WO2016198834A1 - Monoclonal antibodies binding mcm5 - Google Patents

Monoclonal antibodies binding mcm5 Download PDF

Info

Publication number
WO2016198834A1
WO2016198834A1 PCT/GB2016/051609 GB2016051609W WO2016198834A1 WO 2016198834 A1 WO2016198834 A1 WO 2016198834A1 GB 2016051609 W GB2016051609 W GB 2016051609W WO 2016198834 A1 WO2016198834 A1 WO 2016198834A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
seq
sequence
mcm5
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2016/051609
Other languages
English (en)
French (fr)
Inventor
Ronald Alfred Laskey
Kai Stoeber
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arquer Diagnostics Ltd
Original Assignee
Arquer Diagnostics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arquer Diagnostics Ltd filed Critical Arquer Diagnostics Ltd
Priority to US15/580,667 priority Critical patent/US20180186892A1/en
Priority to JP2017564337A priority patent/JP2018520127A/ja
Priority to CN201680033481.3A priority patent/CN107810200B/zh
Priority to ES16727798.7T priority patent/ES2678049T3/es
Priority to EP16727798.7A priority patent/EP3221352B1/en
Publication of WO2016198834A1 publication Critical patent/WO2016198834A1/en
Anticipated expiration legal-status Critical
Priority to US17/174,268 priority patent/US20210277142A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57434Specifically defined cancers of prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57496Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701Details
    • G01N2333/4703Regulators; Modulating activity
    • G01N2333/4706Regulators; Modulating activity stimulating, promoting or activating activity

