WO2016196741A2 - Low intensity focused ultrasound for treating cancer and metastasis - Google Patents

Low intensity focused ultrasound for treating cancer and metastasis Download PDF

Info

Publication number
WO2016196741A2
WO2016196741A2 PCT/US2016/035440 US2016035440W WO2016196741A2 WO 2016196741 A2 WO2016196741 A2 WO 2016196741A2 US 2016035440 W US2016035440 W US 2016035440W WO 2016196741 A2 WO2016196741 A2 WO 2016196741A2
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
ultrasound
lofu
subject
transducers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/035440
Other languages
English (en)
French (fr)
Other versions
WO2016196741A3 (en
Inventor
Chandan Guha
Stephen Barry
Fernando Macian
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Montefiore Medical Center
Albert Einstein College of Medicine
Original Assignee
Montefiore Medical Center
Albert Einstein College of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Montefiore Medical Center, Albert Einstein College of Medicine filed Critical Montefiore Medical Center
Priority to CN201680045882.0A priority Critical patent/CN108601554B/zh
Priority to CN202210152097.2A priority patent/CN114886412B/zh
Priority to JP2017563052A priority patent/JP6819012B2/ja
Priority to EP16804398.2A priority patent/EP3302264B1/en
Priority to US15/578,892 priority patent/US10974077B2/en
Publication of WO2016196741A2 publication Critical patent/WO2016196741A2/en
Publication of WO2016196741A3 publication Critical patent/WO2016196741A3/en
Anticipated expiration legal-status Critical
Priority to US17/191,497 priority patent/US12011619B2/en
Priority to US18/658,055 priority patent/US20240366964A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00Measuring for diagnostic purposes; Identification of persons
    • A61B5/06Devices, other than using radiation, for detecting or locating foreign bodies ; Determining position of diagnostic devices within or on the body of the patient
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00Measuring for diagnostic purposes; Identification of persons
    • A61B5/48Other medical applications
    • A61B5/4836Diagnosis combined with treatment in closed-loop systems or methods
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B8/00Diagnosis using ultrasonic, sonic or infrasonic waves
    • A61B8/08Clinical applications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
    • A61K41/0028Disruption, e.g. by heat or ultrasounds, sonophysical or sonochemical activation, e.g. thermosensitive or heat-sensitive liposomes, disruption of calculi with a medicinal preparation and ultrasounds
    • A61K41/0033Sonodynamic cancer therapy with sonochemically active agents or sonosensitizers, having their cytotoxic effects enhanced through application of ultrasounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N5/10X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N5/10X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
    • A61N5/1077Beam delivery systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N7/02Localised ultrasound hyperthermia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B18/00Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body
    • A61B2018/00005Cooling or heating of the probe or tissue immediately surrounding the probe
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B18/00Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body
    • A61B2018/00005Cooling or heating of the probe or tissue immediately surrounding the probe
    • A61B2018/00011Cooling or heating of the probe or tissue immediately surrounding the probe with fluids
    • A61B2018/00023Cooling or heating of the probe or tissue immediately surrounding the probe with fluids closed, i.e. without wound contact by the fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B90/00Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups A61B1/00 - A61B50/00, e.g. for luxation treatment or for protecting wound edges
    • A61B90/36Image-producing devices or illumination devices not otherwise provided for
    • A61B90/37Surgical systems with images on a monitor during operation
    • A61B2090/374NMR or MRI
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B90/00Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups A61B1/00 - A61B50/00, e.g. for luxation treatment or for protecting wound edges
    • A61B90/36Image-producing devices or illumination devices not otherwise provided for
    • A61B90/37Surgical systems with images on a monitor during operation
    • A61B2090/378Surgical systems with images on a monitor during operation using ultrasound
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N2005/002Cooling systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N5/10X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
    • A61N5/1048Monitoring, verifying, controlling systems and methods
    • A61N5/1049Monitoring, verifying, controlling systems and methods for verifying the position of the patient with respect to the radiation beam
    • A61N2005/1061Monitoring, verifying, controlling systems and methods for verifying the position of the patient with respect to the radiation beam using an x-ray imaging system having a separate imaging source
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N5/10X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
    • A61N2005/1092Details
    • A61N2005/1098Enhancing the effect of the particle by an injected agent or implanted device
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0004Applications of ultrasound therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0043Ultrasound therapy intra-cavitary
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0056Beam shaping elements
    • A61N2007/0065Concave transducers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0073Ultrasound therapy using multiple frequencies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0078Ultrasound therapy with multiple treatment transducers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0086Beam steering
    • A61N2007/0091Beam steering with moving parts, e.g. transducers, lenses, reflectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N7/00Ultrasound therapy
    • A61N2007/0086Beam steering
    • A61N2007/0095Beam steering by modifying an excitation signal

