적으로 파괴되는 특징을 보인다. 임상 증상은 서서히 진행되는 사지의 위약(weakness, 쇠약) 및 위축으로 시작하고, 병이 진행되면서 결국 호흡근 마비로 수년 내에 사망에 이르게 되는 치명적인 질환이다.
본 발명에서는 총 15명의 한국인 산발성 ALS 환자 및 부모를 대상으로 엑솜 서열 확인법을 시행하고, 엑손 및 스플라이스 위치에서 신규 변이를 발견하였으며, 이 변이가 이전에 보고된 인구 집단의 빈도가 1% 미만으로 매우 드물고 한국인 정상인 대조군에서 발견되지 않는 변이임을 규명하였다. 본 발명에서 ALS 환자로부터 발견한 신규 변이는 RAPGEF2 c.4069G>A (p.Glu1357Lys), RAPGEF2 c.1883C>T (p.Thr628Ile), RAPGEF2 c.3293G>A (p.Arg1098His), FRAS1 c.8393C>T (p.Ala2798Val), SPAG17 c.2815G>T (p.Ala939Ser), XRCC3 c.598G>A (p.Val200Ile), IFT80 c.595G>A (p.Val199Ile), ADGRL3 c.715A>G (p.Ser239Gly), SSH2 c.1408G>T (p.Glu470*), CLEC4C c.629_631delAGA (p.Lys210del), PLEKHM2 (c.1921+6C>T) 및 PSEN1 c.497T>C (p.Leu166Pro)였으며, 이 가운데 특히 RAPGEF2 유전자에서 발견된 세 개의 변이는 dbSNP141, 1000 지놈 프로젝트 및 EAC (Exome Aggregation Consortitum) 데이터베이스에서 0.1% 미만의 빈도로 매우 드문 변이이거나 보고된 바 없었고, 한국인 대조군에서도 발견되지 않았으며 통계학적 분석에서 RAPGEF2 유전자가 ALS와 관련이 있을 가능성이 확인되었다.
본 발명에서 ALS 환자로부터 발견한 변이 가운데 PSEN1 c.497T>C는 가족성 EOAD(early-onset Alzheimer’s dementia)에서 종전에 보고된 바 있는 변이이나, ALS 환자에서는 처음으로 발견된 변이이다.
그 외에 다른 변이들은 종전에 보고된 적 없는 새로운 변이(variants of unknown significance, VUS)이다. 본 발명에서 발견한 11개의 신규 VUS 가운데 10개 변이는 엑손 영역에 위치하는 아미노산에 영향을 주는 변이였다. FRAS1 c.8393C>T (p.Ala2798Val), RAPGEF2 c.4069G>A (p.Glu1357Lys), RAPGEF2 c.1883C>T (p.Thr628Ile), RAPGEF2 c.3293G>A (p.Arg1098His), SPAG17 c.2815G>T (p.Ala939Ser), XRCC3 c.598G>A (p.Val200Ile), IFT80 c.595G>A (p.Val199Ile), ADGRL3 c.715A>G (p.Ser239Gly) 및 XRCC3 c.598G>A (p.Val200Ile)는 missense 변이이고, CLEC4C c.629_631delAGA (p.Lys210del)는 inframe deletion, SSH2 c.1408G>T (p.Glu470*)는 nonsense 변이를 나타낸다. 나머지 하나는 엑손 경계 근처의 플랭킹 영역에 위치하는 인트론 변이였다(PLEKHM2 c.1921+6C>T).
본 발명의 일 구현예에 따르면, 본 발명의 (a) RapGEF2 돌연변이 단백질은 서열목록 제11서열의 아미노산 서열에서 1357번째 아미노산 잔기인 글루탐산이 라이신으로 치환, 628번째 아미노산 잔기인 트레오닌이 이소류신으로 치환 또는 1098번째 아미노산 잔기인 아르기닌이 히스티딘으로 치환된 RapGEF2 돌연변이 단백질이고; (b) IFT80 돌연변이 단백질은 서열목록 제12서열의 아미노산 서열에서 199번째 아미노산 잔기인 발린이 이소류신으로 치환된 IFT80 돌연변이 단백질이며; (c) SSH2 돌연변이 단백질은 서열목록 제13서열의 아미노산 서열에서 470번째 아미노산 잔기인 글루탐산이 종결코돈으로 치환된 SSH2 돌연변이 단백질이고; (d) XRCC3 돌연변이 단백질은 서열목록 제14서열의 아미노산 서열에서 200번째 아미노산 잔기인 발린이 이소류신으로 치환된 XRCC3 돌연변이 단백질이며; (e) SPAG17 돌연변이 단백질은 서열목록 제15서열의 아미노산 서열에서 939번째 아미노산 잔기인 알라닌이 세린으로 치환된 SPAG17 돌연변이 단백질이고; (f) CLCE4C 돌연변이 단백질은 서열목록 제16서열의 아미노산 서열에서 210번째 아미노산 잔기인 라이신이 결실된 CLEC4C 돌연변이 단백질이며; (g) FRAS1 돌연변이 단백질은 서열목록 제17서열의 아미노산 서열에서 2798번째 아미노산 잔기인 알라닌이 발린으로 치환된 FRAS1 돌연변이 단백질이고; (h) ADGRL3 돌연변이 단백질은 서열목록 제18서열의 아미노산 서열에서 239번째 아미노산 잔기인 세린이 글라이신으로 치환된 ADGRL3 돌연변이 단백질이며; (i) PSEN1 돌연변이 단백질은 서열목록 제19서열의 아미노산 서열에서 166번째 아미노산 잔기인 류신이 프롤린으로 치환된 PSEN1 돌연변이 단백질이다.
PLEKHM2 c.1921+6C>T는 인트론 영역에서 나타나는 변이로서 돌연변이 단백질을 생산하지 않는다.
본 발명에 따르면, 본 발명에서 발견한 돌연변이 유전자 및/또는 이로부터 코딩되는 돌연변이 단백질은 ALS의 유전학적 원인을 밝히고 ALS를 진단하는데 매우 유용하게 사용될 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 근위축성측삭경화증의 진단에 필요한 정보를 제공하는 방법을 제공한다:
(i) 개체(subject)로부터 분리된 생물학적 시료로부터 (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자; (f) 서열목록 제6서열의 염기서열에서 1921+6번째 염기인 시토신이 티민으로 치환된 PLEKHM2 돌연변이 유전자로 구성된 군으로부터 선택되는 돌연변이 유전자; (g) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자; (h) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자; (i) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자; 또는 (j) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자의 mRNA 또는 상기 유전자에 의해 코딩되는 돌연변이 단백질을 검출하는 단계; 및
(ii) 상기 시료에서 상기 돌연변이 유전자의 mRNA 또는 돌연변이 단백질이 검출된 경우, 상기 개체는 근위축성측삭경화증인 것으로 판정하는 단계.
본 발명에서 용어 “생물학적 시료”란 근위축성측삭경화증 여부를 확인하고자 하는 개체로부터 분리된 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료를 포함하나, 이들에 한정되는 것은 아니다.
본 발명에 따르면, 상기 단계 (i)에서 mRNA는 상기 돌연변이 유전자에 특이적으로 결합하는 프라이머, 프로브 및 공지된 다양한 시퀀싱 방법을 이용하여 검출할 수 있다.
mRNA를 검출하기 위한 방법으로는 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블롯 (northern blot), DNA 마이크로어레이 칩 등이 있으나, 이들에 한정되는 것은 아니다.
상기 방법을 통하여 대상 질환의 발병이 의심되는 개체에서 돌연변이 유전자의 mRNA를 검출할 수 있고, mRNA 검출 여부를 판단하여 근위축성측삭경화증을 진단할 수 있다. mRNA는 바람직하게는 진단 마커로 사용되는 돌연변이 유전자에 특이적인 프라이머를 사용하는 역전사효소 중합반응 또는 상기 유전자에 특이적인 탐침을 사용하는 DNA 마이크로어레이 칩을 이용하여 검출할 수 있다.
본 발명의 일 구현예에 따르면, 진단 마커로 사용되는 돌연변이 유전자에 특이적인 프라이머를 사용하여 역전사효소 중합반응을 수행한 후 생성물을 전기영동하여 확인함으로써 상기 돌연변이 유전자의 존재 여부를 검출하고, 그로부터 근위축성측삭경화증을 간편하게 진단할 수 있다.
한편, DNA 마이크로어레이 칩은 상기 돌연변이 유전자 또는 그 단편에 해당하는 핵산이 유리 등의 기판에 고밀도로 부착되어 있는 DNA 칩을 이용하는 것으로서, 개체 시료로부터 mRNA를 분리하고, 그 말단 또는 내부에 형광물질이 표지된 cDNA 탐침을 만들어 DNA 칩에 혼성화시킴으로써 근위축성측삭경화증을 진단할 수 있다.
구체적으로, DNA 마이크로 어레이 칩을 이용한 분석방법은 하기의 단계를 포함할 수 있다:
(1) 개체 시료로부터 돌연변이 유전자의 mRNA를 분리하는 단계;
(2) 상기 mRNA를 cDNA로 합성하면서 형광물질로 표지하는 단계;
(3) 상기 형광물질로 표지된 cDNA를 돌연변이 유전자에 대한 탐침이 고정된 DNA 마이크로어레이 칩과 혼성화하는 단계; 및
(4) 상기 혼성화된 DNA 마이크로어레이 칩을 분석하여 개체 시료에서의 돌연변이 유전자의 발현을 검출하는 단계.
상기 분석방법에 적합한 형광물질로 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate), 로다민(rhodamine) 등을 사용할 수 있으나, 이들에 한정되는 것은 아니다.
본 발명에 따르면, 상기 단계 (i)에서 돌연변이 단백질은 상기 돌연변이 단백질에 특이적으로 결합하는 항체를 이용하여 측정할 수 있다.
돌연변이 단백질을 측정하기 위한 분석방법으로 웨스턴 블로팅, ELISA, 방사선 면역분석법, 방사선 면역확산법, 오우크테로니 면역확산법, 로켓 면역전기영동, 면역조직화학염색, 면역침전분석, 보체고정분석, FACS, 단백질 칩 등을 이용할 수 있으나, 이들에 한정되는 것은 아니다.
상기 방법을 통하여 대상 질환의 발병이 의심되는 개체에서 항원-항체 복합체의 형성량을 검출할 수 있고, 돌연변이 유전자로부터 코딩되는 단백질의 발현 여부를 판단하여 근위축성측삭경화증 여부를 진단할 수 있다.
본 발명에서 용어 “항원-항체 복합체”란 돌연변이 유전자로부터 코딩되는 단백질과 이에 특이적인 항체의 결합물을 의미하고, 항원-항체 복합체의 형성량은 검출 표지의 신호강도를 통해서 정량적으로 측정할 수 있다.
단백질 발현은 예를 들면 ELISA를 이용하여 측정할 수 있다. ELISA는 고체 지지체에 부착된 항원을 인지하는 표지된 항체를 이용하는 직접 ELISA, 고체 지지체에 부착된 항원을 인지하는 항체의 복합체에서 포획 항체를 인지하는 표지된 항체를 이용하는 간접 ELISA, 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 표지된 또 다른 항체를 이용하는 직접 샌드위치 ELISA, 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 또 다른 항체와 반응시킨 후 이 항체를 인지하는 표지된 2차 항체를 이용하는 간접 샌드위치 ELISA 등 다양한 ELISA 방법이 포함된다.
또한, 상기 돌연변이 유전자로부터 코딩되는 단백질에 대한 하나 이상의 항체를 이용한 웨스턴 블로팅을 이용할 수 있다. 시료에서 전체 단백질을 분리하고, 이를 전기영동하여 단백질을 크기에 따라 분리한 다음, 니트로셀룰로스 막으로 이동시켜 항체와 반응시킨다. 생성된 항원-항체 복합체의 양을 표지된 항체를 이용하여 확인하는 방법으로 유전자의 발현에 의해 생성된 단백질의 양을 확인함으로써 근위축성측삭경화증을 진단할 수 있다.
또한, 상기 돌연변이 유전자로부터 코딩되는 단백질에 대한 하나 이상의 항체를 이용한 면역조직화학염색을 실시할 수 있다. 개체로부터 채취한 조직을 고정시킨 후 당해 분야에 널리 공지된 방법으로 파라핀 포매 블록을 만든다. 이들을 수 ㎛ 두께의 절편으로 만들어 유리 슬라이드에 붙여 조직 절편 슬라이드를 만든 후, 여기에 본 발명에 따른 돌연변이 유전자로부터 코딩되는 단백질에 특이적인 항체를 공지의 방법에 따라 반응시킨다. 이후, 반응하지 못한 항체는 세척하여 제거하고, 면역반응을 관찰하기 위한 발색시약으로 반응시켜 상기 단백질의 발현을 현미경 하에서 관찰함으로써 근위축성측삭경화증을 진단할 수 있다.
또한, 상기 돌연변이 유전자로부터 코딩되는 단백질에 대한 하나 이상의 항체가 기판 위의 정해진 위치에 배열되어 고밀도로 고정화되어 있는 단백질 칩을 이용할 수 있다. 단백질 칩을 이용하여 시료를 분석하는 방법은 시료에서 단백질을 분리하고, 분리한 단백질을 단백질 칩과 혼성화시켜 항원-항체 복합체를 형성하고, 이를 판독하여 단백질의 존재를 확인함으로써 근위축성측삭경화증을 진단할 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 생물학적 시료로부터 본 발명의 돌연변이 유전자의 mRNA 또는 상기 유전자에 의해 코딩되는 돌연변이 단백질을 검출할 수 있는 검출제를 포함하는 근위축성측삭경화증 진단용 조성물을 제공한다.
본 발명에서 mRNA를 검출하는데 사용되는 검출제는 상기 돌연변이 유전자에 특이적으로 결합하는 프라이머 또는 프로브이다.
본 발명의 근위축성측삭경화증 진단용 조성물에서 이용되는 프로브 또는 프라이머는 상기 돌연변이 유전자 뉴클레오티드 서열에 대하여 상보적인 서열을 갖는다. 본 명세서에서 용어 “상보적(complementary)”은 어떤 특정한 혼성화(hybridization) 또는 어닐링 조건 하에서 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. 따라서 용어 “상보적”은 용어 완전 상보적(perfectly complementary)과는 다른 의미를 가지며, 본 발명의 프라이머 또는 프로브는 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도이면, 하나 또는 그 이상의 미스매치(mismatch) 염기서열을 가질 수 있다.
본 명세서에서 사용되는 용어 “프라이머”는 적합한 온도에서 적합한 완충액 내에서 적합한 조건(즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오타이드를 의미한다. 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 있지만 전형적으로 15-30 베이스 페어이다. 짧은 프라이머 분자는 주형과 충분히 안정된 혼성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다.
프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다. 따라서 본 발명에서의 프라이머는 주형인 상술한 뉴클레오티드 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 유전자 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 충분한 상보성을 가지면 충분하다. 이러한 프라이머의 디자인은 상술한 뉴클레오티드 서열을 참조하여 당업자에 의해 용이하게 실시할 수 있으며, 예컨대, 프라이머 디자인용 프로그램(예: PRIMER 3 프로그램)을 이용하여 할 수 있다.
본 명세서에서 사용된 용어 “프로브”는 자연의 또는 변형된 모노머 또는 연쇄(linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고 타깃 뉴클레오타이드 서열에 특이적으로 혼성화 할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다. 본 발명의 프로브는 바람직하게는 단일쇄이며, 올리고디옥시리보뉴클레오타이드이다.
프라이머 또는 프로브 제작 시 참조하여야 하는 본 발명 마커의 뉴클레오타이드 서열은 서열목록 제1서열 내지 제10서열에서 확인할 수 있으며, 이 서열을 참조하여 프라이머 또는 프로브를 디자인할 수 있다.
본 발명에서 단백질을 검출하는데 사용되는 검출제는 올리고펩타이드, 모노클로날 항체, 폴리클로날 항체, 키메릭(chimeric) 항체, 리간드, PNA(Peptide nucleic acid) 또는 앱타머(aptamer)이다. 본 발명에서 사용되는 단백질 검출제는 바람직하게는 본 발명의 돌연변이 유전자에 의해 코딩되는 단백질에 특이적인 항체이다.
본 발명에서 이용되는 항체는 폴리클로날 또는 모노클로날 항체이며, 바람직하게는 모노클로날 항체이다. 항체는 당업계에서 통상적으로 실시되는 방법들, 예를 들어, 융합 방법(Kohler and Milstein, European Journal of Immunology, 6:511-519(1976)), 재조합 DNA 방법(미국 특허 제4,816,56호) 또는 파아지 항체 라이브러리 방법(Clackson et al, Nature, 352:624-628(1991) 및 Marks et al, J. Mol . Biol ., 222:58, 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; 및 Coligan , CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY, 1991에 상세하게 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로서 삽입된다. 예를 들어, 단일클론 항체를 생산하는 하이브리도마 세포의 제조는 불사멸화 세포주를 항체-생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있으며 용이하게 실시할 수 있다. 폴리클로날 항체는 단백질 항원을 적합한 동물에게 주사하고, 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성(affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 근위축성측삭경화증 진단용 조성물을 포함하는 근위축성측삭경화증 진단용 키트를 제공한다.
본 발명의 키트는 마이크로어레이, 유전자 증폭 키트 또는 면역분석(immunoassay)용 키트이다.
본 발명의 키트가 마이크로어레이인 경우에는 마이크로어레이의 고상표면에 프로브가 고정화 되어 있다.
본 발명의 마이크로어레이에 있어서, 상기한 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기체(substrate) 상에 고정화된다. 바람직한 기체는 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함한다. 상기한 혼성화 어레이 요소는 상기의 기체상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기체에 결합될 수 있다.
한편, 본 발명의 마이크로어레이에 적용되는 시료 DNA는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화된다. 혼성화 조건은 다양하게 할 수 있다. 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.
프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단(예컨대, 플루오리신 (fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine), 그리고 Cy3와 Cy5 (Pharmacia), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 및 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
프로브를 이용하는 경우, 프로브를 cDNA 분자와 혼성화시킨다. 본 발명에서, 적합한 혼성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어, 온도, 성분의 농도, 혼성화 및 세척 시간, 완충액 성분 및 이들의 pH 및 이온세기 등의 조건은 프로브의 길이 및 구아닌과 시토신의 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 혼성화를 위한 상세한 조건은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다. 예를 들어, 상기 엄격조건 중에서 고 엄격조건은 0.5 M NaHPO4, 7% SDS(sodium dodecyl sulfate), 1 mM EDTA에서 65℃ 조건으로 혼성화하고, 0.1 x SSC(standard saline citrate)/0.1% SDS에서 68℃ 조건으로 세척하는 것을 의미한다. 또는, 고 엄격조건은 6 x SSC/0.05% 소듐 파이로포스페이트에서 48℃ 조건으로 세척하는 것을 의미한다. 저 엄격조건은 예를 들어, 0.2 x SSC/0.1% SDS에서 42℃ 조건으로 세척하는 것을 의미한다.