Definitions

  • the invention relates to monoclonal antibodies which bind to Mem proteins, to
  • compositions or kits comprising the monoclonal antibodies or to methods of using the antibodies.
  • Urological cancers (occasionally referred to as 'urinary system cancers') are a major and increasing epidemiological problem.
  • Two of the most economically important urological cancers are bladder cancer and prostate cancer.
  • Prostate cancer is the second most common cancer in men after non-melanoma skin cancer, with over 35,000 new cases diagnosed each year in the UK; about 10,200 deaths annually are caused by prostate cancer.
  • Cancer Research UK report that a quarter of all new cases of cancer diagnosed in men in the UK are prostate cancers and 60% of new diagnoses are in men aged over 70 years.
  • the most common form of the disease is adenocarcinoma.
  • the 5-year survival rate is almost 80% in the UK.
  • West African and Afro-Caribbean males have an increased risk of prostate cancer.
  • prostate cancer The symptoms of prostate cancer are similar to those caused by benign enlargement of the prostate gland, and include urgency to urinate, difficulty or pain in passing urine and rarely, blood in the urine or semen. However, in many men the disease remains
  • Treatment depends on the stage and grade of the tumour and the patient's general health and age. Options include active surveillance, partial or radical prostatectomy, orchidectomy, hormone treatment, and radiotherapy such as brachytherapy. Orchidectomy and hormone treatment reduce or eliminate the production of testosterone, which is essential for tumour growth.
  • the definite diagnosis of prostate cancer requires a multi-faceted approach.
  • the current gold standard diagnostic test for prostate cancer is the histological examination of biopsy material. The decision to biopsy is based on age-related serum (Prostate Specific Antigen) PSA level and/or an abnormal digital rectal examination (DRE). DRE, in which the gland is palpated trans-rectally to examine for abnormal morphology is also non-specific.
  • Tumours that are too small to alter the morphology of the gland will not be detected, and abnormal morphology or enlargement is also caused by non-malignant conditions.
  • Samples of the prostate gland are commonly taken using TRUS (trans-rectal ultra sound)-guided needle biopsy.
  • TRUS trans-rectal ultra sound
  • a number of needle cores are taken, typically up to 12, in order to maximize the area of the gland sampled.
  • the procedure is carried out in the outpatients department under local anaesthesia by a urologist with the aid of a nurse or healthcare assistant. This procedure suffers from drawbacks including being somewhat painful for the patient, and exposing the patient to a risk of sepsis and/or bleeding.
  • the tissue cores are microscopically examined in a laboratory for the presence of malignant cells, which has the problem of being labour intensive and requiring highly trained cytologists, as well as being vulnerable to human error.
  • biopsies are invasive and costly. There is a need in the art for a more cost-effective, reliable and/or non-invasive tool for the diagnosis and/or surveillance of urological cancer such as prostate cancer.
  • urological cancer such as prostate cancer.
  • Known alternate and/or less invasive diagnostic procedures for prostate cancer involve the analysis of specific biological markers ('biomarkers').
  • PCA3 prostate cancer gene 3
  • This urinary assay identifies non-coding mRNA from the PCA3 gene that is overexpressed in prostate cancer (Hessels & Schalken, The use of PCA3 in the diagnosis of prostate cancer. Nat Rev Urol, 6, 255-61; 2009).
  • the PCA3 test (Gen-Probe, Inc) relies on the analysis of a first-catch urine specimen produced after a defined form of prostate massage used to express prostatic secretions, which contain epithelial cells into the urethra.
  • PCA3 Prostate Cancer Gene 3
  • PSA Prostate Specific Antigen
  • Symptomatic patients presenting in primary care are typically given a serum PSA test and a DRE.
  • PSA is not specific for prostate cancer.
  • PSA is a constitutively expressed tissue specific intracellular enzyme.
  • a low concentration of PSA is present in the serum of men with healthy prostate glands.
  • a raised level of PSA in serum occurs due to leakage from the prostate gland and is an indication of the relative size of the gland.
  • Raised PSA can occur in non-malignant conditions such as benign prostatic hyperplasia and prostatitis and also in prostate cancer. As men grow older, the volume of the gland increases resulting in rising PSA levels in the absence of malignant disease.
  • the accuracy of the PSA test as measured in ROC (receiver operating characteristic) analysis is 0.678 (Thompson et al., Operating characteristics of a prostate-specific antigen in men with an initial PSA level of 3.0 ng/ml or lower. JAMA, 294, 66-70; 2005). In the UK, PSA tests are usually carried out in hospital laboratories although rapid point-of-care assays are available.
  • Bladder cancer is the fourth most common cancer in men and the ninth most common cancer in women and results in significant morbidity and mortality (Jemal et al. CA Cancer J Clin. 2007. 57:43-66.). Most patients with bladder cancer receive the diagnosis after they present with gross or microscopic haematuria or with other irritative voiding symptoms, such as frequency and dysuria. At initial diagnosis, approximately 70% of patients have bladder cancers that are confined to the epithelium or subepithelial connective tissue. These cancers can be managed with endoscopic resection and intravesical therapy. The recurrence rate for these tumours ranges from 50% to 70% and 10% to 15% of cases progress to muscle invasion over a 5-year period (Shariat et al, 2008. Rev Urol.
  • bladder cancer requires a combination of procedures. Presently there are no methods to identify accurately and easily the presence of early bladder cancer. Screening for bladder cancer in patients who present to the urology clinic with appropriate symptoms is currently done with urinalysis, cystoscopy and a scanning procedure such as abdominal ultrasound, intravenous urogram, computed tomography or magnetic resonance imaging. Urine cytology, in which cells from urine samples are examined microscopically, is used occasionally. Cystoscopy, the mainstay for the detection of bladder cancer, is a relatively short, minimally traumatic procedure performed with local urethral anaesthesia, which identifies nearly all papillary and sessile lesions. Nevertheless, it is still invasive and a cause of discomfort and distress to the patient.
  • cystoscopy may be inconclusive at times because of the grossly abnormal appearance of the bladder mucosa, especially in patients with an indwelling catheter or active inflammation, and it is unable to detect cancers within the ureters.
  • cystoscopy has an appreciable false-negative rate either from operator error or from small areas of "carcinoma in situ", which may be difficult to detect, (van der Poel & Debruyne. Curr Opin Urol. 2001; 11:503-509; Herr. BJU Int. 1999; 84:1102-1103.)
  • Urine cytology In urine cytology for bladder cancer, exfoliated cells can be investigated for the presence of specific cell-surface antigens, nuclear morphology, gene expression or other biological markers.
  • Urine cytology has a high sensitivity and specificity for the detection of high- grade bladder cancer, but it lacks the sensitivity to detect low grade tumours (Wiener et al. Acta Cytol. 1993;37:163-169).
  • the accuracy of urine cytology in predicting bladder cancer recurrence may vary widely, in part because there is an element of subjectivity in the interpretation of the results. Hence, cytology is not ideal for screening for and surveillance of bladder cancer.
  • Mcm5 is a biomarker for cancer (WO99021014).
  • a raised level of Mem proteins such as Mcm5 in urine sediment is associated with malignant changes in the prostate gland. Hence raised levels of these Mem proteins could be used to detect prostate cancer.
  • DELFIA® Dissociation-Enhanced Lanthanide Fluorometric Immunoassay
  • Mcm5 monoclonal antibodies 4B4 and 12A7 in a double antibody assay
  • Dudderidge et al. BJC, 103, 701 - 707; 2010
  • Mcm5 was estimated at between 73% and 93%.
  • benign prostatic hyperplasia did not generate false positive results, which is a disadvantage of the PSA test.
  • the present invention provides antibodies which bind to biomarkers such as an Mem protein, for example Mcm5, in a highly specific manner. These antibodies are useful in detecting levels of the biomarker. For example, these antibodies can be used in diagnostic tests for detecting urological cancers.
  • biomarkers such as an Mem protein, for example Mcm5
  • Mcm5 is a biomarker for cancer.
  • the present inventors have developed two antibodies that bind to Mcm5 but bind to different epitopes to one another (12A7 binds to SEQ ID NO: 1 and 4B4 binds to SEQ ID NO: 2).
  • Such antibodies are advantageous as they can be used in assays to detect Mcm5 (or similar Mem proteins containing these epitopes).
  • these antibodies can be used in an assay which requires immobilisation of the Mcm5 antigen.
  • Mcm5 could be detected using a two-site immunometric assay.
  • a first antibody that binds to Mcm5 could be bound to a plate. This plate could be exposed to a sample such as a urine sample. Any Mcm5 in the sample will be immobilised ⁇ captured”) by the first antibody. The plate may then be washed, leaving the immobilised Mcm5 bound to the first antibody, but removing any other contaminants.