Definitions

  • Induction of a hyporesponsive state to tumor antigens occurs both in CD4+ and CD8+ T cell populations and is often responsible for the inability of the adaptive immune system to mount an efficient anti-tumor response (16-18).
  • Decreased T cell responses to tumor antigens occur in both solid and hematological tumors and appear to be caused by inefficient presentation of antigens by dendritic cells, which results in the preferential activation of tolerogenic programs of gene expression that are dependent on the transcription factors NFAT and Egr2 (18-21).
  • the important role of this process of tumor- induced T cell hyporesponsiveness is underscored by the fact that genetic mouse models where the induction of this tolerogenic gene expression program is prevented result in enhanced anti-tumor T cell responses and control of tumor growth (19, 21).
  • FUS focused ultrasound
  • HIFU High intensity focused ultrasound
  • HIFU thermally induced coagulative necrosis resulting from HIFU treatment can also attenuate the release of immunostimulatory molecules within the tumor microenvironment.
  • HIFU might fail to protect against local and distant metastases arising from the surviving tumor cells.
  • the present invention provides improved tumor and cancer treatments employing low intensity focused ultrasound, and methods of inducing chemosensitization and increasing the efficacy of cancer otherapy treatments.
  • a method for increasing the efficacy of a chemotherapy in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic drug, wherein the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell, wherein the amounts (i) and (ii) together are sufficient to increase the efficacy of the chemotherapy.
  • LOFU low intensity focused ultrasound
  • a chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell
  • a method of increasing the efficacy of a chemotherapy in a predetermined volume of tissue in a subject which volume is less than the whole subject comprising (i) administering to the subject an amount of a chemotherapeutic drug, wherein the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell and (ii) administering to the predetermined volume of tissue in a subject an amount of low intensity focused ultrasound (LOFU), wherein the amounts of (i) and (ii) together are sufficient to increase efficacy of the chemotherapy within the predetermined volume of tissue.
  • ER endoplasmic reticulum
  • UMR unfolded protein response
  • a method of treating a tumor in a subject comprising:
  • a method of treating a chemoresistant tumor in a subj ect, wherein the tumor has become chemoresistant to a previously administered chemotherapeutic drug comprising:
  • LOFU low intensity focused ultrasound
  • Acoustic priming therapy (APT) systems comprise transducers configured to produce acoustic power between 10 and 1000 W/cm 2 spatial peak temporal average intensity (Ispta) in a treatment zone, wherein the frequency of the ultrasound is in the range of 0.01 to 10 MHz, the mechanical index is less than 4 and the ulstrasound is applied continuously from a time in the range of 0.5 to 5 seconds for any particular volume in the treatment zone.
  • Such treatments are identified herein as acoustic priming therapy (APT) treatments.
  • An acoustic priming therapy device comprises: a control system that generates a frequency waveform; and one or more transducers each configured to produce ultrasonic beams based on the frequency waveform with a peak frequency in the range of 0.5 to 5 MHz and an acoustic output intensity of between 20 and 1000 W/cm 2 .
  • each transducer is configured to produce columnated ultrasound such that the beam profile waist at -3dB is not less than 5 mm in a treatment zone.
  • two or more transducers can be operated sequentially or simultaneously and produce ultrasound of average spatial peak 250 J/cm 2 in a treatment zone during a treatment period.
  • the transducers are operated in continuous mode wherein ultrasound is produced in a treatment zone for a treatment period in the range of 0.1 to 10 seconds.
  • a system comprises: an acoustic priming therapy device comprising: a control system that generates a frequency waveform; and one or more transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (I sp ta) m a treatment zone, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz; a radiotherapy treatment machine; and a control system operatively configured to control the acoustic priming therapy device and the radiotherapy treatment machine so that a first amount of the ultrasound and a second amount of radiotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • I sp ta spatial peak temporal average acoustic output intensity
  • a system comprises: an acoustic priming therapy device comprising: a control system that generates a frequency waveform; and one or more transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (Ispta) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz; the acoustic priming therapy device for use in combination with chemotherapy so that a first amount of the ultrasound and a second amount of the chemotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • Ispta spatial peak temporal average acoustic output intensity
  • a system comprises: an acoustic priming therapy device comprising: a control system that generates a frequency waveform; and one or more transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (Ispta) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz; the acoustic priming therapy device for use in combination with immunotherapy so that a first amount of the ultrasound and a second amount of the immunotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • Ispta spatial peak temporal average acoustic output intensity
  • a method of treating a tumor in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy or an amount of radiotherapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat a tumor.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of inhibiting metastasis of a tumor in a subject comprising administering to a subject having a tumor an amount of low intensity focused ultrasound (LOFU) and an amount of a radiotherapy, wherein the amounts together are sufficient to treat a tumor.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of reducing the effective dose of an anti-cancer chemotherapy required to treat a tumor in a subject comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat a tumor.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy comprising administering to the subject, prior to or during the course of the anti-cancer therapy, an amount of an acoustic priming therapy effective to sensitize a tumor in a subject to an amount of an additional anti-cancer therapy modality.
  • a method of treating a tumor in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) with LOFU herein indicating an exemplary embodiment of an ultrasound configuration used in an APT system, and (ii) an amount of chemotherapy or an amount of radiotherapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat a tumor.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of inhibiting metastasis of a tumor in a subject comprising administering to a subject having a tumor an amount of low intensity focused ultrasound (LOFU) and an amount of a radiotherapy, wherein the amounts together are sufficient to inhibit metastasis of a tumor in a subject.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of reducing the effective dose of an anti-cancer chemotherapy required to treat a tumor in a subject comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat a tumor.
  • LOFU low intensity focused ultrasound
  • Also provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy comprising administering to the subject, prior to or during the course of the anti-cancer therapy, an amount of low intensity focused ultrasound (LOFU) effective to sensitize a tumor in a subject to an amount of an anti-cancer therapy.
  • LOFU low intensity focused ultrasound
  • FIG. 1A-1F Melanoma tumors suppress cytokine output of CD4+ T cells: 1A- B: C57B1/6 mice were challenged in the lumbar flanks with 3xl0 5 B16-F1 melanoma cells. Tumors were allowed to grow to 7-8 mm 3 in size. CD4+T cells were isolated from the tumor DLN and distal contralateral NDLN, and stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 and IFNy were measured by ELISA. CD4+T cells from tumor-free mice were used as controls. 1C-D: OTII mice were challenged with 3xl0 5 B16-F1-OVA melanoma cells as described.
  • T cells were stimulated with OVA323-339 peptide-loaded splenocytes and IL-2 and IFNy production measured by ELISA. 1E-F.
  • B16-F1 cells were used to induce tumors in Tyrpl mice as described above.
  • Isolated CD4+ T cells were stimulated with anti-CD3 and anti-CD28 antibodies and IL-2 and IFNy production determined by ELISA.
  • Graphs show mean+SEM from 4 (1A-B) or 3 (1C-F) independent experiments. Results are shown as mean+SEM from 3-5 mice for each experiment. Data were analyzed using ANOVA with a Tukey post-test (***P ⁇ 0.01 ; **P ⁇ 0.01 ; *P ⁇ 0.05).
  • FIG. 2A-2D Treatment of melanoma tumors with LOFU overcomes tumor induced CD4+ T cell tolerance: 2A-B. Tumors were induced in C57B1/6 mice by s.c. injection of 3xl0 5 B16-F1 melanoma cells in the lumbar flank. Tumors were left untreated or treated with LOFU. Thirty-six hours after FUS treatment, CD4+ T cells were isolated from tumor DLN or NDLNs and stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 and IFNy production was assessed by ELISA.
  • mice The results (total cytokine production and ratio of the levels of cytokines produced by T cells from NDLN and DLN in each group) are presented as mean+SEM from 3 different mice per condition. Differences between cytokine production of DLN T cells in untreated or treated mice were analyzed using a 2- tailed t test (*P ⁇ 0.05). 2C. Mice were challenged with 3x10 5 B16 melanoma cells to induce tumors. Following tumor development total RNA samples were extracted from CD4+T cells isolated from the DLN and NDLN of tumor-bearing mice, and tumor-free control mice. Expression of anergy-associated genes was measured by quantitative RT-PCR.
  • the results are shown as fold induction of gene expression in the DLN or NDLN resident T cells in tumor bearing mice compared to T cells isolated from tumor-free mice.
  • the data represent mean+SEM from 3 independent experiments.
  • 2D B16-F1 melanoma tumors were induced in Tyrpl mice that were then left untreated or treated with LOFU.
  • the expression of different anergy-associated genes was measured by RT-PCR in CD4+ T cells isolated from the DLNs and NDLNs. Expression of the anergy-associated genes is presented as fold induction (mean+SEM from 5 independent experiments) over the values obtained in T cells from Tyrpl mice bearing no tumor.
  • FIG. 3A-3B Ly sates from LOFU-treated B16-F1 melanoma tumors can reverse the hyporesponsive state of anergic T cells 3A.
  • Naive CD4+T cells were isolated from spleens and lymph nodes of Tyrpl mice, and differentiated into TH1 cells. Cells were then either left untreated or treated with anti-CD3 alone for 16 hours to induce anergy. Cells were then rested for 72 hours in strict absence of IL-2 and re-stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 levels were measured by ELISA. The results are shown as mean+SEM from 2 independent experiments. 3B.
  • CDl lc+ dendritic cells were isolated from spleens of tumor-free Tyrpl mice.
  • Anergic TH1 cells generated from Tyrpl mouse- derived CD4+T cells as described in (3A) were co-cultured with the dendritic cells and tumor ly sates derived from untreated or LOFU-treated B16-F1 melanoma tumors.
  • Supernatants were collected after 24 hours and assayed for IL-2 by ELISA. Results are shown as mean+SEM from 2 independent experiments with 3 independent sets of tumor lysates used in each experiment. Data were analyzed using ANOVA with a Tukey post-test (**P ⁇ 0 .01).
  • FIG. 4A-4D FUS treatment causes changes in expression and cellular distribution of Hsp70 and calreticulin in B16-F1 melanoma cells.
  • 4A Total DLNs resident cells from untreated and LOFU-treated B16-F1 melanoma-bearing mice were isolated and immunostained for CDl lc to gate dendritic cells. Surface expression of B7.1, B7.2 and MHCII was then assessed by flow cytometry. Appropriate isotype controls were used for each primary antibody. Representative histograms are shown.
  • 4B Representative FACS dot plot of B16 tumor cell suspension obtained from untreated or LOFU treated mice were stained with a viability marker (Live/dead Mk).
  • FIG. 5A-5B FUS treatment of melanoma tumors potentiate dendritic cell- mediated priming of CD4+ T cells: 5A.
  • CDl lc+ splenic dendritic cells were purified from C57B1/6 mice and co-cultured with responder naive CD4+ T cells isolated from OT-II mice.
  • B16-F1-OVA melanoma tumor ly sates were prepared from untreated or LOFU treated tumor-bearing mice and added to the respective cultures to drive dendritic cell mediated T cell stimulation. In separate samples exogenous OVA 3 2 3 -339 peptide was also added along with tumor lysates.
  • FIG. 6A-6D FUS followed by hypofractionated IGRT results in T-cell mediated long term primary tumor control and reduced distal metastases: 6A C57B1/6 mice with 50 mm 3 subcutaneous dorsal right hind limb tumors were separated into one of four treatment groups: untreated, LOFU, hypofractionated IGRT, or LOGU+IGRT and tumor growth monitored for 62 days or until primary tumor grew beyond 300 mm 3 . Graph shows mean+SEM of tumor volume from one of two representative experiments (3-5 mice per group). Data were analyzed with either one-way ANOVA followed by a Bonferroni correction post test (before day 29) or by 2-tailed student t test (after day 29).
  • FIG. 7A-7G LOFU induces OPR.
  • 7A LOFU increases the expression of Bip/Grp78 and EDEM mRNAs.
  • Real Time-PCR analysis of RNA isolated from LGFU- treated RM1 tumors showed 29.73 ⁇ 0.56 fold increase in Bip/Grp78 and 9 27 : 1 . 1 8 fold increase in EDEM mRNA level compared to untreated control.
  • 7B LOFU increases the expression of IREla mRNA by 2.8 ⁇ 0.4 folds. Real Time-PCR analysis demonstrates that LOFU induced increase in the IREl a expression did not alter with the 17AAG treatment.
  • 7C LOFU induced the splicing of XBPl mRNA.
  • 17AAG treatment inhibits the splicing of XBP l.
  • XBPls, XBPlh, and XBPlu denote the spliced, hybrid, and un-spliced forms of XBPl, respectively.
  • LOFU+17AAG combination therapy prolongs ER stress in RM1 tumor cells.
  • Western blot and bar chart showing that the expression of ERP78 (7D & 7E), ERP57 (7D & 7F), and ERp44 (7D & 7G) proteins was induced in combination treatment group.
  • FIG. 8A-8E LOFU+17AAG activates pro-apoptotic pathways of UPR and induces apoptosis in tumor cells.
  • 8A & 8B Western blot of pPERK (8A) and peIF2a (8B).
  • LOFU+17AAG activates PERK by phosphorylation of PERK (pPERK), which further induces the phosphorylation of eIF2a phosphorylation (peIF2a).
  • 8C Real Time-PCR analysis of CHOP mRNA. There was a 25 ⁇ 1.3-fold increase in CHOP transcript in LOFU+17AAG treated group, compared to control.
  • 8D Real Time-PCR array of RNA isolated from LOFU+17AAGtreated tumors.
  • Heat map analysis showed that LOFU+17AAG treatment group increased the transcript level of apoptotic genes several folds compared to untreated control or LOFU groups.
  • 8E TUNEL staining. Immunohistochemical staining showed predominantly tunel positive cells in LOFU+17AAG treatment group, compared to control or LOFU group. Note that 17AAG alone also induced apoptosis in tumor tissue that was augmented by LOFU.
  • Figure 9A-9C LOFU+17AAG treatment inhibits Chaperone Mediated Autophagy (CMA) in RMl tumor cells.
  • CMA Chaperone Mediated Autophagy
  • 9A & 9B Immunoblot analysis showed several fold down-regulation of SMA marker LAMP2a expression level in combination treatment group. Treatment with either LOFU or 17AAG upregulates the LAMP2a expression level.
  • 9A & 9C Combination treatment of LOFU and 17AAG did not alter the expression level of Beclin, a macroautophagy marker.
  • FIG. 10A Treatment schema. Palpable tumors were treated with LOFU every 3-4 days for five fractions administered over two weeks. Animals received 17AAG three times a week during this time. Tumors were harvested 24 hours after the last fraction of LOFU. 10B. RMl tumor. In C57B16 mice, LOFU+17AAG combination treatment reduced RMl tumor growth significantly (p ⁇ 0.004), compared to controls. Note that either LOFU or 17AAG alone failed to control tumors significantly. LOFU sensitized the effects of a low dose (25mg/kg of body weight) 17AAG. IOC. PC3 tumor. In BalbC nu/nu mice LOFU+17AAG combination treatment showed significant reduction in PC3 tumor growth (p ⁇ 0.007).
  • Figure 11A-11F LOFU+17AAG treatment reduces the expression of prostate cancer stem cell markers in RMl cells.
  • Flow cytometry of isolated RMl tumor cells showed significant decrease in SCA1 (11 A & 11B), CD44 (11 A & 11C), CD133 (11 A & 11D), and ⁇ 2 ⁇ 1 integrin (11A & HE) cell surface expression on RMl tumor cells after LOFU+17AAG treatment.
  • (1 IF) qRT-PCR array followed by heat map analysis showed that LOFU+17AAG combination treatment group down-regulates the mRNA levels of stem cell transcription factors.
  • FIG. 12 is a block diagram of an APT device according to an exemplary embodiment of the present invention.
  • FIG. 13 is a block diagram of an APT device according to another exemplary embodiment of the present invention.
  • FIG. 14 is a block diagram of an APT device according to another exemplary embodiment of the present invention.
  • FIGS. 15-17 are block diagrams of APT devices according to exemplary embodiments of the present invention including an integrated ultrasound imaging device.
  • FIG. 18 is a perspective view of a transducer according to an exemplary embodiment of the present invention.
  • FIG. 19 illustrates a positioning apparatus according to an exemplary embodiment of the present invention.
  • an ultrasound (US) therapy that delivers a reduced level of energy to a treatment zone compared to HIFU configurations.
  • the treatment of a particular lesion volume is for a short time (e.g. -1.5 sec) at 1 MHz continuous power, with tumor tissue temperature elevated to less than about 45°C.
  • This ultrasound treatment generated using a concave transducer to focus the ulstrasound in a treatment zone and herein termed "low energy non-ablative focused ultrasound" (LOFU), produces mild mechanical and thermal stress in tumor cells, while avoiding cavitation and coagulative necrosis both of which result in tissue damage.
  • LOFU low energy non-ablative focused ultrasound
  • LOFU has the potential to release immunomodulatory factors, including heat shock proteins (28, 29), and can be effective in inducing tumor- specific immune activation (30, 31).
  • heat shock proteins 28, 29
  • LOFU treatment reverses tumor-induced tolerance, resulting in increased effector cytokine production in tumor-antigen specific CD4+ T cells, which appears to be caused by the release of immunogenic molecules by the tumor cells.
  • LOFU ablative hypofractionated Cone Beam computed tomography (CT) image- guided radiation therapy (IGRT) results in synergistic control of primary tumors and also causes reduction in spontaneous pulmonary metastases and prolongs recurrence free survival in immunocompetent mice (see Example 1).
  • CT Cone Beam computed tomography
  • IGRT image- guided radiation therapy
  • the LOFU (also termed “acoustic priming therapy” herein) involves the application of ulstrasound at an acoustic power between 10 and 1000 W/cm 2 spatial peak temporal average intensity (Ispta) in a treatment zone, with the ultrasound applied continuously for a time in the range of 0.5 to 5 seconds, wherein the frequency is in the range of 0.01 to 10 MHz and the mechanical index is less than 4.
  • Mechanical Index (MI) is the rarefaction pressure in units of MPa over the square root of the central frequency in units of MHz.
  • the energy and intensity of ultrasound applied is intended to fall between energies and intensities of ultrasound that either induce primarily ablative effects or primarily diagnostic effects.
  • the various treatment methods discussed herein may be administered using a LOFU or acoustic priming therapy device that includes a transducer that generates acoustic power between 10 and 1000 W/cm 2 spatial peak temporal average intensity (Ispta) in a treatment zone.
  • the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds or pulsed with pulse durations of 1 to 100 ms, wherein the frequency is in the range of 0.01 to 10 MHz. In some embodiments the frequency is in the range of 0.05 to 5 MHz. In some embodiments the frequency range is from 0.1 to 2 MHz. In some embodiments the minimum diameter of any ultrasound beam in the treatment zone is about 1 cm.
  • the LOFU is administered at 10 to 100 W/cm 2 Ispta in the area of treatment. In an embodiment, the LOFU is administered at 100 to 200 W/cm 2 Ispta in the area of treatment. In an embodiment, the LOFU is administered at 300 to 400 W/cm 2 I S p ta in the area of treatment. In an embodiment, the LOFU is administered at 400 to 500 W/cm 2 I spt a in the area of treatment. In an embodiment, the LOFU is administered at 500 to 600 W/cm 2 I S pta in the area of treatment. In an embodiment, the LOFU is administered at 600 to 700 W/cm 2 I S pta in the area of treatment.
  • the LOFU is administered at 700 to 800 W/cm 2 I S pta in the area of treatment. In an embodiment, the LOFU is administered at 800 to 900 W/cm 2 I S pta in the area of treatment. In an embodiment, the LOFU is administered at 900 to 1000 W/cm 2 I S pta in the area of treatment.
  • the ultrasound is applied for a time in the range of 0.5 to 1 second. In an embodiment, the ultrasound is applied for a time in the range of 1 to 2 seconds. In an embodiment, the ultrasound is applied for a time in the range of 2 to 3 seconds. In an embodiment, the ultrasound is applied for a time in the range of 4 to 5 seconds.
