WO2016207379A1 - Targeted enrichment of long nucleotide sequences using microfluidic partitioning - Google Patents

Targeted enrichment of long nucleotide sequences using microfluidic partitioning Download PDF

Info

Publication number
WO2016207379A1
WO2016207379A1 PCT/EP2016/064719 EP2016064719W WO2016207379A1 WO 2016207379 A1 WO2016207379 A1 WO 2016207379A1 EP 2016064719 W EP2016064719 W EP 2016064719W WO 2016207379 A1 WO2016207379 A1 WO 2016207379A1
Authority
WO
WIPO (PCT)
Prior art keywords
droplets
dna
target dna
target
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/064719
Other languages
English (en)
French (fr)
Inventor
Marie Just Mikkelsen
Thomas Kvist
Esben Bjørn MADSEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Samplix SARL
Original Assignee
Samplix SARL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Samplix SARL filed Critical Samplix SARL
Priority to US15/739,541 priority Critical patent/US10738354B2/en
Priority to EP16732595.0A priority patent/EP3314012B1/en
Priority to CA2990092A priority patent/CA2990092C/en
Priority to EP20191574.1A priority patent/EP3770271B1/en
Priority to DK16732595.0T priority patent/DK3314012T3/da
Priority to JP2017566728A priority patent/JP6936155B2/ja
Priority to AU2016282350A priority patent/AU2016282350A1/en
Publication of WO2016207379A1 publication Critical patent/WO2016207379A1/en
Anticipated expiration legal-status Critical
Priority to US16/921,103 priority patent/US11572584B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Definitions