혼성화 반응 이후에, 혼성화 반응을 통하여 나오는 혼성화 시그널을 검출한다. 혼성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 혼성화 반응 결과물과 반응시켜 혼성화 여부를 확인할 수 있다. 이용될 수 있는 효소/기질의 조합은, 퍼옥시다아제(예컨대, 호스래디쉬 퍼옥시다아제)와 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl and pyrocatechol), TMB(tetramethylbenzidine), ABTS(2,2‘-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphthol-AS-B1-phosphate) 및 ECF 기질; 글루코스 옥시다아제와 t-NBT(nitroblue tetrazolium) 및 m-PMS(phenzaine methosulfate) 등이다. 프로브가 금 입자로 표지된 경우에는 실버 나이트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다. 따라서 본 발명의 마커를 검출하는 방법을 혼성화에 기초하여 실시하는 경우에는, 구체적으로 (i) 본 발명의 마커의 뉴클레오티드 서열에 대하여 상보적인 서열을 가지는 프로브를 핵산 시료에 혼성화시키는 단계; (ii) 상기 혼성화 반응 발생 여부를 검출하는 단계를 포함한다.
본 발명의 일 구현예에 따르면, 본 발명의 진단용 키트는 유전자 증폭 키트일 수 있다.
본 명세서에 기재된 용어“증폭”은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 이는 중합효소 연쇄반응(PCR)(미국 특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(RT-PCR)(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I.(WO 89/06700) 및 Davey, C. 등(EP 329,822)의 방법, 리가아제 연쇄 반응(ligase chain reaction; LCR)(17, 18), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-매개 증폭(transcription-mediated amplification; TMA, WO 88/10315), 자가 유지 염기서열 복제(self sustained sequence replication, WO 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences, 미국 특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction(CP-PCR), 미국 특허 제4,437,975호), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction(AP-PCR), 미국 특허 제5,413,909호 및 제5,861,245호), 핵산 염기서열 기반 증폭(nucleic acid sequence based amplification(NASBA), 미국 특허 제5,130,238호, 제5,409,818호, 제5,554,517호, 및 제6,063,603호), 가닥 치환 증폭(strand displacement amplification)(21, 22) 및 고리-중재 항온성 증폭(loop-mediated isothermal amplification; LAMP)(23)를 포함하나, 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국 특허 제09/854,317호에 기술되어 있다.
PCR은 가장 잘 알려진 핵산 증폭 방법으로, 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운(touchdown) PCR, 핫 스타트(hot start) PCR, 네스티드(nested) PCR 및 부스터(booster) PCR이 개발되었다. 또한, 실시간(real-time) PCR, 분별 디스플레이 PCR(differential display PCR: DD-PCR), cDNA 말단의 신속 증폭(rapid amplification of cDNA ends: RACE), 멀티플렉스 PCR, 인버스 중합효소 연쇄반응(inverse polymerase chain reaction: IPCR), 벡토레트(vectorette) PCR 및 TAIL-PCR(thermal asymmetric interlaced PCR)이 특정한 응용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며, 그의 교시사항은 본 명세서에 참조로 삽입된다.
본 발명의 진단용 키트를 프라이머를 이용하여 실시하는 경우에는 유전자 증폭 반응을 실시하여 본 발명의 마커의 뉴클레오티드 서열의 존재 여부를 조사한다. 따라서 본 발명은 원칙적으로 시료 내의 mRNA를 주형으로 하고 mRNA 또는 cDNA에 결합하는 프라이머를 이용하여 유전자 증폭 반응을 실시한다.
mRNA를 얻기 위하여, 시료에서 총 RNA를 분리한다. 총 RNA를 분리하는 것은 당업계에 공지된 통상의 방법에 따라 실시될 수 있다(참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Tesniere, C. et al., Plant Mol . Biol . Rep., 9:242(1991); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons(1987); 및 Chomczynski, P. et al., Anal. Biochem. 162:156(1987)). 예컨대, TRIzol을 이용하여 용이하게 세포내의 총 RNA를 분리할 수 있다. 이어, 분리된 mRNA로부터 cDNA를 합성하고, 이 cDNA를 증폭한다. 본 발명의 총 RNA는 인간의 시료로부터 분리되는 것이기 때문에, mRNA의 말단에는 폴리-A 테일을 갖고 있으며, 이러한 서열 특성을 이용한 올리고 dT 프라이머 및 역전사 효소를 이용하여 cDNA을 용이하게 합성할 수 있다(참조: PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)). 이어, 유전자 증폭 반응을 통하여 합성된 cDNA를 증폭한다.
본 발명에 이용되는 프라이머는 주형의 한 부위에 혼성화 또는 어닐링되어, 이중쇄 구조를 형성한다. 이러한 이중쇄 구조를 형성하는 데 적합한 핵산 혼성화의 조건은 Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) 및 Haymes, B. D., 등, Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985)에 개시되어 있다.
다양한 DNA 중합효소가 본 발명의 증폭에 이용될 수 있으며, E. coli DNA 중합효소 I의 “클레나우” 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus(Taq), Thermus thermophilus(Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, 및 Pyrococcus furiosus(Pfu)를 포함한다.
중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다. Mg2 +와 같은 조인자, dATP, dCTP, dGTP 및 dTTP를 원하는 증폭 정도가 달성될 수 있을 정도로 반응 혼합물에 제공하는 것이 요구된다. 증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다.
본 발명에 있어서 어닐링은 타깃 뉴클레오타이드 서열과 프라이머 사이에 특이적 결합을 가능하게 하는 엄격조건 하에서 실시된다. 어닐링을 위한 엄격조건은 서열-의존적이며 주위 환경적 변수에 따라 다양하다.
이렇게 증폭된 본 발명의 마커의 뉴클레오티드 서열의 cDNA를 적합한 방법으로 분석하여 본 발명의 마커의 뉴클레오티드 서열의 존재 여부를 조사한다. 예를 들어, 상술한 증폭 반응 결과물을 젤 전기영동을 하고, 그 결과 형성되는 밴드를 관찰 및 분석함으로써 본 발명의 마커의 뉴클레오티드 서열의 존재 여부를 조사한다. 이러한 증폭 반응을 통하여, 생시료에서 본 발명의 마커의 뉴클레오티드 서열이 발견되는 경우, 근위축성측삭경화증의 가능성이 높은 것으로 판정한다.
본 발명의 일 구현예에 따르면, 본 발명의 키트는 면역분석(immunoassay) 방식, 즉 항원-항체 반응 방식으로 실시될 수 있다. 이 경우, 상술한 본 발명의 마커에 특이적으로 결합하는 항체 또는 앱타머를 이용하여 실시된다.
본 발명에서 이용되는 항체는 폴리클로날 또는 모노클로날 항체이며, 바람직하게는 모노클로날 항체이다.
이러한 면역분석은 종래에 개발된 다양한 정량적 또는 정성적 면역분석 프로토콜에 따라 실시될 수 있다. 상기 면역분석 포맷은 방사능면역분석, 방사능면역침전, 면역침전, 면역조직화학염색, ELISA(enzyme-linked immunosorbent assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 유세포 분석(flow cytometry), 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석 또는 면역염색의 방법은 Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay(ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; 및 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다.
예를 들어, 본 발명의 방법이 방사능면역분석 방법에 따라 실시되는 경우, 방사능동위원소(예컨대, C14, I125, P32 및 S35)로 레이블링된 항체가 본 발명의 마커 분자를 검출하는 데 이용될 수 있다.
본 발명의 방법이 ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시예는 (a) 분석하고자 하는 미지의 세포 시료 분해물을 고체 기질의 표면에 코팅하는 단계; (b) 일차항체로서의 마커에 대한 항체와 상기 세포 분해물을 반응시키는 단계; (c) 상기 단계 (b)의 결과물을 효소가 결합된 이차항체와 반응시키는 단계; 및 (d) 상기 효소의 활성을 측정하는 단계를 포함한다.
상기 고체 기질로 적합한 것은 탄화수소 폴리머(예컨대, 폴리스틸렌 및 폴리프로필렌), 유리, 금속 또는 젤이며, 가장 바람직하게는 마이크로타이터 플레이트이다.
상기 이차항체에 결합된 효소는 발색반응, 형광반응, 발광반응 또는 적외선 반응을 촉매하는 효소를 포함하나, 이에 한정되지 않으며, 예를 들어, 알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제, 루시퍼라아제 및 사이토크롬 P450을 포함한다. 상기 이차항체에 결합하는 효소로서 알칼린 포스파타아제가 이용되는 경우에는, 기질로서 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphthol-AS-B1-phosphate) 및 ECF(enhanced chemifluorescence)와 같은 발색반응 기질이 이용되고, 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl and pyrocatechol), TMB(tetramethylbenzidine), ABTS(2,2‘-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌, 글루코스 옥시다아제와 t-NBT(nitroblue tetrazolium) 및 m-PMS(phenzaine methosulfate)과 같은 기질이 이용될 수 있다.
본 발명의 방법이 캡처-ELISA 방식으로 실시되는 경우, 본 발명의 특정 실시예는 (a) 포획항체(capturing antibody)로서 본 발명의 마커에 대한 항체를 고체 기질의 표면에 코팅하는 단계; (b) 포획항체와 시료를 반응시키는 단계; (c) 상기 단계 (b)의 결과물을 시그널을 발생시키는 레이블이 결합되어 있고, 본 발명의 돌연변이 단백질에 특이적으로 반응하는 검출항체(detecting antibody)와 반응시키는 단계; 및 (d) 상기 레이블로부터 발생하는 시그널을 측정하는 단계를 포함한다.
상기 검출 항체는 검출 가능한 시그널을 발생시키는 레이블을 가지고 있다. 상기 레이블은 화학물질(예컨대, 바이오틴), 효소(알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제 및 사이토크롬 P450), 방사능물질((예컨대, C14, I125, P32 및 S35), 형광물질(예컨대, 플루오레신), 발광물질, 화학발광물질( chemiluminescent) 및 FRET(fluorescence resonance energy transfer)을 포함하나, 이에 한정되는 것은 아니다. 다양한 레이블 및 레이블링 방법은 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있다.
상기 ELISA 방법 및 캡처-ELISA 방법에서 최종적인 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 이러한 시그널이 검출은 본 발명의 마커의 정성적 또는 정량적 분석을 가능하게 한다. 만일, 레이블로서 바이오틴이 이용된 경우에는 스트렙타비딘으로, 루시퍼라아제가 이용된 경우에는 루시페린으로 시그널을 용이하게 검출할 수 있다.
본 발명의 다른 구현 예에 따르면, 항체 대신에 본 발명의 마커에 특이적으로 결합하는 앱타머를 이용할 수 있다. 앱타머는 올리고핵산 또는 펩타이드 분자이며, 앱타머의 일반적인 내용은 Bock LC et al., Nature 355(6360):5646(1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med . 78(8):42630(2000); Cohen BA, Colas P, Brent R . "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24):142727(1998)에 상세하게 개시되어 있다.
상술한 면역분석 과정에 의한 최종적인 시그널의 세기를 분석함으로써, 근위축성측삭경화증을 진단할 수 있다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 근위축성측삭경화증에 대한 마커로서 RAPGEF2, IFT80, SSH2, XRCC3, SPAG17, PLEKHM2, CLEC4C, FRAS1, ADGRL3, PSEN1 돌연변이 유전자 및 상기 유전자에 의해 코딩되는 돌연변이 단백질과 이를 이용한 근위축성측삭경화증의 진단 방법을 제공한다.
(b) 본 발명의 근위축성측삭경화증 마커는 한국인 ALS 환자로부터 발견한 새로운 변이로서 종전에 보고된 데이터베이스에서 0.1 % 미만의 빈도로 나타난 매우 드문 변이이거나 보고된 바 없는 변이이며, 정상 대조군에서는 발견되지 않는 변이이다.
(c) 본 발명에서 발견한 돌연변이 유전자 및/또는 이로부터 코딩되는 돌연변이 단백질은 ALS의 유전학적 원인을 밝히고 ALS를 진단하는데 매우 유용하게 사용될 수 있다.
(d) 본 발명에서 발견한 돌연변이 유전자 및/또는 이로부터 코딩되는 돌연변이 단백질에 대하여 유전자 또는 단백질 검사를 실시함으로써 근위축성측삭경화증을 조기 진단할 수 있으며, 그에 따라 최근 개발되고 있는 치료방법을 조기에 적용하여 치료효과를 극대화할 수 있고, 나아가 정확한 병인에 따른 맞춤치료를 가능하게 할 수 있다.
도 1은 sALS 트리오-7에서 PSEN1 유전자의 신규 변이(de novo variant)(c.497T>C; p.Leu166Pro)를 분석한 결과이다.
a. c.497T>C (p.Leu166Pro)를 나타내는 발단자(proband) 및 부모의 엑솜 시퀀싱 결과. PSEN1 c.497T>C 변이는 발단자의 전체 판독 결과 중 46%(37/81)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 PSEN1 유전자 시퀀싱 결과, 뉴클레오타이드 위치 497에서 T-에서-C로 이형접합 치환이 나타남.
도 2는 sALS 트리오-2에서 FRAS1 유전자의 신규 변이(c.8393C>T; p.Ala2798Val)를 분석한 결과이다.
a. c.8393C<T (p.Ala2798Val)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. FRAS1 c.8393C>T 변이는 발단자의 전체 판독 결과 중 49%(26/53)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 FRAS1 유전자 시퀀싱 결과, 뉴클레오타이드 위치 8393에서 C-에서-T로 이형접합 치환이 나타남.
도 3은 sALS 트리오-3에서 RAPGEF2 유전자의 신규 변이(c.4069G>A; p.Glu1357Lys)를 분석한 결과이다.
a. c.4069G>A (p.Glu1357Lys)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. RAPGEF2 c.4069G>A 변이는 발단자의 전체 판독 결과 중 52%(25/48)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 RAPGEF2 유전자 시퀀싱 결과, 뉴클레오타이드 위치 4069에서 G-에서-A로 이형접합 치환이 나타남.
도 4는 sALS 트리오-4에서 CLEC4C 유전자의 신규 변이(c.629_631delAGA; p.Lys210del)를 분석한 결과이다.
a. c.629_631delAGA (p.Lys210del)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. CLEC4C c.629_631delAGA 변이는 발단자의 전체 판독 결과 중 53%(64/122)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 CLEC4C 유전자 시퀀싱 결과, 뉴클레오타이드 위치 629-631에서 이형접합 AGA 결손이 나타남.
도 5는 sALS 트리오-8에서 PLEKHM2 유전자의 신규 변이(c.1921+6C>T)를 분석한 결과이다.
a. c.1921+6C>T를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. PLEKHM2 c.1921+6C>T 변이는 발단자의 전체 판독 결과 중 54%(13/24)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 PLEKHM2 유전자 시퀀싱 결과, 뉴클레오타이드 위치 1921+6에서 C-에서-T로 이형접합 치환이 나타남.
도 6은 sALS 트리오-11에서 SSH2 유전자의 신규 변이(c.1408G>T; p.Glu470*)를 분석한 결과이다.
a. c.1408G>T (p.Glu470*)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. SSH2 c.1408G>T 변이는 발단자의 전체 판독 결과 중 35%(42/120)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 SSH2 유전자 시퀀싱 결과, 뉴클레오타이드 위치 1408에서 G-에서-T로 이형접합 치환이 나타남.
도 7은 sALS 트리오-12에서 SPAG17 유전자의 신규변이(c.2815G>T; p.Ala939Ser) 및 XRCC3 유전자의 신규변이(c.598G>A; p.Val200Ile)를 분석한 결과이다.
a. SPAG17 유전자에서 c.2815G>T (p.Ala939Ser)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. SPAG17 c.2815G>T 변이는 발단자의 전체 판독 결과 중 49%(60/122)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 SPAG17 유전자 시퀀싱 결과, 뉴클레오타이드 위치 2815에서 G-에서-T로 이형접합 치환이 나타남. c. XRCC3 유전자에서 c.598G>A (p.Val200Ile)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. XRCC3 c.598G>A 변이는 발단자의 전체 판독 결과 중 50%(17/34)였으며, 이는 대립형질의 이형접합을 의미함. d. 발단자에서 XRCC3 유전자 시퀀싱 결과, 뉴클레오타이드 위치 598에서 G-에서-A로 이형접합 치환이 나타남.