  • the ultrasound is applied at a frequency of 0.01 to 1 MHz. In embodiment, the ultrasound is applied at a frequency of 1 to 2 MHz. In embodiment, the ultrasound is applied at a frequency of 2 to 3 MHz. In embodiment, the ultrasound is applied at a frequency of 3 to 4 MHz. In embodiment, the ultrasound is applied at a frequency of 4 to 5 MHz. In embodiment, the ultrasound is applied at a frequency of 5 to 6 MHz. In embodiment, the ultrasound is applied at a frequency of 6 to 7 MHz. In embodiment, the ultrasound is applied at a frequency of 7 to 8 MHz. In embodiment, the ultrasound is applied at a frequency of 8 to 9 MHz. In embodiment, the ultrasound is applied at a frequency of 9 to 10 MHz.
  • a method for increasing the efficacy of a chemotherapy in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic drug, wherein the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell, wherein the amounts (i) and (ii) together are sufficient to increase the efficacy of the chemotherapy.
  • LOFU low intensity focused ultrasound
  • a chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell
  • a method of increasing the efficacy of a chemotherapy in a predetermined volume of tissue in a subject which volume is less than the whole subject comprising (i) administering to the subject an amount of a chemotherapeutic drug, wherein the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell and (ii) administering to the predetermined volume of tissue in a subject an amount of low intensity focused ultrasound (LOFU), wherein the amounts of (i) and (ii) together are sufficient to increase efficacy of the chemotherapy within the predetermined volume of tissue.
  • ER endoplasmic reticulum
  • UMR unfolded protein response
  • a method of treating a tumor in a subject, wherein the tumor is resistant to a chemotherapeutic drug comprising:
  • a method of treating a chemoresistant tumor in a subject, wherein the tumor has become chemoresistant to a previously administered chemotherapeutic drug comprising:
  • LOFU low intensity focused ultrasound
  • the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in a tumor cell.
  • ER endoplasmic reticulum
  • URR unfolded protein response
  • the chemotherapeutic drug has previously been administered to the subject a plurality of times and wherein the tumor has been diagnosed as resistant to the chemotherapeutic drug subsequent to an initial administration of the chemotherapeutic drug.
  • the methods can further comprising receiving identification of the subject as having the tumor chemoresistant to a previously administered chemotherapeutic drug.
  • the chemotherapeutic drug effects UPR in a tumor cell.
  • the chemotherapeutic drug effects effects ER stress in a tumor cell.
  • the amounts of (i) and (ii) together are sufficient to induce apoptosis of tumor cells or increase apoptosis of tumor cells.
  • the amount of administered chemotherapeutic drug alone, in the absence of increasing the efficacy is a sub-therapeutic dose with regard to treating a tumor.
  • the LOFU administered is directed at a location of the tumor in the subject.
  • the low intensity focused ultrasound is administered to the subject prior to, or concurrent with, the chemotherapy or the radiotherapy or the immunotherapy.
  • the LOFU is administered to the subject prior to the radiotherapy being administered.
  • the LOFU is administered to the subject prior to the chemotherapy being administered.
  • the LOFU is administered to the subject prior to the immunotherapy being administered.
  • the LOFU is administered to the subject concurrent with the radiotherapy being administered.
  • the LOFU is administered to the subject concurrent with the chemotherapy being administered.
  • the LOFU is administered to the subject concurrent with the immunotherapy being administered.
  • the chemotherapeutic drug is an HSP90 inhibitor.
  • the HSP90 inhibitor is 17AAG (tanespimycin or 17-N- allylamino-17-demethoxygeldanamycinan).
  • the chemotherapy drug is an HSP90 inhibitor.
  • An example of an HSP90 inhibitor is 17AAG (tanespimycin or 17-N- allylamino-17-demethoxygeldanamycinan).
  • the chemotherapy drug is an alkylating agent.
  • the chemotherapy drug is trabectidin.
  • the chemotherapy drug is a mustard gas derivative.
  • the chemotherapy drug is a metal salt.
  • the chemotherapy drug is a plant alkaloid.
  • the chemotherapy drug is a antitumor antibiotic. In an embodiment, the chemotherapy drug is an antimetabolite. In an embodiment, the chemotherapy drug is a topoisomerase inhibitor. In an embodiment, the chemotherapy drug is a protesomal inhibitor. In an embodiment, the chemotherapy drug is a chemotherapeutic NSAID. In an embodiment, the chemotherapy drug is one of the miscellaneous antineoplastics listed hereinbelow.
  • the LOFU is delivered via an ultrasound beam from an ultrasound machine comprising a transducer and the machine and subject are positioned such that at least a portion of the tumor is positioned at the focus of the transducer.
  • the LOFU is delivered to at least a portion of the tumor and the position of the tumor in the subject is monitored via an imaging technique.
  • the imaging technique is magnetic resonance imaging.
  • the imaging technique is computed tomography.
  • the imaging technique is ultrasound imaging.
  • the LOFU is administered to multiple volumes within the tumor at least once over a period of time of less than one hour.
  • the LOFU is non-ablative. In an embodiment of the methods, the LOFU does not cause cavitation in the tissue it is administered to.
  • an ultrasound component of the LOFU is administered at a frequency of from 0.5 MHz to 1.5 MHz. In an embodiment of the methods, the LOFU is administered for 1 to 3 seconds. In an embodiment of the methods, the LOFU is administered by an ultrasound beam such that in the treatment zone in situ intensity is from 250 W/cm 2 to 750 W/cm 2 at 1 mm to 75 mm tissue depth in the subject.
  • the LOFU is administered over the entire tumor volume.
  • the method delivers energy in the range of 300 to 3000 joules per cc of tumor to the tumor.
  • high intensity focused ultrasound HIFU
  • HIFU is not administered to the subject.
  • HIFU is focused ultrasound that effects a tissue temperatures in the focal zone of about 80°C or above.
  • HIFU causes increase temperature up to 60 to 85°C for few seconds of exposure time to solid tissue and/or causes thermal ablation in the tissue. Thermal ablation is usually achieved with power intensity of greater than 1 kW/cm 2 with reported frequency of 0.8 to 7 MHz.
  • LOFU can be achieved with power intensity of, for example, 1 to 3 W/cm 2 and frequency of 0.5 to 3 MHz (see other LOFU ranges herein, however).
  • LOFU can be continuous (100% DC) or pulsed ( ⁇ 100% DC, some literatures referred to as low intensity pulsed ultrasound or LIPUS) focused ultrasound by adjusting the duty cycle. Continuous LOFU at lMHz and 1 W/cm 2 for 10 minutes can produce a 0.1 °C elevation in tissue.
  • the effect of the amount of radiotherapy and the amount of LOFU is synergistic in treating the tumor.
  • the subject is human.
  • the tumor is a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, sialaden, stomach, esophagus, testes, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gall bladder, pancreas, kidney, urinary bladder, cervix, vagina, vulva, prostate, thyroid or skin, head or neck, glioma or soft tissue sarcoma.
  • the tumor is a prostate cancer.
  • the metastasis is a lung metastasis.
  • the LOFU is administered with a device comprising:
  • each of the one or more transducers are configured to produce ultrasonic beams based on the frequency waveform with central frequencies in the range of 0.05 to 5 MHz and an acoustic output intensity of between 20 and 1000 W/cm 2 .
  • each of the one or more transducers are configured to produce ultrasonic beams based on the frequency waveform with central frequencies in the range of 0.5 to 1.5 MHz and an acoustic output intensity of between 20 and 1000 W/cm 2 .
  • each transducer is configured to produce columnated ultrasound such that the beam profile waist at -3dB is not less than 5 mm in a treatment zone.
  • one or more beams are mechanically moved during treatment.
  • the one or more transducers comprise two or more transducers configured to operate sequentially or simultaneously and produce ultrasound of average spatial peak 250 W/cm 2 in a treatment zone during a treatment period.
  • the one or more transducers are configured produce ultrasound having a frequency within the range of 10 kHz to 300 kHz. In an embodiment of the methods, the one or more transducers are configured produce ultrasound having a frequency within the range of 300 kHz to 3 MHz. In an embodiment of the methods, one or more transducers operate at a frequency of 300 kHz to 3 MHz and one or more transducers operates at a frequency of between 30 and 300 kHz. In an embodiment of the methods, two or more ultrasound transducers generate ultrasound beams that pass through a treatment zone, with each beam having an I spta in the intersection zone in the range of 10 to 500 W/cm 2 .
  • the treatment time is less than 5 seconds per cubic centimeter of tumor.
  • two transducers generate ultrasound beams that intersect within a treatment zone, with each beam having an l spta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • three transducers generate ultrasound beams that pass through a treatment zone, with each beam having an I Spta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • the one or more transducers produce ultrasonic beams that are substantially in phase with one another within the treatment zone.
  • two ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 70 to 100 W/cm 2 and the ultrasound is applied continuously from 1 to 5 seconds.
  • three ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 50 to 70 W/cm 2 and the ultrasound is applied continuously for 1 to 5 seconds.
  • ultrasonic beams originating from separate transducers each produce an I S p ta in the range of approximately 100 to 1000 W/cm 2 in the treatment zone.
  • at least one transducer generates an ultrasonic beam with a high intensity diameter that is substantially larger in size than the treatment zone and is directed such that the treatment zone is entirely within the beam.
  • an intense treatment zone is formed where two or more ultrasound beams cross paths, the intense treatment zone being equal to or greater than about 1 cm perpendicular to the transmitted energy direction and also equal to or greater than about 1 cm parallel to the transmitted direction.
  • acoustic pressure applied to a treatment zone from each transducer is 0.1 to 10 MP a.
  • the number of transducers that provide the intense ultrasound treatment zone is between 1 and 1000.
  • the ultrasound from the one or more transducers is applied continuously during the treatment time.
  • the ultrasound is produced with a duty cycle in the range of 1 on time units to 9 off time units.
  • the transducers are configured to produce ultrasound in single frequency tones or multi-frequency chirps.
  • the one or more transducers are operated sequentially in time.
  • the total energy delivered to the target tissue and desired margin around the target tissue for the entire course of the application is greater than that to surrounding tissues.
  • the one or more transducers are configured so that the frequency of ultrasound is swept during application.
  • the one or more transducers comprise two-dimensional phased arrays,
  • the one or more transducers comprise annular arrays.
  • the one or more transducers comprise three- dimensional phased arrays.
  • the one or more transducers are incorporated into one or more endoscopic devices.
  • the one or more transducers are incorporated into a magnetic resonance imaging machine.
  • the one or more transducers are incorporated into a radiotherapy treatment machine.
  • the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 45 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less.
  • the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 50 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less.
  • the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 55 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less.
  • the LOFU and radiotherapy are administered by a system comprising:
  • a LOFU device comprising:
  • transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (I spta ) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of from 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz; a radiotherapy treatment machine; and
  • control system operatively configured to control the LOFU device and the radiotherapy treatment machine so that a first amount of the ultrasound and a second amount of radiotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • a method of treating a tumor in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy or an amount of radiotherapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat a tumor.
  • LOFU low intensity focused ultrasound
  • the amount of LOFU and the amount of radiotherapy are administered to the subject. In another embodiment of the method, the amount of LOFU and the amount of radiotherapy are administered to the subject. In another embodiment of the method, the amount of LOFU and the amount of immunotherapy are administered to the subject.
  • a method of treating a tumor in a subject comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a targeted anti-cancer therapy wherein the amounts of (i) and (ii) together are sufficient to treat a tumor.
  • the targeted therapy comprises a mAb directed to Her2 or VEGFR.
  • the targeted therapy comprises a tyrosine kinase inhibitor.
  • Also provided is a method of inhibiting metastasis of a tumor in a subject comprising administering to a subject having a tumor an amount of low intensity focused ultrasound (LOFU) and an amount of a radiotherapy, wherein the amounts together are sufficient to inhibit metastasis of a tumor in a subject.
  • LOFU low intensity focused ultrasound
  • the radiotherapy can be ablative hypofractionated radiation therapy.
  • the LOFU is directed at a location of the tumor in the subject.
  • Also provided is a method of reducing the effective dose of an anti-cancer chemotherapy required to treat a tumor in a subject comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat a tumor.
  • LOFU low intensity focused ultrasound
  • the LOFU is administered to the subject prior to, or concurrent with, the chemotherapy or the radiotherapy or the immunotherapy.
  • the LOFU is administered to the subject prior to the radiotherapy being administered.
  • the anti-cancer chemotherapy comprises administration of an HSP90 inhibitor to the subject.
  • the HSP90 inhibitor can be 17AAG (tanespimycin or 17-N-allylamino-17- demethoxygeldanamycinan).
  • the chemotherapy drug is an alkylating agent.
  • the chemotherapy drug is trabectidin.
  • the chemotherapy drug is a mustard gas derivative.
  • the chemotherapy drug is a metal salt.
  • the chemotherapy drug is a plant alkaloid.
  • the chemotherapy drug is a antitumor antibiotic.
  • the chemotherapy drug is an antimetabolite.
  • the chemotherapy drug is a topoisomerase inhibitor. In an embodiment, the chemotherapy drug is a protesomal inhibitor. In an embodiment, the chemotherapy drug is a chemotherapeutic NSAID. In an embodiment, the chemotherapy drug is one of the miscellaneous antineoplastics listed hereinbelow. [0087] In an embodiment of the methods, the LOFU is delivered via an ultrasound beam from an ultrasound machine comprising a transducer and the machine and subject are positioned such that the at least a portion of the tumor is positioned at the focal length of the transducer.
  • the LOFU is delivered to at least a portion of the tumor and the position of the tumor is monitored via an imaging technique.
  • Magnetic resonance imaging can be such an imaging technique.
  • the LOFU can be administered to multiple points within the tumor at least once over a period of time of less than one hour.
  • the LOFU is non-ablative.
  • the LOFU is administered at a frequency of from 0.5 MHz to 1.5 MHz.
  • the LOFU is administered for 1.5 - 3 seconds
  • the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam the in situ intensity is from 250 W/cm 2 to 750 W/cm 2 .
  • the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam the in situ intensity is from 250 W/cm 2 to 750 W/cm 2 at 1 mm to 75 mm tissue depth in the subject.
  • the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam the in situ intensity is from 350 W/cm 2 to 650 W/cm 2 at 1 mm to 75 mm tissue depth in the subject.
  • the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam the in situ intensity is from 450 W/cm 2 to 550 W/cm 2 at 1 mm to 75 mm tissue depth in the subject.
  • the LOFU can be administered over the entire tumor volume, or can be administered over a portion of the tumor volume. In a preferred embodiment the LOFU is administered over the entire tumor volume.
  • the LOFU delivers at least 500 to 5000 joules of energy per cc of tumor tissue through the tumor. In an embodiment, of the method the LOFU delivers at least 1000 to 4000 joules of energy per cc of tumor tissue. In an embodiment, of the method the LOFU delivers at least 2000 to 3000 joules of energy per cc of tumor tissue through the tumor.
  • high intensity focused ultrasound is not administered to the subject. In an embodiment, high intensity focused ultrasound has not been administered to the subject. In an embodiment, high intensity focused ultrasound has not been administered to the tumor. In an embodiment where LOFU is administered to the subject before the anti-cancer therapy, high intensity focused ultrasound is not administered to the subject after the LOFU is administered and before the anti-cancer therapy is administered.
  • the anti-cancer therapeutic effect of the amount of radiotherapy and the amount of LOFU is synergistic.
  • the LOFU adminstered raises the tissue/tumor temperature to between 40 °C - 45 °C. In an embodiment, the LOFU adminstered raises the tissue/tumor temperature to no more than 40 °C. In an embodiment, the LOFU adminstered raises the tissue/tumor temperature to no more than 45 °C. In an embodiment, the LOFU adminstered raises the tissue/tumor temperature to no more than 50 °C. HIFU will generally raise tissue temeperatures more than this.
  • the LOFU is administered for 0.5 to 3 seconds. In an embodiment, the LOFU is administered fori .5 to 3 seconds. In an embodiment, the LOFU is administered with a 100% duty cycle. In an embodiment, the LOFU is administered with one of the separate embodiments of a 10, 20, 30, 40, 50, 60, 70, 80 or 90% duty cycle.
  • a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy comprising administering to the subject, prior to, during or after the anti-cancer therapy, an amount of low intensity focused ultrasound (LOFU) effective to sensitize a tumor in a subject to an amount of an anti-cancer therapy.
  • the anti-cancer therapy comprises a chemotherapy, or a radiotherapy, or an immunotherapy, or a targeted therapy, or a surgery.
  • the anti-cancer therapy comprises a chemotherapy.
  • the anti-cancer therapy comprises an immunotherapy.
  • the anti-cancer therapy comprises a radiotherapy.
  • the anti-cancer therapy comprises surgery, for example, to excise the tumor.
  • the method can further comprise administering the anti-cancer therapy to the subject.
  • Sensitizing a tumor to an amount of an anti-cancer therapy makes the tumor more susceptible to the treatment.
  • a parameter by which tumor treatment may be measured such as tumor volume reduction, is greater for a given amount of an anti-cancer therapy applied to the sensitized tumor as compared to the same amount of an anti-cancer therapy applied to a non-sensitizied tumor of equivalent mass, vascularity, postion and type in the same or an equivalent subject.
  • the amount of LOFU effective to sensitize a tumor in a subject to an amount of an anti-cancer therapy and the anti-cancer therapy are synergistic in effect.
  • the subject is a mammal. In an embodiment, the subject is a human.
  • the tumor referred to in the methods can be a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, sialaden, stomach, esophagus, testes, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gall bladder, pancreas, kidney, urinary bladder, cervix, vagina, vulva, prostate, thyroid or skin, head or neck, or is a glioma or a soft tissue sarcoma.
  • the tumor is a prostate cancer.
  • the tumor is a soft tissue sarcoma.
  • the primary tumor is treated.
  • the secondary tumor is treated.
  • treatment of the tumor reduces the likelihood of a secondary tumor.
  • the metastasis comprises one or more lung metastases.
  • tumor refers to a neoplastic cell growth, and includes pre-cancerous and cancerous cells and tissues. Tumors usually present as a lesion or lump. In an embodiment, the tumor is a malignant neoplasm.
  • cancer means, in regard to a cancer or tumor, the spread of the cancer or tumor from one organ or tissue of a subject to another organ or tissue of the subject spatially apart from the first organ or tissue.
  • treating a tumor means that one or more symptoms of the disease, such as the tumor itself, vascularization of the tumor, or other parameters by which the disease is characterized, are reduced, ameliorated, inhibited, placed in a state of remission, or maintained in a state of remission.
  • Treating" a tumor also means that one or more hallmarks of the tumor may be eliminated, reduced or prevented by the treatment. Non-limiting examples of such hallmarks include uncontrolled degradation of the basement membrane and proximal extracellular matrix, migration, division, and organization of the endothelial cells into new functioning capillaries, and the persistence of such functioning capillaries.
  • treating the tumor means reducing the size or volume of the tumor.
  • inhibiting metastasis of a tumor in a subject means that one or more symptoms or one or more other parameters by which the disease is characterized, are reduced, ameliorated, or inhibited.
  • Non-limiting examples of such parameters include uncontrolled degradation of the basement membrane and proximal extracellular matrix, and travel of tumor cells through the bloodstream or lymphatics, invasion, dysregulated adhesion, and proliferation at secondary site, either distal or local.