  • the invention relates to a method for enrichment or isolation of a long nucleotide fragment comprising a known nucleotide sequence element, i.e. a sequence encoding a conserved active site or domain, the method being applicable i.a. to high throughput screening for DNA fragments containing a known sequence element.
  • a known nucleotide sequence element i.e. a sequence encoding a conserved active site or domain
  • Sequencing of DNA is a major driver in genetics research.
  • the 'next generation sequencing' technological revolution is gathering momentum as new robust high- throughput sequencing instruments are becoming available.
  • New and improved methods and protocols have been developed to support a diverse range of applications, including analysis of genetic variation.
  • methods have been developed that aim to achieve targeted enrichment of genome sub- regions such as targeted cancer panels or complete human exomes. By selective recovery of genomic loci of interest, costs and effort can be reduced significantly compared with whole-genome sequencing.
  • Hybrid capture In hybrid capture techniques, short fragment libraries (typically 100-250 base pairs) are hybridized specifically to complementary DNA fragments so that one can physically capture and isolate the sequences of interest. Selective circularization encompasses methods wherein single-stranded DNA circles including target sequences are formed, creating structures with common DNA elements that are then used for selective amplification of the target sequence. Finally, PCR amplification based enrichment is directed toward the target region by conducting multiple PCR reactions in parallel.
  • the invention provides an in vitro method for enriching for one of more target DNA molecule from a sample of mixed DNA molecules comprising the steps of:
  • each droplet contains less than 0.5, preferably less than 0.25 or even more preferably less than 0.1 of said one of more target DNA molecule on average (404), and d) physically selecting droplets containing at least one of said target DNA molecules (405),
  • the invention provides an in vitro method for enriching for one of more target DNA molecule from a sample of mixed DNA molecules comprising the steps of: a) providing a liquid sample of mixed DNA molecules comprising one or more specific target DNA molecule and reagents for specific detection of at least one of said target DNA molecules (401),
  • step (a) specific detection of droplets containing at least one of said target DNA molecules (404), wherein each droplet contains less than 0.5, preferably less than 0.25 or even more preferably less than 0.1 of said one of more target DNA molecule on average (404), and d) physically selecting droplets containing at least one of said target DNA molecules (405), wherein the frequency of the target DNA molecule compared to its frequency in the sample of mixed DNA molecules in step (a) is increased between 0.01 x (total number of droplets containing DNA molecules) x (number of droplets with target DNA) "1 and 100 x (total number of droplets containing DNA molecules) x
  • the total amount of DNA (originating from the selected droplets) in step e) is less than 200fg, or less than 150fg, or less than lOOfg, or less than 80fg, or less than 60fg, or less than 40fg, or less than 20fg, or less than lOfg, or less than 5fg, or less than 3fg, or less than 2fg, or less than lfg.
  • Figure 1 Comparison of PINSswift to current methods of specific DNA enrichment.
  • Upper part The filled black lines represent a DNA target of approximately 30 kb.
  • the dotted lines represent the nucleotide sequence information in respect of the target sequence that is needed in advance in order to perform the enrichment method.
  • the nucleotide sequence information required for PINSswift can be located at any position on the DNA target sequence.
  • Lower part (below the arrow) : The black lines represent enriched DNA target molecule showing the difference in the length of the target DNA molecules after the three different types of enrichment.
  • Figure 2 Enrichment of target DNA molecule (fold enrichment relative to the DNA in the starting sample based on the number of target molecules per ng of total DNA) after 1, 2, 3, and 4 rounds of PINSswift shown for 1, 5 and 20 targets multiplexed in one reaction assuming four positive droplets per target sequence and a total of 20,000 droplets.
  • Figure 3 Correlation between the number of target DNA molecules, the average number of positive droplets and the resulting enrichment of target DNA molecules; exemplified using one round of PINSswift, 20,000 droplets and 10 positive droplets per target.
  • DNA sample containing one or more DNA target and reagents for the detection reaction are mixed.
  • 402 Components required for droplet generation are added to the mixture.
  • 403 Droplets containing the DNA and reagents are generated.
  • reaction steps such as PCR cycling needed for specific detection (optional) are performed.
  • Positive droplets containing target DNA are detected, selected and sorted using an apparatus for physical selection of droplets.
  • Figure 5 Outline of a scheme for performing PINSswift as described in Example 1.
  • 501 A DNA sample containing the DNA target and reagents for PCR are mixed.
  • 502 Components required for droplet generation are added to the mixture.
  • 503 Droplets containing the DNA and reagents are generated.
  • 504 PCR amplification of a fragment of the target nucleotide.
  • Positive droplets containing target DNA are detected based on fluorescence generated in PCR, selected and sorted in a microfluidic chip.
  • a DNA sample containing the DNA target and reagents for PCR are mixed.
  • the collected, sorted positive droplets are coalesced, reagents for
  • Phi29 amplification are added to the water phase, new droplets are generated from the water phase and the droplet emulsion is incubated at 30°C.
  • 611-614 The sorted droplets (612) are coalesced, reagents for Phi29
  • Figure 7 Outline of a scheme for performing PINSswift as described in example 3.
  • 701 A DNA sample containing the DNA target and reagents for PCR are mixed.
  • 702 Components required for droplet generation are added to the mixture.
  • 703 Droplets containing the DNA sample and reagents are generated.
  • 704 PCR amplification of a portion of the target DNA molecule using dUTP in the reaction mixture.
  • 705 Positive droplets containing the target DNA molecule are detected based on fluorescence generated in PCR, selected and sorted in a microfluidic chip.
  • the Phi polymerase amplification reaction mixture with or without template was prepared, and the reaction was allowed to proceed; or the reaction mixture was converted to droplets and then the reaction was allowed to proceed; 1) 1 ng/ ⁇ E. coli DNA template, no droplets, 2) No DNA template, no droplets, 3) 1 ng/ ⁇ E. coli DNA template, reaction in droplets, 4) No DNA template, reaction in droplets, 5) 1 ng/ ⁇ E. coli DNA template, no droplets, no Phi29 polymerase. Marker: 1 kb+ DNA ladder as size marker.
  • Figure 9 Quantitative PCR specific detection and quantitation of the E. coli DNA produced by Phi polymerase amplification of an E.
  • coli DNA template (analyzed samples correspond to the products of Phi polymerase amplification size separated on the agarose gel shown in Figure 8.
  • the templates used for qPCR were the products of: 1) 1 ng/ ⁇ - E. coli DNA template amplified by Phi polymerase, no droplets (B01-B02), 2) No template control amplified by Phi polymerase, no droplets (B03-B04), 3) 1 ng/ ⁇ E. coli DNA template amplified by Phi polymerase in droplets (B05-B06), 4) No template control amplified by Phi polymerase in droplets (B07-B08), 5) Positive E. coli DNA control (B09-10).
  • Detection and characterisation of a target DNA fragment (or molecule) in a complex mixture of DNA fragments (or molecules), particularly a low copy number target molecule requires a sensitive detection method combined with methods for purification and analysis of the target DNA. It is known in the art, that the most sensitive PCR reactions are obtained when the DNA fragment is short, such as 100-250 base pairs. Long range PCR, designed to amplify DNA fragments that are longer than 250 base pairs, for example 500 to 5000 base pairs in length, are not capable of detecting low amounts of target DNA fragment present in a sample of mixed DNA fragments containing high amounts of background DNA. Similarly, hybridization based methods require the sample to be relatively pure to avoid non-specific hybridization.
  • the in vitro method for enriching for one of more target DNA molecule from a sample of mixed DNA molecules employs DNA detection methods (such as PCR) solely for the purpose of identifying DNA molecules (fragments) that comprise the one of more target DNA molecule. Since short DNA sequences are sufficient to identify the target DNA, the present method takes maximum advantage of the most sensitive forms of PCR for detection of a DNA target molecule in a complex DNA mixture.
  • the detection reaction is performed in droplets prepared from the sample of mixed DNA molecule combined with detection reagents.
  • reaction conditions and reagents are optimised for the detection step, which is particularly advantageous for PCR-based detection with respect to Mg ++ ion concentration (which is 10 fold lower than the optimal Mg ++ ion concentration for Phi polymerase general amplification), and target-specific primers. Since the droplet size is typically small ( 1 - ⁇ in diameter), the total volume of the combined droplets comprising target DNA will be small relative to the subsequent amplification reactions, allowing an optimisation of reaction conditions for the subsequent steps of the method . The characterisation of one of more target DNA molecule detected in a sample of mixed DNA molecules requires a sufficient number of copies of the detected molecule.
  • Phi29 polymerase derived from the bacteriophage ⁇ 29
  • WGA whole genome amplification
  • MDA multiple displacement amplification
  • fragments tens of kilobases in length can be produced using the Phi29 polymerase together with non-specific hexameric primers that anneal at intervals along a DNA template.
  • Phi29 polymerase requires a certain amount of input DNA to function in an amplification reaction.
  • Main suppliers of Phi29 polymerase such as Qiagen and Fidelity systems state in their product specifications that the minimum input for the Phi polymerase reaction is 1 ng or higher
  • the method according to the invention requires a polymerase that is capable of amplifying ⁇ less than 300fg of DNA (corresponding to 5565 linear DNA molecule of 50,000 nucleotides). This is more than 3000 fold lower than the reported template requirements of the Phi29 polymerase. Surprisingly, the Phi29 polymerase was found to provide an effective amplification of detected and selected DNA molecules using the method of the invention, even when the input DNA was below 5 fg of DNA.
  • the present invention reveals that amplification of contaminating DNA by Phi29 polymerase in a sample can be eliminated by performing the general amplification reaction of DNA molecules in droplets, in particular droplets having a volume of about 5pL (see Example 4).