도 8은 sALS 트리오-13에서 IFT80 유전자의 신규 변이(c.595G>A; p.Val199Ile)를 분석한 결과이다.
a. c.595G>A (p.Val199Ile)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. IFT80 c.595G>A 변이는 발단자의 전체 판독 결과 중 48%(62/130)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 IFT80 유전자 시퀀싱 결과, 뉴클레오타이드 위치 595에서 G-에서-A로 이형접합 치환이 나타남.
도 9는 sALS 트리오-15에서 ADGRL3 유전자의 신규 변이(c.715A>G; p.Ser239Gly)를 분석한 결과이다.
a. c.715A>G (p.Ser239Gly)를 나타내는 발단자 및 부모의 엑솜 시퀀싱 결과. ADGRL3 c.715A>G 변이는 발단자의 전체 판독 결과 중 48%(69/145)였으며, 이는 대립형질의 이형접합을 의미함. b. 발단자에서 ADGRL3 유전자 시퀀싱 결과, 뉴클레오타이드 위치 715에서 A-에서-G로 이형접합 치환이 나타남.
도 10은 184명의 sALS 환자에서 RAPGEF2 유전자의 두 개 변이를 나타낸 결과이다.
a. 코돈 628(c.1883C>T, p.Thr628Ile)에서 C에서 T로의 치환을 나타내는 변이 부위에 대한 엑솜 시퀀싱 결과. 변이는 발단자 HS-374의 전체 판독 결과 중 49%(5919/12010)였으며, 이는 대립형질의 이형접합을 의미함. b. RAPGEF2 유전자에서 c.1883C>T의 시퀀싱 크로마토그램. c. 코돈 1098(c.3293G>A, p.Arg1098His)에서 G에서 A로의 치환을 나타내는 변이 부위에 대한 엑솜 시퀀싱 결과. 변이는 발단자 HS-477의 전체 판독 결과 중 48%(1379/2855)였으며, 이는 대립형질의 이형접합을 의미함. d. RAPGEF2 유전자에서 c.3293G>A의 시퀀싱 크로마토그램.
도 11은 RAPGEF2 유전자에서 분석된 변이에 대한 모식도이다.
CAP_ED, 전사인자 CAP 패밀리의 이펙터 도메인; REM, Ras 익스체인저 모티프; PDZ_시그널링, PDZ 도메인; RasGEF, Ras-유사 스몰 GTPase에 대한 구아닌 뉴클레오타이드 교환 인자.
도 12는 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 RAPGEF2 유전자의 조직 발현 레벨을 측정한 결과이다.
도 13은 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 IFT80 유전자의 조직 발현 레벨을 측정한 결과이다.
도 14는 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 SSH2 유전자의 조직 발현 레벨을 측정한 결과이다.
도 15는 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 SPAG17 유전자의 조직 발현 레벨을 측정한 결과이다.
도 16은 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 XRCC3 유전자의 조직 발현 레벨을 측정한 결과이다.
도 17은 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 PLEKHM2 유전자의 조직 발현 레벨을 측정한 결과이다.
도 18은 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 FRAS1 유전자의 조직 발현 레벨을 측정한 결과이다.
도 19는 TiGER(Tissue-specific Gene Expression and Regulation, http://bioinfo.wilmer.jhu.edu/tiger/)로부터 채택된 ADGRL3 유전자의 조직 발현 레벨을 측정한 결과이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
재료 및 방법
1. 대상
1) sALS 트리오
한양대학교 신경과 ALS 클리닉을 방문한 15명의 ALS 환자 및 그들의 부모가 2013년 1월부터 ALS 트리오 연구에 포함되었다. 모든 환자는 한국 태생이었다. 임상 진단을 위해 각 환자에 대하여 근전도검사, 임상검사 및 적합한 이미징 방법을 포함하는 신경학적 평가를 실시하였다. 모든 ALS 환자는 신경근 질환을 전공한 신경과 전문의에 의해 진단되었으며, 개정된 El Escorial 진단기준에 부합하는 것을 확인하였다(32, 113). ALS 트리오 연구에는 ALS가 확실한 환자 5명, ALS 일 것으로 예측되는 환자 8명, PLS 플러스 1명 및 퓨어(pure) LMND(lower motor neuron disease) 1명이 포함되었다. ALS 스펙트럼으로 여겨지지 않는 척수성근위축(spinal muscular atrophy), 케네디 증후군(Kennedy syndrome), 일지성 근위축(monomelic atrophy), 히라야마 증후군(Hirayama syndrome) 및 다초점운동신경병증(multifocal motor neuropathy)과 같은 상태로 진단된 환자들은 본 연구에서 제외되었다. 후속조치(follow-up) 동안 치료 또는 질병 진행에 대한 반응을 객관적으로 평가하기 위해 ALSFRS-R을 이용하여 의사가 진단을 위한 기능손상 정도를 판단하였다. ALSFRS-R에는 언어능력, 타액분비, 삼킴, 필체, 음식 자르기 및 기구이용(위루형성술 시행 또는 미시행), 드레싱 및 위생, 침대에서 회전 및 이부자리 조정, 걷기, 계단 오르기, 호흡곤란, 좌위호흡(orthepnea) 및 호흡부전을 평가하는 12개 질문이 포함된다. 각 항목에 대한 점수는 0에서 48 사이의 점수를 내기 위해 총합을 구했다. 진행율은 ΔFS(진단시기에서의 48-ALSFRS-R/발병에서 진단까지의 시간)으로 계산하였으며, 환자를 세 그룹[느림(컷-오프 값 < 0.66), 중간(0.66-1.00), 및 빠름(>1.00)]으로 나누는데 사용하였다. 임상 보고서에는 척추 및 연수 수준에서 상위 및 하위운동뉴런 손상에 대한 징후가 포함되었다. 산발성 ALS는 발단자가 진행형 상위 또는 하위운동뉴런 손상과 같은 징후를 나타내는 경우 및 같은 혈통에서 임상적으로 영향을 받는 가족력을 갖지 않는 경우로 정의되었다. 본 연구는 한양대학교 병원(#HYI-10-01-3) 및 삼성서울병원(#2013-04-131-002)의 기관윤리심의위원회로부터 승인을 받아 진행하였으며, 참가자들은 승인된 연구 프로토콜에 대하여 동의서를 작성하였다. 본 발명자들은 SOD1 유전자에 대하여 사전 스크리닝을 실시하였으며, 모든 발단자에게서 병리학적 변이가 발견되지 않았다.
2) 유효성 확인 세트(validation set)
서울 한양대학교 병원의 신경과 ALS 클리닉을 방문한 184명의 ALS 환자는 유효성 확인 세트로 ALS 트리오 연구에 포함되었다. 모든 ALS 환자는 가능성 또는 명확한 ALS 기준을 충족하는 개정된 El Escorial 진단기준에 따라 신경근 질환을 전공한 신경과 전문의에 의해 진단되었다. 환자들에 대하여 SOD1 유전자에 대한 사전 스크리닝을 실시하였으며, 병리학적 변이는 발견되지 않았다. 부모에 대한 정보는 본 연구의 시작 전에 입수하였다.
2. 분자유전학 테스트
1) 전체 엑솜 시퀀싱
지노믹 DNA(gDNA)는 Wizard 지노믹 DNA 정제 키트(Promega, Madison, WI)를 이용하여 제조사의 지시에 따라 말초 혈액 백혈구로부터 분리하였다. 1% 아가로오스 젤 전기영동 및 PicoGreen®dsDNA Assay(Invitrogen, Life Technologies, Waltham, MA)를 통해 DNA를 확인하였다. 가능한 한 DNA는 OD 260/280 비율이 1.8-2.0으로 온전한 상태여야 한다. SureSelect 시퀀싱 라이브러리는 The Bravo automated liquid handler를 포함하는 Agilent SureSelect all Exon kit 50Mb (Agilent, Santa Clara, CA)를 이용하여 제조사 지시에 따라 준비하였다. 사용률 10%, 강도 5, 버스트 200 당 사이클, 및 4℃에서 360초 동안 모드 주파수 회전(mode frequency sweeping)으로 세팅된 Covaris-S2 instrument (Covaris, Woburn, MA)를 이용하여 120 ㎕ EB 버퍼에 녹인 3 ㎍의 지노믹 DNA를 150 bp의 사이즈로 절단하였다. 절단 효율은 DNA1000 칩(Bioanalyzer, Agilent)의 모세관 전기영동을 통해 평가하였다. 제조사의 프로토콜(Agilent)에 따라 시퀀싱 어댑터를 DNA 단편에 결합시켰다. DNA에 결합시킨 어댑터는 PCR을 이용하여 증폭하였다. PCR 산물의 질(quality)은 모세관 전기영동(Bioanalyzer, Agilent)을 통해 평가하였다. 혼성화 버퍼를 만들기 위해 SureSelect hyb #1, #2, #3, 및 #4 시약(Agilent)을 혼합하였다. 증폭된 DNA 단편은 3.4 ㎕에 750 ng가 되도록 농축하였다. SureSelect block #1, #2, 및 #3 시약(Agilent)을 750 ng의 DNA에 첨가하였다. 혼성화 버퍼 및 DNA 블로커 믹스는 유전자 증폭기를 이용하여 95℃에서 5분, 그 다음 65℃에서 10분간 배양하였다. RNase 블록(Agilent)을 SureSelect 올리고 캡처 라이브러리(Agilent)에 첨가하였다. 캡처 라이브러리는 65℃에서 2분간 배양하였다. 먼저 혼성화 버퍼, 그 다음 DNA 블로커 믹스를 캡처 라이브러리에 첨가하고, 유전자 증폭기를 이용하여 혼합물을 65℃에서 24시간 배양하였다. 50 ㎖ 스트렙타비딘이 코팅된 Dynal MyOne Streptavidin T1 (Invitrogen)을 200 ㎖ SureSelect 바인딩 버퍼(Agilent)로 3회 세척한 다음, 200 ㎕ 바인딩 버퍼에 재부유시켰다. 혼성화 혼합물을 비드 부유물에 첨가하고 상온에서 믹싱하면서 30분간 배양하였다. 상온에서 15분간 500 ㎕ SureSelect 세척 버퍼 #1 (Agilent)로 비드를 세척한 다음, 65℃에서 10분간 500 ㎕ SureSelect 세척 버퍼 #2 (Agilent)로 3회 세척하였다. 30 ㎕ 물로 상온에서 5분간 DNA를 용출하였다. 반응물은 AMPure XP 비드(Beckman Coulter, Brea, CA)로 정제하였다. Herculase II Fusion DNA Polymerase(Finnzymes, Life Technologies)를 이용하여 인덱스 태그를 첨가하기 위해 캡처한 라이브러리를 증폭하였다. 증폭한 라이브러리의 질(quality)는 모세관 전기영동(Bioanalyzer, Agilent)을 통해 평가하였다. SYBR Green PCR 마스터 믹스(Applied Biosystems, Life Technologies)를 이용하여 QPCR를 실시한 다음, 풀(pool)에서 등몰 농도(equimolar amounts)로 태깅된 6 라이브러리들을 결합하였다. 클러스터 형성은 cBot automated cluster generation system (illumine, San Diego, CA)을 이용하였으며 HiSeq 2500 시퀀싱 시스템(illumina)을 이용하여 단위 길이 2x100 bp로 시퀀싱을 실시하였다.
2) 생물정보학 분석
판독 결과는 Burrows-Wheeler Aligner(BWA) 0.7.10을 이용하여 GRCh37/hg19 빌드에 맵핑하였다(114). Picard-tools 1.114는 중복 판독(duplicate reads)을 표시하기 위해 사용하였다(http://picard.sourceforge.net/). GATK(v3.2-2) IndelRealigner는 삽입/결실(indel) 위치 주변의 판독 결과를 조정하기 위해 사용하였다. 판독 결과의 질은 GATK BaseRecalibrator를 이용하여 측정하였다. 유전자형은 GATK HaplotypeCaller에 의해 모든 샘플에 대하여 동시에 생성되었다. 변이 퀄리티 스코어 조정은 GATK VariantRecalibrator를 이용하여 실시하였으며, 99.7 truth sensitivity level로 필터링하였다. 희귀 변이를 확인하기 위해 dbSNP141트, NHLBI 엑솜 시퀀싱 프로젝트(http://evs.gs.washington.edu/EVS/) 및 1000 지놈 프로젝트(http://www.1000genomes.org/)를 확인하였다. 변이의 명명(annotation)은 인-하우스 커스텀-메이드 스크립트를 이용하여 실시하였다(표 1).
전체 엑솜 시퀀싱에 대한 생물정보학 분석 파이프라인
분석 툴
Fastq quality control NGSQCToolkit_v2.3.3
Alignment BWA-0.7.10 mem, Picard-tools-1.114/AddOrReplaceReadGroups.jar
Remove duplicate Picard-tools-1.114/MarkDuplicates.jarPicard-tools-1.114/FixMateInformation.jar
Realignment GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T RealignerTargetCreatorGenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T IndelRealigner
Recalibration GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T BaseRecalibratorGenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T PrintReads
Variant/Genotype calling(gVCF method) GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T HaplotypeCaller
Filtering GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T VariantRecalibratorGenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar -T ApplyRecalibration sensitivity 99.7 cutoff
Annotation In-house perl script annotation
3) 필터링 기준
모든 발단자에 대하여 ALS 감별진단을 위해 기존에 알려진 ALS 및 FTD 원인 유전자 또는 관련 유전자, HSP 및 감별을 요하는 다른 질병 유전자의 돌연변이를 먼저 스크리닝하였다(표 2-5). 기존에 알려진 병원성 변이를 확인하기 위해 인간 유전자 돌연변이 데이터베이스(HGMD®2014.1Proversion)에 대한 변이 리스트를 비교하였다.
신규 변이는 부모가 참조서열(reference sequence)에 대하여 동형접합(homozygous)이고, 발단자는 이형접합(heterozygous)인 것으로 확인하였다. 본 발명자들은 dbSNP141 데이터베이스, 1000 지놈 프로젝트 및 엑솜 변이 서버에서 확인된 0.01 미만의 대립 유전자 빈도를 갖는 변이들을 희귀 변이로 선택하였다.
또한, 본 연구에서 발견된 변이들을 인종이 일치하는 100명의 정상 대조군과 비교하였다. 정상 대조군 데이터는 한국 질병관리본부로부터 지원받은 한국인 지놈 분석 프로젝트(4845-301), 한국인 지놈 및 역학 연구(4851-302) 및 한국인 바이오뱅크 프로젝트(4851-307, KBP-2014-031)에서 제공받았다. 이에 더해 본 연구에서 발견된 변이를 자체 질병 대조군인 75명의 ALS가 아닌 환자의 엑솜 데이터와 비교하였다.
ALS 및 FTD 원인 유전자
표현형 유전자 RefSeq 유전자 설명 염색체 위치 유전형식
ALS SPG11 NM_025137.3 Spastic paraplegia 11 15q14 AR
ALS VAPB NM_004738.4 VAMP (vesicle-associated membrane protein)-associated protein B and C 20q13.3 AD
ALS ALS2 NM_020919.3 Amyotrophic lateral sclerosis 2 2q33.1 AD
ALS ANG NM_001145.4 Angiogenin, ribonuclease, RNase A family, 5 14q11.1 AD
ALS DAO NM_001917.4 D-amino-acid oxidase 12q24 AD
ALS FIG4 NM_014845.5 FIG4 phosphoinositide 5-phosphatase 6q21 AD
ALS OPTN NM_021980.4 Optineurin 10p13 AD
ALS SETX NM_015046.5 Senataxin 9q34.13 AD
FTD MAPT NM_005910.5 Microtubule-associated protein tau 17q21.1 AD
FTD PSEN1 NM_000021.3 Presenilin-1 14q24.3 AD
FTD PSEN2 NM_000447.2 Presenilin-2 1q42.13 AD
FTD TARDBP NM_007375.3 TAR DNA binding protein 1p36.22 AD
FTD TREM2 NM_018965.2 Triggering receptor expressed on myeloid cells 2 6p21.1 AR
ALS/FTD FUS NM_004960.3 FUS RNA binding protein 16p11.2 AD
ALS/FTD GRN NM_002087.2 Granulin 17q21.32 AD
ALS/FTD SIGMAR1 NM_005866.2 Sigma non-opioid intracellular receptor 1 9p13.3 AD/AR
ALS/FTD SOD1 NM_000454.4 Superoxide dismutase 1 21q22.11 AD
ALS/FTD SQSTM1 NM_003900.4 Sequestosome 1 5q35 AD
ALS/FTD TAF15 NM_139215.2 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor 17q11.1-q11.2 AD
ALS/FTD TARDBP NM_007375.3 TAR DNA binding protein 1p36.22 AD
ALS/FTD UBQLN2 NM_013444.3 Ubiquilin 2 Xp11.21 X-linked
ALS/FTD VCP NM_007126.3 Valosin-containing protein 9p13.3 AD
ALS 및 FTD 관련 유전자
표현형 유전자 RefSeq 유전자 설명 염색체 위치 참고문헌
ALS APEX1 NM_001641.3 APEX nuclease (multifunctional DNA repair enzyme) 1 14q11.2-q12 (115)
ALS ARHGEF28 NM_001080479.2 Rho guanine nucleotide exchange factor (GEF) 28 5q13.2 (116)
ALS ERBB4 NM_005235.2 Erb-b2 receptor tyrosine kinase 4 2q33.3-q34 (117)
ALS EWSR1 NM_001163285.1 Ewing sarcoma breakpoint region 1 22q12.2 (118)
ALS NEFH NM_021076.3 Neurofilament, heavy polypeptide (200 kDa) 22q12.2 (119)
ALS PFN1 NM_005022.3 Profilin 1 17p13.3 (69)
ALS PON1 NM_000446.5 Paraoxonase 1 7q21.3 (120)
ALS PON2 NM_000305.2 Paraoxonase 2 7q21.3 (120)
ALS PON3 NM_000940.2 Paraoxonase 3 7q21.3 (120)
ALS PRPH NM_006262.3 Peripherin 12q12-q13 (121)
ALS SRCAP NM_006662.2 Snf2-related CREBBP activator protein 16p11.2 (110)
ALS SS18L1 NM_198935.1 Synovial sarcoma translocation gene on chromosome 18-like 1 20q13.3 (122)