  • a second antibody that binds to Mcm5 can be used to detect the concentration of bound Mcm5.
  • This second antibody should be conjugated to a detection agent such as Eu 3+ .
  • the plate can be exposed to the second antibody and the second antibody will bind to the immobilised Mcm5. Any excess antibody can be removed by washing. The amount of second antibody remaining can be detected by fluorescence quantification which will measure the amount of Eu 3+ present. The amount of second antibody remaining will be proportional to the concentration of Mcm5 in the sample.
  • a detection agent such as Eu 3+
  • the present inventors have developed two such antibodies (named 12A7 and 4B4). These two antibodies bind to SEQ ID NO: 1 and SEQ ID NO: 2 respectively.
  • SEQ ID NO: 1 and SEQ ID NO: 2 represent two different Mcm5 epitopes which are spatially arranged on Mcm5 to allow the two antibodies to bind to Mcm5 at the same time. This is demonstrated in Examples 2 and 3.
  • the present inventors are the first to identify two Mcm5 epitopes which are arranged such that antibodies to each epitope may bind simultaneously. Furthermore, the inventors are the first to provide sequences of two antibodies that can bind independently to Mcm5.
  • (ii) comprises at least one CDR selected from the group consisting of: a. 12A7 CDRH1 which has a sequence of SEQ ID NO: 9 or a sequence that differs from SEQ ID NO: 9 by a single amino acid substitution; b. 12A7 CDRH2 which has a sequence of SEQ ID NO: 11 or a sequence that differs from SEQ ID NO: 11 by a single amino acid substitution; c. 12A7 CDRH3 which has a sequence of SEQ ID NO: 13 or a sequence that differs from SEQ ID NO: 13 by a single amino acid substitution; d.
  • 12A7 CDRL1 which has a sequence of SEQ ID NO: 3 or a sequence that differs from SEQ ID NO: 3 by a single amino acid substitution
  • e. 12A7 CDRL2 which has a sequence of SEQ ID NO: 5 or a sequence that differs from SEQ ID NO: 5 by a single amino acid substitution
  • f. 12A7 CDRL3 which has a sequence of SEQ ID NO: 7 or a sequence that differs from SEQ ID NO: 7 by a single amino acid substitution
  • g. 4B4 CDRH1 which has a sequence of SEQ ID NO: 21 or a sequence that differs from SEQ ID NO: 21 by a single amino acid substitution
  • h. 4B4 CDRH2 which has a sequence of SEQ ID NO: 23 or a sequence that differs from SEQ ID NO: 23 by a single amino acid substitution
  • 4B4 CDRH3 which has a sequence of SEQ ID NO: 25 or a sequence that differs from SEQ ID NO: 25 by a single amino acid substitution
  • j. 4B4 CDRL1 which has a sequence of SEQ ID NO: 15 or a sequence that differs from SEQ ID NO: 15 by a single amino acid substitution
  • k. 4B4 CDRL2 which has a sequence of SEQ ID NO: 17 or a sequence that differs from SEQ ID NO: 17 by a single amino acid substitution
  • 4B4 CDRL3 which has a sequence of SEQ ID NO: 19 or a sequence that differs from SEQ ID NO: 19 by a single amino acid substitution; comprises a heavy chain variable region having a sequence at least 85%,
  • composition comprising the antibody of the invention.
  • a hybridoma cell line capable of producing the antibody of the invention.
  • a polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising the heavy chain of an antibody of the invention.
  • a polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising the light chain of an antibody the invention.
  • a polynucleotide comprising a nucleic acid sequence of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 or 34.
  • a vector comprising a nucleic acid of the invention.
  • a host cell comprising a nucleic acid or vector of the invention.
  • composition comprising a first antibody of the invention.
  • composition comprising a second antibody that binds to Mcm5.
  • kit comprising:
  • composition comprising a first antibody of the invention.
  • composition comprising a second antibody of the invention.
  • a method of determining the concentration of Mcm5 in a sample comprising the following steps:
  • the present invention provides an antibody.
  • the term 'antibody ' can refer to naturally occurring forms or recombinant antibodies such as single-chain antibodies, chimeric antibodies or humanised antibodies.
  • the terms 'antibody' and 'antibodies' may also be considered to encompass fragments of antibodies that can bind to a target protein, such as an Mem protein like Mcm5. Such fragments may include Fab'2, F'(ab) 2 , Fv, single chain antibodies or diabodies.
  • antibodies of the invention are naturally occurring, full length antibodies (rather than fragments).
  • the antibody is a mouse antibody (i.e. originally derived from mouse spleen cells).
  • antibodies are formed from two heavy chains and two lights chains.
  • Each heavy chain is made up of a heavy chain constant region (CH) and a heavy chain variable region (VH).
  • each light chain is made up of a light chain constant region (CL) and a light chain variable region (VL).
  • the VH and VL regions comprise complementarity defining regions (CDRs). The CDRs are primarily responsible for specific binding to the target protein.
  • An antibody of the invention may be an antibody of any class, particularly IgG, IgM or IgA.
  • the antibody is an IgG antibody.
  • the term "monoclonal antibody” is intended to refer to an antibody that is obtained from a population of substantially similar antibodies, i.e. from a population of antibodies that are identical except for a minority of naturally occurring variants. A population of monoclonal antibodies will bind to the same epitope. Monoclonal antibodies can be produced by a variety of techniques well known to the person skilled in the art and including the methods disclosed in “Monoclonal Antibodies: A manual of techniques", H Zola (CRC Press, 1988) and in “Monoclonal Hybridoma Antibodies: Techniques and Application", SG Hurrell (CRC Press, 1982). In an embodiment an antibody of the invention is a monoclonal antibody.
  • the antibody specifically to Mcm5. Even more preferably the antibody binds to at least one of SEQ ID NO: 1 or SEQ ID NO: 2. Optionally the antibody specifically binds to at least one of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Mcm5 is a putative DNA replication licensing factor and a member of the MCM
  • MCM proteins bind to chromatin and are believed to exhibit helicase activity and thus be core components of DNA replication.
  • Mcm5 is upregulated in the transition from the GO to Gl/S phase of the cell cycle and may actively participate in cell cycle regulation; Mcm5 can interact with at least two other members of the MCM family.
  • MCM proteins 2 - 7 comprise part of the pre-repli cation complexes which form on chromatin and which are essential prerequisites, or licensing factors, for subsequent DNA replication.
  • the MCM protein complexes act as replicative helicases and thus are core components of the DNA replication machinery.
  • MCMs are upregulated in the transition from the GO to Gl/S phase of the cell cycle and actively participate in cell cycle regulation.
  • the MCM proteins form an annular structure around the chromatin.
  • the human Mcm5 gene maps to 22ql3.1 and the mature Mcm5 protein consists of 734 amino acids (SEQ ID NO: 35; UNIPROT P33992: HUMAN DNA replication licensing factor MCM5).
  • the Mcm5 gene may differ slightly in sequences between individuals.
  • the phrase "binds to McmS” refers to antibodies that bind to SEQ ID NO: 35, but also to antibodies that bind to a polypeptide having sequences at least 90%, 95%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 35.
  • the antibody binds to a polypeptide 100% identical to SEQ ID NO: 35.
  • an antibody of the invention will bind to an epitope (fragment) of Mcm5 (for example SEQ ID NO: 1 or SEQ ID NO: 2).
  • an antibody of the invention will bind to an epitope (fragment) of Mcm5 (for example SEQ ID NO: 1 or SEQ ID NO: 2).
  • McmS refers to an antibody that binds to only a single epitope of Mcm5 such as SEQ ID NO: 1 or SEQ ID NO: 2.
  • 'binding affinity '1 refers to the ability of an antibody to bind to its target.
  • the term 'binding affinity '1 refers to the ability of an antibody to bind to its target.
  • 'specifically binds' refers to an antibody that binds to a target such as Mcm5 with a binding affinity that is at least 2-fold, 10-fold, 50-fold or 100-fold greater than its binding affinity for binding to another non-target molecule.
  • the non-target molecule is an Mem protein, other than Mcm5, such as Mem 2.
  • an antibody of the invention is capable of binding to an Mem protein, optionally Mcm5, with a binding affinity that is at least 2-fold, 10-fold, 50-fold or 100-fold greater than its binding affinity for binding to another non-target molecule.
  • an antibody of the invention is capable of binding to SEQ ID NO: 1 or SEQ ID NO: 2 with a binding affinity that is at least 2-fold, 10-fold, 50-fold or 100-fold greater than its binding affinity for binding to another non-target molecule.
  • a preferred method for the evaluation of binding affinity for Mcm5 is by ELISA.
  • an antibody of the invention has an affinity for Mcm5 (measured as an EC50 or 50% maximum binding concentration, as described in Example 2) of 2500 ng/ml or lower, 1500 ng/ml or lower, 1000 ng/ml or lower, 600 ng/ml or lower, 50 ng/ml or lower, 30 ng/ml or lower, 20 ng/ml or lower, or 10 ng/ml or lower.