  • treating the metastasis means reducing the development or inhibiting the development of metastases.
  • Radiotherapy is well-known in the art. Radiotherapy as encompassed herein includes medically therapeutic radiation delivered by a machine outside the body (external- beam radiation therapy), or from radioactive material placed in the body near cancer cells (internal radiation therapy, also called brachytherapy) or systemic radiation therapy. Radiotherapy as encompassed herein includes 3 -dimensional conformal radiation therapy (3D-CRT), intensity-modulated radiation therapy (IMRT), image-guided radiation therapy (IGRT), and tomotherapy. The radiotherapy may also be part of a stereotactic radiosurgery or stereotactic body radiation therapy (SBRT). Delivery by any particle beam known in the art is encompassed also, for example proton therapy, carbon ion therapy, or other charged particle beams depending on tumor type and location.
  • 3D-CRT 3 -dimensional conformal radiation therapy
  • IMRT intensity-modulated radiation therapy
  • IGRT image-guided radiation therapy
  • SBRT stereotactic body radiation therapy
  • Delivery by any particle beam known in the art is encompasse
  • the radiotherapy is CT image guided.
  • the radiotherapy is hypofractionated cone beam radiotherapy.
  • the radiotherapy is hypofractionated cone beam CT image guided radiotherapy. All combinations of the various elements described herein are within the scope of the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
  • Chemotherapeutic drugs which may be used in the invention are various. Examples of chemotherapeutic drugs include:
  • alkylating agents e.g. trabectidin ((rR,6R,6aR,7R,13S,14S,16R)-6',8,14-trihydroxy-7',9- dimethoxy-4,10,23-trimethyl-19-oxo-3',4',6,7,12,13,14,16-octahydrospiro[6,16- (epithiopropano-oxymethano)-7,13-imino-6aH-l,3-dioxolo[7,8]isoquino[3,2- b] [3]benzazocine-20,l'(2'H)-isoquinolin]-5-yl acetate));
  • mustard gas derivatives e.g. mechlorethamine, cyclophosphamide, chlorambucil, melphalan, and ifosfamide
  • ethylenimines e.g. thiotepa and hexamethylmelamine
  • alkylsulfonates e.g. busulfan
  • hydrazines and triazines e.g. altretamine, procarbazine, dacarbazine and temozolomide
  • nitrosureas e.g. carmustine, lomustine and streptozocin
  • metal salts e.g. carboplatin, cisplatin, and oxaliplatin
  • plant alkaloids e.g. vinca alkaloids such as vincristine, vinblastine and vinorelbine, taxanes such as paclitaxel and docetaxel, podophyllotoxins such as etoposide and tenisopide, camptothecan analogs (topoisomerase inhibitors) such as irinotecan and topotecan
  • plant alkaloids e.g. vinca alkaloids such as vincristine, vinblastine and vinorelbine, taxanes such as paclitaxel and docetaxel, podophyllotoxins such as etoposide and tenisopide, camptothecan analogs (topoisomerase inhibitors) such as irinotecan and topotecan
  • topoisomerase inhibitors topoisomerase inhibitors
  • antitumor antibiotics e.g. anthracyclines: doxorubicin, daunorubicin, epirubicin, mitoxantrone, and idarubicin; chromomycins: dactinomycin and plicamycin; miscellaneous ones such as mitomycin and bleomycin;
  • antimetabolites e.g. folic acid antagonists: methotrexate; pyrimidine antagonists: 5- fluorouracil, foxuridine, cytarabine, capecitabine, and gemcitabine; purine antagonist: 6- mercaptopurine and 6-thioguanine; adenosine deaminase inhibitors: cladribine, fludarabine, nelarabine and pentostatin);
  • topoisomerase inhibitors e.g. ironotecan, topotecan; amsacrine, etoposide, etoposide phosphate, teniposide
  • miscellaneous antineoplastics e.g. ribonucleotide reductase inhibitor: hydroxyurea; adrenocortical steroid inhibitor: mitotane; enzymes: asparaginase and pegaspargase; antimicrotubule agent: estramustine; retinoids: bexarotene, isotretinoin, tretinoin (ATRA).
  • ribonucleotide reductase inhibitor hydroxyurea
  • adrenocortical steroid inhibitor mitotane
  • enzymes asparaginase and pegaspargase
  • antimicrotubule agent estramustine
  • retinoids bexarotene, isotretinoin, tretinoin (ATRA).
  • Chemotherapeutic drugs which effect endoplasmic reticulum (ER) stress and/or effect unfolded protein response (UPR) in cells are known in the art.
  • protesomal inhibitors such as e.g. Bortezomib (Velcade; previously known as PS-341), elicit an ER stress response.
  • protesomal inhibitors such as e.g. Bortezomib elicit the UPR.
  • Hhistone deacetylase (HDAC) inhibitors elicit an ER stress response.
  • Chemotherapeutic NSAIDS e.gf. indomethacin, diclofenac, and celecoxib
  • Estrogen receptor a inhibitors such BHPI (1, 3- dihydro-3,3-bis(4-hydroxyphenyl)-7-methly-2H-indol-2-one) can activate the UPR.
  • Platinum-containing anti-cancer drugs cisplatin is known to elicit an ER stress response.
  • the taxane family of drugs paclitaxel is known to elicit an ER stress response.
  • Anthracycines such as doxorubicin are known to elicit ER stress.
  • Cyclophosphamide is known to elicit ER stress. See also Table 2 of Hetz et al, Nature Reviews, Drug Discovery, 12:703-719 (Sept., 2013), hereby incorporated by reference.
  • the endoplasmic reticulum is the site of synthesis and folding of secreted, membrane-bound and some organelle-targeted proteins.
  • the ER is highly sensitive to stresses that perturb cellular energy levels, the redox state or Ca 2+ concentration. Such stresses reduce the protein-folding capacity of the ER, which can result in the accumulation and aggregation of unfolded proteins and/or an imbalance between the load of resident and transit proteins in the ER and the organelle's ability to process that load. This condition is referred to herein, and in the art, as "ER stress”.
  • the ER stress response can promote cellular repair and sustained survival by reducing the load of unfolded proteins through global attenuation of protein synthesis and/or upregulation of chaperones, enzymes and structural components of the ER, which enhance protein folding.
  • This response is collectively termed as the unfolded protein response (UPR).
  • UPR unfolded protein response
  • Types of action Drug name Mechanism of Action Selected interactions with LOFU
  • UPR can confer resistance to Bortezomib
  • ER stress inducer Combining two different sources of UPR inducing agents can provide an additive effect to cancer killing.
  • the chemotherapy drug is an HSP90 inhibitor.
  • An example of an HSP90 inhibitor is 17AAG (tanespimycin or 17-N-allylamino-17- demethoxygeldanamycinan).
  • the chemotherapy drug is an alkylating agent.
  • the chemotherapy drug is trabectidin.
  • the chemotherapy drug is a mustard gas derivative.
  • the chemotherapy drug is a metal salt.
  • the chemotherapy drug is a plant alkaloid.
  • the chemotherapy drug is an antitumor antibiotic.
  • the chemotherapy drug is an antimetabolite.
  • the chemotherapy drug is a topoisomerase inhibitor.
  • the chemotherapy drug is a protesomal inhibitor.
  • the chemotherapy drug is a chemotherapeutic NSAID.
  • the chemotherapy drug is one of the miscellaneous antineoplastics listed hereinabove.
  • chemotherapy drugs or agents encompassed by the invention include anthracyclines, maytansinoids, alkylating agents, anti-metabolites, plant alkaloids or terpenoids, and cytotoxic antibiotics.
  • the chemotherapy agent is cyclophosphamide, bleomycin, etoposide, platinum agent (cisplatin), fluorouracil, vincristine, methotrexate, taxol, epirubicin, leucovorin (folinic acid), or irinotecan.
  • Anti -tumor immunotherapies encompassed herein include monoclonal antibodies (including naked, chemo-, radio- or toxin- conjugated antibodies and also bispecific antibodies), relevant antigen-binding fragments thereof such as fragments comprised of Fab or scFv fragments, that that bind with high affinity to cancer-associated biomolecular targets; (ii) those that are non-specific with respect to tumor cells and tumor cell antigens; anti-tumor immunotherapies e.g. cytokines, interleukins, interferons, GM- CSF, small organic molecules (e.g.
  • immunotherapy excludes bacteria-based anticancer or anti-tumor immunotherapies. In one embodiment, immunotherapy as used herein excludes Listeria-based immunotherapies.
  • increasing efficacy of a treatment means an increase in the extent of therapeutic effect achieved versus the extent achieved for the same amount of treatment (e.g. a given treatment dose) in the absence of the efficacy-increasing method being applied.
  • an acoustic priming therapy device comprising:
  • a control system that generates a frequency waveform; and one or more transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (I spta ) in a treatment zone, wherein ultrasound is applied continuously to the treatment zone for a time in the range of from 0.5 to 5 seconds, wherein ultrasound frequency is in the range of 0.01 to 10 MHz and wherein mechanical index of any beam is less than 4.
  • I spta spatial peak temporal average acoustic output intensity
  • each of the one or more transducers are configured to produce ultrasonic beams based on the frequency waveform with central frequencies in the range of 0.05 to 5 MHz and an acoustic output intensity of between 20 and 1000 W/cm 2 .
  • each of the one or more transducers are configured to produce ultrasonic beams based on the frequency waveform with central frequencies in the range of 0.5 to 1.5 MHz and an acoustic output intensity of between 20 and 1000 W/cm 2 .
  • each transducer is configured to produce columnated ultrasound such that the beam profile waist at -3dB is not less than 5 mm in a treatment zone.
  • one or more beams are mechanically moved during treatment.
  • the one or more transducers comprise two or more transducers configured to operate sequentially or simultaneously and produce ultrasound of average spatial peak 250 W/cm 2 in a treatment zone during a treatment period.
  • the one or more transducers are configured produce ultrasound having a frequency within the range of 10 kHz to 300 kHz.
  • the one or more transducers are configured produce ultrasound having a frequency within the range of 300 kHz to 3 MHz.
  • one or more transducers operate at a frequency of 300 kHz to 3 MHz and one or more transducers operates at a frequency of between 30 and 300 kHz
  • two or more ultrasound transducers generate ultrasound beams that pass through a treatment zone, with each beam having an l spta in the intersection zone in the range of 10 to 500 W/cm 2
  • the treatment time is less than 5 seconds per cubic centimeter of tumor.
  • two transducers generate ultrasound beams that intersect within a treatment zone, with each beam having an I S p ta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • three transducers generate ultrasound beams that pass through a treatment zone, with each beam having an I S p ta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • the one or more transducers produce ultrasonic beams that are substantially in phase with one another within the treatment zone.
  • two ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 70 to 100 W/cm 2 and the ultrasound is applied continuously from 1 to 5 seconds.
  • three ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 50 to 70 W/cm 2 and the ultrasound is applied continuously for 1 to 5 seconds.
  • ultrasonic beams originating from separate transducers each produce an I S p ta in the range of approximately 100 to 1000 W/cm 2 in the treatment zone.
  • At least one transducer generates an ultrasonic beam with a high intensity diameter that is substantially larger in size than the treatment zone and is directed such that the treatment zone is entirely within the beam.
  • an intense treatment zone is formed where two or more ultrasound beams cross paths, the intense treatment zone being equal to or greater than about 1 cm perpendicular to the transmitted energy direction and also equal to or greater than about 1 cm parallel to the transmitted direction.
  • acoustic pressure applied to a treatment zone from each transducer is 0.1 to 10 MPa.
  • the number of transducers that provide the intense ultrasound treatment zone is between 1 and 1000.
  • the ultrasound from the one or more transducers is applied continuously during the treatment time.
  • the ultrasound is produced with a duty cycle in the range of 1 on time units to 0 to 9 off time units.
  • the transducers are configured to produce ultrasound in single frequency tones or multi-frequency chirps.
  • the one or more transducers are operated sequentially in time.
  • the total energy delivered to the target tissue and desired margin around the target tissue for the entire course of the application is greater than that to surrounding tissues.
  • the one or more transducers are configured so that the frequency of ultrasound is swept during application.
  • the one or more transducers comprise two-dimensional phased arrays.
  • the one or more transducers comprise annular arrays.
  • the one or more transducers comprise three- dimensional phased arrays.
  • the one or more transducers are incorporated into one or more endoscopic devices.
  • the one or more transducers are incorporated into a magnetic resonance imaging machine.
  • the one or more transducers are incorporated into a radiotherapy treatment machine.
  • the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 45 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less. In an embodiment of the device, the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 50 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less.
  • the one or more transducers are configured to produce ultrasound so that the maximum temperature reached in the treatment zone is less than 55 °C during a treatment where ultrasound is applied to the treatment zone for about 2 seconds or less.
  • an acoustic priming therapy device comprising:
  • a control system that generates a frequency waveform; and one or more transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (I spta ) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of from 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz; a radiotherapy treatment machine; and
  • control system operatively configured to control the acoustic priming therapy device and the radiotherapy treatment machine so that a first amount of the ultrasound and a second amount of radiotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • an acoustic priming therapy device comprising:
  • transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (Ispta) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of from 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz;
  • the acoustic priming therapy device for use in combination with chemotherapy so that a first amount of the ultrasound and a second amount of the chemotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • Also provided is a system comprising:
  • an acoustic priming therapy device comprising:
  • transducers configured to produce ultrasound based on a frequency waveform between 1 and 1000 W/cm 2 spatial peak temporal average acoustic output intensity (Ispta) in a treatment zone, wherein the ultrasound is applied continuously for a time in the range of from 0.5 to 5 seconds, and wherein ultrasound frequency is in the range of 0.01 to 10 MHz;
  • the acoustic priming therapy device for use in combination with immunotherapy so that a first amount of the ultrasound and a second amount of the immunotherapy are administered to a subject, wherein the first and second amounts together are sufficient to treat a tumor in the subject.
  • B16 melanoma tumors suppress IL-2 and IFNy production by tumor-specific CD4+ T cells: To determine how melanoma cells may modulate tumor induced effector CD4+ T cell responses, three different mouse models were used. First, B16-F1 melanoma tumors were induced in C57B1/6J mice by subcutaneous injection of B16 cells in the lumbar flanks. Tumors were allowed to grow to a size of 7-8 mm and CD4+ T cells were then isolated from both the ipsilateral inguinal draining lymph nodes (DLN) and distal- contralateral non-draining cervical lymph nodes (NDLN). T cells were also obtained from control mice that did not harbor any tumors.
  • DLN ipsilateral inguinal draining lymph nodes
  • NDLN distal- contralateral non-draining cervical lymph nodes
  • CD4+ T cells isolated from the tumor DLN produced significantly less IL-2 than cells isolated from the distal contralateral NDLN of the same mice, or from lymph nodes of control tumor-free mice, when stimulated ex vivo with anti-CD3 and anti-CD28 antibodies. A similar but less pronounced effect was also observed for IFNy (Fig 1 A and B).
  • a B16-F1 melanoma cell line that had been stably transfected to express OVA as a surrogate tumor antigen was used. These cells were subcutaneously injected into OT-II mice, a mouse strain with T cells expressing a transgenic MHC class Il-restricted TCR that recognizes the OVA323-339 peptide. T cells were collected from these mice as described, and stimulated ex vivo using splenocytes loaded with OVA323-339 peptide. CD4+ T cells from the ipsilateral DLN again produced significantly reduced amounts of IL-2 and IFNy compared to cells from the contralateral NDLN or from tumor free mice (Fig. 1C and ID).
  • HIFU Treatment of primary B16 melanoma with LOFU overcomes tumor-induced tolerance in CD4+ T cells: HIFU is currently being used to predominantly cause tumor ablation through the generation of high amounts of heat inside the tumor tissue leading to coagulative necrosis. Although HIFU is a very effective, noninvasive ablative procedure to achieve local tumor control, it destroys the vasculature and tissue infrastructure almost instantaneously, thereby limiting the infiltration of dendritic cells and immune cells for antigen presentation and recognition.
  • CD4+ T cells from the DLN of the LOFU-treated mice produced significantly more IL-2 compared to the cells obtained from the group of mice bearing untreated tumors.
  • T cells from the corresponding NDLN produced comparable amounts of IL-2 in treated and untreated mice (Fig 2A).
  • Fig 2B A similar, but less pronounced effect, was observed on IFNy production in these same experimental groups of mice (Fig 2B).
  • LOFU treatments of B16 melanoma tumors appear to bolster CD4+ T cells to overcome the hyporesponsive state induced by the melanoma tumor microenvironment, suggesting improved activation and reduced tumor-induced T cell tolerance.
  • melanoma tumors can induce an NF ATI-dependent program of gene expression that produces a set of proteins which interfere with TCR signaling and directly inhibit expression of cytokines, resulting in the establishment of functional anergy in CD4+ T cells (21).
  • LOFU treatment could inhibit tumor-induced T cell tolerance by preventing anergy induction and be responsible for the increased cytokine expression observed in the DLN resident CD4+ T cells following treatment with LOFU, the expression of those anergy-associated genes in CD4+ T cells isolated from the DLN of mice bearing B16 tumors was first monitored and compared with the expression of those genes in T cells harvested from NDLN of the same mice.
  • T cells from the DLN of tumor-bearing mice expressed higher levels of anergy- associated genes, including the E3 ubiquitin ligases Grail, Cbl-b and Itch and the transcription factor Egr2 (Fig. 2C).
  • E3 ubiquitin ligases Grail Cbl-b and Itch
  • Egr2 the transcription factor Egr2
  • B16 melanomas with LOFU would have an effect on the expression of those anergy-associated genes in T cells.
  • B16 tumors growing on Tyrpl mice were either left untreated or treated with LOFU.
  • CD4+ T cells were isolated from the DLN and NDLN and the expression of several anergy-associated genes was assessed.
  • T cells derived from the DLN showed varying degrees of upregulation of 6 of the 7 anergy genes analyzed, including Grail, Itch, and Cblb, as well as the transcription factors Egr2 and Grg4, and the protease Caspase3 (Fig 2D).
  • Ikaros Another transcription factor, which is also upregulated in several in vitro and in vivo T cell anergy models, was not significantly upregulated in this melanoma model of tumor-induced anergy, and its levels remained largely similar in both the DLN and NDLN derived T cells (Fig 2D).
  • LOFU treated melanoma tumors are able to reactivate anergic tumor antigen- specific T cells:
  • LOFU might not only prevent the induction of tumor-antigen specific T cell anergy but also reverse established anergy and generate a productive effector response in previously tolerized T cells was investigated.
  • Naive CD4+ T cells were isolated from spleen and lymph nodes of Tyrpl mice, in vitro differentiated into TH1 cells and anergized by activating them through partial stimulation using with anti-CD3 antibodies in the absence of co-stimulation. As expected, T cells became hyporesponsive and showed a profound decrease in IL-2 production upon re-stimulation with anti-CD3 and anti-CD28 antibodies (Fig 3 A).
  • Treatment of melanoma with LOFU induces changes in the expression and subcellular distribution of the molecular chaperones calreticulin and Hsp70 in melanoma tumor cells: Activation of melanoma-specific T cells by dendritic cells is a crucial event in determining their fate. A successful antigen presentation event that is able to elicit an effector T cell response is critically dependent on the activation state of dendritic cells that would otherwise deliver tolerogenic stimuli. The results indicate that treatment of melanoma tumors with LOFU resulted in increased CD4+ T cell activation as consequence of hindering tumor-induced T cell tolerance. This could potentially result from the generation of more immunogenic dendritic cell populations.
  • B16 melanoma tumors were left untreated or exposed to LOFU treatment and tumor tissue sections were put on slides. Slides were subjected to staining with anti-Hsp70 or anti- calreticulin antibodies for a subsequent detection by immunofluorescence. Immunofluorescence analyses of LOFU treated melanomas confirmed that LOFU induced increased expression of Hsp70 (Fig. 4C). Interestingly, compared to untreated cells, LOFU treated cells also showed a change in the distribution of calreticulin, which appeared to accumulate in discrete regions of the plasma membrane on B16 cells (Fig. 4C).