  • the present invention pertains to an in vitro method in which the concentration of a specific target DNA molecule is increased relative to the concentration of total DNA in a sample, by 1) dilution of a sample into multiple sub- compartments such as droplets (separation) containing reagents for detection of specific target, 2) detection of the specific target sequence within the droplets and, 3) physical selection of droplets containing the target sequence (selection), 4) addition of chemicals for general DNA amplification to the selected DNA containing the target sequence, 5) general amplification of the selected DNA containing the target DNA molecule.
  • a sample into multiple sub- compartments such as droplets (separation) containing reagents for detection of specific target, 2) detection of the specific target sequence within the droplets and, 3) physical selection of droplets containing the target sequence (selection), 4) addition of chemicals for general DNA amplification to the selected DNA containing the target sequence, 5) general amplification of the selected DNA containing the target DNA molecule.
  • the invention is based on the principle that, if only a fraction of the droplets contain the target DNA molecule, the concentration of the target DNA molecule relative to total DNA is higher in these droplets, compared to the concentration in the original sample.
  • the fraction of droplets containing the target determines the degree of enrichment; if the fraction is low, the enrichment is high ( Figure 3).
  • the presence or absence of the target DNA molecule in a sample or a dilution thereof or droplet is defined by the presence of detectable target molecule in the sample, or a dilution thereof, or droplet using the selected method of detection (e.g. PCR).
  • the target can be further enriched by further rounds of selection (as above), until it can be sequenced by standard methods such as Sanger sequencing, sequencing by synthesis, Pyrosequencing or similar detection of DNA sequence or by PCR, hybridization or other detection assays, or it can be used directly from the first round of selection.
  • Droplets amplified and sorted according to the invention contain DNA fragments of 5-100 kb containing the sequence used for identification.
  • the method of the invention is surprisingly efficient, whereby the extent of DNA sequencing can be reduced by a factor of more than 1 billion for 5 multiplexed DNA targets by three rounds of PINSswift or a factor of 25 million for one target sequence using two rounds of PINSswift (Figure 2).
  • a sample of mixed DNA molecules potentially comprising a target DNA molecule is selected for performing PINSswift.
  • One or more nucleotide seguences of at least 10 (or 15, more preferably 40) unigue nucleotides located within the target DNA molecule is selected for screening and detecting the DNA molecule by a desired method, such as PCR detection,
  • the target DNA molecule is typically larger than 500 base bairs, such as between 2000 and 10 8 base pairs, preferably between 2,000 and 200,000 base pairs, more preferably between 10,000 - 100,000 base pairs.
  • a target DNA molecule may contain more than one unigue nucleotide seguence, each seguence corresponding to a given genetic marker, for example one genetic marker seguence diagnostic of an infectious agent and a second marker diagnostic of an antibiotic resistance gene.
  • the freguency of the target DNA molecule in the sample of mixed DNA molecules is less than 10 "2 , it may for example lie between 10 3 and 10 "9 , or for example between 10 "4 - 10 "7 , or even less than 10 11 (calculated as base pairs of target seguence divided by base pairs of total DNA in the sample).
  • the liguid sample of mixed DNA molecules is serially diluted by a desired number of dilutions until each droplet in the subsequent droplet formation step contain less than 0.01 target DNA molecule on average, preferably less than 0.001 or even more preferably less than 0.0001 specific target DNA molecule on average.
  • the total number of droplets formed in step b) of the method is from between 5xl0 3 and lxlO 10 , or from between 2xl0 4 and lxlO 7 , or between 5xl0 5 and 5xl0 6 .
  • the target DNA molecule will be present in less than 1,000 of these droplets, preferably less than 100 of these droplets, even more preferably less than 10 of these droplets.
  • the presence or absence of the target DNA molecule in a droplet is defined herein as the presence or absence of detectable target DNA molecule when employing methods for specific detection of the target DNA molecule, such as those exemplified in the present application.
  • the frequency and abundance of the target DNA molecule in the mixed DNA sample may be determined by DNA concentration measurement, PCR, real time PCR, by hybridization based assays or by assays detecting an RNA or protein product of the target sequence.
  • Reagents for PCR detection include a PCR polymerase (e.g Taq polymerase) , a Mg ++ concentration of 1.5-2.5 mM in IX Standard Taq Reaction Buffer, and 200 ⁇ dNTPs of each deoxynucleotide, that is typically optimal for most PCR products generated with Taq DNA Polymerase.
  • Oligonucleotide primers generally 20-40 nucleotides in length, whose sequence is capable of specifically binding to the 5' and 3' ends of the known sequence of the target DNA molecule.
  • Droplets containing diluted sample DNA and reagents necessary for specific detection of target DNA are generated using any method of droplet generation to isolate target DNA sequences in closed
  • Suitable methods for droplet generation include active methods such as acoustic energy ejected droplets, dielectrophoresis (DEP) and electrowetting on dielectric (EWOD), and passive methods such as shear focusing [ 1], or T-junction, x-junction and flow focusing [2], vortexing, shaking, and sonication.
  • active methods such as acoustic energy ejected droplets, dielectrophoresis (DEP) and electrowetting on dielectric (EWOD)
  • passive methods such as shear focusing [ 1], or T-junction, x-junction and flow focusing [2], vortexing, shaking, and sonication.
  • shear focusing [ 1] or T-junction, x-junction and flow focusing [2]
  • vortexing shaking, and sonication.
  • the general amplification can occur in other micro-volume compartments, such as reaction chambers in microfluidic chips.
  • the droplets are screened for the presence of the target DNA molecule using the desired detection technique.
  • the frequency of the target DNA molecule will be increased compared to its frequency in the sample of mixed DNA molecules in step (a)
  • the average total number of DNA fragments per droplet e.g. single target in a sample, such as one gene from a human genome
  • the positive droplets will on average comprise the target DNA molecule in pure form.
  • all droplets formed in step b) of the method comprise mixed DNA and the increase in frequency, obtained by selection of the positive droplets is typically between 0.1 x (total number of DNA-containing droplets) x (number of droplets with target DNA) "1 and 10 x (total number of of DNA-containing droplets) x (number of droplets with target DNA) "1 .
  • the number of droplets containing target is typically between 5 and 1000 per target sequence.
  • the total number of droplets is at least 5,000, but typically greater than 20,000 and often greater than 500,000.
  • the presence of the target DNA molecule in the droplets may be determined by PCR including qPCR, by hybridization based assays or by assays detecting an RNA or protein product of the target sequence.
  • the reagents for specific detection may contain dUTP to make it possible to selectively inactivate the DNA amplified in the detection step using UDG at a subsequent step.
  • step c) Physical selection of droplets containing said specific target DNA (406) Based on the detection of target DNA in step c) droplets are sorted into at least two different streams. When more than one specific target is detected in step c), the droplets may be sorted into 3, 4, 5 or more streams. In the stream containing droplets wherein the target is detected, the target is enriched as compared to the sample of mixed DNA molecules in step a).
  • DNA from selected droplets containing specific target DNA, and wherein total amount of DNA is less than 300fg, is amplified using any method of total DNA amplification to increase the abundance of the DNA in each sample.
  • a suitable general amplification method is Multiple Displacement Amplification (MDA)[4].
  • MDA Multiple Displacement Amplification
  • the enzyme employed for performing the general amplification is Phi29 polymerase; preferably the general amplification enzyme consists of Phi29 polymerase, whereby general amplification does not require additional polymerases. It may be necessary to add reagents for general amplification by breaking, mixing, or fusing droplets or to break emulsion by applying force such as centrifugation and/or sonication.
  • droplets generated from a liquid sample comprising the selected coalesced droplets containing specific target DNA and the reagents for general amplification, are prepared using any method of droplet generation to isolate target DNA sequences in closed
  • General amplification then takes place in the generated droplets (see figure 5).
  • the general amplification reaction is performed in droplets that are at least 1 ⁇ in diameter on average (corresponding to an average droplet volume of at least 0.00052 pL; allowing the formation of ⁇ 1.9 billion droplets/ ⁇ - general
  • the droplets have a diameter of from 2 to 20 ⁇ on average (corresponding to an average droplet volume of 0.0042 pL; with the formation of 240 million droplets/ ⁇ ..; up to an average droplet volume of 4.2 pL; with the formation of 240,000 droplets/ ⁇ -).
  • the volume of the general amplification reaction is at least 5 ⁇
  • the general amplification reaction will be performed in at least 1.2xl0 6 droplets; and up to a maximum of 1.2xl0 9 droplets for each 5 ⁇ of reaction mixture.
  • all droplets are then coalesced, and the target DNA molecules may then be further detected, selected and amplified in a subsequent cycle of steps a) to e).
  • the amplification of DNA in the detection step c) can be performed using dUTP in place of one of the deoxyribonucleotide (dNTPs), where the product may then be optionally selectively degraded, inactivated or removed.
  • This inactivation may be performed using an enzyme such as Uracil-DNA glycosylase, also known as UNG or UDG.
  • the target DNA molecules may be further enriched.
  • the target DNA molecules may be further amplified using a general amplification such as MDA or a specific amplification such as PCR.
  • a general amplification such as MDA
  • a specific amplification such as PCR.
  • further amplification may be performed by collecting the water phase from the coalesced droplets obtained following general
  • step e adding reagents for general amplification to the water phase to form a reaction mixture; generating new droplets from the reaction mixture, and incubating the droplet emulsion at 30°C.
  • the scheme is outlined in Figure 4. (401): Determine the concentration of target DNA molecules in the original DNA sample. Dilute the sample until the expected average number of droplets containing a target molecule (positive droplets) is less than 0.5. If only one target is enriched, the average number of positive droplets should be smaller resulting in a greater enrichment. Ideally, the entire sample of droplets should contain 2-100,000 positive droplets per specific target, preferably 5-10,000 and more preferably 20-100. When two different specific targets such as two different genes are to be enriched from the same sample, the ideal number of positive droplets is two times higher. If more than one sequence variant of the target is present, each variant counts as a separate target DNA molecule.