  • the EC50 will typically be higher than 1 ng/ml and thus the EC50 may be between 1 ng/ml and any of the upper limits specified in the preceding sentence.
  • the binding kinetics (e.g. binding affinity) of the antibody also can be assessed by standard assays known in the art, such as by Surface Plasmon Resonance (SPR) (e.g. BiacoreTM system) analysis.
  • SPR Surface Plasmon Resonance
  • the affinity constant (KD) for binding to Mcm5 is preferably in the range of 1-10 000 nM, 1-1000 nM, 1-500 nM, 1-100 nM, 1-50 nM or 1-10 nM.
  • the association rate (ka) is preferably in the range of 0.4-3.4 x 10 6 1/M.
  • the dissociation rate (kd) is preferably in the range of 1-10 x 10 "3 1/s. These values may typically be determined by SPR (Surface Plasmon Resonance).
  • CDRs Complementary determining regions
  • An antibody of the invention preferably comprises at least one of the CDRs of antibodies 12A7 or 4B4, i.e. a CDR selected from the group consisting of:
  • 12A7 CDRH1 which has a sequence of SEQ ID NO: 9 or a sequence that differs from SEQ ID NO: 9 by 1, 2 or 3 amino acid substitutions
  • b. 12A7 CDRH2 which has a sequence of SEQ ID NO: 11 or a sequence that differs from SEQ ID NO: 11 by 1, 2 or 3 amino acid substitutions
  • c. 12A7 CDRH3 which has a sequence of SEQ ID NO: 13 or a sequence that differs from SEQ ID NO: 13 by 1, 2 or 3 amino acid substitutions
  • d. 12A7 CDRL1 which has a sequence of SEQ ID NO: 3 or a sequence that differs from SEQ ID NO: 3 by 1, 2 or 3 amino acid substitutions
  • 12A7 CDRL2 which has a sequence of SEQ ID NO: 5 or a sequence that differs from SEQ ID NO: 5 by 1, 2 or 3 amino acid substitutions
  • f. 12A7 CDRL3 which has a sequence of SEQ ID NO: 7 or a sequence that differs from SEQ ID NO: 7 by 1, 2 or 3 amino acid substitutions
  • g. 4B4 CDRH1 which has a sequence of SEQ ID NO: 21 or a sequence that differs from SEQ ID NO: 21 by 1, 2 or 3 amino acid substitutions
  • h. 4B4 CDRH2 which has a sequence of SEQ ID NO: 23 or a sequence that differs from SEQ ID NO: 23 by 1, 2 or 3 amino acid substitutions
  • 4B4 CDRH3 which has a sequence of SEQ ID NO: 25 or a sequence that differs from SEQ ID NO: 25 by 1, 2 or 3 amino acid substitutions
  • 4B4 CDRL1 which has a sequence of SEQ ID NO: 15 or a sequence that differs from SEQ ID NO: 15 by 1, 2 or 3 amino acid substitutions
  • k. 4B4 CDRL2 which has a sequence of SEQ ID NO: 17 or a sequence that differs from SEQ ID NO: 17 by 1, 2 or 3 amino acid substitutions
  • 4B4 CDRL3 which has a sequence of SEQ ID NO: 19 or a sequence that differs from SEQ ID NO: 19 by 1, 2 or 3 amino acid substitutions.
  • Antibodies that have the same CDRs as the 4B4 and 12A7 antibodies may differ substantially from the sequences of 4B4 and 12A7 in other regions. Such antibodies may, for example, be antibody fragments.
  • phrase sequence that differs from SEQ ID NO: 3 by a single amino acid substitution ' refers to the possibility of replacing one amino acid defined in SEQ ID NO: 3 by a different amino acid. Preferably such a replacement is a conservative amino acid substitution.
  • the following eight groups each contain amino acids that are typically conservative substitutions for one another:
  • the antibody of the invention comprises at least one CDR from the heavy chain of 12A7 (12A7 CDRHl, 12A7 CDRH2 or 12A7 CDRH3) as well as at least one CDR from the light chain of 12A7 (12A7 CDRLl, 12A7 CDRL2 or 12A7 CDRL3).
  • the antibody of the invention comprises at least two CDRs from the heavy chain of 12A7 and at least two CDRs from the light chain of 12A7.
  • the antibody of the invention comprises all three CDRs from the heavy chain of 12A7 and/or all three CDRs from the light chain of 12A7.
  • the antibody of the invention comprises 12A7 CDRLl and 12A7 CDRL2, 12A7 CDRLl and 12A7 CDRL3, 12A7 CDRLl and 12A7 CDRHl, 12A7 CDRLl and 12A7 CDRH2, 12A7 CDRLl and 12A7 CDRH3, 12A7 CDRL2 and 12A7 CDRL3, 12A7 CDRL2 and 12A7 CDRHl, 12A7 CDRL2 and 12A7 CDRH2, 12A7 CDRL2 and 12A7 CDRH3, 12A7 CDRL3 and 12A7 CDRHl, 12A7 CDRL3 and 12A7 CDRH2, 12A7 CDRL3 and 12A7 CDRH3, 12A7 CDRHl and 12A7 CDRH2, 12A7 CDRHl and 12A7 CDRH3, or 12A7 CDRH2 and 12A7 CDRH3.
  • the antibody of the invention comprises at least one CDR from the heavy chain of 4B4 (4B4 CDRHl, 4B4 CDRH2 or 4B4 CDRH3) as well as at least one CDR from the light chain of 4B4 (4B4 CDRLl, 4B4 CDRL2 or 4B4 CDRL3).
  • the antibody of the invention comprises at least two CDRs from the heavy chain of 4B4 and at least two CDRs from the light chain of 4B4.
  • the antibody of the invention comprises all three CDRs from the heavy chain of 4B4 and/or all three CDRs from the light chain of 4B4.
  • the antibody of the invention comprises 4B4 CDRLl and 4B4 CDRL2, 4B4 CDRLl and 4B4 CDRL3, 4B4 CDRLl and 4B4 CDRHl, 4B4 CDRLl and 4B4 CDRH2, 4B4 CDRLl and 4B4 CDRH3, 4B4 CDRL2 and 4B4 CDRL3, 4B4 CDRL2 and 4B4 CDRHl, 4B4 CDRL2 and 4B4 CDRH2, 4B4 CDRL2 and 4B4 CDRH3, 4B4 CDRL3 and 4B4 CDRHl, 4B4 CDRL3 and 4B4 CDRH2, 4B4 CDRL3 and 4B4 CDRH3, 4B4 CDRHl and 4B4 CDRH2, 4B4 CDRL3 and 4B4 CDRH3, 4B4 CDRHl and 4B4 CDRH
  • the antibody of the invention comprises at least one CDR having a sequence identical to that described in any one of SEQ ID NO: 3 (12A7 CDRLl), SEQ ID NO :5 (12A7 CDRL2), SEQ ID NO: 7 (12A7 CDRL3), SEQ ID NO: 9 (12A7 CDRH1), SEQ ID NO: 11 (12A7 CDRH2), SEQ ID NO: 13 (12A7 CDR H3), SEQ ID NO: 15 (4B4 CDRLl), SEQ ID NO: 17 (4B4 CDRL2), SEQ ID NO: 19 (4B4 CDRL3), SEQ ID NO: 21 (4B4 CDRH1), SEQ ID NO: 23 (4B4 CDRH2) or SEQ ID NO :25 (4B4 CDRH3).
  • an antibody of the invention comprises 12A7 CDRL2
  • the 12A7 CDRL2 has the sequence described in SEQ ID NO: 5.
  • the 12A7 CDRLl has the sequence described in SEQ ID NO: 3.
  • the 12A7 CDRL3 has the sequence described in SEQ ID NO: 7.
  • the 12A7 CDRH1 has the sequence described in SEQ ID NO: 9.
  • the 12A7 CDRH2 has the sequence described in SEQ ID NO: 8.
  • CDRH2 has the sequence described in SEQ ID NO: 11.
  • an antibody of the invention comprises 12A7 CDRH3, the 12A7 CDRH3 has the sequence described in SEQ ID NO: 13.
  • the 4B4 CDRLl has the sequence described in SEQ ID NO: 15.
  • the 4B4 CDRL2 has the sequence described in SEQ ID NO: 17.
  • the 4B4 CDRL3 has the sequence described in SEQ ID NO: 19.
  • an antibody of the invention comprises 4B4 CDRH1
  • the 4B4 CDRH1 has the sequence described in SEQ ID NO: 21.
  • the 4B4 CDRH2 has the sequence described in SEQ ID NO: 23.
  • the 4B4 CDRH3 has the sequence described in SEQ ID NO: 25.
  • an antibody comprising at least one of the CDRs of 12A7 or 4B4 binds
  • an antibody comprising at least one of the CDRs of 12A7 or 4B4 binds (optionally specifically binds) to SEQ ID NO: 1 or SEQ ID NO: 2.
  • the antibody of the invention preferably comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 29 or 33 and/or a light chain variable region sequence having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 27 or 31.
  • a variable antibody of the invention Such an antibody is referred to herein as a "variant antibody of the invention”.
  • the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 29. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 29. In one embodiment the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 27. In a further embodiment the antibody comprises a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 27. In a further embodiment the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 27 and a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 29.
  • the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 29 and a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 27.
  • the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 33.
  • the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 33.
  • the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 31.
  • the antibody comprises a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 31.
  • the antibody has a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO:33 and a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 31.
  • the antibody has a heavy chain variable region having a sequence at least 98%) identical to SEQ ID NO: 33 and a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 31.
  • antibodies contain multiple regions including framework regions. Deletion or addition of amino acids in the framework regions is unlikely to affect the ability of the antibody to bind to its target. On the other hand, mutations in the CDRs are considerably more likely to affect the ability of an antibody to bind to a target. Thus, in certain embodiments of the invention, variant antibodies have
  • CDRs which are identical to the CDRs of the 12A7 or 4B4 antibodies or have CDRs which vary in only a single amino acid substitution (preferably a conservative amino acid substitution).
  • Variant antibodies of the invention may have framework regions which differ in sequence quite significantly from those described in SEQ ID NO: 27, 29, 31 or 33.
  • an antibody of the invention comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 29, the antibody further comprises at least one of 12A7 CDRH1, 12A7 CDRH2 or 12A7 CDRH3. It is understood by the person skilled in the art that, since target binding specificity is determined by the CDRs, an antibody comprising the CDRs of 12A7 may still bind to Mcm5 even if the remainder of the antibody sequence is quite variable.
  • the antibody comprises at least one of 12A7 CDRH1, 12A7 CDRH2 or 12A7 CDRH3 the antibody preferably comprises a heavy chain variable region having a sequence at least 90% identical to SEQ ID NO: 29.