ALS CHRNA4 NM_000744.6 Acetylcholine receptor, neuronal nicotinic, alpha-4 subunit 20q13.2-q13.3 (123)
ALS/FTD CHMP2B NM_014043.3 Chromatin modifying protein 2B 3p11.2 (124)
ALS/FTD DCTN1 NM_004082.4 Dynactin 1 2p13 (125)
ALS/FTD HNRNPA1 NM_031157.2 Heterogeneous nuclear ribonucleoprotein A1 12q13.1 (72)
ALS/FTD HNRNPA2B1 NM_031243.2 Heterogeneous nuclear ribonucleoprotein A2/B1 7p15 (72)
ALS의 감별진단을 위한 HSP 원인 유전자
표현형 유전자 Locus name 유전자 설명 염색체 위치 유전형식
Uncomplicated HSP ATL1 SPG3A Atlastin GTPase 1 14q22.1 AD
Uncomplicated HSP SPAST SPG4 Spastin 2p24-p21 AD
Uncomplicated HSP NIPA1 SPG6 Non-imprinted in Prader-Willi / Angelman syndrome 1 15q11.2 AD
Uncomplicated HSP KIAA0196 SPG8 KIAA0196 8q24.13 AD
Uncomplicated HSP KIF5A SPG10 Kinesin family member 5A 12q13.13 AD
Uncomplicated HSP RTN2 SPG12 Reticulon 2 19q13.32 AD
Uncomplicated HSP HSPD1 SPG13 Heat shock protein 60kDa protein1 (chaperonin) 2q33.1 AD
Complicated HSP BSCL2 SPG17 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 11q13 AD
Uncomplicated HSP REEP1 SPG31 Receptor accessory protein 1 2p11.2 AD
Uncomplicated HSP ZFYVE27 SPG33 Zinc finger, FYVE domain containing 27 10q24.2 AD
Uncomplicated HSP SLC33A1 SPG42 Solute carrier family 33 (acetyl-CoA transporter), member 1 3q25.31 AD
Uncomplicated HSP CYP7B1 SPG5A Cytochrome P450, family 7, subfamily B, polypeptide 1 8q21.3 AR
Uncomplicated HSP SPG7 SPG7 Spastic paraplegia 7 16q24.3 AR
Uncomplicated HSP SPG11 SPG11 Spastic paraplegia 11 15q14 AR
Complicated HSP ZFYVE26 SPG15 Zinc finger, FYVE domain containing 26 14q24.1 AR
Complicated HSP ERLIN2 SPG18 ER lipid raft associated 2 8p11.2 AR
Complicated HSP SPG20 SPG20 Spastic paraplegia 20 13q13.3 AR
Complicated HSP SPG21 SPG21 Spastic paraplegia 21 15q22.31 AR
Complicated or uncomplicated HSP DDHD1 SPG28 DDHD domain containing 1 14q21 AR
Complicated HSP KIF1A SPG30 Kinesin family member 1A 2q37.3 AR
Complicated HSP FA2H SPG35 Fatty acid 2-hydroxylase 16q23 AR
Complicated HSP PNPLA6 SPG39 Patatin-like phospholipase domain containing 6 19p13.2 AR
Complicated HSP GJC2 SPG44 Gap junction protein, gamma 2 1q42.13 AR
Complicated HSP GBA2 SPG46 Glucosidase, beta (bile acid) 2 9p13.3 AR
Complicated HSP AP4B1 SPG47 Adaptor-related protein complex 4, beta 1 subunit 1p13.2 AR
Uncomplicated HSP AP5Z1 SPG48 Adaptor-related protein complex 5, zeta 1 subunit 7p22.2 AR
Complicated HSP TECPR2 SPG49 Tectonin beta-propeller repeat-containing 2 14q32.31 AR
Complicated HSP AP4M1 SPG50 Adaptor-related protein complex 4, mu 1 subunit 7q22.1 AR
Complicated HSP AP4E1 SPG51 Adaptor-related protein complex 4, epsilon 1 subunit 15q21.2 AR
Complicated HSP AP4S1 SPG52 Adaptor-related protein complex 4, sigma 1 subunit 14q12 AR
Complicated HSP VPS37A SPG53 Vacuolar protein sorting 37 homolog A 8p22 AR
Complicated HSP DDHD2 SPG54 DDHD domain containing 2 8p11.23 AR
Complicated HSP CYP2U1 SPG56 Cytochrome P450, family 2, subfamily U, polypeptide 1 4q25 AR
Complicated HSP GAD1 N/A Glutamate decarboxylase 1 2q31 AR
Complicated HSP L1CAM SPG1 L1 cell adhesion molecule Xq28 X-linked
Complicated HSP PLP1 SPG2 Proteolipid protein 1 Xq22 X-linked
Complicated HSP SLC16A2 SPG22 Solute carrier family 16, member 2 Xq13.2 X-linked
* 약자: AD, 상염색체 우성(autosomal dominant); AR, 상염색체 열성(autosomal recessive); N/A, 해당없음.
ALS의 감별진단을 위한 다른 질병 관련 유전자
표현형 유전자 유전자 설명 염색체 위치 유전 형식
Hexosaminadase A deficiency HEXA Hexosaminidase A 15q24.1 AR
Adult polyglucosan body disease GBE1 Glucan (1,4-alpha-), branching enzyme 1 3p12.3 AR
4) 변이 유효성 평가를 위한 생어(Sanger) 시퀀싱
필터링 기준을 따른 모든 아미노산의 치환을 유발하는 신규 변이는 아버지, 어머니 및 발단자 DNA 샘플에 대한 생어 시퀀싱을 통해 평가하였다. 타겟 유전자의 모든 엑손 및 엑손-인트론 경계는 프라이머를 이용하여 PCR을 통해 증폭하였다(표 6). PCR은 유전자 증폭기 모델 GeneAmp PCR system 9700 (Applied Biosytems, Foster City, CA)을 이용하여 다음의 조건으로 실시하였다: 32사이클로 94℃에서 30초간 변성, 60℃에서 30초간 어닐링 및 72℃에서 30초간 연장. 앰플리콘(5 ㎕)에 2U 쉬림프 알칼라인 포스파타아제 및 10U 엑소누클레아제 I(USB Corp., Cleveland, OH)을 37℃에서 15분간 처리한 다음, 80℃에서 15분간 배양하여 효소를 불활성화시켰다. 사이클 시퀀싱은 ABI 3130xl Genetic Analyzer(Applied Biosystems, Foster City, CA, USA)에서 Big Dye Terminator Cycle Sequencing Ready Reaction kit(Applied Biosystems, Foster City, CA, USA)를 이용하여 실시하였다. 변이의 명명은 GenBank의 참조서열에 따라 명기하였다. 본 발명에서 돌연변이에 대한 표기법은 ATG 개시 코돈의 A에 대응하는 뉴클레오타이드를 +1로 표기하는 인간 게놈 변이 협회(http://www.hgvs.org/mutnomen/)의 권고를 따랐다.
전체 엑솜 시퀀싱에 의해 검출된 변이에 대한 생어 시퀀싱 검증용 프라이머 쌍
유전자 뉴클레오타이드 변이 RefSeq 정방향 역방향
FRAS1 c.8393C>T NM_025074.6 TCCCTAAGTCAGCTATGGGAAG AATTCCATGCTTGGTCTTGG
RAPGEF2 c.4069G>A NM_014247.2 CACCAGAGAAGCTGGGAGAC GCAATGGAGAAAATGAGGAAA
CLEC4C c.629_631delAGA NM_130441.2 TGACCTTGACTTTCGCACTG CCAGCAGTCTCTGGCACATA
PSEN1 c.497T>C NM_000021.3 GGCTTAAGCACGAGAATTGC GCAAGGAGCAACAGAAGAATG
PLEKHM2 c.1921+6C>T NM_015164.2 CTGCTCATGATCCACGTGTT CTTCCTTGGGGTGCCTTT
SSH2 c.1408G>T NM_033389.3 CCATCATCAACACTGGCTGT CACAGGCCTTTCTGATTTGC
SPAG17 c.2815G>T NM_206996.2 AAGGATGACGTCAAGGCTTC GGGGACTCTTCTGTTACTTCTTGG
XRCC3 c.598G>A NM_001100119.1 CAAGGGAACCAGTTGTGTGA TGGTGCTCACCTGGTTGAT
IFT80 c.595G>A NM_020800.2 TGGATGTCTTAGGTGCTAGGTG CTCACTGTGTTGTCCAGGCTAA
ADGRL3 c.715A>G NM_015236.4 TATGCCCTGGACTCCCTACA ATCCCATGTTCCTTCGATCC
5) 인-실리코 분석 및 유전자 우선순위 결정(prioritization)
SIFT(Sorting Intolerant From Tolerant)(126) 및 Polymorphism Phenotyping 2 (PolyPhen-2 v2.2.2)(127, 128) 서버는 단백질 구조, 기능 및 표현형과 서열 보존에 대한 비동일 단일염기 다형성(non-synonymous single nucleotide polymorphism) 치환의 효과를 예측하는데 사용되었다. PolyPhen-2에서 확률적 스코어가 0.85 이상인 경우, 돌연변이는 “손상 예상(probably damaging)”, 0.15 이상인 경우 “손상 가능(possibly damaging)”으로 구분되었다. 남은 돌연변이는 양성(benign)으로 분류하였다. SIFT에서는 특정 아미노산 치환이 미치는 영향을 정규화 확률로 나타내며 스코어가 0.05 이하인 경우 해당 아미노산의 치환이 단백질의 구조에 영향을 미칠 것임을 뜻한다.
신규 변이를 갖는 특정 유전자에 대한 우선순위를 결정하기 위해 ToppGene Prioritization software(129)를 사용하였다. 유전자 리스트는 전사체(유전자 발현), 단백질체(단백질 도메인 및 상호작용), 조절체(regulome)(TFBS 및 miRNA), 온톨로지, 표현형, 및 비블리옴(bibliome)(PubMed literature co-citation)을 기반으로 ALS 기전과 관련하여 기존에 발표된 문헌들과 비교하였다. 결합된 유사지수(similarity scores) 및 p-값은 본 발명에서 후보 유전자들의 우선순위를 결정하는데 사용되었다.
6) RAPGEF2 유전자의 검증
타겟 차세대 시퀀싱(targeted next generation sequencing)을 이용하여 184명의 ALS 환자의 엑손 및 플랭킹 영역에 대한 RAPGEF2 유전자 분석을 실시하였다(표 7). 라이브러리는 illumina Miseq sequencing system (amplicon size 425bp, paired-ends, read length 250 bp, coverage > 5000x)에서 색인, 풀링 및 시퀀싱되었다. 판독 결과는 BWA 0.7.5를 이용하여 GR37/hg19 빌드에 맵핑하였다(114). Picard-tools 1.84는 중복 판독(duplicate reads)을 표시하기 위해 사용하였다(http://picard.sourceforge.net/). 재정렬(realignment) 및 재보정(recalibration)은 GATK RealignerTargetCreator, IndelRealigner, 및BaseRecalibrator을 이용하여 실시하였다. GATK UnifiedGenotyper를 이용하여 모든 샘플에 대한 유전자형을 분석하였다.
엑솜 캡처를 위한 RAPGEF2 유전자의 타겟 위치
염색체 시작 좌표 종료 좌표 길이(bp) 앰플리콘 커버리지
4 160188998 160189367 370 2 100
4 160225494 160225625 132 1 100
4 160235743 160235920 178 1 100
4 160243499 160243635 137 1 100
4 160244611 160244769 159 1 100
4 160250986 160251674 689 3 100
4 160252559 160253873 1315 5 100
4 160259463 160259620 158 1 100
4 160260266 160260506 241 1 100
4 160262716 160263099 384 2 100
4 160264107 160264580 474 2 100
4 160265188 160265211 24 1 100
4 160266258 160266481 224 1 100
4 160267941 160268150 210 1 100
4 160271289 160271441 153 1 100
4 160273837 160274062 226 1 100
4 160274639 160275198 560 3 100
4 160277005 160277310 306 1 100
4 160279266 160281301 2036 7 100
7) MALDI-TOF를 이용한 대조군 연구
나이 및 성별이 일치하는 364명의 건강한 한국인 대조군에 대하여 MALDI-TOF MS(matrix assisted laser desorption/ionization time-of-flight mass spectrometry) 및 본 발명에서 디자인한 프라이머를 이용하여 RAPGEF2 유전자에서 발견된 신규 변이 유무를 스크리닝하였다(표 8). 약 30분 내에 각 38-웰 칩에 처리된 샘플은 MassARRAY Analyzer Compact (Sequenom, San Diego, CA)를 이용하여 분석하였다. 데이터는 SpectroACQUIRE software (Sequenom)를 통해 자동으로 수집되었으며, MassARRAY Typer software의 TrafficLights module에 의해 검토되었다. 각 실험에서 피크 높이에 대한 상세한 정보 및 신호 대 잡음비(signal-to-noise)에 기초한 각 세포에 대한 확률치(probability value) 및 피크 확률 통계는 필요에 따라 각 샘플에 대하여 검토하였다. 이 시스템에서 확률은 자동으로 계산되었으며, 엄격 정도(stringency level)는 conservative, moderate 및 aggressive calls의 3가지 레벨로 분석되었다. Aggressive call은 높은 오차율(<1%)을 보이는 반면, conservative call은 uncalled 유전자형에서 가장 낮은 비율을 나타낸다. 저 확률 콜(calls)은 제외되었다. 필요 시 개별 샘플에 대하여 스펙트럼 데이터를 검토하였다. Cluster Plot software module은 이형(atypical) 이형접합체 및 동형접합체 상태를 가시화하는데 사용되었다.
MALDI-TOF를 이용한 RAPGEF2 변이의 대조군 연구에 사용되는 프라이머 쌍
유전자 뉴클레오타이드 변이 RefSeq 정방향 역방향
RAPGEF2 c.4069G>A NM_014247.2 ACGTTGGATGGACACAGGCACAATAAAGCG ACGTTGGATGAGTCACAGACGTTAGGCTAC
실험결과
1. 분자유전학 분석
1) Q.C 분석 및 엑솜 시퀀싱에 대한 기술통계
Agilent SureSelect all Exon kit 50 Mb(Agilent)를 이용하여 15명의 ALS 발단자 및 그들의 건강한 부모(n=45)에 대한 전체 엑솜 시퀀싱을 실시하였다. 각 개체당 최소 50,000,000 bp의 전체 판독 결과를 얻었다. 염기의 평균 92%가 Phred 스코어 30이상의 높은 품질을 나타냈다. 전체 판독 결과의 99.95%를 참조서열에 맵핑하였다. 15명의 발단자와 그들의 부모로부터 얻은 모든 샘플은 평균 74x 였다. 각 개인에 있어서 타겟 염기의 평균 99%는 적어도 하나의 독립적인 서열 판독에 의해 처리되었고, 91%는 적어도 10개의 독립적인 서열 판독에 처리되었으며, 82.4%는 적어도 20개의 독립적인 서열 판독에 의해 처리되었다(표 9).
기존에 보고된 ALS-FTD 원인 또는 관련 유전자, ALS의 감별진단을 위한 HSP 및 다른 질병 유전자에서 돌연변이는 발견되지 않았다(표 2-5).
엑솜 시퀀싱에 대한 통계 요약
Trio No. Total reads % more than Q30 bases Mapped reads % mapped reads Non-duplicate reads Mean coverage depth % target at 1X % target at 10X % target at 20X
1-P 51,480,912 86.6 51,462,399 99.96 43,389,970 55.3 98.5 88.5 77.7
1-F 65,167,802 86.0 65,139,804 99.95 53,577,017 67.1 98.9 90.7 82.4
1-M 92,465,892 86.5 92,432,848 99.96 64,418,232 82.8 99.0 92.2 85.8
2-P 63,791,280 86.4 63,765,712 99.95 51,913,342 66.4 98.7 90.1 81.6
2-F 53,939,296 89.0 53,917,610 99.95 46,457,814 57.7 98.8 89.6 79.6
2-M 50,089,792 88.6 50,068,431 99.95 44,276,977 56.8 98.6 88.8 78.4
3-P 60,588,212 88.2 60,563,239 99.95 50,151,748 64.1 98.7 90.1 81.3
3-F 53,293,388 88.1 53,270,250 99.95 44,153,932 55.3 98.7 89.2 78.7
3-M 47,072,096 87.9 47,050,572 99.95 41,578,973 52.0 98.7 88.9 77.5
4-P 131,434,474 93.3 131,374,780 99.95 99,643,297 126.4 99.7 95.6 91.5
4-F 94,184,158 93.2 94,147,248 99.96 69,072,547 87.9 99.4 93.6 87.5
4-M 127,543,470 93.4 127,488,235 99.95 97,221,570 122.1 99.7 95.6 91.4
5-P 57,160,108 94.5 57,138,906 99.96 55,255,727 73.0 99.0 91.2 83.3
5-F 80,431,798 94.6 80,401,581 99.96 76,811,873 101.5 99.4 93.5 87.9
5-M 60,087,382 94.2 60,061,780 99.95 57,809,232 73.8 98.8 90 81.8
6-P 49,678,674 93.7 49,659,982 99.96 43,296,585 55.3 98.7 88.6 77.1
6-F 56,020,666 93.7 56,000,999 99.96 51,481,301 66.4 99.0 90.5 81.4
6-M 47,568,954 93.7 47,549,366 99.95 42,956,118 54.6 98.8 89.0 77.5
7-P 50,459,952 93.4 50,436,949 99.95 45,070,379 57.2 98.9 89.5 78.6