  • a target DNA molecule is long, such as longer than 20,000 base pairs, more than one properly spaced nucleotide sequence for detection of specific target may be used. Each of these nucleotide sequences counts as separate DNA molecules.
  • the correlation between number of targets, the average number of positive droplets and the resulting enrichment after PINSswift is shown in Figure 3 using an example of one round of PINSswift, 20,000 droplets and 10 positive droplets per target.
  • the enrichment may be higher or lower than the expected enrichment of figure 3 due to bias of this amplification step. In our experience the resulting enrichment may be at least two fold higher. Also, if a larger number of droplets such as one million droplets are used, this will result in a greater enrichment.
  • a typical size of the droplets may be less than 100 ⁇ in diameter, such as 1-100 ⁇ , 5- 50 ⁇ or preferably 10-30 ⁇ .
  • the droplets may also be of varying sizes within the same sample.
  • the diluted target DNA molecules are mixed with reagents suitable for detection of the target sequences in the sample. If detection is performed using PCR, these reagents may include a polymerase, target specific primers, probes such as Taqman probes, molecular beacons, or scorpion probes, SybrGreen, nucleotides, and salts.
  • reagents suitable for detection of the target sequences in the sample may include a polymerase, target specific primers, probes such as Taqman probes, molecular beacons, or scorpion probes, SybrGreen, nucleotides, and salts.
  • Droplets containing mixed DNA and reagents for detection are now generated (403) If detection is performed using PCR; the droplet sample is transferred to a PCR apparatus and PCR amplification is performed and the droplets are then sorted according to the presence (positive) or absence (negative) of the target molecule. Where fluorescence labelled oligonucleotides are used, the presence of the target molecule can be detected by the fluorescence of the droplets (404 and 405).
  • the selected and sorted droplets will contain a small amount of target DNA molecules such as 2-1000 molecules and amplification of said molecules is therefore necessary before the DNA can be used for downstream applications e.g. DNA sequencing. Due to the small amount of DNA, it may not be possible to generally amplify the DNA using standard procedures. Methods to improve the amplification include repeated steps of amplification and re-amplification and combinations of amplification in droplets and standard amplification (in one reaction, excluding droplet formation).
  • the DNA generated in the detection step may be degrade or remove the DNA generated in the detection step. It may be preferred to use dUTP in the PCR reagents. The MDA reaction is then performed using standard dNTPs. After detection and physical selection of droplets, the DNA generated in PCR can be degraded and the treated sample can be used for an additional round starting with dilution, detection and physical selection.
  • the droplets are fused (also termed coalesced or demulsified).
  • the enriched DNA may also be further purified and may be further amplified using general or specific amplification such as MDA and PCR respectively.
  • the PINSswift procedure employs general amplification to the target DNA molecule after it has been sorted. This has several advantages over a procedure where the DNA is generally amplified in droplets before detection and sorting including 1) the chemicals and enzymes needed for general amplification do not need to be present in the detection step, and 2) as the volume of the sorted droplets is small, the detection chemicals will only have minimal influence on the general amplification step.
  • general amplification is performed using Phi29 polymerase in a process where the DNA is amplified in droplets before detection, the polymerase will degrade oligonucleotides to be used for detection thereby preventing correct identification of droplets containing target DNA molecule.
  • the reaction conditions are not optimal for general amplification, and the general amplification can be inhibited.
  • the detection chemicals could alternatively be added to the droplets after general amplification thereby avoiding the problems of incompatibility between the detection and general amplification reactions.
  • this complicates the process by requiring a droplet fusion step.
  • PINSswift can be adapted to perform multiplex PINSswift.
  • Multiplex PINSswift employs additional features that are designed to detect a 2nd consecutive sequence of at least 10 (or 15, more preferably 40) nucleotides in the sample of mixed DNA molecules analysed, by amplification of this 2nd consecutive sequence with sequence specific primers to generate a 2nd target DNA molecule. If several droplets show specific detection (e.g. by fluorescence signal) from both the 1st and 2nd consecutive sequence then they have a high probability of being located on the same MDA-amplified target DNA molecule.
  • multiplex PINSswift provides simultaneous purification of up to thousands of different target molecule, each comprising more than 5,000 base pairs.
  • Separate detection molecules can be provided to separate droplets or can be added as a mixture.
  • PINSswift may be applied to a sample of mixed DNA molecules that may comprise a target DNA molecule.
  • a sample of mixed DNA molecules comprises a population of DNA molecules (e.g. chromosomal DNA molecules or plasmid DNA molecules) where the individual DNA molecules within the population differ by at least one nucleotide within a known consecutive sequence of at least 10 (or 15 or more preferably 40) nucleic acid base pairs in their DNA, such that a target molecule comprising the known consecutive sequence differs from, and can be distinguished from, non-target molecules in the sample.
  • the sample of mixed DNA molecules may additionally comprise single stranded RNA or DNA polynucleotides.
  • the population of DNA molecules in the sample of mixed DNA molecules comprises the target DNA molecule.
  • the target DNA molecule can be in linear or circular forms. Circular DNA can occur naturally or can be obtained by cloning DNA into plasmids, fosmids, cosmids, BAC clones, or generated by ligation or through Cre/LoxP mediated recombination.
  • a target DNA molecule comprises one or more known consecutive sequence of at least 10 (or 15 more preferably 40) unique nucleic acid base pairs (or nucleotides).
  • a target DNA molecule can be selected from a sample of mixed DNA molecules, by selecting for a target DNA molecule comprising this consecutive sequence of at least 10, 15 or 40 nucleic acid base pairs (or nucleotides).
  • the target DNA molecule can also be selected from the sample of mixed DNA molecules, by selecting for a target DNA molecule comprising at least two consecutive sequences of at least 10 (or 15 more preferably 40) nucleic acid base pairs (or nucleotides), wherein the two consecutive sequences are comprised within a DNA molecule of 50 to 100,000 nucleic acid base pairs, preferably 150 to 3,000 nucleic acid base pairs, more preferably 150 to 1500 nucleic acid base pairs.
  • the frequency of the target DNA molecule in the sample of mixed DNA molecules is less than 10 "2 , it may for example lie between 10 3 and 10 "9 (calculated as base pairs of target sequence divided by base pairs of total DNA in the sample).
  • the sample could be DNA from a human swab and the target DNA could be a region of 30,000 base pairs containing a specified gene.
  • the frequency of the target DNA molecule is 30,000 divided by approximately 3 billion base pairs (the human genome) which equals 10 ⁇ 5 .
  • the method of the invention is particularly suitable where the frequency of the target DNA molecule in the sample of mixed DNA molecules is less than 10 "2 .
  • the method of the invention is also suitable where the frequency of the target DNA molecule in the sample of mixed DNA molecules is less than 10 3 , 10 "4 , 10 "5 , 10 ⁇ 6 , 10 ⁇ 7 , 10 ⁇ 8 , 10 ⁇ 9 , 10 ⁇ 10 , or 10 "11 .
  • the sample of mixed DNA molecules will be derived from a cell population comprising genomic DNA, while in other instances the sample may be derived from samples where the DNA molecules are of diverse origin, such as environmental samples.
  • the frequency of the target DNA molecule is defined as the number of specific target DNA base pairs divided by the number of total base pairs in the sample.
  • the frequency of the target DNA molecule in the sample of mixed DNA molecules is determined by making a dilution series in triplicate, detecting the presence or absence of target and determining the number of targets using, for instance, most probable number methods.
  • the frequency of the target molecule can also be determined using qPCR or digital droplet PCR [3] .
  • the concentration of DNA is measured and the number of total genome equivalents is determined by dividing this concentration by the average molecular weight of the genome.
  • the target DNA molecule is derived from the genome of a cell, where the genome may be either chromosomal or extra-chromosomal DNA, or from DNA present outside of a cell such as from a virus or cell free DNA.
  • the target DNA molecule may be derived from a cell, where the cell is selected from amongst a microbial cell, a plant cell, an animal cell, a protist cell, a fungal cell, or a mammalian cell.
  • the mammalian cell may be a human cell.
  • the microbial cell may be a bacterial cell, a yeast cell or a fungal cell.
  • the target DNA molecule may be derived from a fungal mycelium or fungal spores.
  • the cell(s) may be part of a multicellular tissue or multicellular organism.
  • the target DNA molecule may be derived from one or more viral particles, where the virus has an RNA or DNA genome.
  • the target DNA molecule may be derived from a host genome comprising integrated DNA derived from a virus.
  • the target DNA molecule may also be derived from a bacteriophage.
  • the target DNA or RNA molecule is present in a sample of mixed DNA molecules, where the mixed DNA molecules may be derived from a sample collected from the environment, for example a sample of soil, water or air.
  • the sample may be derived from a multicellular organism, such as a mammal, for example an animal or a human subject.
  • the sample for example a biopsy
  • the sample may be derived from a body fluid (e.g. blood, plasma, serum, lymph and urine), from faeces or from a body tissue or organ.
  • the multicellular organism from which the sample is derived may be a living or may be a dead organism.
  • the sample of mixed DNA molecules comprising the target DNA molecule may be prepared from a sample collected from nature or from an organism (e.g. a biopsy). Methods for selective extraction of DNA molecules are known in the art [4] .
  • the step of cell disruption or cell permeabilisation is normally required in order to release total nucleic acid molecules (including DNA or RNA) from a cell, this step preceding the subsequent step of selective extraction of DNA molecules.