  • LOFU treatment of melanoma tumors potentiates dendritic cell-mediated tumor antigen presentation to elicit a stronger CD4+ T cell response: To determine the possibility that LOFU treatment of tumors could result in enhanced stimulatory capacity of resident dendritic cells, it was directly tested if lysates prepared from LOFU treated tumors could elicit enhanced priming of antigen specific T cells leading to a more robust effector response. For this experiment, B16-F1-OVA melanoma cells were used to induce tumors in C57BL/6 mice. Lysates were prepared from untreated and LOFU treated tumors.
  • Splenic dendritic cells and responder naive CD4+T cells were isolated from C57BL/6 and OT-II tumor-free mice, respectively, and were co-cultured in the presence or absence of the different tumor lysates described above. Though the OVA containing tumor lysates could act as a source of tumor antigen to prime responder T cells, exogenous OVA323-339 peptide was also added to ensure uniform loading of dendritic cells with this peptide in all conditions and more accurately determine the tolerogenic or activating nature of the different tumor lysates.
  • control responder OT-II T cells upon activation with dendritic cells loaded with OVA323-339 peptide, showed a strong response with elevated levels of IL-2 production.
  • lysates obtained from untreated tumors markedly inhibited OT- II responses and resulted in a profound decrease in IL-2 production, even though exogenous OVA323-339 peptide was added to the culture (Fig. 5A).
  • lysates derived from LOFU treated tumors did not only have no negative effect on the responses of OT-II cells to OVA323-339 but were also able to elicit a strong activation of OT-II responder T cells even in the absence of exogenous peptide (Fig.5 A). These results extended further support the observation that LOFU treatment of B16 melanoma tumors prevents the negative effect on the T cell priming capacity of dendritic cells that normally occurs in the tumor microenvironment.
  • LOFU followed by ablation of tumor by hypofractionated IGRT results in enhanced T-cell mediated control of primary melanoma lesions:
  • a series of in vivo treatment strategies evaluating primary tumor control were performed using a combination of LOFU with or without tumor ablation using daily 10 Gy hypofractionated IGRT to a total dose of 30 Gy per mouse with established B16-M1 tumors located subcutaneously in the right dorsal hindlimb. Treatment was initiated for all mice when tumor volume reached ⁇ 50 mm 3 . Tumor volumes in each group were then measured three times a week for up to 62 days (Fig. 6A).
  • mice within the hypofractionated IGRT or LOFU+IGRT groups experienced significant growth delay for up to 3-weeks following treatment after which mice treated with IGRT alone began to exhibit primary tumor regrowth, reaching a volume >300 mm 3 at approximately 5-weeks.
  • the mice in the LOFU+IGRT group had a sustained response, with limited tumor growth for more than 6-weeks following treatment.
  • mice in the LOFU+IGRT group demonstrated regression of tumors from their baseline measurements and a complete tumor- free response was seen in 4 out of 5 mice.
  • the adaptive immune system constantly surveys for malignantly transformed cells. This is largely achieved by recognition of tumor-associated antigens that prime the appropriate T cell repertoire to mount antitumor immune responses.
  • tumors also employ diverse mechanisms to evade the adaptive immune system and thwart antitumor T cell responses (1).
  • successful therapy against cancer has to overcome the major obstacle of tumor-induced tolerance (36).
  • T cell subtypes including defective presentation of tumor antigens and inadequate activation of antigen presenting cells, signaling through co-inhibitory receptors, immunosuppression by factors released within the tumor microenvironment and local recruitment of suppressor cells (9, 15-17, 20, 37-39).
  • ICD immunogenic cell death
  • Thermally ablative HIFU while able to control primary tumors, is typically not effective at preventing micro-metastatic invasions in surrounding or distant tissues, suggesting that cell death caused by this FUS modality fails to adequately prime an adaptive anti-tumor immune response. Indeed, local or distal micro-metastatic invasions may be prevented or ameliorated by an adequately primed immune system that could eliminate the relatively small tumor load of cells that escape initial ablative treatment.
  • non-ablative LOFU treatment enhances T cell effector responses by overcoming the tolerizing effects of the tumor microenvironment and prevents local recurrence and distal metastases when administered prior to an ablative treatment.
  • T cell hyporesponsiveness to tumor antigens has been described in T cells in several mouse tumor models and in human cancers (15, 18, 41). This laboratory has previously reported that tumor-antigen specific CD4+ T cells become anergic in tumor bearing mice and express a series of anergy-associated genes that have been shown to hinder their ability to proliferate and produce effector cytokines (21, 42). Furthermore, prevention of the expression of those genes in mice that lack NFAT1 or Egr2, two transcription factors responsible for the expression of anergy-inducing genes (43-45), leads to inhibition of tumor-antigen specific T cell hyporesponsiveness and improved control of local tumor growth (19, 21).
  • the data confirm that resident tumor antigen specific CD4+ T cells in the tumor DLN upregulate the expression of anergy associated genes, including Grail, Itch, Cblb, Grg4, and Egr2.
  • the activation of this program of gene expression was well correlated with a reduced ability to produce cytokines following ex-vivo restimulation, supporting that B16 melanoma induces an intrinsic state of hyporesponsiveness in tumor antigen specific CD4+ T cells.
  • treatment of the primary tumor with LOFU resulted in an increased ability of those tumor-antigen specific CD4+ T cells to produce cytokine upon re-stimulation.
  • This stress could help generate novel unique "non-self tumor antigens that, in turn, could make the tumor more immunogenic and less able to induce tolerance.
  • the release of stress-induced danger signals by tumor cells could generate a tumor microenvironment that targeting dendritic cells would find less conducive to induction of tolerance in T cells.
  • Stress associated molecular chaperones including heat shock proteins and calreticulin, have been implicated in dendritic cell maturation and enhanced anti -tumor immunity (32, 48-51). There is evidence that primary tumor ly sates are rich in heat shock proteins that can trigger maturation signals in dendritic cells (52).
  • heat shock proteins are also capable of associating with and delivering antigenic peptides from tumor cells to dendritic cells, furthermore their presence in the tumor cell plasma membrane has been associated with increased immune responses (53-55).
  • Calreticulin has also been described to play an important role in antitumor response and its translocation to the surface of tumor cells has been associated with increased phagocytosis of the cell by dendritic cells and immune activation (56, 57).
  • Previous studies using HIFU in murine adenocarcinoma models showed that this treatment significantly increased expression of co-stimulatory molecules on dendritic cells, which also produced higher levels of IL-12 and resulted in increased CTL activity (58, 59).
  • LOFU induces a redistribution of calreticulin in B16 cells and an increase in the expression of the inducible heat shock protein Hsp70, suggesting that cellular stress mediated by LOFU is capable of inducing changes in the expression of those stress-induced proteins.
  • MHC-II or B7 proteins were detected, it cannot be ruled out that LOFU may also induce other changes in dendritic cell function that can contribute to the potentiation of the efficient presentation of tumor antigens.
  • the data support that the thermal/mechanical stress inflicted by LOFU is likely responsible for the enhanced tumor immunogenicity and for promoting T cell activation over anergy.
  • T cell tolerance induced by tumor antigens remains a major obstacle in treating cancer. Effective reversal of tolerance in tumor-specific T cells is a key goal in clinical antitumor strategies.
  • Our data find that pre-established anergy in T cells can be reversed by lysates prepared from LOFU treated melanoma tumors. This observation opens up the possibility that LOFU treatment of tumors could release novel immunogenic molecules from tumor cells that would not only prevent but also reverse pre-established tumor tolerance in T cells. Signaling through the IL-2 receptor has long been known to prevent and reverse clonal anergy in T cells (60-62).
  • LOFU pretreatment not only controlled tumor growth more effectively, but, as indicated before, likely resulted in the generation of strongly immunogenic IGRT-induced tumor death that provided protection from metastasis and ensured longer recurrence free survival.
  • mice 6-8 week old C57BL/6, B6.Cg-RagltmlMomTyrplB- wTg(TcraTcrb)9Rest/J (Tyrpl) and B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II) mouse strains were purchased from The Jackson Laboratory. BALBc/Nude mice were obtained from National Cancer Institute, distributed through Charles River. All mice were housed and maintained in pathogen-free facilities.
  • B16-F1 and B16-F10 melanoma cell lines were purchased from the American Type Culture Collection (ATCC).
  • a highly aggressive subclone of B16-F10 (B16-M1) was generated by isolating and expanding a metastatic clone that arose in a C57BL/6 mouse 6 weeks after surgical removal of an established primary tumor.
  • the B16-OVA melanoma cell line was kindly provided by E.M. Lord (University of Rochester Medical Center, Rochester, NY).
  • the expression of OVA by B16-OVA cells was confirmed by real time PCR. All melanoma cells were cultured in DMEM (Thermo Scientific) supplemented with 10% heat inactivated FBS, 2mM L-Glutamine and 250 IU of penicillin/streptomycin.
  • CD4+ T cells were isolated using anti-CD4 conjugated magnetic Dynabeads (Life Technologies) according to the manufacturer's protocol. Where indicated, CD4+ T cells were differentiated into TH1 helper cells by activation with plate-bound anti-CD3 ⁇ (clone 2C11; 0.25 ig/mL) and anti-CD28 (clone 37.51 ; 0.25 ig/mL) antibodies (BD Biosciences) and cultured for six days in DMEM supplemented with 10% heat inactivated FBS, 2 mM L-glutamine, 50 fM 2-mercaptoethanol, nonessential amino acids and essential vitamins (Cambrex), in the presence of murine IL-12 (10 ng/mL) (eBioscience), anti-mouse IL-4 antibody (clone 11C.11; 10 ⁇ g/ml) and 10 U/mL recombinant human IL-2 (Biological Resources Branch of the National Cancer Institute).
  • Tumor models 3xl0 5 B16-F1 melanoma cells suspended in Hanks' Balanced Salt Solution (Invitrogen) were injected s.c. in the lumbar flanks of mice. Melanoma tumors were induced in the footpads by injecting 2x10 5 B16-M1 cells in the dorsum of the right hind limb.
  • TGD tumor growth delay
  • ELISA 1.5 to 2.5xl0 4 T cells were left rested or stimulated with either anti- CD3 ⁇ +anti-CD28 antibodies, T cell depleted OVA peptide 323-339 (OVA323-339)-loaded splenocytes at a 1 :5 T cell:splenocyte ratio, or CDl lc+ purified dendritic cells (using CDl lc-beads; Miltenyi Biotech) loaded with OVA323-339 or melanoma tumor lysates at a 1 :3 dendritic cell:T cell ratio. Culture supernatants were typically harvested 24 hours after stimulation, and IL-2 or IFNlevels were measured by a sandwich ELISA (BD Biosciences).
  • Tumor lysates Tumors were resected from tumor bearing mice, cut into 1-2 mm pieces and passed through 40 fm nylon meshes. Cells were washed in PBS and resuspended in serum-free DMEM. Cell suspensions were then snap frozen in liquid nitrogen, and thawed at 37°C for five cycles with visual confirmation of complete lysis by light microscopy. The lysates were spun at 10,000g for 15 minutes at 4°C, and the pellets with cellular debris were discarded. The supernatant was used along with purified dendritic cells to stimulate T cells.
  • a therapy and imaging probe system (TIPS, Philips Research North America, Briarcliff Manor, NY, USA) was utilized for all ultrasound exposures.
  • the system is capable of delivering focused and spatiotemporally controlled ultrasound energy and consists of a therapy control workstation, RF generators and control electronics, an 8-element spherical shell annular array ultrasound transducer (80 mm radius of curvature, 80 mm aperture), as well as a motion stage to allow for in-plane transducer movement and accurate positioning perpendicular to ultrasound beam axis.
  • the focused ultrasound beam can also be steered approximately ⁇ 15 mm out-of-plane using electronic deflection of the focal point.
  • the ultrasound beam propagates vertically into the target through a thin (25 ⁇ ) circular plastic membrane, with acoustic coupling provided by degassed water.
  • the system allows adjustments of acoustic output power, ultrasound exposure duration, duty cycle, and ultrasound frequency.
  • In vivo focused ultrasound (FUS) therapy Mice were anesthetized with a continuous flow 1.5 liters/minute of 1.5% isoflurane in pure oxygen. To ensure proper acoustic coupling, the tumor-bearing leg or lumbar flank were carefully shaved. Once the animal was positioned for therapy, the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel. The center of the tumor was then placed at the focal length of 80 mm from the transducer. Ultrasound exposures were delivered to the tumor using a 1 mm grid pattern extending over the entire tumor volume.
  • FUS focused ultrasound
  • Two layers of grid points were performed in each tumor, resulting in approximately 160 discrete foci and 5 min exposure duration per tumor.
  • the ultrasound transducer was operated at 1.0 MHz, resulting in an ellipsoid focal spot approximately 1.5 mm in diameter and 12 mm in length (-6 dB of pressure), as measured along the ellipsoid axes.
  • Ultrasound exposures were delivered to the tumor using a 1 mm grid pattern extending over the entire tumor volume. Prior to therapy, the tumor volume was measured to calculate the grid size for the particular treatment.
  • the duration of ultrasound exposure at each grid point was 1.5 s, after which the transducer was automatically positioned over the next grid point and the procedure repeated until the entire tumor volume was covered.
  • LOFU non-ablative low-energy FUS
  • the resulting in situ intensity (Ispta) at the focus was estimated to be 550 W/cm2 at a depth of 4 mm in tissue. Total energy deposition to a tumor was approximately 900 J.
  • In vivo hypofractionated cone beam CT image-guided Radiation Therapy All radiation was delivered using Xstrahl Limited's Small Animal Radiation Research Platform (SARRP) to deliver a 10 Gy dose to a target tumor in 341 seconds. Anesthetized animals were placed on stage attached to a motorized platform and the tumor- bearing right hind limb was extended, elevated, and secured to a 1.5 cm adhesive platform to minimize extraneous tissue exposure. Once secure, a cone beam CT (CBCT) was performed and the data opened in 3D Sheer for tissue segmentation and treatment planning. 10 Gy each was delivered for three successive days for a total hypofractionated dose of 30 Gy. In the combination therapy groups, LOFU was performed 2-4 hours prior to CBCT.
  • SARRP Small Animal Radiation Research Platform
  • Pulmonary Metastasis Evaluation Lungs were isolated from animals that died spontaneously, were euthanized or were sacrificed at the end of the 8-week experiment. 1 mL of Fekete's solution (Ethanol, Glacial acetic acid and formaldehyde based bleaching fixative) was injected to insufflate the lungs. The trachea was then clamped, and the entire lungs and heart removed en bloc and washed with PBS. The lungs were then placed in Fekete's solution and allowed to bleach for 48 hours prior to analysis. The left lung and the 4 lobes of the right lung were isolated and nodules counted with the aid of a dissecting microscope.
  • Fekete's solution Kethanol, Glacial acetic acid and formaldehyde based bleaching fixative
  • Recurrence Free Survival The following events were scored as positive events in our recurrence free survival analysis: spontaneous death with necropsy validation of tumor involvement, euthanasia due to extensive local metastasis to the draining popliteal or inguinal lymph nodes, or euthanasia due to moribund appearance indicating extensive systemic tumor burden. The following non-tumor-dependent deaths were processed as censored data: death within 24-48 hours of amputation or sacrifice of any animals at the end of the 8-week experiment. In order to prevent selective sacrifice of control or treated animals, cages were labeled using an alphanumeric code such that animal institute veterinarians were blinded from treatment and control groups. Recurrence free survival was analyzed using a Mantel-Cox test, with statistical significance defined as P ⁇ 0.05.
  • the primer sets used are the following: [00188] actinb: F-GTGACGTTGACATCCGTAAAGA (SEQ ID NO: 1),
  • Cblb F-GCAGCATCATTGACCCTTTCA (SEQ ID NO:3),
  • Grail F-ATGCAAGAGCTCAAAGCAGGAAGC (SEQ ID NO: 5),
  • Caspase3 F-ACGCGCACAAGCTAGAATTT (SEQ ID NO:9),
  • Egr2 F-TCAGTGGTTTTATGCACCAGC (SEQ ID NO: 11),
  • Grg4 F-TCACTCAAGTTTGCCCACTG (SEQ ID NO: 13),
  • Flow cytometry Cells were pre-blocked with Fc block (CD16/CD32) antibody prior to immunostaining.
  • the following fluorochrome conjugated antibodies were used: anti- B7.1, B7.2, CDl lc, MHC-II, CD45, as well as their respective isotype control antibodies (eBiosciences); anti-Hsp70 (Novus Biologicals) and anti-TRPl (Abeam).
  • Dead cells were detected by using a UV LIVE/DEAD® Fixable Dead Cell Stain Kit (Invitrogen).
  • the immunostained cells were analyzed on an LSR-II Flow Cytometer (Becton Dickinson), and post-acquisition analyses were carried out using the FlowJo software.
  • the hypoxic tumor microenvironment generates oxidative Endoplasmic Reticulum (ER) stress, resulting in protein misfolding and unfolded protein response (UPR).
  • ER oxidative Endoplasmic Reticulum
  • UPR protein misfolding and unfolded protein response
  • HSP90 heat-shock protein 90
  • 17AAG has shown promise against various solid tumors, including prostate cancer (PC).
  • PC prostate cancer
  • therapeutic doses of 17AAG elicit systemic toxicity.
  • LOFU non-ablative and non-invasive low energy focused ultrasound
  • 17AAG causes synthetic lethality and significant tumoricidal effects in mouse and human PC xenografts.
  • LOFU induces ER stress and UPR in tumor cells without inducing cell death.
  • Treatment with a non-toxic dose of 17AAG further increased ER stress in LOFU treated PC and switched UPR from a cytoprotective to an apoptotic response in tumors resulting in significant induction of apoptosis and tumor growth retardation.
  • LOFU-induced ER stress makes the ultrasound-treated tumors more susceptible to chemotherapeutic agents, such as 17AAG.
  • LOFU-induced chemosensitization is a novel therapy that can be used on tumors, for example, locally advanced and recurrent tumors.
  • Treatment schema and toxicity of LOFU and 17AAG therapy For each grid location, LOFU was administered for 1.5 seconds at 100% duty cycle, acoustic power of 3 W, and using ultrasound frequency of 1 MHz. This protocol yielded an approximate in situ spatial-peak temporal-average acoustic intensity of 270 W/'cm 2 , resulting in estimated average intra-tumoral temperature elevation of 3.2 °C. Post-treatment, there were no signs of normal tissue toxicity such as alopecia, thermal damage, or skin wounds. Preclinical pharmacokinetic studies in mice have shown 17AAG to be widely distributed and to undergo extensive hepatic metabolism.
  • 17AAG Systemic administration of 17AAG is known to be associated with significant hepatotoxicity, characterized by increases in transaminases and bile acids, and drug-related histopathologic lesions in the gallbladder, common bile duct, and gastrointestinal tract. Therefore, we determined the dose of 17AAG that was nontoxic for our therapy.
  • C57B1/6 mice were treated with intraperitoneal injections of 17AAG (25 - 75 mg/kg body weight) three times a week. Control mice were injected with equal volume of the vehicle DMSO, which was used to solubiiize 17AAG.
  • a low dose of 17AAG that was found to be nontoxic was 25 mg/kg in C57B1/6 mice and 14 mg/kg in Balb/c nude mice. Thus, these dose levels were selected for the current study.
  • the goal was to combine two therapies that are nontoxic, albeit subtherapeutic, and examine whether the combination can be therapeutic.
  • Combination treatment of LOFU+17AAG amplifies ER stress: Accumulation of misfolded proteins in the ER induces a stress response with induction of chaperone proteins that help in correction of protein misfolding. To detect the level of ER stress, the expression levels of ER chaperones, ERp44, ERp57, and ERp72 were quantitated among different treatment groups.
  • ERp44 is responsible for oxidative protein folding [69].
  • ERp57 is an ER resident thiol disulfide oxidoreductase [70] while Erp72 is a disulfide isomerase. All these proteins participate in the protein folding machinery of the ER.
  • immunoblot analysis demonstrated a significant increase in the expression of ERp78 (p ⁇ 0.03, Figure 7D & 7E), ERp44 (p ⁇ 0.05, Figure 7D & 7G), and ERp57 (p ⁇ 0.04, Figure 7D & 7F) protein levels in tumor tissues following combination treatment with LOFU+17AAG. This suggests that 17AAG mediated inhibition of HSP90 may increase the unfolded protein burden in the ER, thereby prolonging ER stress.
  • LOFU+17AAG activates pro-apoptotic pathways of UPR and induces apoptosis in mouse and human prostate cancer tissues: ER stress activates the three arms of UPR at the same time, thereby producing antagonistic cytoprotective and apoptotic signals at the same time. The fate of the cell depends upon the ability of its protein correction machinery to lower the ER stress, thereby attenuating the UPR. If ER stress persists, the cytoprotective pathways are eventually overwhelmed with the chronic activation of PERK-mediated apoptotic pathways causing cellular demise.