7-F 58,692,976 93.4 58,666,334 99.95 54,227,119 69.2 99.2 91.4 83.0
7-M 92,118,690 93.6 92,084,906 99.96 72,622,171 94.9 99.2 92.9 86.6
8-P 53,590,510 92.4 53,571,980 99.96 47,992,562 62.1 98.7 89.2 79.1
8-F 56,093,884 92.5 56,073,138 99.96 50,218,779 65.6 98.8 90.0 80.6
8-M 58,010,996 92.6 57,990,089 99.96 51,785,665 67.1 98.9 90.6 81.7
9-P 50,157,706 89.9 50,107,633 99.90 48,327,117 62.3 98.6 88.9 78.8
9-F 64,748,536 92.5 64,725,656 99.96 57,619,562 73.5 99.0 91.0 82.6
9-M 68,247,826 92.4 68,220,992 99.96 61,297,253 79.5 99.1 91.7 84.3
10-P 66,576,932 93.6 66,544,375 99.95 65,055,775 81.2 99.2 92.2 85.3
10-F 57,288,346 93.5 57,265,630 99.96 55,776,398 70.4 99.0 90.7 82.3
10-M 63,224,312 93.3 63,187,574 99.94 62,259,646 73.6 99.3 91.8 84.3
11-P 54,139,302 90.1 54,086,046 99.90 52,123,490 67.9 98.6 89.5 80.4
11-F 55,080,696 89.9 55,018,427 99.89 52,618,323 67.7 98.7 89.8 80.8
11-M 58,156,702 89.8 58,094,439 99.88 55,931,004 72.3 98.7 90.1 81.7
12-P 70,645,628 91.9 70,619,926 99.96 64,640,898 84.1 99.3 92.0 84.7
12-F 80,572,600 91.1 80,542,081 99.96 69,890,686 90.4 99.4 92.6 85.7
12-M 67,083,856 91.4 67,057,069 99.96 60,763,860 79.6 99.2 91.7 83.9
13-P 59,815,598 93.6 59,792,743 99.96 55,052,338 73.6 98.9 90.2 81.4
13-F 65,585,926 93.0 65,553,902 99.95 60,095,261 75.4 99.2 91.4 83.2
13-M 79,320,916 92.9 79,280,711 99.94 72,390,269 91.7 99.4 92.8 86.2
14-P 60,891,562 93.3 60,863,344 99.95 57,820,449 72.9 99.2 91.2 82.8
14-F 61,485,616 92.9 61,463,752 99.96 55,608,163 73.5 99.0 90.5 81.8
14-M 57,261,444 93.8 57,243,205 99.96 53,229,496 71.0 98.8 89.9 80.8
15-P 66,782,838 92.9 66,761,203 99.96 60,425,805 80.4 99.0 91.1 83.1
15-F 56,780,312 93.2 56,761,259 99.96 52,059,338 70.1 98.9 90.0 80.9
15-M 64,590,202 93.5 64,571,321 99.97 58,806,125 78.9 99.0 91.0 83.0
2) 신규 변이 발생을 포함하는 공지된 병리학적 변이의 발견
본 발명자들은 PSEN1 유전자에서 sALS 트리오-7로부터 기존에 보고된 바 있는 돌연변이 하나를 발견하였다. 이것은 497번째 뉴클레오타이드 위치에서 티민이 시토신으로 치환된 것으로 코돈 166번 위치에서 류신을 아르기닌으로 치환된다; c.497T>C (p.Leu166Pro)(도 1). 발단자에서 PSEN1 c.497T>C의 변이 판독은 전체 판독 결과의 46%(37/81)이며, 이는 대립유전자의 이형접합성을 의미한다. 돌연변이는 생어 시퀀싱을 통한 신규 변이 발생으로 확인되었으며, 발단자에서는 이형접합체가 발견되었고 부모에서는 발견되지 않았다. PSEN1 c.497T>C는 가족성 EOAD(early-onset Alzheimer’s dementia)에서 종전에 보고된 바 있다(130).
3) 신규로 발생한 VUS(variants of unknown significance)의 발견
생어 시퀀싱을 이용하여 변이를 확인 후, 본 발명자들은 8명의 sALS 트리오로부터 9개의 신규 VUS(variants of unknown significance)를 발견하였다(도 2-9). 9개의 신규 VUS 가운데 8개 변이는 엑손 영역에 위치하며 아미노산 서열에 영향을 주는 변이였다. 5명 sALS 트리오로부터 6개의 미스센스 VUS가 발견되었다; FRAS1 c.8393C>T (p.Ala2798Val), RAPGEF2 c.4069G>A (p.Glu1357Lys), SPAG17 c.2815G>T (p.Ala939Ser), XRCC3 c.598G>A (p.Val200Ile), IFT80 c.595G>A (p.Val199Ile), 및 ADGRL3 c.715A>G (p.Ser239Gly). sALS 트리오-12의 발단자는 PAG17 c.2815G>T (p.Ala939Ser) 및 XRCC3 c.598G>A (p.Val200Ile) 두 개의 신규 VUS를 갖는 것으로 나타났다. Inframe deletion인 CLEC4C c.629_631delAGA (p.Lys210del)가 sALS 트리오-4에서 확인되었으며, 넌센스 변이인 SSH2 c.1408G>T (p.Glu470*)가 sALS 트리오-11에서 확인되었다. 넌센스 변이는 mRNA 레벨에서 조기 종결코돈(premature stop codon)을 만들 것으로 예측된다. 나머지는 엑손 경계 근처의 플랭킹 영역에 위치하는 인트론 변이였다(PLEKHM2 c.1921+6C>T).
SIFT 및 PolyPhen-2를 이용한 인-실리코 분석 결과, 4개의 신규 변이는 2개의 테스트 중 적어도 하나에서 유해한 것으로 나타났고, 3개 미스센스 변이는 SIFT 및 PolyPhen-2 모두에서 양성(benign)인 것으로 예측되었다(표 10). 모든 변이의 GEFR++ 스코어는 XRCC3 유전자의 c.598G>A를 제외하고 4 이상이었으며, 이는 해당 변이의 위치가 진화적으로 보존되어 온 것임을 의미한다. 6개 신규 VUS는 dbSNP141, 1000 지놈 프로젝트(전체 및 동아시아인 대립유전자 빈도) 및 ExAC(Exome Aggregation Consortium)에서 발견되지 않았다. 또한, 3개의 신규 VUS인 RAPGEF2 c.4069G>A (p.Glu1357Lys), CLEC4C c.629_631delAGA (p.Lys210del) 및 XRCC3 c.598G>A (p.Val200Ile)는 dbSNP141 데이터베이스에서 rs 번호가 있으면서, 기존의 인구집단을 대상으로 한 데이터베이스 중 하나 이상에서 0.1% 이하의 대립유전자 빈도를 나타내는 것으로 보고된 바 있다. 모든 변이는 인종이 일치하는 100명의 정상 대조군 개체의 외부 한국인 엑솜 데이터 및 자체 질병 대조군에서 발견되지 않았다(표 11).
신규 변이 발생률의 총 빈도는 기존에 보고된 돌연변이 및 VUS를 포함하여 0.6(9/15)이었다.
인-실리코 분석 및 보존성 스코어를 통해 15 sALS 트리오로부터 확인한 신규 변이의 리스트
Trio No. Gene Genomic coordinates (hg38) RefSeq Nucleotide change Amino acid change PolyPhen-2(HumDiv, Probabilistic score) SIFT(Tolerance index) GERP++ score
2 FRAS1 Chr4:78,479,668 NM_025074.6 c.8393C>T p.Ala2798Val Benign(0.347) Tolerated(0.23) 5.59
3 RAPGEF2 Chr4:159,353,947 NM_014247.2 c.4069G>A p.Glu1357Lys Benign(0.092) Tolerated(0.07) 6.17
4 CLEC4C Chr12:7,729,607 NM_130441.2 c.629_631delAGA p.Lys210del N/A N/A N/A
7 PSEN1* Chr14:73,186,869 NM_000021.3 c.497T>C p.Leu166Pro Possibly damaging(0.469) Deleterious(0.01) 5.46
8 PLEKHM2 Chr1: 15,728,363 NM_015164.2 c.1921+6C>T N/A N/A N/A N/A
11 SSH2 Chr17:29,636,741 NM_033389.3 c.1408G>T p.Glu470* N/A N/A 6.16
12 SPAG17 Chr1:118,042,042 NM_206996.2 c.2815G>T p.Ala939Ser Probably damaging(0.999) Deleterious(0.01) 5.23
12 XRCC3 Chr14:103,699,540 NM_001100119.1 c.598G>A p.Val200Ile Benign(0.021) Tolerated(0.66) -7.12
13 IFT80 Chr3:160,357,533 NM_020800.2 c.595G>A p.Val199Ile Benign(0.016) Deleterious(0.00) 5.37
15 ADGRL3 Chr4:61,733,074 NM_015236.4 c.715A>G p.Ser239Gly Probably dagaming(0.991) Deleterious(0.00) 4.04
* 공지된 병리학적 변이
** 약자: N/A, 해당없음.
15 sALS 트리오에서 확인된 신규 변이의 인구집단 내 빈도
TrioNo. Gene RefSeq Nucleotide change Amino acid change rs number Allele frequency External Korean exome data
dbSNP141 1000Genome 1000Genome(EA) ExAC
2 FRAS1 NM_025074.6 c.8393C>T p.Ala2798Val N/A N/A N/A N/A N/A N/A
3 RAPGEF2 NM_014247.2 c.4069G>A p.Glu1357Lys rs200644232 0.0002 0.000 0.000 0.0001 N/A
4 CLEC4C NM_130441.2 c.639_631delAGA p.Lys210del N/A N/A N/A N/A 0.00002 N/A
7 PSEN1* NM_000021.3 c.497T>C p.Leu166Pro rs63750265 N/A N/A N/A N/A N/A
8 PLEKHM2 NM_015164.2 c.1921+6C>T N/A N/A N/A N/A N/A N/A N/A
11 SSH2 NM_033389.3 c.1408G>T p.Glu470* N/A N/A N/A N/A N/A N/A
12 SPAG17 NM_206996.2 c.2815G>T p.Ala939Ser N/A N/A N/A N/A N/A N/A
12 XRCC3 NM_001100119.1 c.598G>A p.Val200Ile rs531332562 0.0004 N/A N/A 0.00005 N/A
13 IFT80 NM_020800.2 c.595G>A p.Val199Ile N/A N/A N/A N/A N/A N/A
15 ADGRL3 NM_015236.4 c.715A>G p.Ser239Gly N/A N/A N/A N/A N/A N/A
* 기존에 보고된 돌연변이
** 약자: N/A, 해당없음. EA, 동아시아인; ExAC, Exome Aggregation Consortium.
3) 유전자 우선순위 결정
인간 유전자 주석 및 문헌과 마우스 표현형 데이터를 결합한 ToppGene 소프트웨어를 이용하여 후보 유전자를 평가하였다(129). 트레이닝 유전자 세트로서 표 2에 기재된 22개의 ALS-FTD 원인 유전자와 테스트 유전자 세트로서 신규 VUS가 발견된 9개 유전자를 이용하여 분석을 실시하였다. 분석 결과에 따르면, RAPGEF2 유전자는 p-값 0.05 이하로 기존에 알려진 ALS-FTD 유전자와 높은 관련성을 보였다. 특히, 기존에 알려진 ALS-FTD 유전자와 RAPGEF2 유전자는 생물학적 기전 및 발현 부위가 통계적으로 유의한 연관성을 보였다 (p-값은 모두 < 0.05)(표 12). 따라서, 본 발명자들은 RAPGEF2 유전자에 초점을 맞추기로 하였다.
ToppGene을 이용한 신규 변이의 우선순위(129)
순위 유전자 Molecular Function(p-value) Biological Process(p-value) Cellular Component(p-value) Pathway (p-value) Pubmed (p-value) Gene Family(p-value) Coexpre-ssion(p-value) Disease (p-value) Average Score Overall(p-value)
1 RAPGEF2 0.017005 0.007194 0.011118 0.501635 0.139961 0.146501 0.007848 0.18705 0.304168 0.003722
2 IFT80 0.576194 0.142577 0.094833 0.23414 0.192283 0.499673 0.51537 0.00327 0.201703 0.076533
3 SSH2 0.104644 0.104644 0.18378 0.501635 0.132112 0.146501 0.51537 0.18705 0.167025 0.146642
4 XRCC3 0.576194 0.158273 0.140615 0.501635 0.06998 0.146501 0.51537 0.503597 0.160944 0.222278
5 SPAG17 0.576194 0.670373 0.080445 0.23414 0.621321 0.146501 0.51537 0.503597 0.071555 0.316402
6 PLEKHM2 0.104644 0.282538 0.338784 0.501635 0.219751 0.146501 0.51537 0.18705 0.062085 0.334397
7 CLEC4C 0.576194 0.223022 0.262263 0.23414 0.621321 0.499673 0.51537 0.18705 0.07439 0.378598
8 FRAS1 0.576194 0.321779 0.197515 0.23414 0.621321 0.146501 0.51537 0.503597 0.106461 0.397609
9 ADGRL3 0.576194 0.324395 0.23087 0.501635 0.621321 0.146501 0.51537 0.503597 0.047731 0.43641
4) ALS 및 대조군에서 RAPGEF2 유전자의 검증
ALS와 RAPGEF2 유전자의 관련성을 검증하기 위해 MALDI-TOF를 이용하여 385명의 건강한 개체를 대상으로 RAPGEF2 유전자에서 발견된 변이인 c.4069G>A에 대한 대조군 연구(control study)를 실시하였으며, 변이가 발견된 사람은 없었다. 또한, 본 연구에서 ALS 트리오와 무관한 184명의 ALS 환자의 RAPGEF2 유전자에 대하여 타겟 차세대 시퀀싱을 실시하였다. 그 결과, 2명으로부터 2개의 미스센스 VUS를 발견하였다: HS-374로부터 c.1883C>T (p.Thr628Ile), HS-477로부터 c.3293G>A (p.Arg1098His)(도 10). 본 연구에서 1명의 트리오 케이스 및 2명의 산발성 ALS 환자의 RAPGEF2 유전자에서 총 3개의 변이가 발견되었다(3/199, 1.5%). c.1883C>T (p.Thr628Ile) 변이는 UBQ 수퍼패밀리 도메인에 위치하며, c.3293G>A (p.Arg1098His) 및 c.4069G>A (p.Glu1357Lys) 변이는 RasGEF 도메인 바깥쪽 3’-말단 영역에 위치한다(도 11).
2. 환자 특성
ALS 트리오의 15명 발단자에 대한 임상 정보는 표 13에 요약하였다. 15명의 환자 가운데 9명은 남성, 6명은 여성이었다(남성:여성 비율은 1:0.6). 평균 발병 연령은 34.2세였다(범위, 19-49세). ALS에 대하여 가족력을 가진 사람은 없었다. sALS 트리오-7의 발단자를 제외하고 인지 장애를 보인 사람은 없었다. 14명의 환자(93.3%)은 사지에서 증상이 시작되었고 한 환자는 숨뇌 영역에서 증상이 시작되었다. 진단 당시 평균 ALSFRS-R은 40.5이고, 평균 델타-FS는 0.57이다. 추적 관찰기간동안 사망한 환자는 없었다. 두 명의 환자는 증상 발병 후 21개월 및 49개월 후 비-침습적 인공 호흡기 치료를 받았다. 숨뇌에서 발병한 ALS 트리오-12 발단자는 발병 후 빠르게 증상이 진행되어 10개월 후 비-침습적 인공 호흡기 치료 및 위루형성술(gastrostomy)을 받았다.
PSEN1 유전자의 c.497T>C (p.Leu166Pro) 변이를 갖는 sALS 트리오-7의 발단자는 28세 남자로 24개월간의 보행장애 및 하지 경련 기왕력이 있었다. 정신운동 장애, 공간지각력 저하를 포함한 인지장애가 경직성 보행장애에 선행되었다. 신경학적 검사에서 하지의 심한 경직과 좌우 과활동성 심부힘줄반사(Bilateral hyperactive deep tendon reflexes), 호프만 징후 및 바빈스키 징후가 나타났다. MMSE(Mini Mental State Examination)는 26/30을 기록했다. 정밀 신경심리 검사에서는 주의집중, 언어능력, 기억력, 전두엽 기능을 비롯한 모든 영역에서 인지 저하가 확인되었다. 근전도에서는 활성 탈신경(active denervation) 및 만성 탈신경 소견은 보이지 않았다. 뇌 및 척추 MRI 결과, 미만성 대뇌피질 위축이 관찰되었다. 치매나 인지 장애를 유발할 수 있는 이차적인 원인을 시사하는 검사 소견은 없었다. 고든 및 프링글 기준에 따라 하지의 근육 신경을 침범하며 치매를 동반하는 원발성 측삭경화증으로 진단되었다(18, 131).
RAPGEF2 유전자에서 c.4069G>A (p.Glu1357Lys) 변이를 갖는 sALS 트리오-3의 발단자는 36세 여성으로 오른손 및 하지에서 7개월간 점진적인 운동장애를 나타냈다. 1년 후, 구음 장애가 발생하였다. 신경근육질환에 대한 가족력은 없었다. 신경학적 검사 결과, 혀, 두 팔 및 두 다리에서 근위축 및 쇠약(weakness)이 나타났다. 속상위축(fasciculation)이 사지에서 분명하게 관찰되었으며, 좌우 과활동성 심부힘줄반사, 호프만 및 바빈스키 징후, 및 발목의 간헐성 경련이 나타났다. 기본적인 혈액 검사에서는 유의한 이상 소견을 보이지 않았다. 근전도 검사 결과, 활동성 및 만성 탈신경이 사지에서 나타났다. 뇌 MRI 결과, 이상 소견은 없었다. 개정된 E1-Escorial 기준에 따라, 3개 영역에서 상위운동신경 징후가 있는 경우로 임상적으로 명확한 ALS로 진단하였다.
FRAS1 유전자에서 c.8393C>T (p.Ala2798Val) 변이를 갖는 sALS 트리오-2의 발단자는 36세에 상지(upper extremity)에서 발병되었다. 진단 시 환자의 ALSFRS-R은 45/48이었고, 델타-FS는 1.43으로 상대적으로 증상이 빨리 진행되었다. 상기 환자는 ALS 발병 후 34개월 시점에 생존해 있었다.
CLEC4C 유전자에서 c.629_631delAGA (p.Lys210del) 변이를 갖는 sALS 트리오-4의 발단자는 21세 여성으로 19세에 상지에서 발병되었고, 느리게 진행 중인 운동장애를 갖고 있다. 진단 시 환자의 ALSFRS-R은 46/48이었고, 델타-FS는 0.1이었다. 상기 환자는 증상 발병 후 23개월 시점에 생존해 있었다.
PLEKHM2 유전자에서 c.1921+6C>T 변이를 갖는 sALS 트리오-8의 발단자는 39세 남성으로 38세에 증상이 시작되었으며, 상지에서 운동장애가 서서히 진행되었다. 진단 시 환자의 ALSFRS-R은 39/48이었고, 델타-FS는 0.89이었다. 상기 환자는 증상 발병 후 15개월 시점에 생존해 있었다.
SSH2 유전자에서 c.1408G>T (p.Glu470*) 변이를 갖는 sALS 트리오-11의 발단자는 39세에 상지에서 증상이 시작되었다. 진단 시 환자의 ALSFRS-R은 33/48이었고, 델타-FS는 0.75였다. 상기 환자는 증상 발병 후 8개월 시점에 생존해 있었다.