  • the target DNA molecule is derived from an RNA genome
  • the RNA genome or parts thereof are first reverse transcribed to provide a cDNA molecule, where the nucleotide sequence of the cDNA corresponds to (is a reverse transcript of) the RNA genome.
  • a compound such as a protein, or a compound comprising a DNA or RNA fragment, such as a DNA fragment coupled to a protein, may be bound to the target nucleotide in order to enable or facilitate subsequent detection. Unbound compounds may be washed from the sample before generation of droplets.
  • Useful proteins include antibodies, single-chain variable fragment and enzymes.
  • Useful compounds include DNA binding proteins such as regulatory proteins and histones.
  • the DNA sample may be circularized before the generation of droplets. Some general amplification methods, including the Phi polymerase catalyzed MDA reaction, are more efficient on circular templates. By circularizing the template, the DNA from the original nucleotide sample may therefore be favoured over non template reaction or templates stemming from the detection reaction and bias against target can thereby be reduced.
  • the sample may be diluted before formation of droplets. If for example 1 million droplets are used for the enrichment of a gene from human chromosomal DNA 100 pg human DNA may be used to obtain 30 copies of target DNA molecule in the 1 million droplets. As a copy of the human genome contains approximately 100,000 fragments of 30,000 base pairs, each droplet may therefore contain an average of 3 fragments. The approximately 30 droplets containing the target DNA molecule will therefore also contain non-target fragments. If the DNA is sequenced after the enrichment is finalized, the non-target fragments may also be sequenced but, as the non-target fragments are likely to be different from each other, the sequence of the target DNA molecule is clearly distinguishable. For more complex samples such as a low copy virus in a human sample, the number of non-target fragments per target fragments in a positive droplet may be even higher such as higher than 100 : 1 or 10,000 : 1.
  • the total number of target DNA molecules is typically between 5 and 1,000, such as 5-100,000.
  • the preferred number of total target DNA molecules added to the droplets is low such as 20-100 to achieve a high degree of enrichment.
  • a higher number of total target DNA molecules may be preferred such as 100- 10,000.
  • Methods of the invention include forming multiple droplets where the droplets each contain less than 0.01 specific target molecules on average.
  • the distribution of specific target molecules follows Poisson distribution.
  • Some droplets may contain non-target molecules present at 10 fold or higher concentrations as compared to the target molecule, while other droplets may contain only the target molecule.
  • droplets can be formed by a variety of techniques such as those described in [5-7] .
  • Methods of the invention may involve forming a two-phase system comprising aqueous droplets surrounded by an immiscible carrier fluid.
  • the aqueous sample within the droplet is prepared by preparing a mixture suitable for specific detection of target DNA molecules containing sample DNA and e.g. a polymerase, primers, probes and buffer solutions.
  • Aqueous droplets are either generated in an apparatus having means for creating a vortex/turbulence in a sample comprising two immiscible liquid phases in controlled environments, creating droplets of liquid (phase 1) in a 2nd phase liquid by controlling the mechanical parameters and thereby also the liquid volume of each generated droplet or by a means for extruding droplets of one liquid phase in a 2nd immiscible liquid phase, where the so formed droplets remain discrete and wherein the volume of the droplet is controlled by the diameter of the means for droplet extrusion.
  • the carrier fluid is one that is immiscible with the sample fluid.
  • the carrier fluid can be a non-polar solvent, decane, fluorocarbon oil, silicone oil or any other oil (for example mineral oil).
  • the carrier fluid contains one or more additives such as agents which increase, reduce, or otherwise create non-Newtonian surface tensions (surfactants) and/or stabilize droplets against spontaneous coalescence or contact.
  • additives such as agents which increase, reduce, or otherwise create non-Newtonian surface tensions (surfactants) and/or stabilize droplets against spontaneous coalescence or contact.
  • Methods of the invention further involve detection of the target nucleic acid molecule within the droplets containing target DNA molecules.
  • the detection involves amplification of a part of the target molecule.
  • the amplification reaction includes polymerase chain reaction, or nested polymerase chain reaction including or excluding probes such as Taqman probes, Scorpion probes, Molecular Beacon probes, Padlock probes, Molecular inversion probes and any other probe that functions by sequence specific recognition of target DNA molecule by hybridization and result in increased fluorescence on amplification of the target sequence.
  • Methods according to the invention also include methods wherein detection is based on fluorescence from optically labelled probes such as fluorescently labelled probes wherein the target is not amplified.
  • optically labelled probes such as fluorescently labelled probes wherein the target is not amplified.
  • the DNA is denatured e.g. by increasing temperature to around 95°C and the probe is subsequently allowed to anneal to the target, resulting in activation of the probe or probes.
  • optically labelled probes can be Molecular Beacons, where a single-stranded bi-labelled fluorescent probe is held in a hairpin-loop conformation of around 20 to 25 nt by a complementary stem sequences of around 4 to 6 nt.
  • the desired fluorochrome attached to one end of the sequence is in close proximity of the light quencher attached to the other end.
  • the probe anneals to an amplified target.
  • the hairpin structure is no longer maintained, and the quencher no longer quenches emitted light from the fluorochrome.
  • the optically labelled probes can also be FRET (fluorescence resonance energy transfer) probes.
  • the specific target sequence may also be detected using nucleic acid stains such as cyanine dyes.
  • a variety of different methods for physical selection of droplets or droplet sorting can be employed including steering, heating, electro-wetting, magnetic activated sorting, acoustic waves [6], and dielectrophoretic sorting [8] .
  • Such physical selection can be carried out using an apparatus with means for receiving droplets of an aqueous liquid that are suspended in a 2nd immiscible liquid (e.g.
  • droplets from specific detection step and means for passing each droplet past a detection unit capable of detecting a component in said droplet, and means for addressing said droplet for delivery to a selected compartment as determined by the presence or absence of the detectable component and means for delivering said droplet to the selected compartment.
  • MDA Multiple Displacement Amplification
  • MDA employs a strand displacement polymerase that possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single stranded DNA in the 3'- to 5'-direction, as exemplified by bacteriophage phi29 polymerase, that belongs to eukaryotic B-type DNA polymerases (UniProtKB/TrEMBL: Q38545). Other useful polymerases include Bstl polymerase.
  • the amplification may be performed in droplets to increase the local concentration of DNA. In some embodiments, the amplification is performed at around 30°C for four hours, preferably less than one hour.
  • target DNA molecule from the detection and sorting step may be as low as five or fewer molecules, typical general amplification reactions will either produce no product or produce background reaction (no template reaction).
  • the detection molecule may be removed using uracil-DNA N-glycosylase [9].
  • the detection molecules can be separated using methods based on size separation such as size exclusion based on differential binding affinity of small and large DNA to silica particles [ 10] .
  • Such silica surfaces have limited binding efficiency to DNA fragments smaller than 100 bp, and consequently only DNA fragments smaller than 100 bp will efficiently be discarded, when silica based purification in applied. In some applications, however, it may not be necessary to remove the detection molecule. For instance, since Phi polymerase and some other polymerases have low activity on DNA molecules shorter than 1000 base pairs, it may not be necessary to remove the detection molecule if the step following PINSswift enrichment is a general amplification since the detection molecule will only be amplified to limited extent, if at all amplified, compared to the actual targeted larger DNA molecule.
  • the nucleotide sequence of the molecule including the target nucleotide sequence can be determined.
  • the enriched target DNA molecule can be sequenced using e.g. Sanger sequencing, Emulsion PCR, Shotgun sequencing, SOLiD sequencing, bridge PCR, Ion Torrent sequencing, Polony sequencing, Pyrosequencing, Sequencing by synthesis, DNA nanoball sequencing, Heliscope single molecule sequencing, Nanopore DNA sequencing, Tunnelling currents DNA sequencing, Sequencing by hybridization, Sequencing with mass spectrometry, Transmission electron microscopy DNA sequencing, RNAP (RNA Polymerase) sequencing or Single-molecule real-time sequencing.
  • PINSswift to isolate or enrich target DNA molecule in mixed sample of DNA molecules extracted from samples collected from the environment, or from clinical samples provides direct access to the genome, or parts thereof, that cannot be analysed by other methods because of the sample complexity.
  • PINSswift is particularly useful for isolating or enriching DNA molecules involved in hereditary diseases, cancer, and infectious diseases.
  • Multiplex PINSswift is particularly useful for simultaneous isolation or enrichment of more than one target DNA molecule from samples comprising several target DNA molecules, such as a sample to be analysed for the DNA sequence of more than one virus, more than one hereditary disease or more than one cancer related gene.
  • PINSswift is also particularly useful for obtaining target DNA molecule sequence information from samples where only a small part of the sequence is known prior to enrichment, since the technique only requires a small part of the target DNA molecule sequence to be known in order to perform the detection step and furthermore takes advantage of high fidelity of polymerases (like Phi polymerase) in the MDA amplification to generate large amplified DNA molecules of up to 100,000 bp.
  • PINSswift is particularly useful for gap closing of DNA sequences, as PINSswift will retrieve up to 100,000 bp of sequence surrounding the small detection area and can therefore be designed to cover the unknown gap region.
  • PINSswift is also particularly useful when sequencing samples containing more than one variant of a target DNA molecule sequence such as chromosomal DNA containing two alleles of a gene.
  • a target DNA molecule sequence such as chromosomal DNA containing two alleles of a gene.