  • the antibody of the invention comprises 12A7 CDRH1, 12A7 CDRH2 and 12A7 CDRH3 and comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO:29.
  • an antibody of the invention comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO:
  • the antibody further comprises at least one of 4B4 CDRH1, 4B4 CDRH2 or 4B4
  • the antibody comprises at least one of 4B4 CDRHl, 4B4 CDRH2 or 4B4 CDRH3 the antibody preferably comprises a heavy chain variable region having a sequence at least 90% identical to SEQ ID NO: 33.
  • the antibody of the invention comprises 4B4 CDRHl, 4B4 CDRH2 and 4B4 CDRH3 and comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 33.
  • an antibody of the invention comprises a light chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 27, the antibody further comprises at least one of 12A7 CDRLl, 12A7 CDRL2 or 12A7 CDRL3. It is understood by the person skilled in the art that, since target binding specificity is determined by the CDRs, an antibody comprising the CDRs of 12A7 may still bind to Mcm5 even if the remainder of the antibody sequence is quite variable. For this reason where the antibody comprises at least one of 12A7 CDRLl, 12A7 CDRL2 or 12A7 CDRL3 the antibody preferably comprises a light chain variable region having a sequence at least 90% identical to SEQ ID NO: 27. In a more preferred embodiment the antibody of the invention comprises 12A7 CDRLl, 12A7 CDRL2 and 12A7 CDRL3 and comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 27.
  • an antibody of the invention comprises a light chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 31
  • the antibody further comprises at least one of 4B4 CDRLl, 4B4 CDRL2 or 4B4 CDRL3.
  • the antibody preferably comprises a heavy chain variable region having a sequence at least 90% identical to SEQ ID NO: 31.
  • the antibody of the invention comprises 4B4 CDRLl, 4B4 CDRL2 and 4B4 CDRL3 and comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO:31.
  • a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 31 (iv) a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 31.
  • An antibody having a heavy chain variable sequence identical to SEQ ID NO: 29 and a light chain variable sequence identical to SEQ ID NO: 27 may be referred to as antibody 12A7.
  • An antibody having a heavy chain variable sequence identical to SEQ ID NO: 33 and a light chain variable sequence identical to SEQ ID NO: 31 may be referred to as an antibody 4B4.
  • the variant antibody of the invention will compete for binding to Mcm5 with the 12A7 antibody. Similarly, in some embodiments of the invention the variant antibody of the invention will compete for binding to Mcm5 with the 4B4 antibody.
  • an antibody is ' at least 90%, 95%, 98%, 99% or 100% identicar to a second antibody if the sequences have at least 90%, 95%, 98%, 99% or 100% identity when assessed using ClustalW (Thompson et al., 1994) with the following parameters:
  • Pairwise alignment parameters -Method accurate, Matrix :P AM, Gap open penalty: 10.00, Gap extension penalty: 0.10;
  • 'Deletion' variant antibodies may comprise the deletion of 1, 2, 3, 4, 5 or more amino acids or, in some cases, the deletion of entire regions of SEQ ID NOs: 27, 29, 31 or 33.
  • 'Substitution' variants may comprise the replacement of 1, 2, 3, 4, 5 or more amino acids with the same number of new amino acids.
  • the variant antibodies of the invention comprise sequences differing from SEQ ID NOs: 27, 29, 31 or 33 by conservative amino acid substitutions (optionally only by conservative amino acid substitutions).
  • conservative amino acid substitutions are unlikely to alter the binding properties of an antibody.
  • Antibodies that compete with antibodies of the invention The invention further provides an antibody that competes with an antibody of the invention.
  • the invention provides an antibody that competes with an antibody which:
  • (iv) comprises a light chain variable region sequence having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 27 or 31.
  • the invention provides an antibody that competes with an antibody comprising 12A7 CDRH1, 12A7 CDRH2, 12A7 CDRH3, 12A7 CDRL1, 12A7 CDRL2, and 12A7 CDRL3 or an antibody comprising 4B4 CDRH1, 4B4 CDRH2, 4B4 CDRH3, 4B4
  • the invention provides an antibody that competes with an antibody comprising a heavy chain variable region having a sequence 100% identical to SEQ ID NO: 29 or 33 and a light chain variable region having a sequence 100% identical to SEQ ID NO: 27 or 31.
  • a heavy chain variable region having a sequence 100% identical to SEQ ID NO: 29 or 33 and a light chain variable region having a sequence 100% identical to SEQ ID NO: 27 or 31.
  • the invention provides an antibody that competes with antibody 12A7 or antibody 4B4.
  • an ELISA assay may be performed by immobilising the reference antibody, such as a 4B4 or a 12A7 antibody, on an ELISA plate. The plate is then blocked with a suitable blocking agent. An excess of a second antibody is added (the second antibody is the antibody whose ability to compete with the 4B4 or 12A7 antibody is to be assessed for example an antibody of the invention that competes with 4B4 or 12A7). Mcm5 is added. Following a suitable incubation period, the ELISA plate is washed and an Mcm5 detection agent is added to measure the amount of Mcm5 bound to the immobilised reference antibody.
  • the reference antibody such as a 4B4 or a 12A7 antibody
  • a suitable detection reagent is a labelled 12A7 antibody.
  • a suitable detection reagent is a labelled 4B4 antibody.
  • the concentration at which 50% inhibition occurs is known as the Ki.
  • an antibody that competes with 12A7 or 4B4 binds with a Ki 2-fold, 5-fold, 10-fold, 50-fold or 100-fold lower than an antibody which does not bind to Mcm5.
  • an antibody that competes with an antibody of the invention is an antibody that binds to the same epitope (for example SEQ ID NO: 1 or SEQ ID NO: 2).
  • An antibody of the invention may be conjugated to a label (for example Europium 3+ or Horseradish Peroxidase).
  • the label may be directly, attached or may be attached via a linker (such as Adipic Acid Dihyrazide (ADH)).
  • ADH Adipic Acid Dihyrazide
  • the label may be attached by chemical conjugation.
  • Methods of conjugating labels to antibodies are known in the art.
  • carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159) may be used to conjugate labels to antibodies.
  • Other methods for conjugating a label to an antibody can also be used.
  • sodium periodate oxidation followed by reductive alkylation of appropriate reactants can be used, as can glutaraldehyde cross-linking.
  • the antibody of the invention is labelled by conjugated to Europium. This may be achieved using an EG&G Wallac DELFIA (R) Eu-labelling kit and following the manufacturer' s protocol .
  • compositions comprising an antibody of the invention.
  • Such compositions may further comprise suitable stabilising agents that are capable of stabilising the antibody in solution.
  • the composition may comprise a buffer selected from the group consisting of TAPS (3-
  • composition comprises phosphate-buffered saline at pH 7.6.
  • the composition comprises phosphate-buffered saline with between 0.01% and 0.09% sodium azide.
  • the composition comprises agents suitable for storing the antibodies of the invention at room temperature or at a temperature less than or equal to 15°C, 10°C, 7°C, 5°C, 0°C, -10°C, or -25°C. In a preferred
  • the composition comprises agents suitable for storing the antibodies of the invention at a temperature between 2°C and 8°C.
  • the composition comprises a stabilising agent such as a sugar, for example lactose or trehalose. If the antibody of the invention is conjugated, for example to a Europium label, it is advantageous to include a 7.5% purified BSA stabiliser in the composition.
  • Nucleic acids and Vectors The invention also relates to polynucleotides comprising nucleic acid sequences that encode antibodies of the invention.
  • a polynucleotide of the invention may comprise a nucleic acid sequence that encodes any antibody as described herein.
  • the term "nucleic acid molecule" and “polynucleotide ' " are used interchangeably herein and refer to a polymeric form of nucleotides of any length, deoxyribonucleotides, ribonucleotides, or analogs thereof.
  • a nucleic acid which "encodes" a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a polynucleotide of the invention may comprise a nucleic acid that encodes an antibody comprising a variable region having a sequence at least 95% identical to SEQ ID NO: 29 or 33, or an antibody comprising a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 27 or 31.
  • a polynucleotide of the invention may encode both a polypeptide having a sequence at least 95% identical to SEQ ID NO: 29 and a polypeptide having a sequence at least 95% identical to SEQ ID NO: 27.
  • polynucleotide of the invention may encode both a polypeptide having a sequence at least 95% identical to SEQ ID NO: 33 and a polypeptide having a sequence at least 95% identical to SEQ ID NO: 31.
  • An example polynucleotide of the invention comprises or consists of a nucleic acid sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 or 34.
  • the polynucleotide of the invention comprises or consists of a nucleic acid sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 28, 30, 32 or 34.
  • the polynucleotide of the invention comprises a polynucleotide sequence having at least 95% identity to SEQ ID NO: 28 and a polynucleotide sequence having at least 95% identity to SEQ ID NO:30.