sALS 트리오-12의 발단자에서는 2개의 신규 VUS, 즉, SPAG17 유전자의 c.2815G>T (p.Ala939Ser) 변이 및 XRCC3 유전자의 c.598G>A (p.Val200Ile) 변이가 발견되었다. 상기 환자는 40세에 숨뇌 영역에서 증상이 발병하였다. 진단 시 환자의 ALSFRS-R은 42/48이었고, 델타-FS는 1.5였다. 상기 환자는 증상 발병 후 6개월시점에 생존해 있었으며, 발병 후 10개월에 기관절개술(tracheostomy) 및 위루형성술을 받았다.
IFT80 유전자에서 c.595G>A (p.Val199Ile) 변이를 갖는 sALS 트리오-13의 발단자는 41세에 하지(lower extremity)에서 발병되었다. 진단 시 환자의 ALSFRS-R은 37/48이었고, 델타-FS는 0.73이었다. 상기 환자는 ALS 발병 후 10개월 시점에 생존해 있었다.
ADGRL3 유전자에서 c.715A>G (p.Ser239Gly) 변이를 갖는 sALS 트리오-15의 발단자는 43세에 하지에서 발병되었다. 진단 시 환자의 ALSFRS-R은 43/48이었고, 델타-FS는 0.25였다. 상기 환자는 증상 발병 후 6개월 시점에 생존해 있었다.
15명 sALS 환자의 임상적인 특징
Trio No. Sex Age onset Family history Diagnosis rEEC Site of onset ALSFRS-R delta-FS FVC (%) Onset to initial (Mo) Duration of f/u (mo) NIV from onset (mo) Gastrostomy from onset (mo) Death from onset (mo)
1 M 30 No ALS probable LE 45 0.1 71 29 40 49 - -
2 F 36 No ALS definite UE 38 1.43 71 7 34 - - -
3 F 27 No ALS probable LE 44 0.36 67 11 69 - - -
4 F 19 No ALS probable UE 46 0.1 68 20 23 - - -
5 F 28 No ALS definite UE 35 0.43 73 30 17 - - -
6 M 23 No ALS definite UE 36 0.52 58 23 23 - - -
7 M 26 No PLS plus - LE 37 0.32 56 24 10 - - -
8 M 38 No ALS definite UE 39 0.89 90 9 15 - - -
9 M 26 No ALS probable LE 41 0.37 63 19 38 - - -
10 F 49 No ALS probable LE 45 0.5 71 6 14 21 - -
11 F 39 No ALS definite UE 33 0.75 83 20 8 - - -
12 M 40 No ALS probable bulbar 42 1.5 56.4 4 6 10 10 -
13 M 41 No ALS probable LE 37 0.73 84 15 10 - - -
14 M 49 No ALS probable UE 46 0.25 101.6 8 7 - - -
15 M 43 No pure LMND - LE 43 0.25 not done 20 6 - - -
* 약어: PLS, primary lateral sclerosis; LMND, lower motor neuron disease; rEEC, revised El Escorial criteria; UE, upper extremity; LE, lower extremity; ALSFRS-R, the ALS functional rating scale-revised; delta-FS, delta-functional rating; FVC, forced vital capacity; NIV, non-invasive ventilation.
논의
1. 신규 변이의 발견
본 발명에서 15명의 sALS 트리오에 대한 전체 엑솜 시퀀싱을 실시하였고, 8 트리오로부터 PSEN1 유전자에서 1개의 기존에 보고된 돌연변이 및 9개의 VUS를 포함하는 10개의 신규 변이를 발견하였다. 먼저 본 발명자들은 전체 엑솜 시퀀싱을 통해 가족력이 없는 EOAD 환자에서 원인이 되는 변이를 발견하였다. 두 번째로 본 발명자들은 한국인 sALS 환자에서 신규 변이의 빈도를 평가하였다. 마지막으로 이러한 결과들은 ALS에서 신규 변이에 대한 체계적인 분석을 제공하며, 본 발명자들은 ALS 유전적 배경에 기여하는 새로운 후보로서 RAPGEF2 유전자를 확인하였다.
본 발명자들은 26세에 발병한 sALS 트리오-7로부터 신규 PSEN1 병리학적 변이인 c.497T>C (p.Leu166Pro)를 발견하였다. 이 변이는 가족성 이른발병 알츠하이머 치매(early onset Alzheimer's dementia; EOAD)의 원인이 되는 변이로 보고된 바 있다(130). 산발성 EOAD 환자에서 신규 변이에 대한 보고는 수 례만 보고되었는데(132-134) 이는 PSEN1 유전자 검사가 가족력이 있는 EOAD 환자에서 주로 시행되므로 선택편견(selection bias)이 작용했을 가능성이 있다(134). 본 발명의 결과더불어, 신규 변이가 발생하는 환자의 발병 연령은 26세에서 37세로 매우 어렸다. 본 연구에서 발단자와 마찬가지로 선천성강직성대마비(spastic paraplegia)를 보이는 몇몇 가족성 EOAD 증례가 보고된 바 있다(135-137). 특히, PSEN1 유전자 엑손 9의 결손이 조기 선천성강직성대마비이 관련이 있다고 알려져 있다 (138-140). 생어 시퀀싱을 통한 타겟 유전자 시퀀싱은 일반적으로 돌연변이를 찾기 위한 유용한 방법으로 알려져 있지만 질병의 다양한 표현형(phenotypic variability), 유전적 복합성(genetic heterogeneity) 및 다발성 분자 메커니즘으로 인해 다수의 신경 퇴행성 질환에서 원인이 되는 유전자 및 변이를 결정하는데 어려움이 있다. 따라서, 명확한 타겟 유전자가 없는 상황에서 일반적인 원인 유전자에 대한 검사 후 전체 엑솜 시퀀싱을 시행하는 것은 진단적 유용성을 지닌다.
본 발명에서 신규 변이 발생율은 0.6 (9/15)였고, 이는 ASD (autism spectrum disorders) 및 ALS의 최근 연구 결과와 유사하다(표 14). 최근 한 연구에서는 전체 엑솜 시퀀싱을 통한 47 sALS 트리오의 신규 변이 빈도를 0.64 (30/47)로 보고하였다(110). O’Roak 등은 189명의 자폐증 환자 및 부모에 대해 전체 엑솜 시퀀싱을 시행하였고, 그 결과 181개의 non-synonymous 변이(0.96, 181/189)를 발견했으며, 그 중 120개는 생화학적 특성 및 종간 보존 정도에 의거하여 질환에 영향을 미칠 가능성이 큰 변이로 분류되었다(103). ASD에 대한 다른 연구에서 신규 변이의 비율은 0.63 - 0.68로 나타났으며, 이는 본 발명의 결과와도 일치하였다(141-143).
Non-synonymous (NS) 변이의 신규 발생률 비교
질병 표현형(참고) NS 변이 수 발단자 수 발단자 당 NA 변이 수
ASD (141) 125 200 0.63
ASD (103) 181 189 0.96
ASD (142) 119 175 0.68
ASD (143) 232 343 0.68
ALS (110) 30 47 0.64
ALS (본 발명) 9 15 0.6
* 약어: ASD, autism spectrum disorders; ALS, amyotrophic lateral sclerosis.
2. RAPGEF2 유전자
본 발명에서 RAPGEF2(Ras guanine nucleotide exchange factor 2) 유전자가 ALS의 원인 유전자 후보로 확인되었다. 본 발명자들은 sALS 트리오-3에서 RAPGEF2 유전자의 신규 미스센스 변이 c.4069G>A (p.Glu1357Lys)를 발견하였다. 또한, 독립된 184명의 sALS 환자군에서 RAPGEF2 유전자의 미스센스 변이 두 개를 추가로 발견하였다; c.1883C>T (p.Thr628Ile) 및 c.3293G>A (p.Arg1098His). 본 발명의 실험 분석결과들은 RAPGEF2 유전자가 sALS에 대한 원인 유전자일 가능성을 시사한다. 첫째로, 100명의 동일 인종의 정상 대조군 및 75명의 자체 질병 대조군에서는 RAPGEF2 유전자의 상기 3가지 변이가 존재하지 않았다. 그리고 dbSNP141, 1000 지놈 프로젝트(전체 및 동아시아인) 및 ExAC(Exome Aggregation Consortium)에서 변이의 대립유전자 빈도는 극히 드물었다(0.1% 이하). 둘째, 출판된 문헌, 전사체, 단백체, 조절체, 온톨로지 및 표현형 데이터베이스에 대한 비교를 기반으로 한 분석에서 기존에 알려진 ALS의 발병 기전과 RAPGEF2 유전자를 비교한 결과 RAPGEF2 유전자가 ALS와 통계적으로 유의한 관계가 있음이 확인되었다.
RAPGEF2 유전자는 염색체 4q32.1에 위치하고 35개의 엑손으로 구성되며, 1,499개의 아미노산을 코딩한다. RapGEF2 단백질은 비활성 GDP- 및 활성 GTP-결합 상태를 결정하는 GTP/GDP-조절 스위치로서 신호전달에서 GTPase 기능을 가진 RAS 패밀리 멤버의 하나이다(144). RapGEF2는 CNBD(cyclic nucleotide-binding domain), Ras 익스체인지 도메인, PDZ 도메인, Ras 연관 도메인 및 Rap GEF 도메인을 포함하는 여러 도메인을 포함한다(145). RapGEF2의 GEF 도메인은 Rap1 및 Rap1과 가까운 패밀리 멤버인 Rap2에서 GTP 교환을 조절하는 역할을 한다(146). 다른 도메인들은 그것의 활성, 안정성 및 위치를 조절하는 것으로 보인다(147, 148).
쥐를 대상으로 한 실험에서 RapGEF2가 쥐의 뇌에서 풍부하게 발현되고, 시냅스 원형질막 소포에 많이 존재한다는 사실이 관찰되었는데 이로부터 RapGEF2가 시냅스에서 역할을 수행할 것이라는 가설이 제기된 바 있다(도 12)(149). 또한, 초기 뇌 발달 및 뉴런의 형태발생 과정이 RapGEF2의 기능과 연관되어 있다는 보고도 있었다(150-152). RapGEF2는 MAPK 및 Rap1 신호전달 경로에 관여한다. Rag1 신호전달체계는 뉴런 이동에 관여하며, Cdk5에 의해 조절된다(153). 최근 연구에서 RapGEF2의 Cdk5-의존적 조절이 뉴런 이동 및 대뇌피질의 신경회로구성에 중요한 역할을 한다는 것이 보고되었다(145).
3. 다른 유전자들
본 발명자들은 sALS-13의 IFT80 유전자로부터 신규 변이 c.595G>A를 발견하였다. IFT80(Intraflagellar transport 80) 유전자는 염색체 3q25.33에 위치하며, 21개의 엑손으로 구성된다. 이 유전자는 IFT(intraflagellar transport) 콤플렉스 B 단백질을 코딩하며, 운동 및 감각 섬모에서 필수적인 역할을 한다. IFT80 유전자의 돌연변이는 ATD2(asphyxiating thoracic dystrophy 2) 및 SRP(short-rib polydactyly syndrome) 타입 Ⅲ를 유발한다(154). IFT80은 연조직 및 신장에서 풍부하게 발현된다(도 13). 최근 왕 등은 입천장 및 해면질골(trabecular bone)에서 IFT80 발현이 증가되며, 마우스 경골에 대한 면역화학 분석을 통해 Hh 및 Wnt 신호전달 경로를 조절함으로써 연골세포 분화에 IFT80이 필수적으로 작용한다는 것을 밝혔다(155).
sALS 트리오-11의 SSH2 유전자에서 넌센스 신규 변이 c.1408G>T (p.Glu470*)가 발견되었다. SSH2(Slingshot protein phosphatase 2) 유전자는 염색체 17q11.2에 위치하며, 24개의 엑손으로 구성된다. 이 유전자는 단백질 티로신 포스파타아제를 코딩하며, 액틴 필라멘트를 조절하는데 중요한 역할을 한다(156). SSH2는 혀 및 혈액에서 풍부하게 발현된다(도 14). 최근 정신분열증 환자를 대상으로 한 연구에서 ARC(activity-regulated cytoskeleton-associated protein) 및 NMDAR(N-methyl-D-aspartate receptor) 복합체를 포함하는 글루탐산성 시냅스후 단백질(glutamatergic postsynaptic protein)에서 신규 변이가 많이 발견된다는 사실을 확인하였다. 또한, 시냅스 강도(synaptic strength), 즉 액틴 필라멘트 다이나믹스 조절 단백질을 조절하는 복합체들과 상호작용하는 단백질에서 돌연변이가 많이 나타나며, 이들의 mRNA는 FMRP(fragile X mental retardation protein)를 타겟으로 한다. 이 연구에서 SSH2 유전자의 미스센스 신규 변이 c.1477G>A (p.Glu493Lys)가 정신분열증 환자 한 명에서 발견되었으며, 이는 SSH2 유전자가 정신분열증 및 다른 신경발달장애의 메커니즘에 관여할 수 있다는 것을 암시한다(157).
sALS-트리오 4의 CLEC4C 유전자에서 인프레임 결실인 c.629_631delAGA가 발견되었다. CLEC4C(C-type lectin domain family 4, member C) 유전자는 염색체 12p13.2-p12.3에 위치하며, 7개의 엑손으로 구성된다. 이 유전자의 단백질 패밀리 멤버는 공통의 단백질 접힘(fold) 구조를 공유하며, 세포 부착, 세포 신호전달, 당단백질 순환(turnover) 및 염증과 면역 반응에서의 역할과 같은 다양한 기능을 갖는다. 타입 2 트랜스멤브레인 단백질은 수지상세포 기능에 있어서 중요한 역할을 한다(158). 최근, 형질전환 마우스를 이용한 한 연구에서 CLEC4C를 통한 플라스마사이토이드 수지상세포로의 항원 전달이 자가면역질환의 치료 또는 원치 않는 항체 반응을 억제하는데 유용한 면역학적 내성 유도에 효과적인 방법이라는 것이 보고되었다(159).
sALS-트리오 8의 PLEKHM2 유전자에서 인트론 변이인 c.1921+6C>T가 발견되었다. PLEKHM2[Pleckstrin homology domain containing, family (with RUN domain) member 2] 유전자는 염색체 1q36.21에 위치하며, 21개 엑손으로 구성된다. PLEKHM2는 흉선에서 풍부하게 발현된다(도 17). 이 유전자는 살모넬라 감염 시 키네신(kinesin) 동원(recruitment)을 억제하며, PLEKHM2 활성은 살모넬라-포함 액포의 위치 결정 및 유지에 필수적이다(160).
본 발명자들은 FRAS1 유전자에서 미스센스 변이인 c.8393C>T를 발견하였다. FRAS1(Fraser extracellular matrix complex subunit 1) 유전자는 염색체 4q21.21에 위치하며, 74개의 엑손으로 구성된다. FRAS1은 소장 및 피부에서 풍부하게 발현된다(도 18). 이 유전자는 세포외 기질 단백질을 코딩하며, 표피 기저막 부착 및 발달시기 동안 기관형성을 조절하는 기능을 가진다(161). FRAS1 유전자에서의 돌연변이는 잠복안구(cryptophthalmos), 합지증(syndactyly) 및 신장결함을 포함하는 다발계통 기형(multisystem malformation)을 나타내는 프레이저 신드롬의 원인이다(162).
sALS-트리오 15의 ADGR3 유전자에서 미스센스 변이인 c.715A>G가 발견되었다. ADGRL3(Adhesion G protein-coupled receptor L3) 유전자는 LPHN3(latrophilin 3)로도 알려져 있다. 이 유전자는 염색체 4q13.1에 위치하며, 27개 엑손으로 구성되고, 뇌, 태반 및 눈에서 발현된다(도 19). 이 유전자는 GPCR(G-protein coupled receptors)의 라트로필린(latrophilin) 서브 패밀리 멤버를 코딩한다. 라트로필린은 7개의 트랜스멤브레인 영역과 더불어 19개의 아미노산 신호전달 펩타이드 및 세린/트레오닌-리치 글리코실화 영역을 포함하는 긴 N-말단 세포외 서열을 갖는다(163). ADGRL3은 뇌에 가장 특이적인 라트로필린이다(163). 최근 연구에 따르면, ADGRL3 유전자가 ADHD(attention-deficit/hyperactivity disorder)와 연관이 있다는 사실이 보고되었다(164). 연구진은 ADGRL3 유전자 변이가 집중력 및 활동성과 관련된 주요 뇌 영역에서 발현되고, ADHD와 연관된 신경회로의 대사에 영향을 미치며, 자극제에 대한 반응과 연관되어 있다는 것을 발견하였다(164).
4. ALS에서 다수의 원인유전자(Oligogenic) 모델
sALS 트리오-12로부터 두 개의 미스센스 신규 변이를 발견하였다: SPAG17 유전자에서 c.2815G>T (p.Ala939Ser) 및 XRCC3 유전자에서 c.598G>A (p.Val200Ile). SPAG17(Sperm associated antigen 17) 유전자는 염색체 1p12에 위치하며 56개 엑손으로 구성된다. SPAG17은 폐에서 풍부하게 발현된다(도 15). SPAG17-결핍 마우스는 비강섬모 및 기관섬모의 운동성을 소실하며, 비강 점액의 정정작용(nasal mucus clearance)의 감소, 폐에 물이 축적되어 나타나는 호흡 장애 및 폐포상피의 파괴, 뇌수종의 발생과 뇌실 팽창, 젖 빨기 실패 및 신생아 사망을 나타낸다. 이러한 결과는 Spag17이 운동섬모의 기능 및 구조에 중요한 역할을 한다는 것을 의미한다(165). 또한, SPAG17 유전자의 변이는 인간의 신장과 관련있다. 최근 골격성장 및 무기질침착(mineralization)은 SPAG17 유전자 기능을 통한 연골세포 및 골아세포의 일차 섬모에 의해 조절된다는 보고가 있었다(166).
XRCC3(X-ray repair complementing defective repair in Chinese hamster cells 3) 유전자는 염색체 14q32.3에 위치하며, 10개의 엑손으로 구성된다. XRCC3은 소장 및 후두에서 많이 발현되며, HR(homologous recombination) 경로와 연관되어 있다(도 16)(167). XRCC3 유전자 돌연변이는 손상 후 회복 매커니즘을 저해하여 염색체의 불안정성 및 다수의 다른 DNA 손상제에 대하여 민감한 양성을 나타낸다(168).
다수의 원인유전자(oligogenic) 모델은 가족성 ALS에서 제안되었으며, 이는 다수의 유전자에서 발생하는 변이가 다양한 양상으로 유전되어 ALS를 유발할 수 있다는 가설이다(60). Blitterswijk 등은 97명의 가족성 ALS 환자들을 대상으로 ANG 유전자와 FUS 및 TARDBP 유전자의 변이를 동시에 가지고 있거나 혹은 C9orf72 반복서열 증가와 함께 TARDBP , SOD1 혹은 FUS 유전자의 변이를 가진 경우를 보고하였다. 그러나 한 환자에서 두 개의 변이가 발견된 경우 하나는 실제 질환을 유발하는 변이가 아닐 가능성을 고려해야 하며, 이러한 관점에서 이 연구 집단에서 발견된 ANG 유전자의 변이는 다형성일 것으로 생각된다(60, 173). 그럼에도 불구하고, ALS 환자가 질병의 발생과 관련있는 유전적 변이에 더해 이차적으로 질환의 진행 혹은 발병 나이 및 증상 발현 여부에 관련이 있는 추가 변이를 가질 가능성을 배제할 수는 없다.
5. 요약 및 결론
본 발명자들은 신규 돌연변이 측정을 통해 신규 ALS 원인 유전자를 찾기 위해 발단자-부모 sALS 트리오에 대하여 전체 엑솜 시퀀싱을 실시하였다. ToppGene 소프트웨어를 이용하여 본 발명에서 발견한 신규 변이에 대한 유전자 및 기존에 알려진 ALS 유전자들과 다층적인 비교 분석을 시행하여 우선순위를 결정하였다. 이러한 분석을 통해 RAPGEF2 유전자를 신규 원인 유전자의 후보로 선정하였다. MALDI-TOF MS를 이용하여 364명의 나이 및 성별이 일치하는 건강한 한국인 대조군에 대하여 RAPGEF2 유전자의 신규 변이 c.4069G>A를 스크리닝하였고, 그 결과 신규 변이는 발견되지 않았다. 또한, 독립된 184명의 ALS 환자에 대한 RAPGEF2 유전자 분석을 실시한 결과, 2명의 환자로부터 2개의 미스센스 변이를 발견하였다; c.1883C>T 및 c.3293G>A. 또한, 100명의 한국인 정상 대조군과 75명의 비-ALS 환자로부터 얻은 자체 질병 대조군 엑솜 데이터에서 3개의 RAPGEF2 변이는 발견되지 않았다.
본 발명은 전체 엑솜 시퀀싱을 통해 한국인 sALS 트리오에서 신규 돌연변이를 발견한 최초의 연구이다. 본 발명의 결과는 ALS의 원인에 대해 더 넓은 지식을 제공한다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (11)