  • phosphorylated eIF2a decreases the translation of most cellular proteins, including pro-survival and anti-apoptotic proteins, it increases the translation of a transcription factor, ATF4 that is responsible for inducing the transcription of pro-apoptotic genes, such as, CCAAT/ enhancer-binding protein homologous protein (CHOP), thereby preparing the cell for programmed cell death in case the misfolded proteins are not repaired and ER stress persists [71].
  • LOFU treatment failed to induce CHOP levels (1.6 ⁇ 0.7 fold) over untreated controls.
  • treatment with 17AAG alone induced CHOP transcript levels to 14.8 ⁇ 2 fold, which was further increased to 25 ⁇ 1.3 fold (p ⁇ 0.006) in the combination treatment group of LOFU+17AAG, compared to untreated controls (Figure 8C).
  • LOFU sensitizes human and murine prostate cancer grafts to non-toxic low doses of 17AAG Treatment with LOFU alone or low dose of 17AAG (25 mg/kg body weight) alone did not show any normal tissue toxic effect but failed to inhibit tumor growth. However, combination therapy of LOFU+17AAG reduced the growth of murine RM1 tumors ( Figure l OB). The average estimated tumor growth is 5% (pO.0001 ), 9% (pO.0001 ) and 11% (pO.0001) slower in LOFU, 17AAG and LOFU+17AAG cohort compared to control group. The median time to achieve tumor size 2000 mm 3 in control, LOFU, and LOFU+17AAG were 18, 22, and 42 days, respectively. All the animals in 17AAG group achieved the size within the interval of 26-30 days.
  • LOFU+17AAG treatment reduces the prostate cancer stem cell population in tumor tissue: The effect of LOFU+ 17AAG-induced ER stress on PC stem/progenitor population was evaluated by flow cytometric analysis of PC stem/progenitor cell surface markers [24, 25]. The percentage of cells expressing cell surface SCA1 ( Figure 11A & 11B) ⁇ : 0.004). CD44 ( Figure 11 A & 11C) (p ⁇ 0.003), CD133 ( Figure 11A & 11D) (p ⁇ 0.007), and ⁇ 2 ⁇ 1 integrin (p ⁇ 0.005) ( Figure 1 A & H E) was significantly decreased in the combination treatment group, compared to control or single treatment cohort.
  • the effect of LOFU can ameliorate resistance to a chemotherapy, and chemosensitization can be effected.
  • mice and athymic nude mice were maintained ad libitum and all studies were performed under the guidelines and protocols of the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
  • a therapy and imaging probe system (TIPS, Philips Research North America, Briarcliff Manor, NY, USA) was utilized for all ultrasound exposures.
  • the system includes an 8- element spherical shell annular array transducer (80 mm radius of curvature, 80 mm aperture), as well as a motion stage to allow for transducer movement and accurate positioning.
  • the transducer was operated at 1.0 MHz, resulting in a focal spot approximately 1.5 mm in diameter and 12 mm in length (-6 dB of pressure). [12,13])
  • the animals were anesthetized with ketamine and xylazine (7: 1 mg/ml for 100 1/ mouse, i.p .
  • the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel.
  • Ultrasound exposure parameters were as follows: acoustic power of 3 W and a duty cycle of 100%, yielding an approximate in situ spatial -peak temporal-average intensity (Ispta) [74] of 270 W/cm 2 at a sonication depth of 3 mm in tissue, assuming an attenuation coefficient of 0.5 dB cm-1 MHz-1 [75].
  • Ultrasound exposures were delivered to the tumor using a 2 mm grid pattern extending over the entire tumor volume. Prior to LOFU, the tumor volume was measured to calculate the grid size for the particular treatment. The duration of LOFU exposure at each grid point was 1.5 s, after which the transducer was automatically positioned over the next grid point and the procedure repeated until the entire tumor volume was covered. This yielded a non-uniform energy delivery to the tumor.
  • the ultrasound exposures were performed in a 6 mm ⁇ 6 mm area within a tissue-mimicking phantom, [76] into which a T-type thermocouple (diameter 200 ⁇ ) was embedded at a depth of 3 mm. These in vitro exposures were repeated 5 times and the results averaged.
  • Apoptotic cells were detected in situ by performing TUNEL (TdT-mediated digoxigenin labeled dUTP nick end labeling) staining. Briefly, paraffin embedded sections were de- paraffinized, rehydrated through graded alcohols, and stained using an ApopTag kit (Intregen Co, Norcross, GA, USA). The apoptotic rate in tumor cells was quantified by counting the percent of apoptotic cells in each high power field. [00209] Immunoblot Analysis
  • the tumor cells were harvested, washed with phosphate-buffered saline, and lysed using TPER (Thermo Fisher Scientific, Rockford, IL, USA). Cell lysates were subjected to SDS-PAGE, transferred to polyvinylidene difluoride membrane, and immunoblotted with primary antibodies against PERK, pPERK, eIF2,peIF2, ERp72, ERp44, ERp57, Beclin (Cell signaling, Danvers, MA, USA), Lamp2a (Abeam, Cambridge, MA, USA), and horseradish per-oxidase-conjugated secondary antibody.
  • TPER Thermo Fisher Scientific, Rockford, IL, USA. Cell lysates were subjected to SDS-PAGE, transferred to polyvinylidene difluoride membrane, and immunoblotted with primary antibodies against PERK, pPERK, eIF2,peIF2, ERp72, ERp44, ERp57, Beclin (
  • the blots were developed using the ECL kit (GE Healthcare, Piscataway, NJ, USA). Densitometric analysis of immunoreactive bands of each blot was photographed and then images were digitized and analyzed by using Gel Doc XR system (Bio-Rad, Hercules, CA, USA).
  • RNA samples were stored at -80°C, prior to further use. Isolated RNA was subjected to cDNA synthesis using the SuperScriptTM First-Strand Synthesis System (Invitrogen, Grand Island, NY, USA). The splicing of XBP1 RNA was detected using the following primer pair 5'-ACTCGGTCTGGAAATCTG-3' (SEQ ID NO: 19) and 5 '-TAGCCAGGAAACGTCTAC-3 ' (SEQ ID NO:20) (Fisher Scientific, Pittsburg, PA, USA) [77].
  • Real time PCR was performed in Light Cycler real time PCR machine (Bio Rad Laboratories, Hercules, CA, USA) using the Absolute QPCR SYBER Green Mix (ABgene, Rochester, NY, USA) according to the standard ABgene protocol. To check for primer amplification specificity, a melting curve was generated at the end of the PCR and different samples containing the same primer pair showed matching amplicon melting temperatures.
  • Primers used for real time PCR included GRP78 5'TTGCTTATGGCC TGGAT AAGAGGG3 ' (SEQ ID NO:21) and 5'TGTACCCTTGTCTTCAGCTGTCAC3' (SEQ ID NO:22); EDEM 5' TCATCCGAGTTCCAGAAAGCAGTC 3' (SEQ ID NO:23) and 5' TTGACATAGAGTGGAGGGTCTCCT 3' (SEQ ID NO:24) (Fisher Scientific). All the qRT-PCR and Real time PCR experiments were repeated three times.
  • the qRT-PCR and PCR array for apoptosis genes and stem cell transcription factor were performed by SA Biosciences PCR array system (Frederick, MD, USA) according to manufacturer protocol.
  • cDNA were prepared from purified total RNA using RT 2 First Strand Kit (Qiagen) followed by PCR array using SA Bioscience PCR array kit. Data was analyzed by web based PCR array data analysis software from SA Biosciences.
  • Flank tumors were treated with LOFU, 17AAG, and LOFU+17AAG in various cohorts. 24 hours after treatment, tumor cells were isolated by collagenase digestion and analyzed by fiowcytometry for the expression of prostate cancer stem cell markers, SCA1, CD44, and CD133. Isolated tumor cells were stained with anti-SCAl conjugated with FITC (BD Biosciences, La Jolla, CA, USA), anti-CD133 conjugated with pacific blue (eBioscience, San Diego, CA, USA) and anti-CD44 conjugated with PE (BD Biosciences, La Jolla, CA, USA). Data acquisition was performed using LSRII (BD Biosciences) and analyzed by Flow Jo v.7.1 (Treestar Inc, Ashland, OR, USA) software.
  • mice survival/mortality in different treatment groups was analyzed by Kaplan-Meier as a function of radiation dose using Sigma-Plot and GraphPad Prism (version 4.0 for OS X, San Diego, CA, USA) software.
  • FIG. 12 shows an acoustic priming therapy (APT) device, generally designated by reference number 1, according to an exemplary embodiment of the present invention.
  • the APT device 1 is powered by an electrical power source (not shown) and includes a control system 10, amplifier 12, matching transformer 14 and transducer 16.
  • the ultrasound transducer 16 may be positioned near or within a region of the patient's body 1000.
  • a clinician may make appropriate adjustments to the frequency and duration of the ultrasound pulses to be delivered by the transducer 16 using a function generator at the control system 10.
  • a transmitting surface of the transducer element creates pressure waves in the bodily fluids surrounding the ultrasound transducer 16.
  • the pressure waves then propagate through the fluids and tissues within the patent's body 1000 and ultimately reach the target region, thereby causing a non-ablative, sonic stress to the target tissue.
  • the sonic stress delivered to the tissue may have many therapeutic uses, and in the case of cancer treatment, for example, such stress of cancer cells in a tumor may result in immunogenic modulation, radio-sensitization and chemo-sensitization.
  • the ultrasound transducer 16 may be repositioned to an adjacent area of the patient's body for further treatment.
  • the matching transformer 14 provides an impedance transformation between the power supply and ultrasound transducer.
  • the amplifier 12 generates a transducer driver signal for driving the transducer 16 based on the output signal of the control system 10.
  • the amplifier 12 may be a switched resonant power amplifier, an example of which is disclosed in U.S. Patent No. 7,396,336, the contents of which are incorporated herein by reference in their entirety.
  • low impedance ultrasound driver-transducer systems can be employed [78].
  • the transducer 16 generates acoustic power between 10 and 1000 W/cm 2 spatial peak temporal average intensity (I spta ) in a treatment zone.
  • the ultrasound is applied continuously for a time in the range of from 0.5 to 5 seconds, wherein the frequency is in the range of 0.01 to 10 MHz.
  • the minimum diameter of any ultrasound beam in the treatment zone is about 1 cm.
  • the frequency of ultrasound generated by the APT device 1 is in the range of about 10 KHz to about 300 KHz.
  • the APT device according to the present invention may generate higher frequencies such as, for example, frequencies in the range of about 300 KHz to about 3 MHz.
  • an embodiment of such an APT device, generally designated by reference number 100 may include a control system 110, amplifier 112, matching transformer 114 and transducer 116, such components having the same function and structure as previously described with reference to FIG. 12.
  • the transducer 116 may be a flat or concave piston- type transducer comprised of single or multiple elements that convert another type of energy to acoustic energy.
  • the APT device 1 and APT device 100 may be integrated into a single system, generally designated by reference number 200, to provide improved efficacy and/or lower overall energy input.
  • the integrated system 200 provides focused low frequency and collimated high frequency beams for APT treatment.
  • the low frequency ultrasound is substantially focused according to what is achievable for a given frequency or range of frequencies and the mid frequency is collimated.
  • the transducer used to produce the low frequency is concave and the transducer used to produce the mid frequency is planar.
  • the APT device 1, 100, 200 may operate in conjunction with an ultrasound monitoring system, generally designated by reference 300.
  • the ultrasound monitoring system 300 may be powered by an electrical power source (not shown) and includes a control system 310, amplifier 312 and pulse receiver system 314.
  • the ultrasound monitoring system 300 may be used to monitor and/or provide imaging of the target tissue prior to, during and/or after APT treatment, and in particular the pulse receiver system 314 may include a transducer that receives pressure waves reflected from or generated by or from within the target tissue and the amplifier 312 generates electrical signals corresponding to the received pressure waves.
  • the control system 310 generates output based on the electrical signals that can be used by a clinician to determine treatment status and/or other parameters.
  • the ultrasound monitoring system 300 is shown as a separate component from the APT device 1, 100, 200, it should be appreciated that the monitoring and APT delivery may be performed by a unitary system.
  • the ultrasound monitoring system 300 is used to provide information on the location of tissue to be treated.
  • One or more, non-therapeutic ultrasound transmit and receive sub-systems may be used to monitor APT treatment and the effects of treatment on tissues.
  • the data collected and used for planning radiation treatment are also used at least in part for planning ultrasound treatment.
  • the data collected for APT treatment planning or APT treatment is used in radiation treatment planning. In some embodiments the data collected for radiation treatment planning is used for APT treatment planning. In some embodiments the data collected during APT treatment is used in radiation treatment planning.
  • ultrasound is applied at a lower frequency to treat a particular location or locations identified in part by ultrasound imaging performed at a higher frequency.
  • tissue temperature may be monitored via acoustic means [79].
  • ultrasound elastography is used to monitor treatment.
  • harmonic imaging is used to monitor treatment.
  • thermal strain is measured.
  • the system is comprised of one or more ultrasound transmit and receive transducer sub-systems used to measure tissue strain.
  • Tissue strain information may be used to aim the treatment ultrasound beams to a desired tissue and, in some embodiments, prior to applying full treatment power to treatment transducers.
  • power is applied at 10 to 50 % of the intended treatment power to one or more of the treatment transducers and strain of the target tissue is measured using ultrasound feedback.
  • APT transducers may be physically or electronically repositioned or more effectively directed to the target tissue based on strain imaging.
  • full power is applied from one or more transducers, but the time is shorter than that used for therapeutic effect during the strain measurement period until a desired targeting is confirmed.
  • thermometry is used to monitor treatment.
  • Each transducer of the APT system 1, 100, 200 may be a single transducer or may be an array of a plurality of transducers.
  • FIG. 18 is a perspective view of a transducer, generally designated by reference number 400, according to an exemplary embodiment of the present invention.
  • the transducer 400 includes an array of transducer elements 402. Any number of transducer elements 402 may be sequentially arranged along the azimuth axis.
  • the transducer elements 402 are supported on a backing block 404. Signal leads couple the electrode of each transducer element 402 to transmit and receive circuitry as is well known.
  • the transducer elements 402 convert electrical signals provided by the transmit circuitry to pressure waves.
  • two or more ultrasound transducers generate ultrasound beams that intersect within a treatment zone, herein denoted an intersection zone, with each beam having an l spta in the intersection zone in the range of 10 to 500 W/cm 2 .
  • two transducers generate ultrasound beams that intersect within a treatment zone, with each beam having an l spta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • three transducers generate ultrasound beams that intersect within a treatment zone, with each beam having an lspta in the intersection zone in the range of 50 to 500 W/cm 2 .
  • the plurality of beams are substantially in phase with one another.
  • two ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 70 to 100 W/cm 2 and the ultrasound is applied continuously from 1 to 5 seconds.
  • three ultrasound beams emanating from separate ultrasound transducers are substantially of the same frequency and in phase and intersect within a treatment zone, and each beam has an acoustic power spatial peak intensity in the intersection zone in the range of 50 to 70 W/cm 2 and the ultrasound is applied continuously for 1 to 5 seconds.
  • beams originating from separate transducers or transducer elements each produce an I S p ta of approximately 300 W/cm 2 in the treatment zone.
  • At least one transducer diameter and the ultrasound beam emanating from this transducer is substantially larger than the treatment zone.
  • an intense treatment zone is formed where two or more beams cross paths, the intense treatment zone being equal to or greater than about 1 cm perpendicular to the transmitted energy direction and also equal to or greater than about 1 cm parallel to the transmitted direction.
  • acoustic pressure applied to a treatment zone from each transducer is 0.1 to 10 MP a.
  • the number of transducers that provide the intense ultrasound treatment zone is between 1 and 1000.
  • one or more central frequencies are employed during treatment with central frequencies ranging from about 100 kHz to 20 MHz.
  • the ultrasound from a given transducer is applied continuously.
  • the ultrasound emanating from a given transducer is applied in pulses with repeating on time units and off time units known as a duty cycle.
  • the duty cycle may be in the range of 1 on time units to 9 off time units.
  • the transducers transmit single frequency tones or multi- frequency chirps.
  • the transducers are operated sequentially such that the total energy delivered to the target tissue for the entire course of the application is greater than that to surrounding tissues.
  • the frequency is swept during application, in part to reduce undesirably high intensity zones in the zones near the transducers.
  • the transducer comprising treatment head is mechanically vibrated.
  • the transducers are comprised of 2 dimensional phased arrays, annular arrays and/or three-dimensional phased arrays.
  • one or more ultrasound transducers are incorporated into one or more endoscopic devices.
  • the APT treatment systems disclosed herein have a low thermal dose compared to thermal dosing schemes common in hyperthermic and ablative thermal therapies.
  • the maximum temperature reached in the treatment zone is 45 °C during a treatment that lasts about 2 seconds or less.
  • coupling media is used between the transducers and the patient's body to efficiently transmit ultrasound waves and in some embodiments to provide a desired distance between a transducer and a treatment zone.
  • the coupling media is circulated to cool the transducer or the patient's body during treatment or both. Separate fluids may be used for purposes of transmitting ultrasound, providing spacing and providing cooling to the patient and system components.
  • APT treatment using the systems described herein can promote the interactions between cells, and between cells and matrix proteins. Interactions between cancer cells and immune cells and interactions between immune cells, for example T Cells and DCs.
  • APT treatment may disrupt protein complexes, for example protein folding complexes.
  • transducer applicators are designed so that they may be hand-held by the clinician or care giver.
  • applicators are mounted to a mechanical positioning device, such as the positioning device 500 illustrated in FIG. 19.
  • the positioning device 500 may be manually manipulated or robotic controlled.
  • the positioning device 500 is an arc-shaped rail on which the transducer travels, and in particular the transducer may be attached to a cable-driven carriage that is in turn mounted on the rail.
  • the rail itself may be rotatable so that the transducer can be positioned in three dimensions.
  • the positioning device 500 may be large enough that a patient can fit underneath and within the target range of the transducer.
  • FIG. 19 shows only one transducer positioned on the rail, it should be appreciated that more than one transducer may be disposed on the rail and/or other rails may be provided that support one or more other transducers.
  • a Stewart platform sometimes referred to as a hexapod, may be used in the positioning apparatus.
  • Computer programming may be used to set treatment parameters and operate positioning apparatuses.
  • the treatment system comprises patient cooling mechanisms to cool the skin exposed to ultrasound energy or other energy.
  • TGF-beta directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell 8:369-380.
  • Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 8:793-800.
  • Transcriptional regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. J Exp Med 209:2157-2163.
  • Egr-2 and Egr-3 are negative regulators of T cell activation. Nat Immunol 6:472-480.
  • Ox-40 ligand a potent costimulatory molecule for sustaining primary CD4 T cell responses. J Immunol 161 :6510- 6517.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Radiology & Medical Imaging (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Surgery (AREA)
  • Molecular Biology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Medical Informatics (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Human Computer Interaction (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Surgical Instruments (AREA)
  • High Energy & Nuclear Physics (AREA)
  • Magnetic Resonance Imaging Apparatus (AREA)
PCT/US2016/035440 2015-06-03 2016-06-02 Low intensity focused ultrasound for treating cancer and metastasis Ceased WO2016196741A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CN201680045882.0A CN108601554B (zh) 2015-06-03 2016-06-02 用于治疗癌症和转移的低强度聚焦超声
CN202210152097.2A CN114886412B (zh) 2015-06-03 2016-06-02 用于治疗癌症和转移的低强度聚焦超声
JP2017563052A JP6819012B2 (ja) 2015-06-03 2016-06-02 癌と転移を処置するための低密度焦点式超音波
EP16804398.2A EP3302264B1 (en) 2015-06-03 2016-06-02 Low intensity focused ultrasound for treating cancer and metastasis
US15/578,892 US10974077B2 (en) 2015-06-03 2016-06-02 Low intensity focused ultrasound for treating cancer and metastasis
US17/191,497 US12011619B2 (en) 2015-06-03 2021-03-03 Low intensity focused ultrasound for treating cancer and metastasis
US18/658,055 US20240366964A1 (en) 2015-06-03 2024-05-08 Low intensity focused ultrasound for treating cancer and metastasis