  • droplets containing each detection sequence are collected in separate compartments to ensure that only one copy of the sequence is present.
  • the droplet may subsequently be barcoded separately to enable the separate sequencing of each variant of the target DNA molecule sequence.
  • PINSswift may be used to analyse target DNA molecule in samples derived from multicellular organisms, such as a biopsy or a sample of body fluid or faeces obtained from a subject (e.g. human or animal subject), for the diagnosis or monitoring the progress of a medical indication or disease.
  • samples derived from multicellular organisms such as a biopsy or a sample of body fluid or faeces obtained from a subject (e.g. human or animal subject), for the diagnosis or monitoring the progress of a medical indication or disease.
  • Diagnosis of a wide range of medical indications in a subject such as a disease caused by an infectious agent can be assisted by the isolation or enrichment and detection of a target DNA or RNA molecule that is derived from the genome of the infectious agent by PINSswift or Multiplex PINSswift, where the target DNA molecule is detected in a sample of mixed DNA molecules derived from a biopsy or sample of body fluid obtained from a patient.
  • PINSswift in target DNA molecule isolation provides the additional feature, that additional diagnostic features of the disease can be determined.
  • the genome of the infectious agent comprises resistance genes that confer resistance to certain therapeutic agents
  • enrichment of a resistance gene may also retrieve the region surrounding the resistance gene and may provide information about the specific infectious agent carrying the resistance.
  • PINSswift may be applied to diagnostics such as detection of presence of an infectious agent such as a prokaryotic organism and antibiotic resistance. Such cases can be the presence of methicillin resistance (MR) in Staphylococcus aureus (SA).
  • MR methicillin resistance
  • SA Staphylococcus aureus
  • MRSA methicillin resistance
  • PINSswift can be used for detection of co-existence of MR and SA if a method such as duplex detection is applied.
  • Such duplex detection can be a dual-reporter detection system, where one detection system is used to monitor the presence of one event such as MR whereas another detection system is used to monitor the presence of another event, such as presence of SA within the same droplet.
  • PINSswift can be applied to selectively retrieve additional DNA sequences from the host genome based on the presence of genes such as MR or SA. Thus, it can be used to provide additional sequence information from the genome of the infectious organism, which is of importance for bacterial typing.
  • PINSswift may also be used to assist diagnosis of a disease caused by, or originating from the presence of a viral agent in a subject.
  • the presence or absence of viral DNA at a known integration site can be determined by tracking the co-enrichment of the viral DNA and integration site DNA sequence.
  • PINSswift may be applied to multiple genes within a single genome or within multiple genomes, which may be detected by any suitable molecular detection method. If required, a series of multiplex PCR reactions can be carried out and differentiated using specific dyes for each reaction. This can be done by introduction of detection systems such as probes such as Taqman probes, Scorpion probes, Molecular Beacon probes or similar. Moreover, PINSswift can also be applied to a series of genes which are not necessarily differentiated at the point of detection. Differentiation can be applied after sequence retrieval, using such methods as bar-coded PCR or similar.
  • PINSswift is based on specifically selecting samples where amplification of a desired DNA region from a complex, mixed DNA sample has occurred.
  • Phi29 polymerase based amplification MDA
  • Pan et al. [ 18] states in general terms that a highly specific whole genome amplification (WGA) of complex DNA pools which avoids amplification bias remains a challenge.
  • WGA whole genome amplification
  • DOP-PCR and random priming PCR are described as being much less efficient at reproducing the locus representation [ 19], resulting in even more biased amplification products.
  • the challenge of TIP/bias is not seen when applying the PINSswift technique, because the step of general amplification (e.g. MDA) is performed in at least 1.2xl0 6 droplets per 5 ⁇ _ MDA reaction mixture, each droplet having a volume of 5pL or less; where the total amount of DNA molecule amplified is less than 300 fg (more commonly ⁇ 50fg). Under these conditions, amplification of the DNA molecules (normally 1 target DNA molecule and ⁇ 2 non-target molecules in each droplet) is reagent-limited due to the pL volume of MDA reagents in each droplet.
  • MDA general amplification
  • the target DNA molecule is effectively amplified while non-target DNA molecules, that might otherwise be preferentially amplified by Phi29 polymerase, are not overrepresented in the final product.
  • performing general amplification in these droplets also serves to eliminate amplification of contaminating DNA molecules (see Example 5).
  • the successful implementation of the PINSswift method was not expected because the amplification of the target DNA molecules in the general amplification step requires a combination of pL reaction volumes and a template of as low as one to two DNA molecules.
  • the minimal negative TIP/bias observed in the PINSswift system is significantly lower than the overall gain obtained from the amplification process and the net result is therefore a substantial enrichment of the target DNA molecule.
  • DNA sample and detection reagents 1 ⁇ _ of a DNA sample containing 0.2 pg/ ⁇ of chromosomal Escherichia coli DNA and 1 pg/ ⁇ of HeLa human chromosomal DNA was mixed with standard PCR reagents to a total volume of 10 ⁇ _.
  • One region (E. coli - ampliconl) was targeted by primers "MB8 Fwl tm60" and "MB8 Revl tm60" annealing to Escherichia coli Aspartokinasel (thrA) together with molecular beacon probe "MB 8.7” annealing to the region between the two PCR primers.
  • the second region (E.
  • coli - amplicon2 was targeted by primers "ThrB-fw” and "ThrB-Re” annealing to Escherichia coli Homoserine kinase (thrB) together with Beacon- ThrB annealing to the DNA between the two primers,
  • Emulsion PCR was performed with the following cycling conditions: 95°C 2 min, 3x(95°C 3 seconds, 56°C 15 second), 25°C 30 seconds. Detection and Selection
  • the sample was transferred to a microfluidic chip with a sorting channel diameter of 100 ⁇ using a syringe pump and transported into a t-junction sorting zone on the chip.
  • the droplets were visualized using a camera and bright fluorescent droplets (positive droplets) were physically sorted into one channel while non-fluorescent or weakly fluorescent droplets were discarded and left unsorted and were subsequently discarded.
  • the positive droplets a total of 31
  • an oil phase were removed from the chip using vacuum from a syringe pump followed by gravity flow and transferred to a 200 ⁇ _ tube.
  • the total amount of the DNA molecules in the detected droplets, following coalescence, is estimated to be 1.7 fg, assuming that the average size of a detected target DNA molecule is 50,000 base pairs.
  • the 10 ⁇ _ water phase was transferred to a new tube containing reagents for MDA amplification, including Phi29 polymerase, dNTPs, random hexameric primers and suitable salts to reach a total volume of 20 ML 50 ⁇ _ oil (4% v/v ABIL EM90, 0.05% v/v Triton X100, 96% v/v Mineral oil [light oil for molecular biology; Sigma-Aldrich; # M5904]) was added and the two phases were mixed on a vortex mixer generating approximately 2 million water-in-oil droplets of different sizes with an average volume of approximately 5 pL.
  • reagents for MDA amplification including Phi29 polymerase, dNTPs, random hexameric primers and suitable salts
  • the emulsion was broken by adding 40 ⁇ _ perfluorooctan- l-ol, vortexing and centrifugation, the water phase was transferred to a new tube and the Phi polymerase amplification process was repeated, and the emulsion was coalesced.
  • the final water phase contained 370 ng/ ⁇ - total DNA in 20 ⁇ .
  • the number of target DNA molecules was quantified using qPCR with primers annealing to a region adjacent to the primer pair used for detection (primers MBlO. lfw and MBlO. lrev).
  • the final sample contained l . lxlO 10 target copies per ⁇ _ as quantified using qPCR as described above or 30000 targets per pg. This corresponds to an enrichment of approximately 1090 fold (calculated on a targets / pg total DNA basis).
  • the sample was sequenced using Sanger sequencing and next generation sequencing (Illumina 150 bp paired-end sequencing) and both the expected Escherichia coli sequence were confirmed.
  • Purified human DNA containing a point mutation at codon 12 (sequence GAT) in gene Kras (JX512447) was mixed 1 : 100 with a corresponding sample without the mutation in codon 12 (sequence GGT) (mutation frequency 1%).
  • 1 ⁇ _ of a DNA sample containing 330 ng of the mixed chromosomal DNA was mixed with standard PCR reagents to a total volume of 20 ⁇ _.
  • PCR Emulsion PCR was performed with the following cycling conditions: 95°C 2 min, 3x(95°C 5 seconds, 56°C 15 second, 72°C 15 seconds), 25°C 30 seconds.
  • the sample was transferred to a microfluidic chip with a sorting channel diameter of 105 ⁇ using a syringe pump and transported into an x-junction sorting zone on the chip.
  • the droplets were visualized using a camera and bright fluorescent droplets (positive droplets) were physically sorted into one channel while non-fluorescent or weakly fluorescent droplets were sorted into the other channel.
  • the positive droplets (a total of 950) followed by an oil phase were removed from the chip using vacuum from a syringe pump and transferred to a 200 ⁇ _ tube.
  • the total amount of the DNA molecules in the selected positive droplets is estimated to be 50 fg, assuming that the average size of a detected target DNA molecule is 50,000 base pairs.
  • 10 ⁇ _ of 10 mM Tris-HCI, pH 8 was added to the oil containing the sorted positive droplets. The droplets were broken by adding 200 ⁇ _ mineral oil, vortexing and centrifugation. The 10 ⁇ _ water phase was transferred to a new tube containing reagents for MDA amplification, including Phi29 polymerase, dNTPs, random hexameric primers, dithiothreitol (DTT) and suitable salts to reach a total volume of 20 ⁇ _.
  • reagents for MDA amplification including Phi29 polymerase, dNTPs, random hexameric primers, dithiothreitol (DTT) and suitable salts to reach a total volume of 20 ⁇ _.
  • 10 ⁇ _ of the above enriched DNA sample was amplified using Phi29 polymerase in a total of 20 ⁇ _ as described above.
  • the resulting enriched sample contained 350 ng/ ⁇ . total DNA (sample A).
  • 10 pg of the first enriched sample (before the second round of Phi29 polymerase amplification) was subjected to a second round of enrichment by performing emulsion PCR, selecting and sorting positive droplets. Approximately 400 droplets were selected and sorted as described above and the sorted droplets were further amplified resulting in a sample of 412 ng/ ⁇ - total DNA in 20 ⁇ _ (B- sample).
  • the number of target DNA molecules in samples A and B were quantified using qPCR with primers annealing to a region adjacent to the primer pair used for detection.