  • the polynucleotide of the invention comprises a polynucleotide sequence having at least 95% identity to SEQ ID NO: 32 and a polynucleotide sequence having at least 95% identity to SEQ ID NO: 34.
  • An antibody of the invention may thus be produced from a polynucleotide which encodes, and is capable of expressing, it.
  • a polynucleotide of the invention may encode an antibody light chain, and an antibody heavy chain or both.
  • Two polynucleotides may be provided, one of which encodes an antibody light chain and the other of which encodes the corresponding antibody heavy chain.
  • Such a polynucleotide or pair of polynucleotides may be expressed together such that an antibody of the invention is generated.
  • Polynucleotides of the invention can be synthesised according to methods well known in the art, as described by way of example in Sambrook et al (1989, Molecular Cloning - a laboratory manual; Cold Spring Harbor Press).
  • the invention further provides a vector (such as a plasmid or recombinant viral vector) comprising the polynucleotide of the invention.
  • a vector such as a plasmid or recombinant viral vector
  • the vector further comprises a control sequence operably linked to the inserted sequence, thus allowing for expression of the antibody of the invention in vivo.
  • the vector of the invention further comprises appropriate initiators, promoters, enhances and other elements which may be necessary and which are positioned in the correct orientation, in order to allow for expression of a polypeptide of the invention.
  • the present invention further provides a hybridoma cell line capable of producing an antibody of the invention.
  • a hybridoma cell line capable of producing an antibody of the invention.
  • Such a hybridoma cell line will produce the antibody of the invention when maintained in suitable culture conditions.
  • hybridoma expressing an antibody of the invention. This may be performed by immunising a mammal such as a mouse, rabbit or guinea pig, with an antigen (for example Mcm5). It may be beneficial to include an adjuvant such as Freund's complete adjuvant.
  • an adjuvant such as Freund's complete adjuvant.
  • the spleen cells of the immunised mammal are removed and fused with myeloma cells to form hybridoma lines which are immortal given appropriate conditions and which secrete antibodies.
  • the hybridomas are separated into single clones and the antibodies secreted by each clone are evaluated for their binding ability to Mcm5 protein.
  • Host cell lines The invention also provides host cells comprising the nucleic acids or vectors of the invention.
  • host cells include cells that have been modified to express an antibody of the invention.
  • Such host cells may be eukaryotic cells or prokaryotic cells.
  • the host cells may be mammalian cells, insect cells, or bacterial cells.
  • host cells that may be modified by insertion of vectors or nucleic acids of the invention include mammalian HEK293T, CHO, HeLa, NSO and COS cells.
  • bacterial cells such as E.coli may be used.
  • Such host cells may be cultured using routine methods to produce an antibody of the invention.
  • Antibodies of the invention may be produced using any method.
  • the antibodies are produced directly from a hybridoma cell line.
  • the antibodies are produced recombinantly.
  • the cell line can be cultivated in vitro, for example in a vessel such as a cell culture flask or a fermenter, and the antibody can be isolated from the vessel using conventional techniques known in the art.
  • an antibody will be considered to have been "produced by a hybridoma cell line ' " if the antibody is derived from an antibody which was produced by the hybridoma cell line.
  • Such antibodies can be considered to have been "derived” from an antibody which was produced by the hybridoma cell line.
  • antibodies of the invention are produced directly from the hybridoma cell line itself.
  • antibodies of the invention may be produced using recombinant techniques.
  • the sequence of an antibody of the invention may be used to transfect a host cell line of the invention.
  • the cell lines may be grown in a flask or a fermenter, and the antibody expressed by the cell can be isolated and purified using standard techniques (such as affinity chromatography).
  • the antibodies may then be conjugated to a radio label or immobilised to a solid support.
  • a suitable solid support is an ELISA plate.
  • Kits and methods of determining the concentration of Mcm5 in a sample are provided.
  • the antibodies of the invention may be used as part of a kit.
  • the antibodies may be part of a kit for use in detecting the concentration of Mcm5 in a sample, for example a sample from a human, this can allow detection of cancer in a subject from which the sample is taken.
  • the antibodies of the invention may be used in a method of detecting the concentration or amount of Mcm5 in a sample (also referred to as an Mcm5 detection method of the invention).
  • a method of detecting the concentration or amount of Mcm5 in a sample also referred to as an Mcm5 detection method of the invention.
  • such a method comprises the following steps:
  • step (iv) there is a wash step between steps (iv) and (v) to ensure that the second antibody whose concentration is detected in step (v) bound to the Mcm5 in step (iv).
  • step (i) there is a further wash step after step (i) to remove excess first antibody and/or after step (ii) to remove excess Mcm5.
  • the wash step is performed by exposing the solid support to a wash buffer.
  • the antibodies present in a kit or the invention or used in a method of the invention are suitable for detecting a urological cancer such as prostate cancer or bladder cancer.
  • a method of detecting the concentration or amount of Mcm5 in a sample uses, or a kit of the invention comprises, two antibodies of the invention which do not compete with one another (such as the 4B4 and 12A7 antibodies) and preferably bind to different epitopes of the antigen of interest.
  • This can be determined by performing an ELISA, such as that described above.
  • One of the two antibodies may be immobilised onto an ELISA plate. The plate is then blocked with a suitable blocking agent. An excess of the other antibody is then added (the antibody whose ability to compete with the first antibody is to be assessed).
  • the target antigen, such as Mcm5 is then added.
  • the ELISA plate is washed and a detection agent capable of binding to the target antigen is added to measure the amount of the target antigen bound to the immobilised antibody. If the two antibodies compete the amount of the target antigen bound to the immobilised antibody will be lower than if the antibodies do not compete (and, optionally, bind to different epitopes).
  • the concentration at which 50% inhibition occurs is known as the Ki.
  • an antibody that competes with another antibody binds with a Ki 2-fold, 5-fold, 10-fold, 50-fold or 100-fold lower than an antibody which does not compete.
  • an Mcm5 detection method of the invention uses, or a kit of the invention comprises, a first antibody of the invention and a second antibody of the invention.
  • the first antibody may bind (optionally bind specifically) to SEQ ID NO: 1 and the second antibody may bind (optionally bind specifically) to SEQ ID NO: 2.
  • the first antibody may comprise at least one CDR selected from the group consisting of 12A7 CDRH1, 12A7 CDRH2, 12A7 CDRH3, 12A7 CDRL1, 12A7 CDRL2, and 12A7 CDRL3.
  • the second antibody may comprise at least one CDR selected from the group consisting of
  • the first antibody comprises 12A7 CDRH1, 12A7 CDRH2, 12A7 CDRH3, 12A7 CDRL1, 12A7 CDRL2, and 12A7 CDRL3.
  • the second antibody comprises 12A7 CDRH1, 12A7 CDRH2, 12A7 CDRH3, 12A7 CDRL1, 12A7 CDRL2, and 12A7 CDRL3.
  • the first antibody comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 29 and a light chain variable region sequence having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 27.
  • the second antibody comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 33 and a light chain variable region sequence having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 31.
  • a DELFIA detection system may be used in an Mcm5 detection method of the invention.
  • the first antibody and the second antibody preferably bind different epitopes.
  • one of the antibodies can be immobilised on a plate. A sample to be tested can be added to the plate.
  • the other antibody (the first or the second antibody which was not immobilised to the plate) can then be added.
  • the other antibody should be conjugated to a detection agent such as a Europium label.
  • Time-resolved fluorescent spectroscopy can then be used to determine whether the target antigen is present (by measuring the amount of the labelled antibody that is present).
  • a kit of the invention comprises a first or second antibody of the invention which is conjugated to a radiolabel, for example
  • kits for performing such labelling are available.
  • the first or second monoclonal antibody may be conjugated to Europium using an Eu-NI-ITC chelate.
  • a kit of the invention may comprise further components for use in a DELFIA detection system.
  • Such further components may include a DELFIA enhancement solution or a DELFIA detection solution Definitions
  • a verified IMAGE clone containing the human MCM5 cDNA was obtained and used as a PCR template in order to amplify a 648bp fragment of DNA.