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562170378P 2015-06-03 2015-06-03
US62/170,378 2015-06-03
US201562204312P 2015-08-12 2015-08-12
US62/204,312 2015-08-12

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/578,892 A-371-Of-International US10974077B2 (en) 2015-06-03 2016-06-02 Low intensity focused ultrasound for treating cancer and metastasis
US17/191,497 Continuation US12011619B2 (en) 2015-06-03 2021-03-03 Low intensity focused ultrasound for treating cancer and metastasis

Publications (2)

Publication Number Publication Date
WO2016196741A2 true WO2016196741A2 (en) 2016-12-08
WO2016196741A3 WO2016196741A3 (en) 2017-05-04

Family

ID=57442265

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/035440 Ceased WO2016196741A2 (en) 2015-06-03 2016-06-02 Low intensity focused ultrasound for treating cancer and metastasis

Country Status (5)

Country Link
US (3) US10974077B2 (https=)
EP (1) EP3302264B1 (https=)
JP (3) JP6819012B2 (https=)
CN (2) CN114886412B (https=)
WO (1) WO2016196741A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016196741A3 (en) * 2015-06-03 2017-05-04 Montefiore Medical Center Low intensity focused ultrasound for treating cancer and metastasis
WO2019094802A1 (en) 2017-11-09 2019-05-16 Montefiore Medical Center Low energy immune priming for treating cancer and metastasis
WO2019123411A1 (en) 2017-12-22 2019-06-27 Freedom Waves S.R.L. System for inducing sonoporation of a drug into cancer cells and method thereof
EP3923814A1 (fr) * 2019-02-15 2021-12-22 Boysset, Max Pièce d'habillement et méthode de contrôle de cellules utilisant une telle pièce d'habillement
US11260249B2 (en) * 2018-07-19 2022-03-01 Sonablate Corp. System, apparatus and method for high intensity focused ultrasound and tissue healing activation
US20230293913A1 (en) * 2022-03-17 2023-09-21 Open Water Internet Inc. Harmonic excitation therapy and anti-tumor agent

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107427695B (zh) 2015-03-09 2019-08-16 纽约州立大学研究基金会 用于组织维护、修复和再生的促进细胞活性的系统和方法
EP3525883A4 (en) 2016-10-16 2020-12-02 Vibrato Medical, Inc. EXTRACORPORAL THERAPEUTIC ULTRASOUND TO PROMOTE ANGIOGENESIS
JP2020110282A (ja) * 2019-01-10 2020-07-27 治 三宅 生体用の超音波照射治療装置
CA3280998A1 (en) 2019-02-13 2025-10-30 Alpheus Medical, Inc. Non-invasive sonodynamic therapy
CN110507917A (zh) * 2019-07-30 2019-11-29 哈尔滨医科大学 一种超高场磁共振引导的低强度聚焦超声爆破系统
JP7498261B2 (ja) * 2019-08-27 2024-06-11 モンテフィオーレ メディカル センター 放射線療法による焼灼後の調節
US20210169979A1 (en) * 2019-12-05 2021-06-10 The Board of Regents for the Oklahoma Agricultural and Mechanical Colleges System and method for sonosensitized cancer immunotherapy with nanoparticles
KR20230065247A (ko) * 2020-08-06 2023-05-11 몬테피오레 메디컬 센터 방사선 요법에 대한 보조로서의 수지상 세포 활성화 요법
CA3185803A1 (en) 2020-08-07 2022-02-10 Vijay Agarwal Ultrasound arrays for enhanced sonodynamic therapy for treating cancer
JP2024511277A (ja) 2021-02-19 2024-03-13 メビオン・メディカル・システムズ・インコーポレーテッド 粒子線治療システムのためのガントリー
EP4308226A2 (en) * 2021-03-15 2024-01-24 Guided Therapy Systems, LLC Method for mid-intensity, non-ablative acoustic treatment of injured tissue
WO2023060199A1 (en) * 2021-10-06 2023-04-13 The Trustees Of Columbia University In The City Of New York Method and integrated system for selective removal of defective cells and edematous fluids from the lung
WO2023105290A1 (en) * 2021-12-10 2023-06-15 Insightec, Ltd. Short-pulse sonodynamic treatment apparatus
EP4577138A1 (en) 2022-08-22 2025-07-02 LaserLeap Technologies, S.A. Devices and methods for priming solid tumors with pressure pulses to enhance anticancer therapies
EP4719591A1 (en) * 2023-06-01 2026-04-08 B.G. Negev Technologies and Applications Ltd., at Ben-Gurion University Therapeutic ultrasound methods

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100092424A1 (en) 2007-11-21 2010-04-15 Sanghvi Narendra T Method of diagnosis and treatment of tumors using high intensity focused ultrasound
WO2011128693A1 (en) 2010-04-16 2011-10-20 Cancercure Technology As Systems for inducing hyperthermia
US20140058293A1 (en) 2012-05-23 2014-02-27 Sunnybrook Research Institute Multi-Frequency Ultrasound Device and Method of Operation