  1. 근위축성측삭경화증(Amyotrophic lateral sclerosis; ALS)에 대한 진단 마커로서
    (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자; (f) 서열목록 제6서열의 염기서열에서 1921+6 염기인 시토신이 티민으로 치환된 PLEKHM2 돌연변이 유전자; (g) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자; (h) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자; (i) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자; 및 (j) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자로 구성된 군으로부터 선택되는 돌연변이 유전자.
  2. 근위축성측삭경화증에 대한 진단 마커로서
    (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자로부터 암호화되는 RapGEF2 돌연변이 단백질; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자로부터 암호화되는 IFT80 돌연변이 단백질; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자로부터 암호화되는 SSH2 돌연변이 단백질; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자로부터 암호화되는 XRCC3 돌연변이 단백질; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자로부터 암호화되는 SPAG17 돌연변이 단백질; (f) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자로부터 암호화되는 CLEC4C 돌연변이 단백질; (g) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자로부터 암호화되는 FRAS1 돌연변이 단백질; (h) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자로부터 암호화되는 ADGRL3 돌연변이 단백질; 및 (i) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자로부터 암호화되는 PSEN1 돌연변이 단백질로 구성된 군으로부터 선택되는 돌연변이 단백질.
  3. 제 2 항에 있어서, 상기 (a) RapGEF2 돌연변이 단백질은 서열목록 제11서열의 아미노산 서열에서 1357번째 아미노산 잔기인 글루탐산이 라이신으로 치환, 628번째 아미노산 잔기인 티로신이 이소류신 치환 또는 1098번째 아미노산 잔기인 아르기닌이 히스티딘으로 치환된 RapGEF2 돌연변이 단백질이고; (b) IFT80 돌연변이 단백질은 서열목록 제12서열의 아미노산 서열에서 199번째 아미노산 잔기인 발린이 이소류신으로 치환된 IFT80 돌연변이 단백질이며; (c) SSH2 돌연변이 단백질은 서열목록 제13서열의 아미노산 서열에서 470번째 아미노산 잔기인 글루탐산이 종결코돈으로 치환된 SSH2 돌연변이 단백질이고; (d) XRCC3 돌연변이 단백질은 서열목록 제14서열의 아미노산 서열에서 200번째 아미노산 잔기인 발린이 이소류신으로 치환된 XRCC3 돌연변이 단백질이며; (e) SPAG17 돌연변이 단백질은 서열목록 제15서열의 아미노산 서열에서 939번째 아미노산 잔기인 알라닌이 세린으로 치환된 SPAG17 돌연변이 단백질이고; (f) CLEC4C 돌연변이 단백질은 서열목록 제16서열의 아미노산 서열에서 210번째 아미노산 잔기인 라이신이 결실된 CLEC4C 돌연변이 단백질이며; (g) FRAS1 돌연변이 단백질은 서열목록 제17서열의 아미노산 서열에서 2798번째 아미노산 잔기인 알라닌이 발린으로 치환된 FRAS1 돌연변이 단백질이고; (h) ADGRL3 돌연변이 단백질은 서열목록 제18서열의 아미노산 서열에서 239번째 아미노산 잔기인 세린이 글리신으로 치환된 ADGRL3 돌연변이 단백질이며; (i) PSEN1 돌연변이 단백질은 서열목록 제19서열의 아미노산 서열에서 166번째 아미노산 잔기인 류신이 프롤린으로 치환된 PSEN1 돌연변이 단백질인 것을 특징으로 하는 돌연변이 단백질.
  4. 다음 단계를 포함하는 근위축성측삭경화증의 진단에 필요한 정보를 제공하는 방법:
    (i) 개체(subject)로부터 분리된 생물학적 시료로부터 (a) 서열목록 제1서열의 염기서열에서 4069번째 염기인 구아닌이 아데닌으로 치환, 1883번째 염기인 시토신이 티민으로 치환 또는 3293번째 염기인 구아닌이 아데닌으로 치환된 RAPGEF2 돌연변이 유전자; (b) 서열목록 제2서열의 염기서열에서 595번째 염기인 구아닌이 아데닌으로 치환된 IFT80 돌연변이 유전자; (c) 서열목록 제3서열의 염기서열에서 1408번째 염기인 구아닌이 티민으로 치환된 SSH2 돌연변이 유전자; (d) 서열목록 제4서열의 염기서열에서 598번째 염기인 구아닌이 아데닌으로 치환된 XRCC3 돌연변이 유전자; (e) 서열목록 제5서열의 염기서열에서 2815번째 염기인 구아닌이 티민으로 치환된 SPAG17 돌연변이 유전자; (f) 서열목록 제6서열의 염기서열에서 1921+6번째 염기인 시토신이 티민으로 치환된 PLEKHM2 돌연변이 유전자; (g) 서열목록 제7서열의 염기서열에서 629번째에서 631번째 염기인 아데닌, 구아닌 및 아데닌이 결실된 CLEC4C 돌연변이 유전자; (h) 서열목록 제8서열의 염기서열에서 8393번째 염기인 시토신이 티민으로 치환된 FRAS1 돌연변이 유전자; (i) 서열목록 제9서열의 염기서열에서 715번째 염기인 아데닌이 구아닌으로 치환된 ADGRL3 돌연변이 유전자; 또는 (j) 서열목록 제10서열의 염기서열에서 497번째 염기인 티민이 시토신으로 치환된 PSEN1 돌연변이 유전자의 mNRA 또는 상기 유전자에 의해 코딩되는 돌연변이 단백질을 검출하는 단계; 및
    (ii) 상기 시료에서 상기 돌연변이 유전자의 mRNA 또는 돌연변이 단백질이 검출된 경우, 상기 개체는 근위축성측삭경화증인 것으로 판정하는 단계.
  5. 제 4 항에 있어서, 상기 단계 (i)에서 mRNA는 상기 돌연변이 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 이용하여 측정하는 것을 특징으로 하는 방법.
  6. 제 4 항에 있어서, 상기 단계 (a)에서 돌연변이 단백질은 상기 돌연변이 단백질에 특이적으로 결합하는 항체를 이용하여 측정하는 것을 특징으로 하는 방법.
  7. 생물학적 시료로부터 제 1 항의 돌연변이 유전자의 mRNA 또는 상기 유전자에 의해 코딩되는 돌연변이 단백질을 검출할 수 있는 검출제를 포함하는 근위축성측삭경화증 진단용 조성물.
  8. 제 7 항에 있어서, 상기 mRNA를 검출할 수 있는 검출제는 상기 돌연변이 유전자에 특이적으로 결합하는 프라이머 또는 프로브인 것을 특징으로 하는 근위축성측삭경화증 진단용 조성물.
  9. 제 7 항에 있어서, 상기 단백질을 검출할 수 있는 검출제는 상기 돌연변이 유전자에 의해 코딩되는 단백질에 특이적인 항체인 것을 특징으로 하는 근위축성측삭경화증 진단용 조성물.
  10. 제 7 항 내지 제 9 항 중 어느 한 항의 조성물을 포함하는 근위축성측삭경화증 진단용 키트.
  11. 제 10 항에 있어서, 상기 키트는 마이크로어레이, 유전자 증폭 키트 또는 면역분석(immunoassay)용 키트인 것을 특징으로 하는 근위축성측삭경화증 진단용 키트.
PCT/KR2016/011254 2015-10-07 2016-10-07 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법 WO2017061818A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0141113 2015-10-07
KR1020150141113A KR102018369B1 (ko) 2015-10-07 2015-10-07 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법

Publications (1)

Publication Number Publication Date
WO2017061818A1 true WO2017061818A1 (ko) 2017-04-13

Family

ID=58488244

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/011254 WO2017061818A1 (ko) 2015-10-07 2016-10-07 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법

Country Status (2)

Country Link
KR (1) KR102018369B1 (ko)
WO (1) WO2017061818A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107354139A (zh) * 2017-09-18 2017-11-17 江苏省农业科学院 小麦als突变型蛋白、核酸及其应用
WO2024011093A1 (en) * 2022-07-08 2024-01-11 Woolsey Pharmaceuticals, Inc. Treating amyotrophic lateral sclerosis having onset 24 months prior to treatment
WO2024011094A1 (en) * 2022-07-08 2024-01-11 Woolsey Pharmaceuticals, Inc. Regimen for treating amyotrophic lateral sclerosis having onset 24 months prior to treatment

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102294939B1 (ko) * 2019-11-29 2021-08-30 주식회사 녹십자지놈 Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130209999A1 (en) * 2011-08-19 2013-08-15 Northwestern University Sqstm1 mutations in amyotrophic lateral sclerosis
KR20150015226A (ko) * 2013-07-31 2015-02-10 한남대학교 산학협력단 퇴행성 신경계 질환 진단용 마커 및 이를 이용한 진단방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101504000B1 (ko) * 2013-05-02 2015-03-18 서울대학교산학협력단 퇴행성 신경질환 진단용 마커 및 그 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130209999A1 (en) * 2011-08-19 2013-08-15 Northwestern University Sqstm1 mutations in amyotrophic lateral sclerosis
KR20150015226A (ko) * 2013-07-31 2015-02-10 한남대학교 산학협력단 퇴행성 신경계 질환 진단용 마커 및 이를 이용한 진단방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIM ET AL.: "CLEC4C p.K21 Odel Variant Causes Impaired Cell Surface Transport in Plasmacytoid Dendritic Cells of Amyotrophic Lateral Sclerosis", ONCOTARGET, vol. 7, no. 18, 1 March 2016 (2016-03-01), pages 24942 - 24949, XP055374576 *
MOEHLMANN ET AL.: "Presenilin-1 Mutations of Leucine 166 Equally Affect the Generation of the Notch and APP Intracellular Domains Independent of their Effect on AB 42 Production", PNAS, vol. 99, no. 12, 11 June 2002 (2002-06-11), pages 8025 - 8030, XP055374573 *
PANAS ET AL.: "Genotyping of Presenilin-1 Polymorphism in Amyotrophic Lateral. Sclerosis", JOURNAL OF NEUROLOGY, vol. 247, 2000, pages 940 - 942, XP009100596 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107354139A (zh) * 2017-09-18 2017-11-17 江苏省农业科学院 小麦als突变型蛋白、核酸及其应用
CN107354139B (zh) * 2017-09-18 2021-04-30 江苏省农业科学院 小麦als突变型蛋白、核酸及其应用
WO2024011093A1 (en) * 2022-07-08 2024-01-11 Woolsey Pharmaceuticals, Inc. Treating amyotrophic lateral sclerosis having onset 24 months prior to treatment
WO2024011094A1 (en) * 2022-07-08 2024-01-11 Woolsey Pharmaceuticals, Inc. Regimen for treating amyotrophic lateral sclerosis having onset 24 months prior to treatment

Also Published As

Publication number Publication date
KR102018369B1 (ko) 2019-09-06
KR20170041955A (ko) 2017-04-18

Similar Documents

Publication Publication Date Title
WO2017061818A1 (ko) 근위축성측삭경화증에 대한 진단 마커로서의 돌연변이 유전자 및 이를 이용한 진단방법
WO2019199105A1 (ko) 알츠하이머성 치매가 발병될 가능성 평가방법
WO2018169145A1 (ko) 진행성 위암 환자의 수술 후 예후 또는 항암제 적합성 예측 시스템
Zahn et al. Aquaporin-8 expression is reduced in ileum and induced in colon of patients with ulcerative colitis
WO2013187730A1 (ko) Ｓｌｉｔ-Ｒｏｂｏ 시스템을 이용한 골절 또는 골다공증의 예방 또는 치료용 조성물
WO2017082655A1 (ko) 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물
WO2021177691A1 (ko) 항암제 내성 진단 또는 치료용 조성물
WO2011146985A1 (en) Method of determining response to treatment with immunomodulatory composition
WO2003039490A2 (en) Compositions and methods for diagnosing and treating mental disorders
Eichenauer et al. The association between prenatal famine, DNA methylation and mental disorders: a systematic review and meta-analysis
Wang et al. Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis
WO2022191566A1 (ko) 췌장암의 진단용 조성물
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
WO2022203314A2 (ko) 악성말초신경초종의 감별진단을 위한 조성물
JP2013500708A (ja) アルツハイマー病の診断のためのプロセス及び方法
WO2021025412A1 (ko) 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법
WO2021071219A1 (ko) 퇴행성 신경질환의 진단용 바이오마커
CN110577989B (zh) 用于检测运动性猝死相关基因的探针、基因芯片及试剂盒
WO2020138561A1 (ko) 뇌수막염 진단을 위한 정보제공방법
WO2024010424A1 (ko) 죽상동맥경화증의 cdkal1 억제제 치료제 스크리닝 방법, cdkal1 억제제 치료제에 대한 치료반응성 예측 바이오마커, 조성물 및 키트
KR102411175B1 (ko) Kl를 포함하는 난청 진단용 바이오마커 조성물 및 이의 용도
WO2023204381A1 (ko) 유럽-동아시아인 데이터 기반 알츠하이머병 치매의 발병 위험군 또는 조기 증상 발현 위험군, 기억상실형 경도인지장애의 발병 위험군 및/또는 아밀로이드β 침착에 대한 PET 양성 위험군을 예측하기 위한 정보를 제공하는 방법
WO2023167544A1 (ko) Fam167a를 포함하는 bcr-abl 비의존성 타이로신 키나아제 억제제 내성을 진단하기 위한 바이오마커 및 fam167a를 타겟으로 하는 만성 골수성 백혈병 예방 또는 치료용 조성물
WO2023177056A1 (ko) 유럽 인구 데이터 기반 알츠하이머병 치매의 발병 위험군 또는 조기 증상 발현 위험군, 기억상실형 경도인지장애의 발병 위험군 및/또는 아밀로이드β 침착에 대한 PET 양성 위험군을 예측하기 위한 정보를 제공하는 방법
WO2023018312A1 (ko) 약물 과민반응 진단용 snp 및 이를 이용한 진단 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16853934

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16853934

Country of ref document: EP

Kind code of ref document: A1