  • the forward PCR primer encoded n initiation codon as well as a modified unpatented poly-Histidine tag (HQ)4.
  • the PCR fragment was cloned into the inducible expression E. coli vector pTRC99a using a double restriction site strategy.
  • This vector allows inducible expression directed by the hybrid trpllac "trc” promoter.
  • Downstream is a lacZ ribosome binding site (RBS) that is situated at an optimized distance from an initiation ATG codon, which is supplied by the Ncol cloning site.
  • RBS lacZ ribosome binding site
  • Stage II A Expression and Purification (small scale - 10ml)
  • the recombinant plasmid containing the Mcm5 fragment was transformed into BL21 E. coli ( ⁇ - ⁇ 3) to ensure high yields of expressed protein.
  • the identified clone with high levels of recombinant protein was cultured at the 0.5L scale and induced with IPTG. Cells were pelleted and stored at -70°C. Cells were disrupted in a denaturing lysis buffer described by Stoeber et al. J Natl Cancer Inst 2002
  • His-tagged recombinant protein was affinity purified under denaturing conditions on an immobilized metal affinity (IMAC) chromatography column. Protein were eluted using an acidic buffer and dialysed against storage buffer (PBS containing 0.3 SDS)
  • Protein A purified MAbs were obtained from the Welcome/CRUK Institute for Cancer and Developmental Biology. These antibodies were screened for their ability to bind to Mcm5.
  • Ni-NTA His-Sorb 96 well microtitre coated plate wells Qiagen.
  • the Ni-NTA coated plates, pre-blocked with BSA, ensure an orientated presentation of the 6x His tagged Mem through Nickel affinity binding to the spacer in comparison to the random presentation of the Mcm5 to the well that would be achieved by passive adsorption plate coating.
  • the Mcm5 at a concentration of 625 ng/ml was Nickel affinity immobilised to Ni-NTA His-Sorb surface (Qiagen) of a 96 well plate at 200 ⁇ /well resulting in 125 ng foMcm5/well.
  • the Mcm5 Ag-Ab complexes of the MAbs were detected by a colorimetric ELISA using goat anti-mouse IgG conjugated to HRP, TMB reagent and 1M H2SO4 assay stop solution, for the measurement of light absorbance at 450 nanometres (Abs 450 nm).
  • An absence of Non-specific binding (NSB) of goat anti-mouse HRP conjugate to the Ni-NTA His-Sorb surface and Mcm5 was excluded byperforming the ELISA on wells free from MAbs.
  • the degree of NSB of the mouse MAbs being screened to the Ni-NTA coated polystyrene wells was established by performing the ELISA in wells with the omission of Mcm5 wells in parallel to performing the ELISA in wells with the Nickel affinity immobilisation of Mcm5 to the microtitre wells.
  • the selected MAb hybridomas were grown up to produce IgG for purification from the culture supernatant using solid-phase protein-A separation according to the manufacturer's instructions (Amersham Pharmacia Biotech Little Chalfont
  • Relative affinities of the protein A purified MAbs were determined by normalisation of Ab concentrations and application of the MAbs to the colorimetric screening assay under Ag- limiting conditions.
  • Ag limiting conditions were determined by linear titration of Mcm5 across the Ni-NTA His-Sorb microtitre plate wells. An observed maximal Abs 450 nm of ⁇ 3.000 is indicative of Ag limiting conditions, because the maximum Abs 450 reading obtainable when Ag is non-limiting is 4.000.
  • the Ag titration was performed using rabbit Mcm5 PAb (101) and Goat anti Rabbit HRP to measure ELISA response. A concentration that gave 25 ng of Mcm5 available for binding to each Ni-NTA well was limiting to the ELISA Abs 450 response of the PAb.
  • the rabbit PAb was chosen to determine Ag-limiting conditions for investigation of the mouse MAbs, as the full array of Mcm5 epitopes are bound by the PAb. This ensured that the MAbs could be investigated in combined incubation studies to determine the degree of epitope competition.
  • the concentration of IgG in the protein-A purified MAb solutions was determined by Abs
  • two MAbs that are targeted to distinct epitopes are required.
  • a pair of MAbs competing for the same epitope will provide an ELISA Abs 450 nm measurement equal to the Abs 450 nm signal of the higher relative affinity Ab when it is incubated in the absence of the competing MAb, however, incubation of a pair of MAbs targeted to distinct epitopes will provide an Abs 450 measurement equal to the sum of both the MAbs individual Abs 450 nm responses to the limited Ag available provided there is an absence of steric hindrance.
  • Antibody epitope competition results show that the MAb 4B4 is targeted to a distinct epitope compatible for two-site binding with the 12A7.
  • the distinct epitope targeted by 4B4 is demonstrated by the Abs 450 response' being equal to the sum of both MAbs binding to the limiting Ag when 4B4 was incubated in parallel to the other MAbs.
  • the MAbs were incubated at a normalised concentration of 20 ng/well, the 50% maximum binding concentration of the MAb with the highest relative affinity 12A7.
  • the optimal MAbs for two-site immunoassay development are highlighted in blue, and their ELISA Abs 450 responses highlighted in yellow.
  • Control Antibodies Monoclonal anti-HA (12CA5)-DyLight680 (1:1000), monoclonal anti-FLAG(M2)-DyLight800 (1:500); staining in
  • Pre-staining of one of the peptide microarrays was done with the secondary goat anti- mouse IgG (H+L) DyLight680 antibody at a dilution of 1 :5000 to investigate background interactions with the antigen-derived peptides that could interfere with the main assays.
  • Subsequent incubation of the peptide microarrays with mouse monoclonal IgG antibodies 12A7 and 4B4 at concentrations of 1 ⁇ g/ml and 10 ⁇ g/ml in incubation buffer was followed by staining with the secondary antibody and read-out at a scanning intensity of 5 (red).
  • HA and Flag control peptides framing the peptide arrays were finally stained as internal quality control to confirm the assay quality and the peptide microarray integrity (scanning intensities red/green: 5/7).
  • a software algorithm breaks down fluorescence intensities of each spot into raw, foreground and background signal and calculates the standard deviation of foreground median intensities. Based on averaged foreground median intensities, intensity maps were generated and interactions in the peptide maps highlighted by an intensity color code with red for high and white for low spot intensities.
  • one of the peptide microarrays was initially incubated with the secondary goat anti-mouse IgG (H+L) DyLight680 antibody at a dilution of 1 :5000 for 30 min at room temperature to analyze background interactions with the antigen-derived peptides. At a scanning intensity of 5, we did not observe any background due to non-specific binding of the secondary antibody. Data quantification with PepSlide ® Analyzer was neither possible nor required, since the absence of any spot pattern hampered alignment of the microarray grid.
  • the peptide microarrays were incubated with mouse monoclonal antibody 12A7 at concentrations of 1 ⁇ g/ml and 10 ⁇ g/ml (top right). After each incubation, staining with the secondary goat anti-mouse IgG (H+L) DyLight680 antibody was followed by read-out at a scanning intensity of 5. We observed a strong and well-defined epitope-like spot pattern formed by a row of neighbored peptides with a consensus motif at excellent signal to noise ratios.
  • the peptide microarrays were incubated with mouse monoclonal antibody 4B4 at concentrations of 1 ⁇ g/ml) and 10 ⁇ g/ml. After each incubation, staining with the secondary goat anti-mouse IgG (H+L) DyLight680 antibody was followed by read-out at a scanning intensity of 5.
  • H+L secondary goat anti-mouse IgG
  • DyLight680 antibody was followed by read-out at a scanning intensity of 5.
  • the raw intensities of the epitope- like spot pattern were similar but the background interactions were slightly increased indicating a signal saturation of the antibody in the concentration range of 1 - 10 ⁇ g/ml.
  • the final staining of the HA and Flag control peptides framing the peptide microarray gave rise to the expected and well-defined spot pattern and
  • SEQ ID NO: 34 TAGGTGAAACTGCAGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAA CTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATGCCATGTCTTGGGTTCGCCA GAATCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTCGTGGTGGTAGTTACAC CTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAAC ACCCTGTATCTGCAAATGAACAGTCTGAGGTCTGAGGACACGGCCATGTATTTCTGTG CAAGACATGGATATAATTACGACGACGGGGCCTGGTTTGCTAACTGGGGCCAAGGGA CTCTGGTCACTGTCTCTGCA
  • MSGFDDPGIF YSDSFGGDAQ ADEGQARKSQ LQRRFKEFLR QYRVGTDRTG FTFKYRDELK 70 80 90 100 110 120
  • MCM5 Homo sapiens minichromosome maintenance complex component 5 (MCM5), mRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/GB2016/051609 2015-06-08 2016-06-01 Monoclonal antibodies binding mcm5 Ceased WO2016198834A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US15/580,667 US20180186892A1 (en) 2015-06-08 2016-06-01 Monoclonal antibodies binding mcm5
JP2017564337A JP2018520127A (ja) 2015-06-08 2016-06-01 Mcm5に結合するモノクローナル抗体
CN201680033481.3A CN107810200B (zh) 2015-06-08 2016-06-01 结合mcm5的单克隆抗体
ES16727798.7T ES2678049T3 (es) 2015-06-08 2016-06-01 Anticuerpos monoclonales de unión a mcm5
EP16727798.7A EP3221352B1 (en) 2015-06-08 2016-06-01 Monoclonal antibodies binding mcm5
US17/174,268 US20210277142A1 (en) 2015-06-08 2021-02-11 Monoclonal antibodies binding mcm5