Family Cites Families (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0068961A3 (fr) 1981-06-26 1983-02-02 Thomson-Csf Dispositif d'échauffement localisé de tissus biologiques
US7510536B2 (en) 1999-09-17 2009-03-31 University Of Washington Ultrasound guided high intensity focused ultrasound treatment of nerves
CA2389669C (en) 1999-11-01 2010-06-01 University Of Cincinnati Transcranial ultrasound thrombolysis system and method of treating a stroke
US6725095B2 (en) 2000-04-13 2004-04-20 Celsion Corporation Thermotherapy method for treatment and prevention of cancer in male and female patients and cosmetic ablation of tissue
US6821274B2 (en) * 2001-03-07 2004-11-23 Gendel Ltd. Ultrasound therapy for selective cell ablation
US20100087728A1 (en) 2000-11-28 2010-04-08 Physiosonics, Inc. Acoustic palpation using non-invasive ultrasound techniques to identify and localize tissue eliciting biological responses
US20040034304A1 (en) 2001-12-21 2004-02-19 Chikayoshi Sumi Displacement measurement method and apparatus, strain measurement method and apparatus elasticity and visco-elasticity constants measurement apparatus, and the elasticity and visco-elasticity constants measurement apparatus-based treatment apparatus
AU2003227960B2 (en) 2002-05-23 2008-10-30 Gendel Limited Ablation device
US7396336B2 (en) 2003-10-30 2008-07-08 Sherwood Services Ag Switched resonant ultrasonic power amplifier system
US7896821B1 (en) * 2003-11-14 2011-03-01 Perfusion Technology, LLC Low intensity directed ultrasound (LODUS) mediated blood brain barrier disruption
US7993289B2 (en) 2003-12-30 2011-08-09 Medicis Technologies Corporation Systems and methods for the destruction of adipose tissue
CA2554043A1 (en) 2004-02-12 2005-08-25 Neurosonix Ltd. Acoustic control of emboli in vivo
KR100537343B1 (ko) * 2004-10-01 2005-12-19 주식회사 듀플로젠 관절염 치료용 초음파 장치
WO2006050058A2 (en) 2004-10-28 2006-05-11 The General Hospital Corporation Methods of detection and therapy of inflamed tissues using immune modulation
CN1814323B (zh) * 2005-01-31 2010-05-12 重庆海扶(Hifu)技术有限公司 一种聚焦超声波治疗系统
US7194063B2 (en) 2005-02-10 2007-03-20 Brookhaven Science Associates, Llc Methods for implementing microbeam radiation therapy
US7963902B2 (en) 2005-04-20 2011-06-21 Richard Blankenbecler Computer prescribed treatment to reduced damage from radiation therapy and chemotherapy
CN101291705A (zh) * 2005-06-07 2008-10-22 皇家飞利浦电子股份有限公司 使用相可变流体的超声药物传输和热治疗的方法和装置
JP4369907B2 (ja) 2005-07-01 2009-11-25 株式会社日立製作所 音響化学治療装置
EP1907065B1 (en) 2005-07-22 2012-11-07 TomoTherapy, Inc. Method and system for adapting a radiation therapy treatment plan based on a biological model
WO2007044469A2 (en) * 2005-10-05 2007-04-19 Perfusion Technology, Llp A method and apparatus to direct radiation treatment to a specific region of the brain
US20070088345A1 (en) 2005-10-13 2007-04-19 Ust Inc. Applications of HIFU and chemotherapy
WO2010029556A1 (en) * 2008-09-12 2010-03-18 Slender Medical, Ltd. A device for ultrasound treatment and monitoring tissue treatment
JP5032094B2 (ja) * 2006-11-06 2012-09-26 テルモ株式会社 超音波診断装置および制御プログラム
WO2008115830A2 (en) 2007-03-16 2008-09-25 Cyberheart, Inc. Radiation treatment planning and delivery for moving targets in the heart
CN101820949B (zh) 2007-03-30 2017-05-24 皇家飞利浦电子股份有限公司 用于引导放疗和其他过程的mri引导的hifu标记法
WO2009070677A1 (en) 2007-11-28 2009-06-04 Reliant Technologies, Inc. Nonablative and ablative tissue treatment method and device
US8466605B2 (en) * 2008-03-13 2013-06-18 Ultrashape Ltd. Patterned ultrasonic transducers
ES2736276T3 (es) 2008-07-14 2019-12-27 Arizona Board Of Regents For And On Behalf Of Arizona State Univ Dispositivos de modulación de la actividad celular utilizando ultrasonido
US8962290B2 (en) 2008-08-26 2015-02-24 Intelligentnano Inc. Enhanced animal cell growth using ultrasound
WO2010115209A2 (en) 2009-04-03 2010-10-07 Palomar Medical Technologies, Inc. Method and apparatus for treatment of tissue
CN101642607B (zh) * 2009-09-01 2012-11-28 西安交通大学 基于阵列换能器的低强度聚焦超声药物控释与监控装置
CN101690677B (zh) * 2009-10-13 2011-09-21 西安交通大学 聚焦超声治疗组合阵元相控阵及多焦点剪切波成像系统
US20130144192A1 (en) * 2011-07-17 2013-06-06 Neurotrek, Inc. Ultrasound neuromodulation treatment of anxiety (including panic attacks) and obsessive-compulsive disorder
RU2589614C2 (ru) * 2010-05-27 2016-07-10 Конинклейке Филипс Электроникс Н.В. Ультразвуковой преобразователь для избирательной генерации ультразвуковых волн и тепла
US8777854B2 (en) * 2011-09-06 2014-07-15 General Electric Company Method and system for ultrasound based automated detection, quantification and tracking of pathologies
MX365418B (es) 2012-06-26 2019-06-03 Biodesix Inc Metodo por espectros de masa para la seleccion y descarte de pacientes de cancer para el tratamiento con terapias generadoras de respuestas inmunitarias.
US20150196638A1 (en) * 2012-07-08 2015-07-16 Sunnybrook Health Sciences Centre System and method for using ultrasound-stimulated microbubble exposures to induce ceramide accumulation in endothelial and tumor cells
EP2881043A4 (en) * 2012-07-30 2016-06-22 Nohsn Co Ltd ULTRASONIC PROBE HAVING GRADIENT INFORMATION AND DEVICE FOR ULTRASONIC DIAGNOSIS AND TREATMENT USING THE SAME
CN102831716A (zh) * 2012-08-27 2012-12-19 曲宝源 预付费球形膨胀腔低压损立柱式超声波热量表
US9061133B2 (en) * 2012-12-27 2015-06-23 Brainsonix Corporation Focused ultrasonic transducer navigation system
CA2898732A1 (en) * 2013-01-18 2014-07-24 Mao CHENGJIAN Estrogen receptor inhibitors
CN203112640U (zh) * 2013-02-05 2013-08-07 韩先锋 旋流分区式船舶压载水处理装置
US10960233B2 (en) 2013-03-06 2021-03-30 B.G. Negev Technologies And Applications Ltd. Low intensity ultrasound therapy
WO2014145007A1 (en) 2013-03-15 2014-09-18 Eagleyemed Ultrasound probe
CN103230648B (zh) * 2013-04-24 2016-09-14 重庆医科大学 低强度聚焦超声分子显像与治疗系统
US10099070B2 (en) 2013-11-08 2018-10-16 Koninklijke Philips N.V. Medical apparatus for radiotherapy and ultrasound heating
CA2929660A1 (en) 2013-11-19 2015-05-28 Ethicon, Inc. Thoracoscopic methods for treatment of bronchial disease
TW201521671A (zh) * 2013-12-11 2015-06-16 Univ Nat Taiwan 超音波醫療裝置
WO2015117067A1 (en) 2014-01-31 2015-08-06 The General Hospital Corporation Dba Massachusetts General Hospital Methods of treating and imaging tumor micrometastases using photoactivatable immunoconjugates
SG11201608691YA (en) 2014-04-18 2016-11-29 Ulthera Inc Band transducer ultrasound therapy
CN107530046B (zh) 2015-01-15 2021-07-13 罗德尼·赫林 漫射声学共焦成像器
CN104874114A (zh) 2015-06-01 2015-09-02 天津大学 一种利用低强度超声促进放射治疗效应的系统
CN114886412B (zh) 2015-06-03 2025-06-24 蒙特非奥里医疗中心 用于治疗癌症和转移的低强度聚焦超声
AU2016349359B2 (en) 2015-11-05 2021-10-28 The General Hospital Corporation Methods for treating cancer by enhancing intratumoral immune response
KR101875111B1 (ko) 2016-04-29 2018-07-09 한국수력원자력 주식회사 저선량 방사선을 이용한 암화유전자 Ras-유도 악성 암화 억제
US20180154183A1 (en) 2016-06-22 2018-06-07 Velayudhan Sahadevan Normal Tissue Toxicity Reducing Microbeam-Broadbeam Radiotherapy, Skin's Radio-Response Immunotherapy and Mutated Molecular Apheresis Combined Cancer Treatments
CA3059981A1 (en) 2016-12-31 2018-07-05 Radiation Barrier Llc Reducing damage from radiation therapy and increasing cancer kill rates by interweaving of low and high dose sessions
JP2020503322A (ja) 2016-12-31 2020-01-30 ラディエーション バリア エルエルシー 低線量放射線を織り込んで用いることによる化学療法による損傷の減少および癌の死滅率の上昇
WO2019094802A1 (en) 2017-11-09 2019-05-16 Montefiore Medical Center Low energy immune priming for treating cancer and metastasis
WO2020123388A1 (en) 2018-12-11 2020-06-18 Board Of Regents, The University Of Texas System Radiotherapies and uses thereof
JP7498261B2 (ja) 2019-08-27 2024-06-11 モンテフィオーレ メディカル センター 放射線療法による焼灼後の調節

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100092424A1 (en) 2007-11-21 2010-04-15 Sanghvi Narendra T Method of diagnosis and treatment of tumors using high intensity focused ultrasound
WO2011128693A1 (en) 2010-04-16 2011-10-20 Cancercure Technology As Systems for inducing hyperthermia
US20140058293A1 (en) 2012-05-23 2014-02-27 Sunnybrook Research Institute Multi-Frequency Ultrasound Device and Method of Operation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HETZ ET AL., NATURE REVIEWS, DRUG DISCOVERY, vol. 12, September 2013 (2013-09-01), pages 703 - 719
SAHA ET AL., ONCOSCIENCE, vol. 1, no. 6, pages 434 - 445

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016196741A3 (en) * 2015-06-03 2017-05-04 Montefiore Medical Center Low intensity focused ultrasound for treating cancer and metastasis
US12011619B2 (en) 2015-06-03 2024-06-18 Montefiore Medical Center Low intensity focused ultrasound for treating cancer and metastasis
US10974077B2 (en) 2015-06-03 2021-04-13 Montefiore Medical Center Low intensity focused ultrasound for treating cancer and metastasis
CN111836666A (zh) * 2017-11-09 2020-10-27 蒙特非奥里医疗中心 用于治疗癌症和转移的低能量免疫致敏
US12070628B2 (en) 2017-11-09 2024-08-27 Montefiore Medical Center Low energy immune priming for treating cancer and metastasis
US12434076B2 (en) 2017-11-09 2025-10-07 Montefiore Medical Center Low energy immune priming for treating cancer and metastasis
WO2019094802A1 (en) 2017-11-09 2019-05-16 Montefiore Medical Center Low energy immune priming for treating cancer and metastasis
EP3706866A4 (en) * 2017-11-09 2021-08-25 Montefiore Medical Center LOW ENERGY IMMUNE PRIMING FOR TREATMENT OF CANCER AND METASTASIS
US11648312B2 (en) * 2017-12-22 2023-05-16 Pierangela Giustetto System for inducing sonoporation of a drug into cancer cells and method thereof
WO2019123411A1 (en) 2017-12-22 2019-06-27 Freedom Waves S.R.L. System for inducing sonoporation of a drug into cancer cells and method thereof
CN111511440A (zh) * 2017-12-22 2020-08-07 自由波有限公司 诱导使药物进入癌细胞内的声孔效应的系统及其方法
US12397056B2 (en) * 2017-12-22 2025-08-26 Freedom Waves S.R.L. System for inducing sonoporation of a drug into cancer cells and method thereof
US20210069332A1 (en) * 2017-12-22 2021-03-11 Freedom Waves S.R.L System for inducing sonoporation of a drug into cancer cells and method thereof
US11260249B2 (en) * 2018-07-19 2022-03-01 Sonablate Corp. System, apparatus and method for high intensity focused ultrasound and tissue healing activation
EP3923814A1 (fr) * 2019-02-15 2021-12-22 Boysset, Max Pièce d'habillement et méthode de contrôle de cellules utilisant une telle pièce d'habillement
EP3923814B1 (fr) * 2019-02-15 2025-11-19 Boysset, Max Pièce d'habillement pour contrôle de cellules
US20230293913A1 (en) * 2022-03-17 2023-09-21 Open Water Internet Inc. Harmonic excitation therapy and anti-tumor agent

Also Published As

Publication number Publication date
JP7635177B2 (ja) 2025-02-25
US12011619B2 (en) 2024-06-18
US20180296859A1 (en) 2018-10-18
CN108601554B (zh) 2022-03-08
CN114886412A (zh) 2022-08-12
EP3302264A4 (en) 2019-02-20
CN114886412B (zh) 2025-06-24
US10974077B2 (en) 2021-04-13
JP7105294B2 (ja) 2022-07-22
EP3302264A2 (en) 2018-04-11
US20210268315A1 (en) 2021-09-02
JP6819012B2 (ja) 2021-01-27
JP2021058618A (ja) 2021-04-15
EP3302264B1 (en) 2025-03-19
CN108601554A (zh) 2018-09-28
JP2018517495A (ja) 2018-07-05
WO2016196741A3 (en) 2017-05-04
US20240366964A1 (en) 2024-11-07
JP2022165965A (ja) 2022-11-01

Similar Documents

Publication Publication Date Title
US20240366964A1 (en) Low intensity focused ultrasound for treating cancer and metastasis
US12434076B2 (en) Low energy immune priming for treating cancer and metastasis
Abdo et al. Immunotherapy plus cryotherapy: potential augmented abscopal effect for advanced cancers
Anzengruber et al. T-cell mediated anti-tumor immunity after photodynamic therapy: why does it not always work and how can we improve it?
De La Maza et al. In situ vaccination after accelerated hypofractionated radiation and surgery in a mesothelioma mouse model
Gameiro et al. Exploitation of differential homeostatic proliferation of T-cell subsets following chemotherapy to enhance the efficacy of vaccine-mediated antitumor responses
CN102740874A (zh) 肿瘤液化的方法和组合物
Cao et al. Trehalose enhanced cold atmospheric plasma-mediated cancer treatment
Wu et al. Focused ultrasound-mediated small-molecule delivery to potentiate immune checkpoint blockade in solid tumors
Bassiony et al. Immunotherapy and cancer
Kolberg et al. The abscopal effect: Could a phenomenon described decades ago become key to enhancing the response to immune therapies in breast cancer?
Byrne et al. CD40 therapy and surgery: a potential immunologic partnership
HK1261209A1 (en) Low intensity focused ultrasound for treating cancer and metastasis
HK1261209B (zh) 用於治疗癌症和转移的低强度聚焦超声
US20170021002A1 (en) Augmentation of cancer and cancer endothelial vaccine immunogenicity by histone deacetylase inhibitors
US20220133788A1 (en) Baff therapy to promote anti-tumor immunity
Zhu et al. The combination of local treatment and immunotherapy
Guha et al. Immune system modulation with LOFU and HIFU treatment of prostate cancer
US20230272101A1 (en) Dendritic cell activating therapy as an adjunct to radiation therapy
Skalina Generation of an In Situ Tumor Vaccine Using Focused Ultrasound-Induced Immune Priming
Lansdell Characterization of surgery-induced vaccine dysfunction in a therapeutic murine melanoma model

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16804398

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2017563052

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16804398

Country of ref document: EP

Kind code of ref document: A2