  • the final Sample A contained 1.7xl0 7 target copies per ⁇ _ as quantified using qPCR as described above or 40 targets per pg. This corresponds to an enrichment of 13000 fold (calculated on a targets / pg total DNA basis).
  • the final Sample B contained 1.2xl0 10 target copies per ⁇ _ as quantified using qPCR as described above or 28000 targets per pg. This corresponds to an enrichment of 70 fold from Sample A and 910,000 fold from the initial sample (calculated on a targets / pg total DNA basis).
  • Example 3 Identification of the sequence and integration point of a virus integrated into human DNA from 50 pg of total DNA
  • PCR Emulsion PCR was performed with the following cycling conditions: 95°C 2 min, 3x(95°C 5 seconds, 56°C 15 second, 72°C 15 seconds), 25°C 30 seconds.
  • the sample was transferred to a microfluidic chip with a channel diameter of 100 ⁇ using a syringe pump and transported into a t-junction sorting zone on the chip.
  • the droplets were visualized using a camera and bright fluorescent droplets (positive droplets) were physically sorted into one channel while non-fluorescent or weakly fluorescent droplets were sorted into the other channel.
  • the positive droplets (a total of 57) followed by an oil phase were removed from the chip using vacuum from a syringe pump and transferred to a 200 ⁇ _ tube.
  • the total amount of the DNA molecules in the selected positive droplets is estimated to be 14.2 fg, assuming that the average size of a detected target DNA molecule is 50,000 base pairs.
  • 10 ⁇ _ reagents including UDG (uracil-DNA N-glycosylase) and buffers for removal of dUTP containing PCR products was added to the oil containing the sorted positive droplets. The droplets were coalesced by adding 200 ⁇ _ mineral oil, vortexing and centrifugation. The 10 ⁇ _ water phase was transferred to a new tube and incubated for 10 minutes at 37°C followed by 1 minute at 95°C for inactivation of UDG. Reagents for MDA amplification, including Phi29 polymerase, dNTPs, random hexameric primers and suitable salts were added to reach a total volume of 20 ⁇ _.
  • UDG uracil-DNA N-glycosylase
  • 60 ⁇ _ mineral oil was added and the two phases were mixed on a vortex mixer generating approximately 4 million water-in-oil droplets of different sizes with an average volume of approximately 5 pL. During incubation at 30°C, the droplets gradually fused resulting in an increased droplet size after the total of 4 hours incubation. The final water phase contained 275 ng/ ⁇ - total DNA in 20 ⁇ _.
  • the number of target DNA molecules was quantified using qPCR with primers annealing to a region adjacent to the primer pair used for detection (primers: HPV5901f (GTTTAGTGTGGGCCTGTGC) and HPV5994r (GGCATGGGAACTTTCAGTGT) .
  • the final sample contained 1.5xl0 9 target copies per ⁇ _ as quantified using qPCR as described above or 5500 targets per pg. This corresponds to an enrichment of approximately 1100 fold (calculated on a targets / pg total DNA basis).
  • the sample was sequenced using Sanger sequencing and next generation sequencing (Illumina 150 bp paired-end sequencing) and the sequences of the regions of four integrated copies of HPV18 including integration sites were determined.
  • Example 4 General amplification of a DNA target in droplets eliminates amplification of contaminating DNA All Phi29 polymerase amplification reaction mixtures were prepared in 25 ⁇ _ volume using the RepliG single cell kit from Qiagen according to the manufacturer's recommendations. DNA purified from E. coli was used as template for the reactions. Duplicate samples were prepared, where the amplification reaction in one sample was allowed to proceed in the 25 ⁇ _ volume (standard conditions); while the duplicate samples was first converted to droplets and then the reaction was allowed to proceed.
  • Results Figure 8 shows an agarose gel of the size separated amplification products of the Phi29 polymerase amplifications. Significant amounts of amplified DNA can be seen in lanes 1-3 corresponding to an efficient amplification. As the reaction in lane 3 does not contain template DNA, the amplified DNA is likely to come from contaminating DNA in the reaction. When the non-template reaction was performed in droplets, no amplified DNA is visible on the gel (lane 4).
  • the following experiment was performed to demonstrate the detection, enrichment and sequencing of a target DNA molecule in a sample of mixed DNA molecules, where the frequency of the target DNA molecule in the sample of mixed DNA molecules was between 10 "5 and 10 "7 (calculated as base pairs of target sequence divided by base pairs of total DNA in the sample) and the target DNA molecule comprised from between 10,000 to 100,000 nucleic acid base pairs.
  • the experiment was performed according to the method of the invention, where the sample of mixed DNA molecules was detected by PCR in droplets, where the frequency of target DNA molecules was between 10 "4 to 10 "5 target DNA molecules per droplet. Approximately 100 fg DNA was recovered from positive droplets comprising the target DNA molecule, and a sample thereof was subsequently generally amplified. Amplification reaction was performed in droplets having a size of about 5pL.
  • each droplet contains on average 2.6 DNA fragments hereof approximately 4.2xl0 "5 target fragments.
  • Emulsion PCR was performed with the following cycling conditions: 94°C 2 min, 40x (94°C for 3 seconds, 60°C for 30 seconds), 25°C for 30 seconds. Detection and Selection
  • the sample was transferred to a fluorescence activated cell sorter (Biorad S3e). Positive droplets were physically sorted into one gate while non-fluorescent or weakly fluorescent droplets were sorted into the waste collection. When all droplets were sorted to either gate, the positive droplets (a total of 592) were transferred to a 200 ⁇ _ tube.
  • the sorted positive droplets were coalesced by removing excessive oil, adding 2 x 10 ⁇ _ 1H, 1H, 2H, 2H, Perfluorooctanol, and mixing and centrifuging the mixture.
  • a 3 ⁇ _ sample (approximate 30fg) of the water phase of the coalesced droplets was added to a 17 ⁇ _ mix containing N6 hexamer primer, water, dNTP, 2.5 unit Phi29 polymerase.
  • 20 ⁇ _ 2% PicoSurf oil was added and the reactions were then vortexed for 2 minutes at 2600 rpm to generate water-in-oil droplets where the average droplet volume was approximately 5pL.
  • the droplets were incubated at 30°C for 6 hours and then the enriched and amplified DNA in the coalesced droplets was analysed using qPCR and Tapestation (Agilent) measurements. According to these measurements, the 3 ⁇ _ DNA sample, following enrichment and amplification, now contained 60,000 target molecules. Since the total DNA concentration was below 0.5 ng/ ⁇ -, which is the lower limit of detection of the Tapestation, a second round of general amplification in droplets was therefore performed as above to increase the amount of total DNA.
  • the final sample contained 2.3xl0 7 target copies per ⁇ _ as quantified using qPCR. This corresponds to an enrichment of approximately 2700 fold (calculated on a targets / pg total DNA basis).
  • the sample was sequenced using next generation sequencing (Illumina 150 bp paired-end sequencing).
  • a 14.5 kb sequence contig [SEQ ID No. 24] covering the DUSP3 gene target region was generated from the NGS data.
  • Phi29 polymerase amplification in small size droplets is expected to be inhibited. Nonetheless, droplets created in this experiment (in the femto-to-picoliter range and, thus, expected to result in inhibition) seemingly do not inhibit the Phi29 polymerase amplification, as DNA yield from different sizes of Phi29 polymerase droplets are close to identical (Table 3 Results from Droplet Phi).
  • the procedure is repeated 5 times over a total period of 3 seconds.
  • Average sizes of the resulting droplets were measured using microscope images and associated measuring software. Based on the average droplet sizes the total number of droplets was calculated from each sample. Based on an estimated template fragment size of 30Kb, a template amount of 3ng DNA will be equivalent to 9.3xl0 7 fragments of DNA.
  • the preparation of both samples A and B resulted in droplets where DNA was present (details in Table ) in all created droplets.
  • the droplets generated for both samples were then incubated for 6 hours at 30°C and the reactions were terminated by raising the temperature to 65°C for 10 minutes.
  • the content of the droplets was extracted by applying PicoBreak as described by the manufacturer. SSO Advance Supermix (BioRad) was used to quantify the target region (Dusp3) using RealTime PCR quantification (Ct). Total DNA after amplification was measured using a TapeStation (Agilent).
  • DNA-quantification showed more than double quantities of amplified DNA from Sample A (28.5 ng/ ⁇ ) compared to sample B (13.2 ng/ ⁇ ). Regardless of the surplus of template in both samples (template is present in all droplets) an approximately two-fold lower level of total DNA was observed in the reaction performed in the smaller droplets. If inhibition had not occurred, comparable DNA amounts would be expected as the total reaction volumes of both samples are identical and template is present in all droplets. Ct values in the product from the two reactions were similar. Although this indicates that some inhibition may occur, significant amounts are still produced from the amplification in the smaller droplets and subsequent use in downstream sequencing is still possible.
  • the table shows data from amplification in droplets.
  • the average diameter and the number of droplets 0 is estimated based on microscopy
  • DNA fragments per droplet is based on Tapestation measurement of the DNA prior to droplet generation and the average droplet size
  • the Phi29 polymerase amplification product is determined based on Tapestation measurements.
  • MB8 Fwl tm60 GACGGTAGATTCGAGGTAATGC [SEQ ID No: 1] 5 MB8 Revl tm60 : TATGGCCGGCGTATTAGAAG [SEQ ID No: 2] MBlO. lfw: TCAACAACCTCGCATCGG [SEQ ID No : 3] MBlO.
  • HPV18 104 fwl CAGATCCTTATGGGGATTCC [SEQ ID No: 5]
  • HPV18 105 revl GATTGAGGCACAGTGTCAC [SEQ ID No: 6]
  • HPV18 106p GGCA I I I I I GGAATAGGGCAGG [SEQ ID No: 7]
  • HPV5901f GTTTAGTGTGGGCCTGTGC [SEQ ID No : 8]
  • HPV5994r GGCATGGGAACTTTCAGTGT [SEQ ID No: 9]
  • ThrB-Fw ACATTCAGTCTCAACAAC [SEQ ID No: 10]
  • ThrB-Re AATTTGCTTACCCAGTTC [SEQ ID No : 11]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Dispersion Chemistry (AREA)
PCT/EP2016/064719 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning Ceased WO2016207379A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
US15/739,541 US10738354B2 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
EP16732595.0A EP3314012B1 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
CA2990092A CA2990092C (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
EP20191574.1A EP3770271B1 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
DK16732595.0T DK3314012T3 (da) 2015-06-26 2016-06-24 Målrettet berigelse af lange nukleotidsekvenser ved anvendelse af mikrofluidpartition
JP2017566728A JP6936155B2 (ja) 2015-06-26 2016-06-24 マイクロ流体分配を用いた長いヌクレオチド配列の標的富化
AU2016282350A AU2016282350A1 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
US16/921,103 US11572584B2 (en) 2015-06-26 2020-07-06 Targeted enrichment of long nucleotide sequences using microfluidic partitioning

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562185111P 2015-06-26 2015-06-26
US62/185,111 2015-06-26
DKPA201570449 2015-07-07
DKPA201570449 2015-07-07

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/739,541 A-371-Of-International US10738354B2 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning
US16/921,103 Continuation US11572584B2 (en) 2015-06-26 2020-07-06 Targeted enrichment of long nucleotide sequences using microfluidic partitioning

Publications (1)

Publication Number Publication Date
WO2016207379A1 true WO2016207379A1 (en) 2016-12-29

Family

ID=57584736

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/064719 Ceased WO2016207379A1 (en) 2015-06-26 2016-06-24 Targeted enrichment of long nucleotide sequences using microfluidic partitioning

Country Status (6)

Country Link
US (2) US10738354B2 (enExample)
EP (2) EP3770271B1 (enExample)
JP (1) JP6936155B2 (enExample)
AU (1) AU2016282350A1 (enExample)
DK (1) DK3770271T3 (enExample)
WO (1) WO2016207379A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018221513A1 (ja) * 2017-05-31 2018-12-06 キヤノン株式会社 油性組成物、およびそれを用いた分析方法
WO2023179829A1 (en) 2022-03-21 2023-09-28 Samplix Aps Targeted enrichment of large dna molecules for long-read sequencing using facs or microfluidic partitioning

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015189336A1 (en) * 2014-06-11 2015-12-17 Samplix S.A.R.L. Nucleotide sequence exclusion enrichment by droplet sorting (needls)
DK182109B1 (en) 2019-08-02 2025-08-18 Samplix Aps System and method for amplifying nucleic acids from single cells
US20210214769A1 (en) * 2020-01-13 2021-07-15 Fluent Biosciences Inc. Methods and systems for amplifying low concentrations of nucleic acids
DK181994B1 (en) * 2021-09-28 2025-05-15 Samplix Aps Instrument for sorting of particles
JP7734312B2 (ja) 2020-12-01 2025-09-05 サンプリックス エーピーエス 粒子を分類するためのシステムおよび方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015189336A1 (en) * 2014-06-11 2015-12-17 Samplix S.A.R.L. Nucleotide sequence exclusion enrichment by droplet sorting (needls)
WO2015200717A2 (en) * 2014-06-27 2015-12-30 The Regents Of The University Of California Pcr-activated sorting (pas)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102459592B (zh) 2009-06-15 2017-04-05 考利达基因组股份有限公司 用于长片段阅读测序的方法和组合物
US20120164633A1 (en) 2010-12-27 2012-06-28 Ibis Biosciences, Inc. Digital droplet sequencing
DK2935617T3 (en) 2012-12-21 2017-07-17 Samplix S A R L Likelihood-oriented isolation of nucleotide sequences (PINS)
WO2014165762A1 (en) 2013-04-05 2014-10-09 Raindance Technologies, Inc. Rare cell analysis after negative selection
WO2014172373A2 (en) 2013-04-19 2014-10-23 Raindance Technologies, Inc Digital analyte analysis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015189336A1 (en) * 2014-06-11 2015-12-17 Samplix S.A.R.L. Nucleotide sequence exclusion enrichment by droplet sorting (needls)
WO2015200717A2 (en) * 2014-06-27 2015-12-30 The Regents Of The University Of California Pcr-activated sorting (pas)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DENNIS J. EASTBURN ET AL: "Microfluidic droplet enrichment for targeted sequencing", NUCLEIC ACIDS RESEARCH, vol. 43, no. 13, 14 April 2015 (2015-04-14), pages e86 - e86, XP055211990, ISSN: 0305-1048, DOI: 10.1093/nar/gkv297 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018221513A1 (ja) * 2017-05-31 2018-12-06 キヤノン株式会社 油性組成物、およびそれを用いた分析方法
WO2023179829A1 (en) 2022-03-21 2023-09-28 Samplix Aps Targeted enrichment of large dna molecules for long-read sequencing using facs or microfluidic partitioning
DK202200230A1 (en) * 2022-03-21 2023-12-11 Samplix Aps Targeted enrichment of large dna molecules for long-read sequencing using facs or microfluidic partitioning
DK181862B1 (en) * 2022-03-21 2025-02-24 Samplix Aps Method and kit for targeted enrichment of large dna molecules for long-read sequencing using facs or microfluidic partitioning

Also Published As

Publication number Publication date
DK3770271T3 (da) 2023-05-08
EP3314012B1 (en) 2020-09-09
JP2018518968A (ja) 2018-07-19
CA2990092A1 (en) 2016-12-29
US20200332353A1 (en) 2020-10-22
EP3770271B1 (en) 2023-02-08
AU2016282350A1 (en) 2018-01-18
EP3314012A1 (en) 2018-05-02
EP3770271A1 (en) 2021-01-27
US10738354B2 (en) 2020-08-11
JP6936155B2 (ja) 2021-09-15
US11572584B2 (en) 2023-02-07
US20180179589A1 (en) 2018-06-28

Similar Documents

Publication Publication Date Title
US11390906B2 (en) Nucleotide sequence exclusion enrichment by droplet sorting (NEEDLS)
US11572584B2 (en) Targeted enrichment of long nucleotide sequences using microfluidic partitioning
RU2736351C2 (ru) Способы дискретной амплификации полного генома
JP6626848B2 (ja) 単一の管を付加したプロトコルを用いるタグ化核酸ライブラリの調製
JP2020522243A (ja) 核酸のマルチプレックス末端タギング増幅
EP3387148A1 (en) Method for transcriptome analysis of single cells
JP2022543051A (ja) 単一細胞分析
US9862988B2 (en) Methods and kits for breaking emulsions
EP3980537A2 (en) Methods of barcoding nucleic acid for detection and sequencing
CA2990092C (en) Targeted enrichment of long nucleotide sequences using microfluidic partitioning
CN114945680A (zh) 使用微流体隔室化快速多路复用基于crispr的诊断
JP4304318B2 (ja) 遺伝子の濃縮方法
US20250163407A1 (en) Methods selectively depleting nucleic acid using rnase h
DK181862B1 (en) Method and kit for targeted enrichment of large dna molecules for long-read sequencing using facs or microfluidic partitioning
US20220372550A1 (en) A method to prepare personalized target-irrelevant guide rna pool for crispr
HK40076305A (en) Rapid multiplexing crispr-based diagnostics using microfluidic compartmentalization

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16732595

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2990092

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017566728

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15739541

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016282350

Country of ref document: AU

Date of ref document: 20160624

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016732595

Country of ref document: EP