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1509907.0A GB201509907D0 (en) 2015-06-08 2015-06-08 Antibodies
GB1509907.0 2015-06-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/580,667 A-371-Of-International US20180186892A1 (en) 2015-06-08 2016-06-01 Monoclonal antibodies binding mcm5
US17/174,268 Continuation US20210277142A1 (en) 2015-06-08 2021-02-11 Monoclonal antibodies binding mcm5

Publications (1)

Publication Number Publication Date
WO2016198834A1 true WO2016198834A1 (en) 2016-12-15

Family

ID=53785114

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/051609 Ceased WO2016198834A1 (en) 2015-06-08 2016-06-01 Monoclonal antibodies binding mcm5

Country Status (8)

Country Link
US (2) US20180186892A1 (cg-RX-API-DMAC7.html)
EP (1) EP3221352B1 (cg-RX-API-DMAC7.html)
JP (3) JP2018520127A (cg-RX-API-DMAC7.html)
CN (1) CN107810200B (cg-RX-API-DMAC7.html)
ES (1) ES2678049T3 (cg-RX-API-DMAC7.html)
GB (1) GB201509907D0 (cg-RX-API-DMAC7.html)
TR (1) TR201808196T4 (cg-RX-API-DMAC7.html)
WO (1) WO2016198834A1 (cg-RX-API-DMAC7.html)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201509907D0 (en) * 2015-06-08 2015-07-22 Urosens Ltd Antibodies
GB201820867D0 (en) * 2018-12-20 2019-02-06 Arquer Diagnostics Ltd Detection method
GB201820868D0 (en) * 2018-12-20 2019-02-06 Arquer Diagnostics Ltd Detection method
GB201912605D0 (en) * 2019-09-02 2019-10-16 Arquer Diagnostics Ltd Cancer assay
CN118359714B (zh) * 2024-06-14 2024-10-22 浙江莱阅病理诊断科技有限公司 一种抗mcm2鼠单克隆抗体及其制备方法和免疫组化试剂的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021014A1 (en) * 1997-10-21 1999-04-29 Cancer Research Campaign Technology Limited Determination of cellular growth abnormality
WO2005026211A2 (en) * 2003-09-05 2005-03-24 Eli Lilly And Company Anti-ghrelin antibodies
WO2008132453A1 (en) * 2007-04-25 2008-11-06 Medella Therapeutics Limited Antibodies against ramp3

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201509907D0 (en) * 2015-06-08 2015-07-22 Urosens Ltd Antibodies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021014A1 (en) * 1997-10-21 1999-04-29 Cancer Research Campaign Technology Limited Determination of cellular growth abnormality
WO2005026211A2 (en) * 2003-09-05 2005-03-24 Eli Lilly And Company Anti-ghrelin antibodies
WO2008132453A1 (en) * 2007-04-25 2008-11-06 Medella Therapeutics Limited Antibodies against ramp3

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MAXIMILIAN BURGER: "MCM2 and MCM5 as Prognostic Markers in Colon Cancer: A Worthwhile Approach", DIGESTIVE DISEASES AND SCIENCES, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 54, no. 2, 21 August 2008 (2008-08-21), pages 197 - 198, XP019673457, ISSN: 1573-2568 *
STOEBER KAI ET AL: "Diagnosis of genito-urinary tract cancer by detection of minichromosome maintenance 5 protein in urine sediments", JOURNAL OF THE NATIONAL CANCER INSTITUTE, OXFORD UNIVERSITY PRESS, GB, vol. 94, no. 14, 17 July 2002 (2002-07-17), pages 1071 - 1079, XP009122537, ISSN: 0027-8874, DOI: 10.1093/JNCI/94.14.1071 *
T J DUDDERIDGE ET AL: "Diagnosis of prostate cancer by detection of minichromosome maintenance 5 protein in urine sediments", BRITISH JOURNAL OF CANCER, vol. 103, no. 5, 24 August 2010 (2010-08-24), GB, pages 701 - 707, XP055294840, ISSN: 0007-0920, DOI: 10.1038/sj.bjc.6605785 *

Also Published As

Publication number Publication date
JP2018520127A (ja) 2018-07-26
EP3221352B1 (en) 2018-05-09
US20210277142A1 (en) 2021-09-09
JP2020156486A (ja) 2020-10-01
CN107810200A (zh) 2018-03-16
US20180186892A1 (en) 2018-07-05
ES2678049T3 (es) 2018-08-08
CN107810200B (zh) 2021-04-06
EP3221352A1 (en) 2017-09-27
JP2022165963A (ja) 2022-11-01
TR201808196T4 (tr) 2018-07-23
GB201509907D0 (en) 2015-07-22

Similar Documents

Publication Publication Date Title
US20210277142A1 (en) Monoclonal antibodies binding mcm5
US9429577B2 (en) Anti-uroplakin II antibodies systems and methods
US20220260588A1 (en) Methods and kits
US9428576B2 (en) Anti-p40 antibodies systems and methods
US8632984B2 (en) RBM3 as a marker for malignant melanoma prognosis
CA2653952A1 (en) Use of protein satb2 as a marker for colorectal cancer
WO2012154983A2 (en) Systems and methods for anti-pax8 antibodies
CN102803968B (zh) 食道癌标志物
KR20120095301A (ko) 항-사이토케라틴 8/18 복합체 자가면역항체를 포함하는 암 진단 마커 및 이의 항원을 포함하는 암 진단용 조성물
KR20120116518A (ko) 폐암 조기 진단용 XAGE-1a 마커 및 이의 용도
JP7709703B2 (ja) 膵臓がんの検出方法及び検出試薬
JP4560314B2 (ja) 中性アミノ酸トランスポーターによる癌の検出法、及びそのためのキット
WO2007138143A2 (es) Anticuerpos monoclonales anti-colina quinasa alfa y su uso en técnicas analíticas, de diagnóstico del cáncer y en la preparación de medicamentos
US8080384B2 (en) Method for determination of prognosis of prostate cancer, and diagnostic agent for use in the method
EP2055717A1 (en) Prognostic method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16727798

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
REEP Request for entry into the european phase

Ref document number: 2016727798

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017564337

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE