WO2016196328A1 - Compositions and methods for degradation of misfolded proteins - Google Patents
Compositions and methods for degradation of misfolded proteins Download PDFInfo
- Publication number
- WO2016196328A1 WO2016196328A1 PCT/US2016/034751 US2016034751W WO2016196328A1 WO 2016196328 A1 WO2016196328 A1 WO 2016196328A1 US 2016034751 W US2016034751 W US 2016034751W WO 2016196328 A1 WO2016196328 A1 WO 2016196328A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- pml
- amyloidosis
- proteins
- atxnl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/21—Interferons [IFN]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/12—Mucolytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5058—Neurological cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
Definitions
- Proteins are the most abundant macromolecules of the cell and are critical to virtually all physiological processes. To perform their biological functions, the majority of proteins need to fold into and maintain their native conformations. Although the native conformation of a protein is determined by its amino acid sequence, the folding process is extraordinarily complex and highly prone to error, and its utility can be further limited in situations of genetic mutations, biogenetic inaccuracies, and posttranslational damages (Dobson, 2003, Nature, 426: 884-890; Goldberg, 2003, Nature, 426: 895-899). Proteins that have adopted aberrant conformations, and the aggregates formed by them, pose a constant threat to cell viability and function. Failure to eliminate these proteins is closely linked to the pathogenesis of various debilitating human diseases (Selkoe, 2003, Nature, 426: 900-904; Taylor et al., 2002, Science, 296: 1991-1995)
- PQC protein quality control
- Hsp70 heat shock protein 70
- Hsp60/chaperonin which forms a macromolecular cage to encapsulate relatively small proteins for uninterrupted folding
- HSP90 which most commonly acts on proteins involved in cell signaling and transcription
- HsplOO proteins in prokaryotes or lower eukaryotes e.g., ClpB in bacteria and Hspl04 in yeast
- Hsp70 and its cochaperone Hsp40 e.g., Hsp70 and its cochaperone Hsp40
- the PQC systems in the nucleus are conspicuously unclear. Misfolded proteins in the nucleus can be particularly damaging to postmitotic mammalian cells (e.g., neurons and cardiac myocytes), which are unable to remove these proteins through the breakdown of the nuclear envelope during mitosis.
- the importance of understanding PQC in this cellular compartment is emphasized by the formation of neuronal intranuclear inclusions that are associated with various dominantly inherited neurodegenerative diseases, including Huntington's disease (HD) and several types of spinocerebellar ataxias (SCAs).
- HD Huntington's disease
- SCAs spinocerebellar ataxias
- the present invention provides a composition for treating or preventing a disease or disorder associated with misfolded protein or protein aggregates, wherein the composition comprises a modulator of one or more TRIM proteins.
- the modulator increases the expression or activity of the one or more TRIM proteins.
- the modulator is at least one of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the modulator increases the expression or activity of at least one of human TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM9, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM19 (also referred to herein as "PML"), TRFM20, TRFM21, TRFM24, TRFM25, TRFM27, TRFM28, TRFM29, TRFM32, TRIM34, TRIM39, TRIM43, TRIM44, TRIM45, TRIM46, TRHVI49, TRFM50, TRFM52, TRIM58, TRIM59, TRIM65, TRIM67, TRIM69, TRIM70, TRIM74 and TRIM75; and mouse TRIM30.
- the composition comprises an isolated peptide comprising one or more TRIM proteins.
- the isolated peptide further comprises a cell penetrating peptide (CPP) to allow for entry of the isolated peptide into a cell.
- CPP comprises the protein transduction domain of HIV tat.
- the composition comprises an isolated nucleic acid molecule encoding one or more TRIM proteins.
- the disease or disorder is a polyQ disorder.
- the disease or disorder is a neurodegenerative disease or disorder selected from the group consisting of Spinocerebellar ataxia (SCA) Type 1 (SCAl), SCA2, SCA3, SCA6, SCA7, SCAl 7, Huntington's disease, Dentatorubral-pallidoluysian atrophy
- DPLA Alzheimer's disease
- Parkinson's disease amyotrophic lateral sclerosis
- ALS amyotrophic lateral sclerosis
- prion disease a transmissible spongiform encephalopathy
- tauopathy a tauopathy
- the disease or disorder is selected from the group consisting of AL amyloidosis, AA amyloidosis, Familial Mediterranean fever, senile systemic amyloidosis, familial amyloidotic polyneuropathy, hemodialysis-related amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, Finnish hereditary amyloidosis, lysozyme amyloidosis, fibrinogen amyloidosis, Icelandic hereditary cerebral amyloid angiopathy, type II diabetes, medullary carcinoma of the thyroid, atrial amyloidosis, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, injection-localized amyloidosis, aortic medial amyloidosis, hereditary lattice corneal dystrophy,
- AL amyloidosis AL amyloidos
- the present invention provides a method for treating or preventing a disease or disorder associated with misfolded protein or protein aggregates in a subject in need thereof, where the method comprises administering to the subject a composition comprising a modulator of one or more TRIM proteins.
- the modulator increases the expression or activity of the one or more TRIM proteins.
- the modulator is at least one of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the modulator increases the expression or activity of at least one of human TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM9, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM19 (also referred to herein as "PML"), TRFM20, TRFM21, TRFM24, TRFM25, TRFM27, TRFM28, TRFM29, TRFM32, TRIM34, TRIM39, TRIM43, TRIM44, TRIM45, TRIM46, TRDVI49, TRFM50, TRFM52, TRIM58, TRIM59, TRIM65, TRIM67, TRIM69, TRIM70, TRIM74 and TRIM75; and mouse TRIM30.
- the composition comprises an isolated peptide comprising one or more TRIM proteins.
- the isolated peptide further comprises a cell penetrating peptide (CPP) to allow for entry of the isolated peptide into a cell.
- CPP comprises the protein transduction domain of HIV tat.
- the composition comprises an isolated nucleic acid molecule encoding one or more TRIM proteins.
- the disease or disorder is a polyQ disorder.
- the disease or disorder is a neurodegenerative disease or disorder selected from the group consisting of Spinocerebellar ataxia (SCA) Type 1 (SCAl), SCA2, SCA3, SCA6, SCA7, SCAl 7, Huntington's disease, Dentatorubral-pallidoluysian atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), a transmissible spongiform encephalopathy (prion disease), a tauopathy, and
- the disease or disorder is selected from the group consisting of AL amyloidosis, AA amyloidosis, Familial Mediterranean fever, senile systemic amyloidosis, familial amyloidotic polyneuropathy, hemodialysis-related amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, Finnish hereditary amyloidosis, lysozyme amyloidosis, fibrinogen amyloidosis, Icelandic hereditary cerebral amyloid angiopathy, type II diabetes, medullary carcinoma of the thyroid, atrial amyloidosis, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, injection-localized amyloidosis, aortic medial amyloidosis, hereditary lattice corneal dystrophy,
- AL amyloidosis AL amyloidos
- the method comprises administering the composition to at least one neural cell of the subject.
- the present invention provides a composition for treating or preventing a disease or disorder associated with degradation of functional mutant protein, where the composition comprises a modulator of one or more TRIM proteins.
- the modulator increases the expression or activity of the one or more TRIM proteins.
- the modulator is at least one of the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the disease or disorder is cystic fibrosis.
- the present invention provides a method for treating or preventing a disease or disorder associated with degradation of functional mutant protein in a subject in need thereof, where the method comprises administering to the subject a composition comprising a modulator of one or more TRIM proteins.
- the modulator increases the expression or activity of the one or more TRIM proteins.
- the modulator is at least one of the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the disease or disorder is cystic fibrosis.
- the present invention provides a composition for treating or preventing a disease or disorder associated with misfolded protein or protein aggregates, where the composition comprises a modulator of one or more SUMO-targeted ubiquitin ligase (STUbl).
- the modulator increases the expression or activity of one or more STUbLs.
- the modulator is at least one of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the modulator increases the expression or activity of RNF4.
- the present invention provides a method for treating or preventing a disease or disorder associated with misfolded protein or protein aggregates in a subject in need thereof, where the method comprises administering to the subject a composition comprising a modulator of one or more STUbLs.
- the modulator increases the expression or activity of one or more STUbLs.
- the modulator is at least one of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, and an antisense nucleic acid.
- the modulator increases the expression or activity of R F4.
- the present invention provides a method for producing a recombinant protein, where the method comprises administering a modulator of one or more TRIM proteins to cell modified to express a recombinant protein.
- the modulator comprises an isolated peptide comprising one or more TRIM proteins.
- the modulator comprises an isolated nucleic acid molecule encoding one or more TRIM proteins.
- Atxnl 82Q-GFP was expressed alone or together with PML in HeLa cells (left), or alone in HeLa cells that were previously treated with control (-) or PML siRNA.
- Cell lysate fractions (when indicated) and whole-cell lysates (WCL) were analyzed by filter retardation assay (for SR fraction) or western blot (WB; for the rest).
- Molecular weight standards (in kDa) and relative ratios of SS or SR Atxnl versus actin are indicated.
- Figure IE Effect of PML on the stability of total FLAG-Atxnl 82Q protein, analyzed by a pulse-chase assay and autoradiography. The relative amounts of 35 S-labeled Atxnl 82Q are indicated.
- Figure IF and Figure 1G Effect of PML overexpression (Figure IF) and knockdown (Figure 1G) on the stability of Atxnl 82Q-GFP, analyzed by CHX treatment and WB.
- Figure 1H Effect of PML on Atxnl 82Q-GFP levels in the absence or presence of MG132.
- Figure 2 comprising Figure 2A through Figure 2E, depicts the results of example experiments demonstrating the recognition of misfolded proteins by PML.
- FIG. 2A Binding of GST-Htt 25Q and GST-Htt 103Q to immobilized FLAG-PML and FLAG-GFP (negative control), analyzed by an in vitro pull-down assay followed by WB (top and bottom) and Ponceau S staining (middle). *IgG heavy chain.
- Figure 2B Binding of GST-PML (shown on the right) and the control GST protein to native (N) and urea-denatured (D) luciferase (luc) immobilized on Ni-NTA beads, analyzed as in ( Figure 2A). *Nonspecific proteins from BL21 bacterial lysates that bound to the control beads.
- FIG. 2C Binding of indicated GST-Htt fusions to FLAG-PML CC conjugated on anti- Flag M2 beads or to control beads, analyzed by WB (top and middle) and Coomassie staining (bottom).
- Figure 2D Binding of PML F12/SRS2 (shown on the right) to a peptide library derived from luciferase. The N-terminal amino acid of the first peptide and the number of the last peptide spotted in each row are indicated.
- Figure 2E The occurrence of each amino acid in PML SRS2-binding peptides relative to its occurrence in the luciferase peptide array (set at 100%).
- Figure 3 depicts the results of example experiments demonstrating that SUM02/3 is involved in the ubiquitination and PML-mediated degradation of Atxnl 82Q.
- Figure 3A SUMOl and SUM02/3 modification of Atxnl 82Q in HeLa cells treated without or with MG132.
- d-IP Denaturing immunoprecipitation
- FIG. 3B Localization of Atxnl 82Q (detected by anti-FLAG antibody, red) in GFP- SUM02- or GFP-SUM03 -expressing U20S cells treated with or without MG132. Scale bar, 10 ⁇ .
- Figure 3C SUM02/3 modification of Atxnl 82Q and 30Q in HeLa cells, analyzed by d-IP followed by WB (top) and Ponceau S staining (bottom).
- Figure 3D Atxnl 82Q was expressed alone or together with SUMOl or HA-SUM02 KR in HeLa cells that were previously transfected with the indicated siRNA or un-transfected (-). Cells were treated with or without MG132.
- Figure 4 depicts the results of example experiments demonstrating that PML promotes SUMOylation of Atxnl 82Q.
- Figure 4A SUMOylation of FLAG-Atxnl 82Q in HeLa cells in the absence or presence of HA-PML cells, and without or with MG132 treatment. The amount of Atxnl 82Q DNA used for transfected was adjusted to yield comparable levels of the unmodified protein.
- Figure 4B and Figure 4C SUMOylation of FLAG-Atxnl 82Q ( Figure 4B) and FLAG-nFlucDM-GFP ( Figure 4C) in control and PML siRNA-transfected HeLa cells treated without or with MG132.
- Figure 5 comprising Figure 5A through Figure 51, depicts the results of example experiments demonstrating a role of RNF4 in the degradation of Atxnl 82Q.
- Figure 5 A Levels of Atxnl 82Q-GFP in HeLa cells without and with R F4
- FIG. 5C Relative SS Atxnl 82Q/actin ratios are shown in ( Figure 5C).
- Figure 5D Levels of FLAG-Atxnl 82Q in HeLa cells pretreated with a control siRNA (-) or a combination of three R F4 siRNAs.
- Figure 5E Representative fluorescent images of Atxnl 82Q-GFP in control and R F4-knockdown HeLa cells. Scale bar, 20 ⁇
- Figure 5F Localization of Atxnl 82Q-GFP and endogenous R F4 in HeLa cells treated with vehicle (DMSO) or MG132. Scale bar, 10 ⁇ .
- FIG. 5G and Figure 5H Levels of FLAG-Atxnl 82Q and FLAG-Atxnl 30Q (Figure 5G) or HA-Httexlp 97QP and HA- Httexlp 97QP(KR) (Figure 5H) in HeLa cells without and with R F4 overexpression.
- Figure 51 Stability of nFlucDM-GFP in HeLa cells stably expressing shCtrl and shR F4 (left) and the levels of RNF4 in these cells (right).
- Figure 6, comprising Figure 6A through Figure 61, depicts the results of example experiments demonstrating that RNF4 promotes the ubiquitination and degradation of SUM02/3 -modified Atxnl 82Q.
- FIG. 6A and Figure 6B Levels of SUMOylated FLAG- Atxnl 82Q ( Figure 6 A) and FLAG-nFlucDM-GFP ( Figure 6B), in the absence or presence of RNF4, in HeLa cells treated with or without MG132. d-IP products with similar levels of unmodified proteins, as well as WCL, were analyzed.
- Figure 6C Levels of SUMOylated FLAG- Atxnl 82Q in HeLa cells that were pretreated with a control siRNA or a combination of RNF4 siRNAs, analyzed as in ( Figure 6A).
- FIG. 6D and Figure 6E Unmodified and SUM02-modified FLAG- Atxnl 82Q proteins conjugated on M2 beads (+), or control M2 beads (-), were incubated with ubiquitination reaction mixture, in the absence or presence of GST-R F4.
- Figure 6D A schematic diagram of the experimental design.
- Figure 6E WB analysis of FLAG-Atxnl 82Q (left) and GST-R F4 (right).
- Figure 6F and Figure 6G Localization of Atxnl 82Q- GFP and R F4 proteins (detected by anti-FLAG antibody) in HeLa. Scale bar, 10 ⁇ .
- Figure 7 depicts the results of example experiments demonstrating that PML deficiency exacerbates behavioral and pathological phenotypes of the SCA1 mouse model.
- Figure 7A and Figure 7B Retention times (average + SEM) on accelerating Rotarod at 7 (Figure 7A) and 11 (Figure 7B) weeks of age, with the number of animals indicated in parenthesis.
- Figure 7C and Figure 7D Cerebellar sections of 12-week-old animals were stained with hematoxylin.
- Figure 7D Representative images of the staining. Scale bar, 200 ⁇ .
- FIG. 7H Representative images of the immunohistochemistry staining. Arrowheads indicate the ubiquitin positive aggregates in Purkinje cell bodies. Scale bar, 50 ⁇ . No ubiquitin-positive aggregates were observed in Purkinje cells in mice without Atxnl tg/ ⁇ (see Figure 14D).
- Figure 71 A model for PQC by the PML-RNF4 system. PML recognizes misfolded proteins through SRSs and conjugates them with poly- SUMO 2/3 chain through its SUMO E3 ligase activity (a). RNF4 ubiquitinates SUMOylated-misfolded proteins (b) and targets them for
- Figure 8 depicts the results of example experiments demonstrating that PML co-localizes with Atxnl 82Q aggregates and decreases insoluble Atxnl 82Q.
- Figure 8A Atxnl 82Q-GFP was expressed in PML- deficient (PML ' ) mouse embryonic fibroblasts (MEFs) together with each of the indicated PML isoforms. Cells were stained with anti-PML antibody (red) and DAPI (blue).
- Figure 8B Levels of FLAG- Atxnl 82Q in HeLa cells treated with a control siRNA (-), PML siRNA #4, or PML siRNA #9.
- FIG. 8C HeLa cells were transfected with a control siRNA, PML siRNA #4 (which targeted the 5'UTR of the PML mRNA), or PML siRNA #4 plus a plasmid expressing the open reading frame of PML (hence resistant to the siRNA). Levels of Atxnl 82Q-GFP in various fractions were analyzed.
- Figure 8D HeLa cells were treated with control siRNA, PML siRNA #4, and PML siRNA #9 and then transfected with FLAG- Atxnl 82Q.
- the levels of the FLAG- Atxnl 82Q transcript were determined by quantitative RT-PCR normalized to levels of 18S rRNA.
- Figure 8E Atxnl 30Q-GFP was expressed in HeLa cells in the absence or presence of PML. Cells were then treated with CHX for the indicated times.
- Figure 8F HeLa cells were transfected with nFlucDM-GFP and the corresponding wild-type luciferase (WT) protein. Endogenous PML was detected by an anti-PML antibody (red), and DNA by DAPI (blue). Scale bar: 10 ⁇ .
- Figure 8G PML knockdown leads to accumulation of insoluble mutant luciferase.
- FIG. 9 depicts the results of example experiments demonstrating the interaction of PML with pathogenic Htt proteins.
- Figure 9A PML preferentially interact with pathogenic Htt. Lysates of 293T cells expressing FLAG-GFP or FLAG-PML were incubated with GST-Htt 25Q or GST-Htt 103Q immobilized on glutathione beads (lanes 1-3 and 5-7), or with control glutathione beads (lanes 4 and 8).
- FIG. 9B Schematic representation of wild-type PML isoforms IV (aa 1-633) (called PML in the present work) and various deletion fragments (F1-F10).
- the RING domain (R), Bl box, B2 box, and coiled-coil region (CC) are labeled.
- Substrate recognition sites SRS1 and SRS2 are indicated by lines.
- the interaction of PML with pathogenic Htt proteins (Htt 103Q or 52Q) and denatured luciferase are shown. ND: not done.
- Figure 9C Interactions of full-length PML and PML deletion mutants with Htt.
- PML proteins were generated by coupled in vitro transcription/translation in the presence of [ 35 S]Met, and were incubated with purified GST-Htt 103Q, GST-Htt 25Q, or GST immobilized on glutathione beads.
- [ 35 S]Met-labeled proteins in the input and pull-down samples were analyzed by autoradiography, and GST proteins in the pull-down samples were analyzed by Coomassie staining.
- the three pull-down sample sets were analyzed at the same time and in the same way, including the amount of samples and the exposure duration of autoradiography. The input samples were exposed for a shorter period of time.
- Figure 9D Sequences of Htt 52Q and the CC-destabilizing (cc-) mutant.
- Figure 10 depicts the results of example experiments demonstrating the interaction of PML with denatured luciferase.
- Figure 10A Interaction of PML fragments with denatured luciferase.
- [ 35 S]-labeled full-length FLAG-PML and FLAG-PML deletion mutants were incubated with native or denatured luciferase immobilized on beads, or control beads.
- the input and beads-bound PML proteins were analyzed by autoradiography, and luciferase by
- Figure 11 comprising Figure 11 A through Figure 11G, depicts the results of example experiments demonstrating the modification of misfolded proteins by
- FIG. 11 A HeLa cells were transfected with FLAG-Atxnl 82Q or FLAG- Atxnl 82Q (5KR) and were treated with or without MG132. FLAG-Atxnl 82Q and FLAG-Atxnl 82Q (5KR) were isolated by d-IP, and their SUM02/3 modification was analyzed by Western blot.
- Figure 1 IB HeLa cells were transfected without or with GFP-TDP-43 and treated with vehicle (DMSO) (-) or MG132 (+). d-IP was performed using an anti-GFP antibody or a control antibody. d-IP products were analyzed by Western blot.
- FIG. 11C HeLa cells were transfected with nFluc-GFP, nFlucSM-GFP, and nFlucSM-GFP (each was also N-terminally tagged with the FLAG epitope) and treated with or without MG132. nFluc proteins were isolated by d-IP. The whole cell lysates (WCL) and IP products were analyzed by Western blot. Note that the difference between the SUM02/3 modifications of WT luciferase versus SM/DM luciferase (top, lanes 1-3) was not due to a change in the overall SUM02/3 conjugation in the WCL (bottom).
- Atxnl 82Q-GFP was expressed in HeLa cells pre-treated with control (Ctrl), SUM02/3, or SUMOl siRNA. Cell lysates were analyzed by Western blot.
- Figure 1 IE and Figure 1 IF HeLa cells were treated with control (Ctrl) siRNA,
- Figure 12 depicts the results of example experiments demonstrating that RNF4 promotes degradation of misfolded proteins.
- Figure 12A Representative fluorescence images of HeLa cells expressing Atxnl 82Q-GFP alone or together with RNF4. Scale bar: 20 ⁇ . Images are from the same experiment as that shown in Figure IB.
- Figure 12B The half-life of Atxnl 82Q- GFP in HeLa cells with and without RNF4 overexpression. Samples are from the same experiments as those shown in Figure IF.
- Figure 12C HeLa cells were transfected with control siRNA (-), RNF4 siRNA alone, or RNF4 siRNA plus an siRNA-resistant RNF4.
- FIG. 12F Western blot analysis of HeLa cells transfected with GFP-TDP-43 alone or together with increasing amounts of RNF4.
- Figure 12G GFP-TDP-43 was expressed in cells pre-treated with a control siRNA (-) or the indicated RNF4 siRNA. 500 cells were counted in each experiment. Percentages of cells with GFP-TDP-43 foci are shown.
- Figure 12H HeLa cells treated with RNF4 siRNA were transfected with GFP- TDP-43.
- FIG. 13A Atxnl 82Q-GFP and/or RNF4 were expressed in HeLa cells pre-treated with control siRNA, SUM02/3 siRNA, and SUMOl siRNA. Cell lysates were analyzed by Western blot.
- FIG. 13C Schematic representation of wild-type and mutant RNF4 proteins. The SUMO-interaction motifs (SIMs) 1 to 4 and the RING domain are shown. *: Point mutations are described elsewhere herein.
- Figure 13D and Figure 13E Purified recombinant GST fusions of rat (r) RNF4 and RNF4 CS1 ( Figure 13D) or human RNF4 and RNF4 SIMm ( Figure 13E) were incubated with ubiquitin El, E2 (UbcH5a), and ubiquitin (Ub) as indicated, plus Mg 2+ -ATP.
- Figure 14 depicts the results of experiments demonstrating that PML deficiency reduces arborization of Purkinje cell dendrites but does not result in aggregates in Purkinje cells.
- FIG. 14B Representative confocal images of calbindin immunofluorescence. Scale bar: 100 ⁇ .
- Figure 14D Immunohistochemical staining of the cerebellar cortex sections from 12-week-old PML +/+ and PML ' ' mice without Atxnl tg/ ⁇ . The sections were stained with an anti-ubiquitin antibody and counterstained with hematoxylin. Scale bar: 50 ⁇ .
- Figure 15 depicts the results of example experiments demonstrating the co-localization of TRTM27, TRTM32, and TRIM55 with EGFP- Atxnl 82Q and Httexlp 97QP.
- Figure 15 A Atxnl 82Q-GFP was expressed in HeLa cells together with the indicated FLAG-tagged TRIM proteins. Cells were stained with anti-FLAG antibody (red) and DAPI (blue). Scale bar: 10 ⁇ .
- Figure 15B and Figure 15C Httexlp 97QP was expressed in HeLa cells together with FLAG- tagged TRFM55, TRIM27 ( Figure 15B), and TRIM32 ( Figure 15C).
- Endogenous TRHVI27 was detected by anti-TRIM27 antibody (red). Arrowheads indicate endogenous TRIM27 bodies that were co-localized with the Atxnl 82Q aggregates. Scale bar: 10 ⁇ .
- Figure 16 depicts the results of example experiments demonstrating the reduction of aggregated Atxnl 82Q by TRIM27, TRIM32, and TRFM55.
- Figure 16A and Figure 16B Levels of Atxnl 82Q- GFP when expressed alone (-) or together with the indicated FLAG-tagged TRIM proteins in HeLa cells. The cell lysates were analyzed by Western blot. In the left panel of ( Figure 16 A), the ratios of Atxnl 82Q in the SS fraction versus actin are given, and the expression of TRIM11 could be detected after a prolonged exposure.
- FIG. 16C Expression levels of Atxnl 82Q in HeLa cells treated with control (-) or TRIM27 siRNA. *, a non-specific band.
- Figure 16D PIASy does not inhibit the levels of Atxnl 82Q protein. Western blot analysis of HeLa cells transfected with Atxnl 82Q-GFP, PIASy, and PML as indicated.
- Figure 17, comprising Figure 17A through Figure 17C, depicts the results of example experiments demonstrating that TREVI27 and TRIM32 reduce aggregated Atxnl 82Q independent of PML.
- Figure 17A Partial co-localization of TRFM27 with PML. HeLa cells transfected with FLAG-TRXM27 were immunostained with anti-FLAG (green) and anti-PML (red) antibodies.
- Figure 17B Co-localization of TRFM27 with Atxnl 82Q-GFP aggregates in PML +/+ and PML ' ' ' MEFs. FLAG-TRFM 27 was stained by anti-FLAG (red) antibody.
- Atxnl 82Q-GFP was expressed alone or together with the indicated TRIM proteins in PML +/+ and PML ' ' MEFs. Extracts were analyzed by filter retardation assay. To better compare the effects of TRIM proteins on the aggregates, a lighter exposure is shown on the right panel.
- Figure 18, depicts the results of example experiments demonstrating that TRIM proteins depend on SUM02/3 and the proteasome to remove insoluble Atxnl 82Q.
- Figure 18A- Figure 18F Atxnl 82Q-GFP was expressed alone or together with TRIM55, TRIM27, and TRFM32 in cells treated without or with MG132 ( Figure 18A- Figure 18C), or in control or SUM02/3 knockdown cells ( Figure 18D- Figure 18F). Cell lysates were analyzed by Western blot.
- Figure 18G SUMOylation of purified HA- Atxnl 82Q-FLAG was performed in the presence of recombinant FLAG-TRIM 11 and SUM02 as indicated.
- HA- Atxnl 82Q-FLAG was isolated using denaturing immunoprecipitation. The reaction mixtures and IP samples were analyzed by Western blot.
- Figures 19, depicts the results of example experiments demonstrating the localization of TRIM proteins in relation to Atxnl 82Q.
- Atxnl 82Q-GFP green was expressed in HeLa cells together with the indicated HA-tagged TRIM proteins. Cells were immunostained with anti-HA antibody (red).
- the representative localization patterns for each TRFM protein are shown.
- Figure 19A The representative localization patterns of TRIM1 - TRFM 16.
- Figure 19B The representative localization patterns of TRFM17 - TRIM32.
- Figure 19C The representative localization patterns of TRFM17 - TRIM32.
- Figure 20 depicts the results of a systematic analysis of TRFM proteins on Atxnl 82Q and Httexlp 97QP.
- Atxnl 82Q-GFP ( Figure 20 A) or Httexlp 97QP ( Figure 20B) was co-expressed with the indicated TRXM proteins in HeLa cells.
- Cell lysates were analyzed by Western blot.
- TRXM proteins labeled red and green are those that reduced and increased the levels of the polyQ proteins, respectively, while TRIM proteins labeled in black had no observable effect. Note that the effects of TRFM proteins can be influenced by their levels of expression, as described elsewhere herein.
- Figure 21, depicts the results of example experiments demonstrating that recombinant TAT-TRIMl 1 reduces the levels of misfolded proteins.
- HeLa cells were transfected with Atxnl 82Q-GFP, Atxnl 30Q, or Htt 97Q-GFP, and were subsequently incubated with recombinant TRIMl 1 or SUM02 proteins.
- Figure 21 A Treatment of HeLa cells with TRIMl 1 led to strong reduction in the levels of Atxnl 82Q.
- Figure 21B Treatment of HeLa cells with TRIMl 1 also led to strong reduction in the levels of Htt 97Q.
- Figure 21C SUM02 had minimal effect on the levels of Atxnl 82Q.
- Figure 22 depicts the amino acid sequence of Tat- TRIMl 1 used in example experiments.
- Figure 24 depicts results of experiments demonstrating co-localization of RNF4 with neuronal inclusions of SCA1 patients. Immunostaining of SCA1 brain tissues with anti-polyQ (1C2) and anti-RNF4 antibodies. Scale bar: 10 ⁇ .
- Figure 25 depicts results of experiments demonstrating co-localization of RNF4 with neuronal inclusions of SCA1 patients.
- Figure 25 depicts immunostaining of HD brain tissues with anti-Htt, anti- ubiquitin and two separate RNF4 antibodies. Note that Htt and ubiquitin form ring-like structures (Figure 25A - Figure 25H) or evenly distributed inclusions (Figure 251 - Figure 25L) with the RNF4 signal in the center.
- Figure 26, comprising Figure 26A through Figure 26H, depicts results of experiments demonstrating co-localization of R F4 with inclusions in neurons of FID patients. Shown are Htt and R F4 immunostaining of FID brain tissues. Two different RNF4 antibodies (#1 and #2) were used. Scale bar: 10 ⁇ .
- Figure 27 depicts results from experiments demonstrating SUMOylation of Atxnl 82Q, p53 and alpha-Synuclein.
- Figure 27 A depicts experiments where SUMOylation of Atxnl 82Q was analyzed when TRIMl 1 WT, TRIMl 1 MUT or PML was co-expressed. Before lysis, 10 ⁇ MG132 was added for 4 hours.
- Figure 27B depicts in vitro SUMOylation of purified Atxnl 82Q incubated with TRIMl 1 WT or TRIMl 1 MUT in the presence of El, E2 and SUM02.
- Figure 27C depicts in vitro SUMOylation of purified Flag-p53 incubated with TRFM1 1 or PML in the presence of El, E2 and SUM02.
- Figure 27D depicts in vitro
- Figure 28 depicts results from experiments demonstrating TRDVIl 1 is recruited to Atxnl 82Q aggregates.
- Figure 28A depicts immunofluorescence analysis of transfected GFP-Hsp70 in 293T cells.
- Figure 28B depicts immunofluorescence analysis of transfected GFP-TRFM1 1 in 293T cells.
- Figure 28C depicts immunofluorescence analysis showing that Hsp70 can be recruited into the aggregates of Atxnl 82Q.
- Figure 28D depicts immunofluorescence analysis showing that TRFM1 1 can be recruited into the aggregates of Atxnl 82Q.
- Figure 28E depicts immunoblotting analysis detergent-soluble and insoluble fractions of cells transfected with Atxnl 82Q, TRFM1 1 or Hsp70. Where indicated, 10 ⁇ MG132 is added for 3 hours.
- Figure 28F depicts immunoblotting analysis of detergent-soluble and insoluble fractions of cells transfected with Atxnl 82Q, TRIMl 1 WT (wild type) or
- FIG. 28G depicts immunoblotting where HCT1 16 cells are transfected with the indicated plasmids. After 48 hours, cells were lysed and then stained with 20 ⁇ Thioflavin-T (ThT).
- Figure 29, depicts results from experiments demonstrating TRDVIl 1 binding to Atxnl 82Q.
- Figure 29A depicts purified experiments where Flag-Atxnl 82Q immobilized on beads was incubated with GST or GST-TRIM11.
- Figure 29B experiments where depicts purified Flag-Atxnl 82Q or Flag-Atxnl 30Q immobilized on beads was incubated with GST or GST-TRTM11.
- Figure 29C depicts binding of GST-TRTMl 1 and GST protein to native (N) and urea- denatured (D) luciferase (luc) immobilized on Ni-NTA beads.
- Figure 30 depicts results from experiments demonstrating TR Ml l reduces cellular aggregates.
- Figure 30A depicts experiments where HCTl 16 cells stably expressing GFP-Atxnl 82Q were lysed and then stained with 20 ⁇ Thioflavin-T (ThT).
- Figure 3 OB depicts sedimentation analysis of GFP-Atxnl 82Q- HCTl 16 cells transfected with TR Ml 1.
- Figure 30C depicts experiments where HCTl 16 cells stably expressing GFP-Atxnl 82Q were transfected with TRIMl 1 WT or TRIMl 1 MUT. After 48 hours, cells were lysed and stained with 20 ⁇ ThT.
- Figure 30D depicts sedimentation analysis of GFP-Atxnl 82Q- HCTl 16 cells transfected with TRIMl 1 WT or TRIMl 1 MUT.
- Figure 31 depicts results from experiments demonstrating TRIMl 1 acts as a molecular chaperone to prevent aggregate formation.
- Figure 31C depicts the activity of transfected luciferase in HCTl 16 measured without heat shock as control. After 30 min heat shock at 45°C or after 3 hour recovery at incubator, the luciferase activities were relative to the control.
- Figure 3 ID depicts the activity of transfected luciferase in HCTl 16 measured without heat shock as control. After 60 min heat shock at 45°C or after 1.5 hour or 3 hour recovery at incubator, the luciferase activities were relative to the control.
- Figure 3 IE depicts immunoblotting analysis of HCTl 16 cells stably expressing control vector or Flag-TRFMl l .
- Figure 3 IF depicts ThT analysis showing the prevention of beta-amyloid fibrils formation by GST, TRIMl 1 or Hsp70.
- Figure 31G depicts a sedimentation assay showing the prevention of Atxnl 82Q aggregates formation by Lysozyme, GST or TRIMl 1. The results were shown by immunoblotting and dot-blot assay.
- Figure 31H depicts a sedimentation assay showing the prevention of p53 aggregates formation by L TRIMl 1. Where indicated, El, E2, SUM02 or ATP was applied. The results were shown by immunoblotting and dot- blot assay.
- Figure 32 depicts results from experiments demonstrating HSF1 is not required for regulating the transcription of TRIMl 1.
- Figure 32A depicts experiments where HCTl 16 cells were treated with or without heat shock (42°C) for 1 hour and then recovered for different time. Total cell lysates were subjected to immunoblotting with the indicated antibodies.
- Figure 32B depicts experiments whereHCTl 16 cells stably expressing Flag-TRIMl 1 were treated with or without heat shock (42°C) for 1 hour and then recovered for different time. Total cell lysates were subjected to immunoblotting with the indicated antibodies.
- Figure 32C depicts experiments where HeLa cells were treated with or without heat shock (42°C) for 1 hour and then recovered for different time.
- FIG. 32D depicts experiments where A549 cells were treated with or without AS2O3 for 30 min and then recovered for different time. Total cell lysates were subjected to immunoblotting with the indicated antibodies.
- Figure 32E depicts experiments where A549 cells were treated with or without ⁇ 2 0 2 for 100 min and then recovered for different time. Total cell lysates were subjected to immunoblotting with the indicated antibodies.
- Figure 32F depicts semiquantitative PCR analysis of TRIMl 1, HSP70, HSP90 and GAPDH in response to heat shock.
- Figure 32G depicts experiments where A549 cells stably expressing vector or HSF1 were treated with or without heat shock and recovered for 3 hours. Immunoblotting and semi-quantitative PCR were analyzed.
- Figure 33 depicts results from experiments demonstrating that p53 is a factor in upregulating TRIMl 1 in heat shock response.
- Figure 33A depicts immunoblotting of HCTl 16 p53 wild type or p53 null cells treated with heat shock and recovered.
- Figure 33B depicts qPCR analysis of TRIMl 1 mRNA level in HCTl 16 p53 wild type or p53 null cells treated with heat shock and recovered.
- Figure 33C depicts immunoblotting and semi-quantitative PCR analysis of A549 cells stably expressing control (Ctrl) or p53 shRNA treated with or without heat shock and recovered for 3 hours.
- Figure 33D depicts immunoblotting and semiquantitative PCR analysis of HCTl 16 cells transfected with Ctrl or p53 siRNA treated with or without heat shock and recovered for 3 hours.
- Figure 33E depicts crystal violet analysis of survival of HCTl 16 cells which were heated and recovered for 24 hours. Where indicated, KRIBBl 1 was added.
- Figure 33F depicts relative cell numbers of results presented in Figure 33E analyzed by OD490.
- Figure 34 depicts results from experiments demonstrating TRDVI11 acts as a disaggregase to resolve preformed aggregates.
- Figure 34B depicts a sedimentation assay showing that heat-aggregated luciferase resolved by GST or GST-TRFMl 1. The results were shown by immunoblotting.
- Figure 34D depicts a sedimentation assay showing that heat-aggregated GFP resolved by GST or GST- TRIM11. The results were shown by immunoblotting.
- Figure 34E depicts a
- FIG. 34F depicts a sedimentation assay showing that preformed Atxnl 82Q aggregates (left) and p53 aggregates (right) disaggregated by 1 ⁇ Hsp70 and 0.5 ⁇ Hsp40.
- Figure 34G depicts a sedimentation assay showing that preformed Atxnl 82Q aggregates disaggregated by 0.5 ⁇ GST, 0.5 ⁇ TRFM11, 1 ⁇ Hsp70, 0.5 ⁇ Hsp40 or 1 ⁇ Hspl04.
- Figure 35 depicts results from experiments demonstrating full length TRIM11 is required for refolding activity.
- Figure 35 A depicts a schematic diagram of TRIM 11 structure.
- Figure 35C depicts a sedimentation assay showing heated luciferase aggregates disaggregated by GST, TRIM11, RBC or B30.2.
- Figure 36 comprising Figure 36A and Figure 36B depicts results from experiments demonstrating TRIMl 1 binding to substrates is required for TRIMl 1 disaggregation function.
- Figure 36A depicts purified Flag-Atxnl 82Q immobilized on beads was incubated with GST, GST-TRIMl 1, GST-RBC or GST-B30.2.
- Figure 36B depicts purified Flag-Atxnl 82Q immobilized on beads was incubated with GST, GST- TRIMl 1 or other TRIMl 1 fragments.
- Figure 37 comprising Figure 37A through Figure 37E depicts results from experiments demonstrating TRIMl 1 performs disaggregation independently of its SUMO E3 ligase activity.
- Figure 37B depicts disaggregation and reactivation of preformed luciferase aggregates by 200 nM GST, 200 nM GST-TRIMl 1 WT or MUT.
- Figure 37C depicts the binding of GST, GST-TRIMl 1 WT or MUT to native (N) and urea-denatured (D) luciferase (luc) immobilized on Ni- NTA beads.
- Figure 37D depicts immunofluorescence analysis of transfected GFP-
- FIG. 37E depicts immunofluorescence analysis show that TRIMl 1 MUT can be recruited into the aggregates of Atxnl 82Q.
- Figure 38 depicts results from experiments demonstrating TRIMl 1 can also preform alpha-Synuclein amyloid fibril formation and disaggregate preformed alpha-Synuclein fibers.
- Figure 38A depicts ThT analysis showing prevention of alpha-Syn fibrils formation by GST, TRIMl 1, Hsp70, Hsp40 or Hspl04.
- Figure 38B depicts ThT analysis showing prevention of alpha- Syn fibrils formation by TRIMl 1 in a dose-dependent manner.
- Figure 38C depicts EM images of the fiber formation of alpha-Syn monomer incubated with GST or GST- TRIMl 1.
- Figure 38D depicts a sedimentation assay showing that preformed alpha-Syn fiber disaggregated by TRIMl 1 and Hspl04 A503S.
- Figure 38E depicts ThT analysis showing disaggregation of preformed alpha-Syn fibrils by GST, TRIMl 1 or Hspl04.
- Figure 39 depicts results from experiments demonstrating TRDVI21 has similar disaggregation functions to TRIMl 1.
- Figure 39A depicts binding of GST, GST-TRFM11 WT or MUT to native (N) and urea-denatured (D) luciferase (luc) immobilized on Ni-NTA beads.
- Figure 39B depicts a sedimentation assay showing that heat-aggregated luciferase resolved by GST or GST-TRIM21.
- Figure 40 depicts results from experiments demonstrating PML and Atxnl 82Q disaggregation.
- Figure 40A depicts commassie blue staining of purified Flag-PML6 from 293T cells.
- Figure 40D depicts commassie blue staining of purified Flag-PML4 fragments from 293T cells.
- Figure 41 depicts results from experiments demonstrating TRIM11 in mouse primary hippocampal neurons.
- Figure 41 A depicts MTT analysis showing that GST or TRIM11 incubated alpha- Syn-induced cell death.
- Figure 4 IB depicts immunofluorescence analysis of p-alpha-Syn or p62 in alpha- Syn fiber treated Hippocampal neuron cells.
- Figure 42 depicts results from experiments demonstrating TRTMl 1 is upregulated in response to heat shock in cortical and hippocampal neurons.
- Figure 42A depicts immunoblotting of mouse primary cortical neurons treated with heat shock for 30 minutes at 42°C and recovered for 3 hours.
- Figure 42B depicts immunoblotting of mouse primary hippocampal neurons treated with heat shock for 30 min at 42C° and recovered for 3 hours.
- Figure 42C depicts semiquantitative PCR analysis of TRIM11, HSP70, HSP90 and GAPDH in response to heat shock in hippocampal neurons.
- the present invention is related to the discovery of the role of members of the tripartite motif (TRIM) family of proteins and the SUMO-dependent ubiquitin ligase RNF4 in the recognition and degradation of misfolded proteins, which play a role in the pathology of a variety of neurodegenerative disorders.
- TAM tripartite motif
- RNF4 SUMO-dependent ubiquitin ligase
- the present invention provides compositions and methods to treat or prevent a disease or disorder associated with misfolded protein or protein aggregates. It is demonstrated herein that TRIM proteins have roles in targeting misfolded proteins for proteosomal degradation, as chaperone protein, and in
- the present invention can be used to eliminate intracellular or extracellular misfolded proteins, protein aggregates, or protein inclusions.
- the invention provides compositions and methods to treat or prevent a neurodegenerative disorder in a subject in need thereof.
- the invention provides compositions and methods for the treatment or prevention of neurodegenerative disorders that are poly-glutamine (polyQ) disorders, where repeats of the CAG codon encode proteins with polyglutamine tracts that can result in misfolded protein aggregates.
- polyQ disorders include, but are not limited to Spinocerebellar ataxia (SCA) Type 1 (SCAl), SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, and Dentatorubral-pallidoluysian atrophy
- the invention provides compositions and methods for the treatment of neurodegenerative disorders associated with misfolded proteins or protein aggregates, including, but not limited to, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathies (prion disease), tauopathies, and Frontotemporal lobar degeneration (FTLD).
- ALS amyotrophic lateral sclerosis
- FTLD Frontotemporal lobar degeneration
- the present invention is not limited to the treatment or prevention of neurodegenerative disorders. Rather, the invention encompasses the treatment or prevention of any disease or disorder associated with a misfolded protein or protein aggregate.
- diseases and disorders include, but is not limited to AL amyloidosis, AA amyloidosis, Familial Mediterranean fever, senile systemic amyloidosis, familial amyloidotic polyneuropathy, hemodialysis-related amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, Finnish hereditary amyloidosis, lysozyme amyloidosis, fibrinogen amyloidosis, Icelandic hereditary cerebral amyloid angiopathy, type II diabetes, medullary carcinoma of the thyroid, atrial amyloidosis, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, injection-localized amyloidosis, aortic medial amyloidosis, hereditary lattice corneal dystrophy, corneal amyloidosis associated with trichiasis,
- the invention encompasses the use of one or more TRIM proteins to stabilize a misfolded protein.
- stabilization of a functional misfolded protein via one or more TRIM proteins described herein can treat or prevent a disease or disorder associated with the misfolded protein.
- a disease or disorder associated with the misfolded protein for example, in one
- stabilization of mutant cystic fibrosis transmembrane conductance regulator (CFTR), via one or more TRIM proteins described herein would allow mutant CFTR to function instead of being degraded. It is envisioned that using TRIM proteins to stabilize misfolded proteins can be used to treat cystic fibrosis and other diseases associated with degradation of partially functional proteins. Stabilization of proteins, via one or more TRIM proteins described herein, can be used to treat any disease or disorder associated with degradation of functional mutant protein, including but not limited to cystic fibrosis and lysosomal storage diseases such as Gaucher' s disease and Fabry's disease.
- the present invention provides compositions and methods to increase the expression, activity, or both of a TRIM protein.
- the composition comprises a nucleic acid molecule, expression vector, protein, peptide, small molecule, or the like, which increases the expression, activity, or both of one or more TRIM proteins.
- the present invention provides compositions and methods to increase the expression, activity, or both of one or more SUMO-targeted ubiquitin ligases (STUbL).
- the composition comprises a nucleic acid molecule, expression vector, protein, peptide, small molecule, or the like, which increases the expression, activity, or both of one or more STUbLs.
- an element means one element or more than one element.
- abnormal when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the "normal” (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
- a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
- a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
- a disease or disorder is "alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a patient, or both, is reduced.
- An “effective amount” or “therapeutically effective amount” of a compound is that amount of a compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
- An “effective amount” of a delivery vehicle is that amount sufficient to effectively bind or deliver a compound.
- an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of a compound, composition, vector, or delivery system of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
- the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.
- the instructional material of the kit of the invention can, for example, be affixed to a container which contains the identified compound, composition, vector, or delivery system of the invention or be shipped together with a container which contains the identified compound, composition, vector, or delivery system.
- the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
- patient refers to any animal, or cells thereof whether in vitro or in vivo, amenable to the methods described herein.
- patient, subject or individual is a human.
- a “therapeutic” treatment is a treatment administered to a subject who exhibits signs or symptoms of a disease or disorder, for the purpose of diminishing or eliminating those signs or symptoms.
- treating a disease or disorder means reducing the severity and/or frequency with which a sign or symptom of the disease or disorder is experienced by a patient.
- biological sample is intended to include any sample comprising a cell, a tissue, or a bodily fluid in which expression of a nucleic acid or polypeptide is present or can be detected. Samples that are liquid in nature are referred to herein as "bodily fluids.” Biological samples may be obtained from a patient by a variety of techniques including, for example, by scraping or swabbing an area of the subject or by using a needle to obtain bodily fluids. Methods for collecting various body samples are well known in the art.
- an “immunoassay” refers to any binding assay that uses an antibody capable of binding specifically to a target molecule to detect and quantify the target molecule.
- an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample.
- an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific.
- an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific.
- the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope "A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled "A” and the antibody, will reduce the amount of labeled A bound to the antibody.
- a particular structure e.g., an antigenic determinant or epitope
- a "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
- a "coding region" of a mRNA molecule consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon.
- the coding region may thus include nucleotide residues comprising codons for amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).
- "Complementary" as used herein to refer to a nucleic acid refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand.
- an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil.
- base pairing specific hydrogen bonds
- a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine.
- a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region.
- the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%), or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
- isolated means altered or removed from the natural state.
- a nucleic acid or a peptide naturally present in its normal context in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural context is “isolated.”
- An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
- isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, i.e., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, i.e., the sequences adjacent to the fragment in a genome in which it naturally occurs.
- the term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, i.e., RNA or DNA or proteins, which naturally accompany it in the cell.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (i.e., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
- A refers to adenosine
- C refers to cytosine
- G refers to guanosine
- T refers to thymidine
- U refers to uridine.
- nucleotide as used herein is defined as a chain of nucleotides.
- nucleic acids are polymers of nucleotides.
- nucleic acids and polynucleotides as used herein are interchangeable.
- nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides.
- polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
- recombinant means i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
- polypeptide As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified
- polypeptides derivatives, analogs, fusion proteins, among others.
- the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
- conjugated refers to covalent attachment of one molecule to a second molecule.
- Variant is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential biological properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical.
- a variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
- a variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
- a "modulator of one or more TRIM proteins” is a compound that modifies the expression, activity or biological function of the TRIM protein as compared to the expression, activity or biological function of the TRIM protein in the absence of the modulator.
- a "modulator of RNF4" is a compound that modifies the expression, activity or biological function of RNF4 as compared to the expression, activity or biological function of RNF4 in the absence of the modulator.
- ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Description
- the present invention provides compositions and methods to treat or prevent a disease or disorder associated with misfolded proteins or protein aggregates.
- the present invention provides compositions and methods to increase the recognition and elimination of misfolded proteins.
- the invention provides for the SUMO-mediated ubiquitination and eventual degradation of misfolded protein.
- the invention provides for the
- the present invention can thus be used to eliminate misfolded proteins, protein aggregates, or protein inclusions, both intracellularly or extracellularly.
- the present invention is related to the discovery of the role of members of the tripartite motif (TRIM) family of proteins and the SUMO-targeted ubiquitin ligase (STUbL), RNF4, in the recognition and degradation of misfolded proteins, which play a role in the pathology of a variety of diseases and disorders, including many
- the present invention provides compositions that increase the expression, activity, or both of one or more TRIM proteins, one or more STUbLs, or a combination thereof.
- nucleic acid molecules encoding a TRFM protein and recombinant TRIM proteins promotes the degradation of misfolded protein.
- the composition comprises a modulator of the expression or activity of one or more TRIM proteins.
- the modulator increases the expression or activity of one or more TRIM proteins.
- the one or more TRIM proteins include, any member of the TRIM protein family, including mammalian and non-mammalian members.
- the modulator increases the expression or activity of one or more of human TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM9, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM19 (also referred to herein as "PML"), TRIM20, TRIM21, TRIM24, TRIM25, TRIM27, TRIM28, TRIM29, TRIM32, TRIM34, TRIM39, TRIM43, TRIM44, TRIM45, TRIM46, TRIM49, TRIM50, TRIM52, TRIM58, TRIM59, TRIM65, TRIM67, TRIM69, TRIM70, TRIM74 and TRIM75; and mouse TRIM30.
- the composition comprises a modulator of one or more STUbLs.
- the modulator increases the expression or activity of one or more STUbLs.
- Exemplary STUbLs include, but are not limited to R F4 and RNF111 (also known as Arkadia).
- the composition comprises a modulator of one or more TRIM proteins and a modulator of one or more STUbLs.
- the present invention provides a method for treating or preventing a disease or disorder associated with misfolded proteins or protein aggregates, in a subject in need. It is found herein that increasing the level of expression or activity of a TRIM protein or STUbL, can promote the degradation of misfolded protein, thereby treating the disease or disorder in the subject.
- neurodegenerative diseases or disorders which may be treated or prevented by the compositions and methods of this invention include, but are not limited to polyQ disorders such as SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, Dentatorubral-pallidoluysian atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathies (prion disease), tauopathies, and Frontotemporal lobar degeneration (FTLD).
- DPLA Dentatorubral-pallidoluysian atrophy
- Alzheimer's disease Parkinson's disease
- ALS amyotrophic lateral sclerosis
- FTLD Frontotemporal lobar degeneration
- the present invention is not limited to the treatment or prevention of neurodegenerative disorders. Rather, the invention encompasses the treatment or prevention of any disease or disorder associated with a misfolded protein or protein aggregate.
- diseases and disorders include, but is not limited to AL amyloidosis, AA amyloidosis, Familial Mediterranean fever, senile systemic amyloidosis, familial amyloidotic polyneuropathy, hemodialysis-related amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, Finnish hereditary amyloidosis, lysozyme amyloidosis, fibrinogen amyloidosis, Icelandic hereditary cerebral amyloid angiopathy, type II diabetes, medullary carcinoma of the thyroid, atrial amyloidosis, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, injection- localized amyloidosis, aortic medial amyloidosis, hereditary lattice corneal dystrophy, corneal amyloidosis associated with trichiasis,
- the invention encompasses the use of one or more TRIM proteins to stabilize a misfolded protein.
- stabilization of a functional misfolded protein via one or more TRIM proteins described herein can treat or prevent a disease or disorder associated with the misfolded protein, including but not limited to cystic fibrosis and lysosomal storage diseases such as Gaucher' s disease and Fabry's disease.
- the present invention provides a method to diagnose a disease or disorder associated with a misfolded protein or protein aggregate.
- a disease or disorder associated with a misfolded protein or protein aggregate For example, in one embodiment, one or more TRIM proteins or one or more STUbLs are used as diagnostic markers.
- the present invention is directed to compositions and methods for manufacture of a recombinant protein of interest.
- the one or more TRIM proteins and one or more STUbLs can be used to disaggregate protein aggregates of recombinant protein of interest.
- the present invention includes modulator compositions and methods of preventing and treating a disease or disorder associated with misfolded protein or protein aggregates.
- the modulator compositions and methods of preventing or treating of the invention modulate the level or activity of a gene, or gene product.
- the modulator composition of the invention is an activator that increases the level or activity of a gene, or gene product. It will be understood by one skilled in the art, based upon the disclosure provided herein, that modulating a gene, or gene product, encompasses modulating the level or activity of a gene, or gene product, including, but not limited to, modulating the transcription, translation, splicing, degradation, enzymatic activity, binding activity, or combinations thereof.
- modulating the level or activity of a gene, or gene product includes, but is not limited to, modulating transcription, translation, degradation, splicing, or combinations thereof, of a nucleic acid; and it also includes modulating any activity of polypeptide gene product as well.
- the modulator increases the expression or activity of a gene or gene product by increasing production of the gene or gene product, for example by modulating transcription of the gene or translation of the gene product. In one embodiment, the modulator increases the expression or activity of a gene or gene product by providing exogenous gene or gene product.
- the modulator comprises an isolated nucleic acid encoding one or more TRIM proteins or one or more STUbLs. In one embodiment, the modulator comprises an isolated nucleic acid encoding one or more TRIM proteins and one or more STUbLs. In certain embodiments, the modulator comprises an isolated peptide comprising one or more TRIM proteins or one or more STUbLs.
- the modulator comprises an isolated peptide comprising one or more TRIM proteins and one or more STUbLs.
- the modulator increases the expression or activity of a gene or gene product by inhibiting the degradation of the gene or gene product. For example, in one embodiment, the modulator decreases the ubiquitination, proteosomal degradation, or proteolysis of one or more TRIM proteins or one or more STUbLs. In one embodiment, the modulator increases the stability or half-life of a gene product.
- the modulated gene, or gene product is one or more TRIM proteins.
- TRIM proteins recognize misfolded proteins and mediate the degradation of misfolded proteins and protein aggregates.
- the gene or gene product is one or more STUbLs.
- RNF4 a member of the STUbl family of proteins, mediates the degradation of misfolded proteins and protein aggregates. Modulation of a gene, or gene product, can be assessed using a wide variety of methods, including those disclosed herein, as well as methods known in the art or to be developed in the future.
- modulating the level or activity of a gene, or gene product can be readily assessed using methods that assess the level of a nucleic acid encoding a gene product (e.g., mRNA), the level of polypeptide gene product present in a biological sample, the activity of polypeptide gene product present in a biological sample, or combinations thereof.
- a gene product e.g., mRNA
- modulator compositions and methods of the invention that modulate the level or activity of a gene, or gene product include, but should not be construed as being limited to, a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule (e.g., siRNA, miRNA, etc.), or combinations thereof.
- a modulator composition encompasses a chemical compound that modulates the level or activity of a gene, or gene product.
- a modulator composition encompasses a chemically modified compound, and derivatives, as is well known to one of skill in the chemical arts.
- the modulator composition of the present invention is an agonist, which increases the expression, activity, or biological function of a gene or gene product.
- the modulator of the present invention is an agonist of one or more TRIM proteins or one or more STUbLs.
- modulators include such modulators as discovered in the future, as can be identified by well-known criteria in the art of pharmacology, such as the physiological results of modulation of the genes, and gene products, as described in detail herein and/or as known in the art. Therefore, the present invention is not limited in any way to any particular modulator composition as exemplified or disclosed herein; rather, the invention encompasses those modulator compositions that would be understood by the routineer to be useful as are known in the art and as are discovered in the future. Further methods of identifying and producing modulator compositions are well known to those of ordinary skill in the art. Alternatively, a modulator can be synthesized chemically.
- a modulator composition can be obtained from a recombinant organism.
- Compositions and methods for chemically synthesizing modulators and for obtaining them from natural sources are well known in the art and are described in the art.
- a modulator can be administered as a small molecule chemical, a polypeptide, a peptide, an antibody, a nucleic acid construct encoding a protein, an antisense nucleic acid, a nucleic acid construct encoding an antisense nucleic acid, or combinations thereof.
- Numerous vectors and other compositions and methods are well known for administering a protein or a nucleic acid construct encoding a protein to cells or tissues. Therefore, the invention includes a peptide or a nucleic acid encoding a peptide that is modulator of a gene, or gene product.
- the invention includes a peptide or a nucleic acid encoding a peptide that comprises one or more TR M proteins, one or more STUbLs, or a combination thereof.
- the composition of the present invention comprises one or more peptides.
- a peptide of the composition comprises an amino acid sequence of one or more TRIM proteins.
- the peptide comprises one or more of TRIM55, TRIM 11, TRFM19, TRFM 21, TRIM27, and TRIM32.
- the peptide comprises an amino acid sequence of one or more STUbLs.
- the peptide comprises one or more of RNF4 and RNFl 11 (Arkadia).
- TRIM protein nucleotide and amino acid sequences are provided in Table 1 below.
- Table 1 TRIM protein nucleotide and amino acid sequences
- the invention should also be construed to include any form of a peptide having substantial homology to the peptides disclosed herein.
- a peptide which is "substantially homologous" is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferably about 99% homologous to amino acid sequence of the peptides disclosed herein.
- the composition of the invention comprises a peptide, a fragment of a peptide, a homolog, a variant, a derivative or a salt of a peptide described herein.
- the composition comprises a peptide comprising one or more TRIM proteins, a fragment of one or more TRIM proteins, a homolog of one or more TRIM proteins, a variant of one or more TRIM proteins, a derivative of one or more TRIM proteins, or a salt of one or more TRIM proteins.
- the composition comprises a peptide comprising one or more STUbLs, a fragment of one or more STUbLs, a homolog of one or more STUbLs, a variant of one or more STUbLs, a derivative of one or more STUbLs, or a salt of one or more STUbLs.
- the composition comprises a combination of the peptides described herein.
- the composition comprises a peptide comprising one or more TRIM proteins and a peptide comprising one or more STUbLs.
- the composition comprises a peptide comprising one or more TRIM proteins and one or more STUbLs.
- the peptide comprises a targeting domain, which targets the peptide to a desired location.
- the targeting domain binds to a targeted cell, protein, or protein aggregate, thereby delivering the therapeutic peptide to a desired location.
- the targeting domain is directed to bind to a protein or protein aggregate associated with a disease or disorder, including but not limited to the proteins and protein aggregates of amyloid-beta, alpha-synuclein, tau, prions, SOD1, TDP-43, FUS, p53 mutants, and proteins associated with polyglutamine repeats, such as huntingtin, ataxins.
- the targeting domain comprises a peptide, nucleic acid, small molecule, or the like, which has the ability to bind to the targeted cell, protein, or protein aggregate.
- the targeting domain comprises an antibody or antibody fragment which binds to a targeted cell, protein, or protein aggregate.
- the peptide of the present invention may be made using chemical methods.
- peptides can be synthesized by solid phase techniques (Roberge J Y et al (1995) Science 269: 202-204), cleaved from the resin, and purified by preparative high performance liquid chromatography. Automated synthesis may be achieved, for example, using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
- the peptide may alternatively be made by recombinant means or by cleavage from a longer polypeptide.
- the composition of a peptide may be confirmed by amino acid analysis or sequencing.
- the variants of the peptides according to the present invention may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the peptide is an alternative splice variant of the peptide of the present invention, (iv) fragments of the peptides and/or (v) one in which the peptide is fused with another peptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag).
- a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
- the fragments include peptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
- the peptides of the invention can be post-translationally modified.
- post-translational modifications that fall within the scope of the present invention include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristoylation, protein folding and proteolytic processing, etc.
- Some modifications or processing events require introduction of additional biological machinery.
- processing events such as signal peptide cleavage and core glycosylation, are examined by adding canine microsomal membranes or Xenopus egg extracts (U.S. Pat. No. 6,103,489) to a standard translation reaction.
- the peptides of the invention may include unnatural amino acids formed by post-translational modification or by introducing unnatural amino acids during translation.
- a variety of approaches are available for introducing unnatural amino acids during protein translation.
- special tRNAs such as tRNAs which have suppressor properties, suppressor tRNAs, have been used in the process of site- directed non-native amino acid replacement (SNAAR).
- SNAAR site- directed non-native amino acid replacement
- a unique codon is required on the mRNA and the suppressor tRNA, acting to target a non-native amino acid to a unique site during the protein synthesis (described in WO90/05785).
- the suppressor tRNA must not be recognizable by the aminoacyl tRNA synthetases present in the protein translation system.
- a non-native amino acid can be formed after the tRNA molecule is aminoacylated using chemical reactions which specifically modify the native amino acid and do not significantly alter the functional activity of the aminoacylated tRNA. These reactions are referred to as post-aminoacylation
- the epsilon-amino group of the lysine linked to its cognate tRNA could be modified with an amine specific photoaffinity label.
- the peptides of the invention may be conjugated with other molecules, such as proteins, to prepare fusion proteins. This may be accomplished, for example, by the synthesis of N-terminal or C-terminal fusion proteins provided that the resulting fusion protein retains the functionality of the peptide of the invention.
- Cyclic derivatives of the peptides the invention are also part of the present invention. Cyclization may allow the peptide to assume a more favorable conformation for association with other molecules. Cyclization may be achieved using techniques known in the art. For example, disulfide bonds may be formed between two appropriately spaced components having free sulfhydryl groups, or an amide bond may be formed between an amino group of one component and a carboxyl group of another component. Cyclization may also be achieved using an azobenzene-containing amino acid as described by Ulysse, L., et al., J. Am. Chem. Soc. 1995, 117, 8466-8467. The
- cyclic peptides may comprise a beta-turn in the right position. Beta-turns may be introduced into the peptides of the invention by adding the amino acids Pro-Gly at the right position.
- a more flexible peptide may be prepared by introducing cysteines at the right and left position of the peptide and forming a disulphide bridge between the two cysteines.
- the two cysteines are arranged so as not to deform the beta-sheet and turn.
- the peptide is more flexible as a result of the length of the disulfide linkage and the smaller number of hydrogen bonds in the beta-sheet portion.
- the relative flexibility of a cyclic peptide can be determined by molecular dynamics simulations.
- Peptides of the invention may also have modifications. Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or
- peptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent.
- Such variants include those containing residues other than naturally - occurring L-amino acids, e.g., D-amino acids or non-naturally-occurring synthetic amino acids.
- the peptides of the invention may further be conjugated to non-amino acid moieties that are useful in their therapeutic application.
- moieties that improve the stability, biological half-life, water solubility, and/or immunologic characteristics of the peptide are useful.
- a non-limiting example of such a moiety is polyethylene glycol (PEG).
- Covalent attachment of biologically active compounds to water-soluble polymers is one method for alteration and control of biodistribution, pharmacokinetics, and often, toxicity for these compounds (Duncan et al., 1984, Adv. Polym. Sci. 57:53- 101).
- PEG poly(ethylene glycol)
- PEG poly(sialic acid), dextran, poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA), poly(N- vinylpyrrolidone) (PVP), poly(vinyl alcohol) (PVA), poly(ethylene glycol-co-propylene glycol), poly(N-acryloyl morpholine (PAcM), and poly(ethylene glycol) (PEG)
- PEG poly(ethylene glycol)
- PEG possess an ideal set of properties: very low toxicity (Pang, 1993, J. Am. Coll. Toxicol. 12: 429-456) excellent solubility in aqueous solution (Powell, supra), low immunogenicity and antigenicity
- PEG-conjugated or "PEGylated" protein therapeutics containing single or multiple chains of polyethylene glycol on the protein, have been described in the scientific literature (Clark et al., 1996, J. Biol. Chem. 271 : 21969-21977; Hershfield, 1997, Biochemistry and immunology of poly(ethylene glycol)-modified adenosine deaminase (PEG-ADA). In J. M. Harris and S. Zalipsky (Eds) Poly(ethylene glycol): Chemistry and Biological Applications.
- a peptide of the invention may be synthesized by conventional techniques.
- the peptides of the invention may be synthesized by chemical synthesis using solid phase peptide synthesis. These methods employ either solid or solution phase synthesis methods (see for example, J. M. Stewart, and J. D. Young, Solid Phase Peptide Synthesis, 2 nd Ed., Pierce Chemical Co., Rockford 111. (1984) and G.
- the peptides may be chemically synthesized by Merrifield-type solid phase peptide synthesis. This method may be routinely performed to yield peptides up to about 60-70 residues in length, and may, in some cases, be utilized to make peptides up to about 100 amino acids long. Larger peptides may also be generated synthetically via fragment condensation or native chemical ligation (Dawson et al., 2000, Ann. Rev.
- Solid phase peptide synthesis is described by Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, 111.;
- solid phase peptide synthesis methods include the BOC method which utilized tert-butyloxcarbonyl as the alpha-amino protecting group, and the FMOC method which utilizes 9-fluorenylmethyloxcarbonyl to protect the alpha-amino of the amino acid residues, both which methods are well-known by those of skill in the art.
- N- and/or C-blocking groups may also be achieved using protocols conventional to solid phase peptide synthesis methods.
- C- terminal blocking groups for example, synthesis of the desired peptide is typically performed using, as solid phase, a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group.
- a supporting resin that has been chemically modified so that cleavage from the resin results in a peptide having the desired C-terminal blocking group.
- synthesis is performed using a p-methylbenzhydrylamine (MBHA) resin, so that, when peptide synthesis is completed, treatment with hydrofluoric acid releases the desired C-terminally amidated peptide.
- MBHA p-methylbenzhydrylamine
- N-methylaminoethyl- derivatized DVB resin, which upon HF treatment releases a peptide bearing an N- methylamidated C-terminus.
- Blockage of the C-terminus by esterification can also be achieved using conventional procedures. This entails use of resin/blocking group combination that permits release of side-chain peptide from the resin, to allow for subsequent reaction with the desired alcohol, to form the ester function.
- FMOC protecting group in combination with DVB resin derivatized with methoxyalkoxybenzyl alcohol or equivalent linker, can be used for this purpose, with cleavage from the support being effected by TFA in dicholoromethane. Esterification of the suitably activated carboxyl function, e.g. with DCC, can then proceed by addition of the desired alcohol, followed by de-protection and isolation of the esterified peptide product.
- the peptides of the invention may be prepared by standard chemical or biological means of peptide synthesis.
- Biological methods include, without limitation, expression of a nucleic acid encoding a peptide in a host cell or in an in vitro translation system.
- nucleic acid sequences that encode the peptide of the invention.
- the invention includes nucleic acid sequences encoding the amino acid sequence of one or more TRFM proteins or one or more STUbLs. Accordingly, subclones of a nucleic acid sequence encoding a peptide of the invention can be produced using conventional molecular genetic manipulation for subcloning gene fragments, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (2012), and Ausubel et al.
- the one or more peptides of the invention can be provided a fusion peptide along with a second peptide which promotes "transcytosis", e.g., uptake of the peptide by cells.
- the peptide may comprise a cell-penetrating domain, for example a cell-penetrating peptide (CPP) to allow for the peptide to enter a cell.
- CPP cell-penetrating peptide
- the CPP is derived from HIV Tat.
- the one or more peptides of the present invention can be provided as part of a fusion polypeptide with all or a fragment of the N-terminal domain of the HIV protein Tat, e.g., residues 1-72 of Tat or a smaller fragment thereof which can promote transcytosis.
- the peptide comprises the protein transduction domain of HIV Tat (YGRKKRRQRRR; (SEQ ID NO: 163)).
- the one or more peptides can be provided a fusion polypeptide with all or a portion of the antenopedia III protein.
- Other cell-penetrating domains that mediate uptake of the peptide are known in the art, and are equally applicable for use in a fusion peptide of the present invention.
- the composition of the invention comprises one or isolated nucleic acids.
- the one or more isolated nucleic acids encodes one or more TRIM proteins.
- the one or more isolated nucleic acids encodes one or more of human TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM9, TRIM11, TRIM13, TRIM14, TRHVI15, TREVI16, TREVI17, TRIM19 (also referred to herein as "PML"), TRIM20, TRIM21, TRIM24, TRIM25, TRIM27, TRIM28, TRIM29, TRIM32, TRIM34, TRIM39, TRIM43, TRIM44, TRIM45, TRIM46, TRIM49, TRIM50, TRIM52, TRIM58, TRIM59, TRIM65, TRIM67, TRIM69, TRIM70,
- a peptide corresponding to one or more TRIM proteins or one or more STUbLs is expressed from the one or more nucleic acids in a cell in vivo or in vitro using known techniques.
- the nucleotide sequence of the isolated nucleic acids include both the DNA sequence that is transcribed into RNA and the RNA sequence that is translated into a polypeptide. According to other embodiments, the nucleotide sequences are inferred from the amino acid sequence of the peptides of the invention. As is known in the art several alternative nucleotide sequences are possible due to redundant codons, while retaining the biological activity of the translated peptides.
- the invention encompasses an isolated nucleic acid comprising a nucleotide sequence having substantial homology to a nucleotide sequence encoding a disclosed herein.
- the nucleotide sequence of an isolated nucleic acid is "substantially homologous,” that is, is about 60% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferably about 99% homologous to a nucleotide sequence of an isolated nucleic acid encoding a peptide of the invention.
- the composition comprises a combination of the nucleic acid molecules described herein.
- the composition comprises an isolated nucleic acid molecule encoding one or more TRFM proteins and an isolated nucleic acid molecule encoding one or more STUbLs.
- the composition comprises an isolated nucleic acid molecule encoding one or more TRIM proteins and one or more STUbLs.
- the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012,
- the desired nucleic acid encoding one or more one or more TRIM proteins or one or more STUbLs can be cloned into a number of types of vectors.
- a desired polynucleotide of the invention can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid.
- Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
- the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector.
- a viral vector a viral vector
- bacterial vector a viral vector
- mammalian cell vector a mammalian cell vector.
- the expression vector may be provided to a cell in the form of a viral vector.
- Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012), and in Ausubel et al. (1997), and in other virology and molecular biology manuals.
- Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.
- a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193.
- retroviruses provide a convenient platform for gene delivery systems.
- a selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art.
- the recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
- retroviral systems are known in the art.
- adenovirus vectors are used.
- a number of adenovirus vectors are known in the art.
- lentivirus vectors are used.
- vectors derived from retroviruses such as the lentivirus are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells.
- Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.
- the composition includes a vector derived from an adeno-associated virus (AAV).
- Adeno- associated viral (AAV) vectors have become powerful gene delivery tools for the treatment of various disorders.
- AAV vectors possess a number of features that render them ideally suited for gene therapy, including a lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate
- the encoding sequence is contained within an AAV vector. More than 30 naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for skeletal muscle.
- AAV viruses may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
- expression of one or more TRIM proteins or one or more STUbLs can be achieved by delivering a recombinantly engineered AAV or artificial AAV that contains one or more encoding sequences.
- AAVs is a common mode of exogenous delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes.
- Exemplary AAV serotypes include, but is not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9.
- Desirable AAV fragments for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences.
- artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein.
- Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source.
- An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.
- exemplary AAVs, or artificial AAVs, suitable for expression of one or more TRIM proteins or one or more STUbLs include AAV2/8 (see U. S. Pat. No. 7,282, 199), AAV2/5 (available from the National Institutes of Health),
- AAV2/9 International Patent Publication No. WO2005/033321
- AAV2/6 U.S. Pat. No. 6, 156,303
- AAVrh8 International Patent Publication No. WO2003/042397
- At least one module in each promoter functions to position the start site for RNA synthesis.
- the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 genes, a discrete element overlying the start site itself helps to fix the place of initiation.
- promoter elements i.e., enhancers
- promoters regulate the frequency of transcriptional initiation.
- these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
- the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
- tk thymidine kinase
- the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
- individual elements can function either co-operatively or independently to activate transcription.
- a promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous.”
- an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence.
- certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment.
- a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment.
- Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
- sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (U.S. Patent 4,683,202, U.S. Patent 5,928,906).
- control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
- promoters and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression.
- promoters, enhancers, and cell type combinations for protein
- the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
- the promoter may be heterologous or endogenous.
- the promoter or enhancer specifically directs expression of the one or more TRIM proteins or one or more STUbLs in the intestinal epithelium in neural tissue.
- the promoter or enhancer specifically directs expression of the one or more TRIM proteins or one or more STUbLs in a neuron, astrocyte, oligodendrocyte, Perkinje cell, pyramidal cell, or the like.
- the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
- the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
- Useful selectable markers are known in the art and include, for example, antibiotic- resistance genes, such as neo and the like.
- Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the
- DNA has been introduced into the recipient cells.
- Suitable reporter genes may include genes encoding luciferase, beta- galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (see, e.g., Ui-Tei et al., 2000 FEBS Lett. 479:79-82).
- Suitable expression systems are well known and may be prepared using well known techniques or obtained commercially. Internal deletion constructs may be generated using unique internal restriction sites or by partial digestion of non-unique restriction sites.
- Constructs may then be transfected into cells that display high levels of siRNA polynucleotide and/or polypeptide expression.
- the construct with the minimal
- promoter regions 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter.
- Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.
- the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast or insect cell by any method in the art.
- the expression vector can be transferred into a host cell by physical, chemical or biological means.
- Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
- Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al.
- Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
- Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
- Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
- assays include, for example, "molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
- molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
- biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
- Any DNA vector or delivery vehicle can be utilized to transfer the desired polynucleotide to a cell in vitro or in vivo.
- a preferred delivery vehicle is a liposome.
- the above-mentioned delivery systems and protocols therefore can be found in Gene Targeting Protocols, 2ed., pp 1-35 (2002) and Gene Transfer and Expression Protocols, Vol. 7, Murray ed., pp 81-89 (1991).
- Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers. However, the present invention also encompasses compositions that have different structures in solution than the normal vesicular structure. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are
- the composition of the invention comprises in vitro transcribed (IVT) RNA encoding one or more components of the one or more TRIM proteins or one or more STUbLs.
- IVT in vitro transcribed
- an IVT RNA can be introduced to a cell as a form of transient transfection.
- the RNA is produced by in vitro transcription using a plasmid DNA template generated synthetically. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase.
- the source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
- the desired template for in vitro transcription is one or more TRIM proteins or one or more STUbLs.
- the DNA to be used for PCR contains an open reading frame.
- the DNA can be from a naturally occurring DNA sequence from the genome of an organism.
- the DNA is a full length gene of interest of a portion of a gene.
- the gene can include some or all of the 5' and/or 3' untranslated regions (UTRs).
- the gene can include exons and introns.
- the DNA to be used for PCR is a human gene.
- the DNA to be used for PCR is a human gene including the 5' and 3' UTRs.
- the DNA can alternatively be an artificial DNA sequence that is not normally expressed in a naturally occurring organism.
- An exemplary artificial DNA sequence is one that contains portions of genes that are ligated together to form an open reading frame that encodes a fusion protein. The portions of DNA that are ligated together can be from a single organism or from more than one organism.
- the present invention includes a composition comprising a cell which comprises one or more TRIM proteins, one or more STUbLs, a nucleic acid encoding a one or more TRIM proteins, a nucleic acid encoding a one or more STUbLs or a combination thereof.
- the cell is genetically modified to express a protein and/or nucleic acid of the invention.
- genetically modified cell is autologous to a subject being treated with the composition of the invention.
- the cells can be allogeneic, syngeneic, or xenogeneic with respect to the subject.
- the cell is able to secrete or release the expressed protein into extracellular space in order to deliver the peptide to one or more other cells.
- the genetically modified cell may be modified in vivo or ex vivo, using techniques standard in the art. Genetic modification of the cell may be carried out using an expression vector or using a naked isolated nucleic acid construct.
- the cell is obtained and modified ex vivo, using an isolated nucleic acid encoding one or more proteins described herein.
- the cell is obtained from a subject, genetically modified to express the protein and/or nucleic acid, and is re-administered to the subject.
- the cell is expanded ex vivo or in vitro to produce a population of cells, wherein at least a portion of the population is administered to a subject in need.
- the cell is genetically modified to stably express the protein. In another embodiment, the cell is genetically modified to transiently express the protein.
- the present invention provides a scaffold or substrate composition comprising a protein of the invention, an isolated nucleic acid of the invention, a cell expressing the protein of the invention, or a combination thereof.
- a protein of the invention, an isolated nucleic acid of the invention, a cell a cell expressing the protein of the invention, or a combination thereof is incorporated within a scaffold.
- a protein of the invention, an isolated nucleic acid of the invention, a cell expressing the protein of the invention, or a combination thereof is applied to the surface of a scaffold.
- the scaffold of the invention may be of any type known in the art. Non-limiting examples of such a scaffold includes a, hydrogel, electrospun scaffold, foam, mesh, sheet, patch, and sponge. Therapeutic Methods
- the present invention also provides therapeutic methods for a disease or disorder associated with protein misfolding, protein aggregates, or a combination thereof.
- diseases and disorders treatable by the methods of the invention include, but are not limited to: polyQ disorders such as SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, Dentatorubral-pallidoluysian atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathies (prion disease), tauopathies, Frontotemporal lobar degeneration (FTLD), AL amyloidosis, AA amyloidosis, Familial Mediterranean fever, senile systemic amyloidosis, familial amyloidotic polyneuropathy, hemodialysis-related amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, Finnish hereditary amyloidosis, lysozyme amyloidosis, fibrinogen amyloid
- the invention is not limited to treatment of a disease associated with protein misfolding or protein aggregates that is already established.
- the disease or disorder need not have manifested to the point of detriment to the subject; indeed, the disease or disorder need not be detected in a subject before treatment is administered. That is, significant signs or symptoms of the disease or disorder do not have to occur before the present invention may provide benefit. Therefore, the present invention includes a method for preventing a disease or disorder associated with protein misfolding or protein aggregates, in that a modulator
- a disease associated with protein misfolding or protein aggregates encompasses administering to a subject a modulator composition as a preventative measure against the development of, or progression of a disease associated with protein misfolding or protein aggregates.
- methods of modulating the level or activity of a gene, or gene product encompass a wide plethora of techniques for modulating not only the level and activity of polypeptide gene products, but also for modulating expression of a nucleic acid, including either transcription, translation, or both.
- the method comprises use of one or more TRIM proteins to stabilize a misfolded protein.
- stabilization of a functional misfolded protein via one or more TRIM proteins described herein can treat or prevent a disease or disorder associated with the misfolded protein.
- stabilization of mutant cystic fibrosis transmembrane conductance regulator (CFTR), via one or more TRFM proteins described herein would allow mutant CFTR to function instead of being degraded. It is envisioned that using TRIM proteins to stabilize misfolded proteins can be used to treat cystic fibrosis and other diseases associated with degradation of partially functional proteins.
- Stabilization of proteins, via one or more TRIM proteins described herein, can be used to treat any disease or disorder associated with degradation of functional mutant protein, including but not limited to cystic fibrosis and lysosomal storage diseases such as Gaucher' s disease and Fabry's disease.
- the method comprises administering to the subject in need an effective amount of a composition that increases the expression or activity of one or more of human TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM9, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM19 (also referred to herein as "PML"), TRIM20, TRIM21, TRIM24, TRIM25, TRIM27, TRIM28, TRIM29, TRIM32, TRIM34, TRIM39, TRIM43, TRIM44, TRIM45, TRJM46, TRFM49, TRFM50, TRIM52, TRIM58, TRIM59, TRIM65, TRIM67, TRIM69, TRJM70, TRFM74 and TRIM75; and mouse TRFM30.
- the method comprises administering to the subject an effective amount of a composition that increases the expression or activity of one or more TRIM proteins and one or more STUbLs.
- the method comprises increasing the expression or activity of the one or more TRIM proteins or one or more STUbLs in at least one neural cell of the subject.
- the method comprises increasing the expression or activity of the one or more TRIM proteins or one or more STUbLs in a at least one neuron, astrocyte, oligodendrocyte, Perkinje cell, pyramidal cell, or the like.
- the method comprises contacting the neural tissue of a subject with an effective amount of a composition that increases the expression or activity of one or more components of the one or more TRIM proteins or one or more STUbLs.
- the method comprises contacting a neuron, astrocyte, oligodendrocyte, Perkinje cell, pyramidal cell, or the like, of a subject with an effective amount of a composition that increases the expression or activity of one or more TRIM proteins or one or more STUbLs.
- any of the modulators of the invention described herein can be administered alone or in combination with other modulators of other molecules associated with a disease associated with protein misfolding or protein aggregates.
- any of the modulators of the invention described herein can be administered alone or in combination with other therapeutic or preventative agents which may be used to treat or prevent a disease associated with protein misfolding or protein aggregates.
- Exemplary therapeutic agents which may be used in combination with the modulators of the present invention include, but is not limited to, anti-amyloid- ⁇ antibodies and anti-tau antibodies.
- the nucleic acid composition encodes a peptide comprising one or more of human TRIM3, TRIM4, TRIM5, TRFM6, TRFM7, TRIM9, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM19 (also referred to herein as "PML"), TRIM20, TRIM21, TRIM24, TRIM25, TRIM27, TRIM28, TRIM29, TRIM32, TRIM34, TRIM39, TRIM43, TRIM44, TRFM45, TRFM46, TRFM49, TRIM50, TRIM52, TRIM58, TRIM59, TRIM65, TRIM67, TRFM69, TRFM70, TRFM74 and TRFM75; and mouse TRFM30.
- the invention should also be construed to include any form of a nucleic acid encoding a peptide having substantial homology to the peptides disclosed herein.
- a peptide which is "substantially homologous" is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably, about 95% homologous, and even more preferably about 99% homologous to amino acid sequence of the peptides disclosed herein.
- the composition of the invention comprises a nucleic acid encoding a peptide, a fragment of a peptide, a homolog, a variant, a derivative or a salt of a peptide described herein.
- the composition comprises a nucleic acid encoding a peptide comprising one or more TRFM proteins, a fragment of one or more TRFM proteins, a homolog of one or more TRFM proteins, a variant of one or more TRIM proteins, or a derivative of one or more TRIM proteins.
- the composition comprises a nucleic acid encoding a peptide comprising one or more STUbLs, a fragment of one or more STUbLs, a homolog of one or more STUbLs, a variant of one or more STUbLs, or a derivative of one or more STUbLs.
- a method is also provided of supplying protein to a cell which carries a normal, or a mutant gene, associated with diminished or insufficient activity of one or more TRIM proteins or one or more STUbLs. Supplying protein to a cell with a mutant gene should allow normal functioning of the recipient cells.
- the nucleic acid encoding a peptide may be introduced into the cell in a vector such that the nucleic acid remains extrachromosomal. In such a situation, the nucleic acid will be expressed by the cell from the extrachromosomal location. More preferred is the situation where the nucleic acid or a part thereof is introduced into the cell in such a way that it integrates into the cell's genome or recombines with the endogenous mutant gene present in the cell.
- Vectors for introduction of genes both for recombination, for integration, and for extrachromosomal maintenance are known in the art, and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation, calcium phosphate co-precipitation and viral transduction are known in the art, and the choice of method is within the competence of the practitioner.
- nucleic acid may be employed in gene therapy methods in order to increase the level or activity of the peptides of the invention even in those persons in which the wild type gene is expressed at a "normal" level, but the gene product is insufficiently functional.
- Gene therapy includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
- Oligonucleotides can be modified to enhance their uptake, e.g., by substituting their negatively charged phosphodiester groups by uncharged groups.
- One or more TRIM proteins or one or more STUbLs of the present invention can be delivered using gene therapy methods, for example locally in neural cell or tissue or systemically (e.g., via vectors that selectively target specific tissue types, for example, tissue-specific adeno-associated viral vectors).
- primary cells harvested from the individual can be transfected ex vivo with a nucleic acid encoding any of the peptides of the present invention, and then returned the transfected cells to the individual's body.
- Gene therapy methods are well known in the art. See, e.g., WO96/07321 which discloses the use of gene therapy methods to generate intracellular antibodies. Gene therapy methods have also been successfully demonstrated in human patients. See, e.g., Baumgartner et al., Circulation 97: 12, 1114-1123 (1998), Fatham, C.G. ⁇ gene therapy approach to treatment of autoimmune diseases', Immun. Res. 18: 15-26 (2007); and U.S. Patent No. 7,378089, both incorporated herein by reference. See also Bainbridge JWB et al. "Effect of gene therapy on visual function in Leber's congenital Amaurosis". N Engl J Med 358:2231-2239, 2008; and Maguire AM et al. "Safety and efficacy of gene transfer for Leber's Congenital Amaurosis". N Engl J Med 358:2240-8, 2008.
- nucleic acid encoding a peptide or protein (optionally contained in a vector) into a patients cells
- in vivo and ex vivo the nucleic acid is injected directly into the patient, sometimes at the site where the protein is most required.
- ex vivo treatment the patient's cells are removed, the nucleic acid is introduced into these isolated cells and the modified cells are administered to the patient either directly or, for example, encapsulated within porous membranes which are implanted into the patient (see, e.g., U.S. Pat. Nos. 4,892,538 and 5,283, 187).
- techniques available for introducing nucleic acids into viable cells There are a variety of techniques available for introducing nucleic acids into viable cells.
- nucleic acid is transferred into cultured cells in vitro, or in vivo in the cells of the intended host.
- Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc.
- Commonly used vectors for ex vivo delivery of the gene are retroviral and lentiviral vectors.
- Gene therapy would be carried out according to generally accepted methods, for example, as described by Friedman et al., 1991, Cell 66:799-806 or Culver, 1996, Bone Marrow Transplant 3 : S6-9; Culver, 1996, Mol. Med. Today 2:234-236.
- cells from a patient would be first analyzed by the diagnostic methods known in the art, to ascertain the expression or activity of one or more TRFM proteins or one or more STUbLs.
- a virus or plasmid vector, containing a copy of the gene or a functional equivalent thereof linked to expression control elements and capable of replicating inside the cells, is prepared.
- the vector may be capable of replicating inside the cells.
- the vector may be replication deficient and is replicated in helper cells for use in gene therapy.
- Suitable vectors are known, such as disclosed in U.S. Pat. No. 5,252,479 and PCT published application WO 93/07282 and U.S. Pat. Nos.
- Gene transfer systems known in the art may be useful in the practice of the gene therapy methods of the present invention. These include viral and nonviral transfer methods.
- viruses have been used as gene transfer vectors or as the basis for repairing gene transfer vectors, including papovaviruses (e.g., SV40, Madzak et al., 1992, J. Gen. Virol. 73 : 1533-1536), adenovirus (Berkner, 1992;Curr. Topics Microbiol.
- Nonviral gene transfer methods known in the art include chemical techniques such as calcium phosphate coprecipitation; mechanical techniques, for example microinjection; membrane fusion-mediated transfer via liposomes; and direct DNA uptake and receptor-mediated DNA transfer (Curiel et al., 1992, Am. J. Respir. Cell. Mol. Biol 6:247-252).
- Viral-mediated gene transfer can be combined with direct in vitro gene transfer using liposome delivery, allowing one to direct the viral vectors to the tumor cells and not into the surrounding non-dividing cells. Injection of producer cells would then provide a continuous source of vector particles. This technique has been approved for use in humans with inoperable brain tumors.
- plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus vector.
- the trimolecular complex is then used to infect cells.
- the adenovirus vector permits efficient binding, internalization, and degradation of the endosome before the coupled DNA is damaged.
- U.S. Pat. Nos. 5,691,198; 5,747,469; 5,436, 146 and 5,753,500 see U.S. Pat. Nos. 5,691,198; 5,747,469; 5,436, 146 and 5,753,500.
- Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration.
- Expression vectors in the context of gene therapy are meant to include those constructs containing sequences sufficient to express a polynucleotide that has been cloned therein.
- the construct contains viral sequences sufficient to support packaging of the construct. If the polynucleotide encodes a protein, expression will produce the protein. If the polynucleotide encodes an antisense polynucleotide or a ribozyme, expression will produce the antisense polynucleotide or ribozyme. Thus in this context, expression does not require that a protein product be synthesized.
- the vector also contains a promoter functional in eukaryotic cells.
- the cloned polynucleotide sequence is under control of this promoter. Suitable eukaryotic promoters include those described above.
- the expression vector may also include sequences, such as selectable markers and other sequences described herein.
- the method comprises the use of gene transfer techniques which target an isolated nucleic acid directly to neural tissue.
- Receptor- mediated gene transfer for example, is accomplished by the conjugation of a nucleic acid molecule (usually in the form of covalently closed supercoiled plasmid) to a protein ligand via polylysine.
- Ligands are chosen on the basis of the presence of the
- ligand-DNA conjugates can be injected directly into the blood if desired and are directed to the target tissue where receptor binding and internalization of the DNA-protein complex occurs.
- co- infection with adenovirus can be included to disrupt endosome function.
- compositions of the invention or salts thereof to practice the methods of the invention.
- a pharmaceutical composition may consist of at least one modulator composition of the invention or a salt thereof in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one modulator composition of the invention or a salt thereof, and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these.
- the compound or conjugate of the invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.
- compositions useful for practicing the methods of the invention may be administered to deliver a dose of between
- the pharmaceutically acceptable salt 1 ng/kg/day and 100 mg/kg/day.
- the pharmaceutically acceptable salt 1 ng/kg/day and 100 mg/kg/day.
- compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng/kg/day and 500 mg/kg/day.
- compositions of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered.
- the composition may comprise between 0.1% and 100% (w/w) active ingredient.
- compositions that are useful in the methods of the invention may be suitably developed for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, or another route of administration.
- a composition useful within the methods of the invention may be directly administered to the skin, vagina or any other tissue of a mammal.
- Other contemplated formulations include liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
- the route(s) of administration will be readily apparent to the skilled artisan and will depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human subject being treated, and the like.
- compositions described herein may be prepared by any method known or hereafter developed in the art of
- Such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
- a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
- the amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
- the unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.
- compositions are principally directed to pharmaceutical compositions that are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts.
- compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist may design and perform such modification with merely ordinary, if any, experimentation.
- Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.
- compositions of the invention are formulated using one or more pharmaceutically acceptable excipients or carriers.
- compositions of the invention comprise a
- compositions or conjugates of the invention include, but are not limited to, glycerol, water, saline, ethanol and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).
- isotonic agents for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition.
- Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
- the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
- pharmaceutically acceptable carrier is not DMSO alone.
- Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, vaginal, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art.
- excipients i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, vaginal, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art.
- the pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants,
- preservatives e.g., sodium EDTA, sodium EDTA, sodium bicarbonate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium tartrate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium sulfate, sodium bicarbonate, sodium sulfate, sodium bicarbonate, sodium bicarbonate, sodium sulfate, sodium bicarbonate, sodium sulfate
- additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents;
- sweetening agents such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials.
- additional ingredients that may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Genaro, ed. (1985, Remington's Pharmaceutical Sciences, Mack
- the composition of the invention may comprise a preservative from about 0.005% to 2.0% by total weight of the composition.
- the preservative is used to prevent spoilage in the case of exposure to contaminants in the environment.
- a particularly preferred preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05% to 0.5% sorbic acid.
- the composition preferably includes an anti-oxidant and a chelating agent that inhibits the degradation of the compound.
- Preferred antioxidants for some compounds are BHT, BHA, alpha-tocopherol and ascorbic acid in the preferred range of about 0.01% to 0.3% and more preferably BHT in the range of 0.03% to 0.1% by weight by total weight of the composition.
- the chelating agent is present in an amount of from 0.01% to 0.5% by weight by total weight of the composition.
- Particularly preferred chelating agents include edetate salts (e.g. disodium edetate) and citric acid in the weight range of about 0.01% to 0.20% and more preferably in the range of 0.02% to 0.10%) by weight by total weight of the composition.
- the chelating agent is useful for chelating metal ions in the composition that may be detrimental to the shelf life of the formulation. While BHT and disodium edetate are the particularly preferred antioxidant and chelating agent respectively for some compounds, other suitable and equivalent antioxidants and chelating agents may be substituted therefore as would be known to those skilled in the art.
- Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle.
- Aqueous vehicles include, for example, water, and isotonic saline.
- Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
- Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents.
- Oily suspensions may further comprise a thickening agent.
- suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose.
- Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively).
- Known emulsifying agents include, but are not limited to, lecithin, and acacia.
- Known preservatives include, but are not limited to, methyl, ethyl, or n- propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid.
- Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.
- Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.
- Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent.
- an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.
- Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent.
- Aqueous solvents include, for example, water, and isotonic saline.
- Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
- Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
- a pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in-water emulsion or a water-in-oil emulsion.
- the oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these.
- compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate.
- emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.
- Methods for impregnating or coating a material with a chemical composition include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material (i.e., such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.
- the regimen of administration may affect what constitutes an effective amount.
- the therapeutic formulations may be administered to the subject either prior to or after a diagnosis of disease. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
- compositions of the present invention may be carried out using known procedures, at dosages and for periods of time effective to prevent or treat disease.
- An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the activity of the particular compound employed; the time of administration; the rate of excretion of the compound; the duration of the treatment; other drugs, compounds or materials used in combination with the compound; the state of the disease or disorder, age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors well-known in the medical arts. Dosage regimens may be adjusted to provide the optimum therapeutic response.
- an effective dose range for a therapeutic compound of the invention is from about 1 and 5,000 mg/kg of body weight/per day.
- One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.
- the compound may be administered to a subject as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.
- the frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.
- Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject.
- a medical doctor e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required.
- physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
- the compound in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle.
- the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding/formulating such a therapeutic compound for the treatment of a disease in a subject.
- compositions of the invention are administered to the subject in dosages that range from one to five times per day or more.
- compositions of the invention are administered to the subject in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks.
- the frequency of administration of the various combination compositions of the invention will vary from subject to subject depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors.
- the invention should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any subject will be determined by the attending physical taking all other factors about the subject into account.
- Compounds of the invention for administration may be in the range of from about 1 mg to about 10,000 mg, about 20 mg to about 9,500 mg, about 40 mg to about 9,000 mg, about 75 mg to about 8,500 mg, about 150 mg to about 7,500 mg, about 200 mg to about 7,000 mg, about 3050 mg to about 6,000 mg, about 500 mg to about 5,000 mg, about 750 mg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 50 mg to about 1,000 mg, about 75 mg to about 900 mg, about 100 mg to about 800 mg, about 250 mg to about 750 mg, about 300 mg to about 600 mg, about 400 mg to about 500 mg, and any and all whole or partial increments therebetween.
- the dose of a compound of the invention is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound of the invention used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg.
- a dose of a second compound is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.
- the present invention is directed to a packaged pharmaceutical composition
- a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound or conjugate of the invention, alone or in combination with a second pharmaceutical agent; and instructions for using the compound or conjugate to treat, prevent, or reduce one or more symptoms of a disease in a subject.
- the term "container" includes any receptacle for holding the
- the container is the packaging that contains the pharmaceutical composition.
- the container is not the packaging that contains the pharmaceutical composition, i.e., the container is a receptacle, such as a box or vial that contains the packaged pharmaceutical composition or unpackaged pharmaceutical composition and the instructions for use of the pharmaceutical composition.
- packaging techniques are well known in the art. It should be understood that the instructions for use of the pharmaceutical composition may be contained on the packaging containing the pharmaceutical composition, and as such the instructions form an increased functional relationship to the packaged product. However, it should be understood that the instructions may contain information pertaining to the compound's ability to perform its intended function, e.g., treating or preventing a disease in a subject, or delivering an imaging or diagnostic agent to a subject.
- Routes of administration of any of the compositions of the invention include oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal, and (trans)rectal), intravesical, intrapulmonary, intracerebral, epidural, intracerebroventricular, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
- compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral
- formulations and compositions that would be useful in the present invention are not limited to the particular formulations and compositions that are described herein.
- the present invention provides a method to diagnose a subject having or at risk for developing a disease or disorder associated with protein misfolding or protein aggregates.
- the method comprises using the level of expression or activity of one or more TRIM proteins or one or more STUbLs as diagnostic markers.
- the method comprises detecting the presence of a genetic mutation in a nucleic acid encoding one or more TRIM proteins or one or more STUbLs.
- the method is used to diagnose a subject as having a disease or disorder associated with protein misfolding or protein aggregates. In one embodiment, the method is used to diagnose a subject as being at risk for developing a disease or disorder associated with protein misfolding or protein aggregates. In one embodiment, the method is used to evaluate the effectiveness of a therapy for a neurodegenerative disease or disorder associated with protein misfolding or protein aggregates.
- the method comprises collecting a biological sample from a subject.
- samples include, but are not limited to blood, urine, feces, sweat, bile, serum, plasma, tissue biopsy, and the like.
- the sample comprises at least one cell of neural tissue.
- the sample comprises a neuron, astrocyte, oligodendrocyte, Perkinje cell, pyramidal cell, or the like.
- TRIM proteins or one or more STUbLs comprise any method that interrogates a gene or its products at either the nucleic acid or protein level. Such methods are well known in the art and include, but are not limited to, nucleic acid hybridization techniques, nucleic acid reverse transcription methods, and nucleic acid amplification methods, western blots, northern blots, southern blots, ELISA, immunoprecipitation, immunofluorescence, flow cytometry, immunocytochemistry.
- disrupted gene transcription is detected on a protein level using, for example, antibodies that are directed against specific proteins. These antibodies can be used in various methods such as Western blot, ELISA, immunoprecipitation, flow cytometry, or immunocytochemistry techniques. Methods of manufacturing recombinant protein
- the present invention provides a method of using one or more TRIM proteins, one or more STUbLs, or a combination thereof, in the production of a recombinant protein of interest.
- the one or more TRIM proteins, one or more STUbLs, or a combination thereof can be used to disaggregate protein aggregates of the recombinant protein of interest, thereby allowing for the production and collection of the recombinant protein of interest.
- the method comprises administering to a cell one or more TRIM proteins, one or more STUbLs, a nucleic acid molecule encoding one or more TRIM proteins, a nucleic acid molecule encoding one or more STUbLs, or a combination thereof.
- the cell is modified to express the recombinant protein of interest.
- the cell may be of any expression system, including, but not limited to a yeast expression system, bacterial expression system, insect expression system, or mammalian expression system.
- Example 1 A Cellular System that Degrades Misfolded Proteins and Protects against Neurodegeneration Misfolded proteins compromise cellular function and cause disease. How these proteins are detected and degraded is not well understood.
- the promyelocytic leukemia protein (PML; also known as TRIM19) is a member of the tripartite motif (TRIM) family of proteins, which contain an N-terminal TRIM/BRCC region, consisting of a RING domain, one or two B boxes, and a coiled-coil (CC) motif, followed by a variable C-terminal region.
- TMM tripartite motif
- CC coiled-coil
- PML is predominantly a nuclear protein and is the eponymous component of PML nuclear bodies. It is implicated in a wide variety of cell processes, including apoptosis, transcription, DNA damage signaling, and antiviral responses (Bernardi and Pandolfi, 2007, Nat Rev Mol Cell Biol, 8: 1006- 1016).
- PML also colocalizes with aggregates formed by polyQ proteins associated with SCAs (Skinner et al., 1997, Nature, 389, 971-974; Takahashi et al., 2003, Neurobiol Dis, 13 : 230-237) and, upon overexpression, promotes degradation of at least one of them (mutant ataxin-7) (Janer et al., 2006, J Cell Biol, 174: 65-76).
- Plasmids for expressing the following proteins in mammalian cells were made in pRK5 by PCR, and each was fused with HA, FLAG, or 6xHis tag, or GST or GFP protein at the H2- or COOH-terminus as indicated: FLAG-PML mutants (isoform IV unless otherwise indicated); GST-PML; Atxnl 82Q-GFP, HA- Atxnl 82Q-FLAG, FLAG- Atxnl 82Q; HA- Httexlp 97QP and HA-Httexlp 97QP(KR); FLAG-nFluc-GFP, FLAG-nFlucSM-GFP, and FLAG-nFlucDM-GFP; HA-R F4, HA-RNF4 SFMm, HA-RNF4-FLAG, and HA- R F4 SFMm-FLAG; and HA-SUM02 KR.
- Atxnl 82Q plasmids were made based on the FLAG- Atxnl 82Q/pcDNA plasmid provided by H. Orr (Riley et al., 2005, J Biol Chem, 280: 21942-21948); Httexlp 97QP and Httexlp 97QP(KR) (in which K6, K9, and K15 were changed to Arg) are based on Steffan et al., 2004, Science, 304: 100-104; and nFluc plasmids based on Gupta et al., 2011, Nat Methods, 8: 879-884.
- nFluc protein was fused to the SV40 nuclear localization signal (PKKKRKV) (SEQ ID NO: 147) at the NH2-terminus and to GFP at the COOH-terminus.
- PKKRKV nuclear localization signal
- R188 and R261 were changed to Glu
- FlucSM R188 was changed to Glu (Gupta et al., 2011, Nat Methods, 8: 879-884).
- the template for PCR amplification of RNF4 was purchased from Open
- Htt 25Q, Htt 52Q and Htt 103Q contained the Htt amino acids 1-17 followed by a polyQ stretch of the indicated length (Krobitsch and Lindquist, 2000, Proc Natl Acad Sci USA, 97: 1589-1594).
- Htt 52Q and Htt 52Q cc- cDNAs were assembled by joining synthetic oligos.
- FLAG-PML F12 (571- 633)-6xHis was constructed in pET28a. All plasmids generated for this study were confirmed by DNA sequencing.
- FLAG-PML FLAG- PML M6 (which had the C57S, C60S, C129A, C132A, C189A, and H194A mutations), 6xHis-SUM01, and 6xHis-SUM02 (Chu and Yang, 2011, Oncogene, 30: 1108-1116); FLAG-Atxnl 82Q and FLAGAtxnl 30Q (Riley et al., 2005, J Biol Chem, 280: 21942- 21948); luciferase-6xHis ⁇ a Photinus pyralis luciferase variant) (Sharma et al., 2010, Nat Chem Biol, 6: 914-920); GST-rRNF4 (where "r” denotes rat origin, same below), GSTrRNF4 CS1 (in which C136 and C139 were changed to Ser), FLAG-rRNF4, and FLAGrRNF4 CS (in which
- PML and RNF4 siRNAs were purchased from Qiagen, and the sense strand sequences were: PML#4, CTCCAAGATCTAAACCGAGAA (SEQ ID NO: 148); PML#9, CACCCGCAAGACCAACAACAT (SEQ ID NO: 149); RNF4#5,
- AAGACTGTTTCGAAACCAACA (SEQ ID NO: 152).
- RNF4 was knocked down with either siRNAs individually or in combination at an equal molar ratio.
- SUMOl siRNA (Thermo Scientific, siGENOME SMARTpool M-016005-03-0005) was a pool of 4 target-specific siRNA duplexes. The sense strand sequences were:
- TCAAGAAACUCAAAGAATC (SEQ ID NO: 153), GACAGGGTGTTCCAATGAA (SEQ ID NO: 154), GGTTTCTCTTTGAGGGTCA (SEQ ID NO: 155), and
- SUM02/3 siRNAs (Santa Cruz sc- 37167) was a pool of three different siRNA duplexes, and sense strand sequences were CCCAUUCCUUUAUUGUACA (SEQ ID NO: 157), CAGAGAAUGACCACAUCAA (SEQ ID NO: 158), and CAGUUAUGUUGUCGUGUAU (SEQ ID NO: 159).
- siRNAs using Lipofectamine 2000 or RNAiMAX (Invitrogen), according to the manufacturer's instructions. For knockdown experiments, two rounds of siRNA transfection were performed on consecutive days. When both DNA and siRNA were transfected, DNA was transfected 4-6 hours after treatment with combined RNF4 siRNAs, and a day after treatment with other siRNAs. MG132 (Sigma) was added 24 hours after the last transfection at 7.5-10 ⁇ (final concentration) for 4-5 hours.
- shRNA against human RNF4 cloned into pLKO.1, was obtained from Thermo Scientific.
- the antisense sequence of shRNF4 is
- TGGCGTTTCTGGGAGTATGGG SEQ ID NO: 160
- 293T cells were transfected with lentiviral vectors, Gag helper plasmid, Rev helper plasmid, and VSVG helper plasmid.
- Virus-containing media was collected at 48 hours and 72 hours and spun for 5 minutes at 100 g.
- HeLa cells were transduced using virus-containing supernatant with polybrene and selected with puromycin.
- the pLKO. l vector was used to create control stable cells. Cell lysate fractionation, filter retardation assay, and Western blot
- Cell lysates were made in NP-40-containing buffer and fractionated into supernatant (NS) and pellet by centrifugation. Both fractions were boiled in buffer containing 2% SDS and analyzed by western blot. A portion of the pellet was analyzed by a filter retardation assay for SR species.
- the pellet was resuspended in the pellet buffer (20 mM Tris, pH 8.0, 15 mM MgC12, 2 mM DTT, 250 IU/ml benzonase, 1 mM PMSF, IX complete protease cocktail, and 20 mM NEM) and incubated for 30 minutes on ice.
- the pellet fraction was boiled in 2% SDS, 50 mM DTT. One portion of the boiled pellet fraction was resolved by SDS-PAGE, and proteins entering the gel (SDS-soluble, SS) were detected by Western blot.
- Cells cultured on coverslips were fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.2% Triton X-100 for 15 minutes, blocked with 1% BSA, and incubated with antibodies as indicated.
- Cells were mounted with medium containing DAPI (for DNA detection) (Vector Labs), and the images were acquired with a Nikon Eclipse E800 or Olympus 1X81 microscope.
- DAPI for DNA detection
- Atxnl 82Q For quantification of Atxnl 82Q, Httexlp 97QP, and SUM02-positive Atxnl 82Q aggregates, approximately 400, 500, and 200 cells, respectively, from ten or more randomly selected fields were examined. The sizes of Atxnl 82Q inclusions were measured using ImageJ, and cells were categorized based on the largest inclusion in cells. -value for the proportions of cells with aggregates of various sizes in the presence and the absence of PML was calculated using a chi-squared test. For cells transfected with Httexlp 97QP, approximately 30% of them had either cytoplasmic or nuclear aggregates.
- Cells were pulse labeled in Met- and Cys-free DMEM medium supplemented with [ 35 S]Met and [ 35 S]Cys, and then cultured in regular DMEM.
- HeLa cells were transfected with FLAG-Atxnl 82Q alone or together with a moderate amount of PML. 17 h after transfection, cells were cultured in Met and Cys-free DMEM medium for 30 min, and then pulse labeled for 30 min with [ 35 S]Met and [ 35 S]Cys (100 ⁇ / ⁇ each). Afterwards, cells were rinsed twice with PBS and chased in DMEM with 10% FBS for 0-18 h.
- IP-lysis buffer 50 mM HEPES, pH 7.5, 150 mM NaCl, 0.5% NP-40, and 2 mM DTT
- the whole cell lysates were centrifuged at 13,000 rpm for 15 minutes.
- the supernatants were diluted 20-fold in IP -lysis buffer and incubated with anti-FLAG M2 beads at 4 °C overnight.
- the beads were sequentially washed with IP lysis buffer with additional 0, 0.5 M, and 1 M KC1, and boiled in a 2% SDS sample buffer. Samples were resolved by SDS-PAGE and analyzed by autoradiography. To better compare the half-life of Atxnl 82Q under different conditions, exposures with similar signal intensity at 0 hours were presented.
- IP-lysis buffer was also supplemented with 20 ⁇ ZnC12. The lysates were centrifuged at 13,000 rpm for 15 minutes. Supernatants were incubated with anti-FLAG M2 beads at 4°C for 4 hours to overnight. M2 beads were sequentially washed with IP lysis buffers containing 0, 0.5, and 1 M KCl, and with an elution buffer (50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM DTT). The bound proteins were eluted in the elution buffer containing 0.1-0.3 mg/ml 3xFLAG peptide (Sigma). The major additional bands observed in the FLAG-PML and FLAG-PML M6 preps were derived from PML based on both Western blot and mass spectrometry analyses (Figure 11G).
- GST fusion of PML was expressed in 293T cells and purified using glutathione-SepharoseTM 4B beads (GE Healthcare Life Sciences) with similar lysis and wash conditions as described above.
- GST fusions of rR F4, rR F4 CS1, R F4, and R F4 SFMm were expressed in Escherichia coli BL21 DE3 or Rosetta 2 (EMD
- Luciferase-6xHis was expressed in BL21 DE3 as previously described (Sharma et al., 2010, Nat Chem Biol, 6: 914-920).
- Luc N
- Ni-NTA beads Qiagen
- Denatured luciferase, Luc (D) was generated by treating immobilized Luc (N) with 8 M urea for 5 minutes.
- a luciferase activity assay showed that only 0.2% of enzymatic activity remained after urea treatment.
- lysates from bacteria expressing no luciferase were incubated with Ni- NTA beads in parallel.
- the GST-PML CC-FLAG conjugated glutathione beads were incubated with TEV protease (Sigma) according to the manufacturer's instructions to release PML CC-FLAG from the GST moiety (and from the beads).
- PML CC-FLAG used for pull-down assay was generated by incubating the purified PML CC-FLAG proteins with M2 beads and washed as described above.
- FLAG-PML, FLAG-GFP and PML CC- FLAG bound to anti-FLAG M2 beads were prepared as described above. Purified GST- Htt 25Q, GST-Htt 103Q, GST-Htt 52Q or GST-Htt 52Q cc- were centrifuged at 13,000 rpm for 15 minutes to remove any aggregated proteins.
- FLAG-PML 2.5 ⁇ g or FLAG- GFP (1.1 ⁇ g) at comparable molarity was incubated with GST-Htt 25Q or GST-Htt 103Q (2.5 ⁇ g each) in the absence or presence of Hsp70 (2.5 ⁇ g) and Hsp40 (1.4 ⁇ g) (Enzo Life Sciences) in a final volume of 200 ⁇ assay buffer (50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM DTT, 0.5% P-40) for 2 hours at 4 °C. The beads were washed three times with IP-lysis buffer in Compact Reaction Columns (Affymetrix/USB) and boiled in 2% SDS sample buffer.
- assay buffer 50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM DTT, 0.5% P-40
- Luc (N) or Luc (D) bound Ni- NTA beads or control beads prepared from an equal amount of bacterial lysate were incubated with purified GST (1 ⁇ g), GST-PML (3 ⁇ g) in the absence or presence of Hsp70 (3 ⁇ g) and Hsp40 (1.7 ⁇ g), or [ 35 S]Met-labeled full-length and mutant PML proteins in 200 ⁇ PBS containing 15 mM Imidazole, 1 mM DTT, 0.5% Triton X-100 and 0.5% P-40 at 4 °C for 4 hours.
- the beads were washed three times with PBS containing 20 mM Imidazole, 1 mM DTT, 0.5% Triton X-100 and 0.5% NP-40 and boiled. The input and pull-down samples were analyzed as described above. Screening of cellulose-bound peptides for binding to PML domains
- a peptide library (13-mers overlapping by ten amino acids) for Photinus pyralis luciferase was prepared by automated spot synthesis (JPT peptide Technologies).
- the peptide array membrane was probed with purified PML SRS1 and SRS2 fragments.
- the peptide array membrane was blocked with Odyssey Blocking buffer (LI-COR, Inc) and incubated with FLAG-PML F12(571-633)-HisX6 or PML F4/CC-FLAG (150 nM each) in TBS-T (50 mM TRIS, pH 8.0, 137 mM NaCl, 2.7 mM KC1, 0.05% Tween and 1 mM DTT) at 4 °C for 2 hours.
- TBS-T 50 mM TRIS, pH 8.0, 137 mM NaCl, 2.7 mM KC1, 0.05% Tween and 1 mM DTT
- the membrane was washed and blotted with mouse anti- Flag and anti-mouse-URP antibodies following the manufacturer's instructions.
- the blots were developed using ECL reagents. Background signal on blots with anti-Flag and anti- mouse-URP antibodies alone was minimal even at long exposures.
- the peptide array membrane was regenerated according to the manufacturer's protocol.
- d-IP immunoprecipitation
- cell lysates were boiled at 95°C for 10 minutes. One aliquot was saved for Western blot analysis. The rest of the lysates were either diluted 20-fold in IP-lysis buffer or passed through a Bio-Spin chromatography column (Bio-Rad) equilibrated with IP-lysis buffer to reduce the SDS concentration. Lysates were then incubated with anti-FLAG (M2) beads at 4°C for 4 hours or overnight. The beads were washed as described for FLAG-tagged protein purification, and boiled in 2% SDS sample buffer.
- M2 anti-FLAG
- Proteins from beads were analyzed by Western blot with anti-FLAG, -SUM02/3, -SUMOl, -ubiquitin, and other antibodies as indicated. To better compare the levels of ubiquitinated or SUMOylated species, d-IP products containing similar levels of unmodified proteins were often used for Western blot analysis. In vitro SUMOylation assays
- FLAG-PML M6 100 ng or 45 nM
- SAE1/SAE2 125 nM
- Ubc9 1 ⁇
- His-SUM02 25 ⁇
- Hsp70 420 ng/200 nM
- Hsp40 240 ng/200 nM
- BSA 0.1 ⁇ g/ml
- the reaction mixtures were denatured by the addition of 30 ⁇ IP -lysis buffer containing 2% SDS and 50 mM DTT and heating at 95°C for 10 minutes.
- One aliquot of the heated reaction mixes were saved for Western blot analysis, and the rest were diluted 20-fold in IP-lysis buffer without SDS.
- HA-Atxnl-FLAG was immunoprecipitated by anti-HA beads (Roche) and analyzed for SUM02/3 modification using anti-SUM02/3 antibodies.
- SUMOylated and unmodified Atxnl 82Q proteins was prepared as ubiquitination reaction substrate.
- M2 beads conjugated with FLAG- Atxnl 82Q-HA (1.5 ⁇ g/300 nM) and control M2 beads were mixed with 0.75 ⁇ SAE1/SAE2, 12.5 ⁇ Ubc9, 125 ⁇ His-SUM02, and 2.5 mM DTT in a total volume of 50 ⁇ of Mg2+- ATP-Energy
- Regeneration Solution containing 5 mM ATP (Boston Biochem).
- the reaction was performed at 37 °C for 24 hours, and the reaction buffer was replaced after 12 hours. Beads were then washed sequentially with IP-lysis buffer with additional 0, 0.5, and 1 M KC1 and with ubiquitination reaction buffer (50 mM Tris pH 7.5 and 150 mM NaCl) (Tang et al., 2006, Nat Cell Biol, 8: 855- 862).
- Atxnl 82Q beads and control beads were then incubated at 37 °C for 1 hour with ubiquitination reaction mixes in 20 ⁇ volume containing GST-rRNF4 (0, 40, 160 and 500 ng, or 0, 43, 170, and 530 nM), UBE1 (100 nM), UbcH5a (500 nM), ubiquitin (5 ⁇ g/30 ⁇ ), and Mg 2+ -ATP (2.5 mM) in reaction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, and 2.5 mM DTT). Afterwards, beads were separated from the supernatant and washed with IP-lysis buffer.
- ubiquitination reaction mixes in 20 ⁇ volume containing GST-rRNF4 (0, 40, 160 and 500 ng, or 0, 43, 170, and 530 nM), UBE1 (100 nM), UbcH5a (500 nM), ubiquitin (5 ⁇ g/30 ⁇ ), and
- Atxnl 82Q was denatured and released from the beads by the addition of IP -lysis buffer containing 2% SDS and 50 mM DTT and heat at 95°C for 10 minutes. After dilution, Atxnl 82Q was immunoprecipitated with M2 beads. The IP products and the supernatant from the reaction were analyzed by Western blot.
- the heterozygous B05 transgenic mice (AtxnI tg/ ⁇ ), which harbor the human SCA1 -coding region with 82 CAG repeats driven by a Purkinje cell-specific promoter element, were provided (Burright et al., 1995, Cell, 82: 937-948).
- PML ⁇ ⁇ mice were provided (Wang et al., 1998, Science, 279: 1547-1551).
- Atxnl tg/ ⁇ mice (on FVB background) were mated with ML "7" (on 129Sv background).
- PML +/ ⁇ :Atxnl tg/ ⁇ mice from the Fl generation were mated with PML ' or PML to generate mice used for Rotarod tests and pathology.
- the mating scheme did not affect the Rotarod performance, formation of aggregates, molecular layer thickness, or dendritic arborization of the F2 generation of PML+ or PML +/ ⁇ :Atxnl tg/ ⁇ mice.
- the mouse genotype was determined by PCR either as described (Burright et al., 1995, Cell, 82: 937-948) (tor Atxnl) or according to suggestions by the NCI Mouse Repository (for PML).
- Paraffin-embedded cerebellar midsagital sections were stained with indicated antibodies and visualized using a Leica SP5 II laser scanning confocal microscope, or stained with hematoxylin and visualized using an Olympus BX51 microscope.
- mice per genotype were used for counting Purkinje cells of 1 -year- old mice, two PML +/+ mice per genotype for quantification of dendritic arborization, and three mice per genotype for the rest of the studies.
- the numbers of cells with aggregates were analyzed by chi-squared test and Student's t-test when appropriate.
- the behavioral scores and cerebellar pathology were analyzed by two-way ANO VA with repeated measurements and Student' s t-test. All the data were analyzed using Prism5 software or Microsoft Excel 2008.
- SCA1 is a fatal neurological disorder characterized by progressive ataxia and loss of neurons, especially cerebellar Purkinje cells. It is caused by the expansion of a polyQ stretch in the SCA1 gene product, Ataxin-1 (Atxnl) (Orr and Zoghbi, 2007, Annu Rev Neurosci, 30: 575-621).
- Ataxin-1 Ataxin-1 (Atxnl) (Orr and Zoghbi, 2007, Annu Rev Neurosci, 30: 575-621).
- a cell culture model was generated in which a pathogenic Atxnl protein with 82 contiguous glutamines that was C-terminally fused to the enhanced green fluorescent protein, Atxnl 82Q-GFP, was expressed in HeLa cells.
- Atxnl 82Q-GFP was localized to the nucleus, exhibiting a diffuse localization pattern with markedly higher concentration in microscopically visible inclusions (Figure 1 A and Figure IB). Atxnl 82Q-GFP also yielded both NP-40-soluble (soluble or NS) and NP-40-insoluble (aggregated) species in cell lysates. The latter could be further divided into SDS-soluble (SS) and SDS-resistant (SR) species ( Figure 1C).
- SS SDS-soluble
- SR SDS-resistant
- Htt pathogenic fragment of huntingtin encoded by the first exon of the HD gene, Httexlp 97QP (Steffan et al., 2004, Science, 304: 100-104); and (2) TAR DNA-binding protein 43 (TDP-43), which is associated with both amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) and frontotemporal lobar degeneration with ubiquitinated inclusions (FTLD-U) (Chen-Plotkin et al., 2010, Nat Rev Neurosci, 6: 211- 220).
- Htt pathogenic fragment of huntingtin encoded by the first exon of the HD gene
- TDP-43 TAR DNA-binding protein 43
- ALS amyotrophic lateral sclerosis
- FTLD-U frontotemporal lobar degeneration with ubiquitinated inclusions
- Httexlp 97QP formed microscopically visible inclusions in both the nucleus and the cytoplasm ( Figure II), while TDP-43 formed inclusions mainly in the nucleus.
- PML reduced the nuclear, but not the cytoplasmic, Httexlp 97QP inclusions ( Figure II), and decreased the amount of aggregated Httexlp 97QP ( Figure 1 J, lanes 1 and 2).
- PML also lowered the amount of aggregated, but not soluble, TDP-43 ( Figure IK).
- Htt 52Q cc- the residues in Htt 52Q that were predicted to be involved in the CC formation were mutated, yielding Htt 52Q cc- ( Figure 9D).
- a similar mutation was previously shown to reduce the formation of the CC structure in Htt 72Q (Fiumara et al., 2010, Cell, 143 : 1121-1135).
- Htt 52Q cc- displayed a noticeably reduced propensity to form aggregates and a substantially weaker interaction with PML CC (Figure 2C). Therefore, PML CC/SRS1 likely interacts with the CC structure on pathogenic Htt proteins.
- PML SRS2 purified PML SRS2 was used to screen a cellulose-bound peptide library that represented the complete sequence of luciferase.
- the library consisted of 180 peptides, each containing 13 amino acid residues that overlapped adjacent peptides by ten.
- SUM02 and SUM03 are nearly identical to each other in their sequence (collectively called SUM02/3) and are approximately 50% identical to SUMOl (Wilkinson and Henley, 2010, Biochem J, 428: 133-145). The modification of Atxnl 82Q by these SUMO proteins and their involvement in Atxnl 82Q degradation was investigated.
- Atxnl 82Q was modified by both exogenous (Riley et al., 2005, J Biol Chem, 280: 21942-21948) and endogenous (Figure 3A, left) SUMOl, and this modification was weaker than that of Atxnl 30Q (Riley et al., 2005, J Biol Chem, 280: 21942-21948). Atxnl 82Q was also modified by endogenous SUM02/3 ( Figure 3A, right), and co-localized with GFP-SUM02/3 in the nucleus ( Figure 3B).
- Atxnl 82Q The sites in Atxnl 82Q that were conjugated with SUMOl and SUM02/3 might be different, because a mutant Atxnl 82Q with impaired SUMOl conjugation, Atxnl 82Q (5KR) (Riley et al., 2005, J Biol Chem, 280: 21942-21948), showed no defect in SUM02/3 conjugation (Figure 11 A).
- Atxnl 82Q was more strongly modified by endogenous
- SUM02/3 and SUMOl were silenced separately using siRNA.
- Silencing SUM02/3 also raised the levels of Atxnl 82Q, especially the aggregated form, but not the levels of the control protein GFP ( Figure 1 ID - Figure 1 IF), and it diminished the ability of PML to remove aggregated Atxnl 82Q ( Figure 3E).
- SUM02 and SUM03 contain an internal SUMOylation consensus site that enables the formation of poly chains.
- SUMOl does not contain this site, and when conjugated to the SUM02/3 chain, it can terminate the chain elongation (Wilkinson and Henley, 2010, Biochem J, 428: 133-145). Therefore, two additional strategies were used to inhibit the modification of Atxnl 82Q by SUM02/3. First, SUMOl was
- RNF4 also shortened the half-life of aggregated, but not soluble, Atxnl 82Q ( Figure 5B, lanes 1-12; Figure 5C and Figure 12B).
- knocking down endogenous RNF4 with three siRNAs, individually or in combination increased total and aggregated Atxnl 82Q proteins in cell lysates ( Figure 5D, Figure 12C and Figure 12D), as well as Atxnl 82Q inclusions in the nucleus ( Figure 5E).
- An siRNA-resistant form of RNF4 could reverse the effect of RNF4 knockdown ( Figure 12C), indicative of the specificity of the siRNA.
- Httexlp 97QP, TDP-43, and nFlucDM Forced expression of RNF4 markedly reduced Httexlp 97QP, especially the aggregated form, while having a much weaker effect on Httexlp 97QP(KR) (Figure 5H).
- forced expression of RNF4 decreased the levels of TDP-43 ( Figure 12F)
- silencing RNF4 augmented the percentage of TDP-43 -expressing cells with nuclear inclusions ( Figure 12G and Figure 12H).
- endogenous RNF4 became highly enriched in TDP-43 inclusions ( Figure 121), similar to its accumulation in Atxnl 82Q inclusions under the same conditions (Figure 5F).
- silencing RNF4 prolonged the half-life of nFlucDM ( Figure 51).
- R F4 possesses both ubiquitin ligase and SUMO-binding activities (Sun et al., 2007, EMBO J, 26: 4102-4112). To ascertain the involvement of these activities in degrading Atxnl 82Q, R F4 mutants defective in either ubiquitin ligase (CS and CS1) or SUMO-binding (SIM m ) activity were generated ( Figure 13C). CS and CS1, albeit losing their ubiquitin E3 activity ( Figure 13D), were still able to co-localize with Atxnl 82Q inclusions ( Figure 6F).
- B05 mouse model of SCAl (B05), which expresses the Atxnl 82Q transgene (Atxnl tg/ ⁇ ) in the cerebellar Purkinje cells, was used. Resembling human SCAl patients, B05 mice develop ataxia and neurological abnormalities with increasing age (Burright et al., 1995, Cell, 82: 937-948).
- mice were crossbred with PML ⁇ and iM-wild-type (PML +/+ ) mice and littermates of all genotypes— PML +/+ , PML +/ ⁇ , and PML ⁇ ' ⁇ , PML +/+ :Atxnl tg/ PML +/ ⁇ :Atxnl tg/ ⁇ , and PML ⁇ :Atxnl tg/' — were compared for both motor performance and neuropathology.
- the major neuropathological phenotype of the Atxnl tg/ ⁇ mice is the degeneration of Purkinje cells, a constituent of the top layer (the molecular layer) of the cerebellar cortex. This degeneration is manifested initially in the shrinkage of the molecular layer and the atrophy of Purkinje cell dendrites, and later in the loss of
- PML +/+ :Atxnl tg/ ⁇ mice exhibited a discernible shrinkage, compared to PML mice ( Figure 7C and Figure 7D). Because PML +/+ :AtxnI tg/ ⁇ mice performed similarly on the Rotarod to PML +/+ mice ( Figure 7B), neurodegeneration in PML +/+ :Atxnl tg/ ⁇ mice might not have reached a critical threshold. This nonlinear correlation between behavioral and pathological phenotypes of the SCA1 transgenic model has been previously observed (Gehrking et al., 2011, Hum Mol Genet, 20: 2204-2212).
- Dendritic arborization of Purkinje cells was also examined by immunofluorescence staining with an antibody against the Purkinje cell-specific protein calbindin. At 12 weeks of age, the fluorescence intensity of Purkinje cell dendrites in all groups containing the Atxnl 82Q transgene was reduced to very low levels that precluded precise comparison ( Figure 14A and Figure 14B). Of note, compared to PML +/+ littermates, PML ⁇ ⁇ mice already showed a strong reduction in dendritic arborization of Purkinje cells, while PML +/ ⁇ mice showed an intermediate reduction ( Figure 14A and Figure 14B). These results indicate that PML itself has a role in protecting against neurodegenerati on .
- This system comprises a recognition branch, PML, which selectively binds to misfolded proteins and marks these proteins with poly- SUM02/3 chains, and an effector branch, RNF4, which ubiquitinates SUMOylated misfolded proteins and targets them for proteasomal degradation.
- PML recognition branch
- RNF4 effector branch
- This relay system likely provides a critical link between misfolded proteins and the proteasome in mammalian cells, and it may play an important role in the protection against neurodegeneration and other proteopathies (Figure 71).
- PML which contains at least two SRSs.
- SRSl consisting of the CC region within the TRIM/RBCC motif, favors CC structures on pathogenic polyQ proteins and perhaps other misfolded proteins.
- SRS2 consisting of the C-terminal 63 amino acids, recognizes short peptides enriched in both aromatic (Phe, Trp, and Tyr) and positively charged (Arg and Lys) amino acids.
- SRS2 is similar to the bacterial HsplOO ClpB (Schlieker et al., 2004, Nat Struct Mol Biol, 1 1 : 607-615), except that SRS2 also favors peptides containing Leu, a residue that is often exposed in misfolded proteins and is engaged by Hsp70 (Rudiger et al., 1997, EMBO J, 16: 1501-1507). Thus, SRS2 displays a hybrid substrate specificity of ClpB and Hsp70. These observations indicate that PML can recognize structures or regions that are commonly found in misfolded proteins. A Role for SUMOylation in Degrading Misfolded Proteins
- SUMO conjugation enhances protein solubility (Panavas et al., 2009, Methods Mol Biol, 497: 303-317). Because aggregated proteins cannot be effectively degraded by the proteasome (Verhoef et al., 2002, Hum Mol Genet, 11 : 2689-2700), enhancing protein solubility may be a beneficial effect conferred by PML prior to ubiquitination. Moreover, the extent of SUMOylation may enable the "triage decision" as to whether a given misfolded protein is selected for refolding or degradation.
- Proteins in the nucleus may harbor mutations or sustain acute and chronic damages, as proteins elsewhere do.
- the highly crowded environment of the nucleus likely makes it especially challenging to maintain protein quality.
- the ubiquitin- proteasome pathway is expected to be the main degradative system in the nucleus, where autophagy is not known to operate.
- the TRIM family of proteins is shared among metazoans, from
- RNF4 is conserved among vertebrates (Sun et al., 2007, EMBO J, 26: 4102-4112).
- SUMO-dependent ubiquitin ligases are also present in low eukaryotic species (Sun et al., 2007, EMBO J, 26: 4102-4112), and are involved in the degradation of at least one mutant yeast transcription factor (Wang and Prelich, 2009, Mol Cell Biol, 29: 1694-1706).
- systems analogous to the PML-RNF4 system may play a role in maintaining protein quality in these organisms.
- the tripartite motif-containing (TRIM) family consists of a large number of proteins in metazoan cells, ranging from approximately twenty in C. elegans to over seventy in mice and humans. These proteins share at their N-termini the characteristic TRIM or RBCC motif, which is comprised of a RFNG domain, one or two B-boxes
- TRIM proteins modulate a range of cellular processes including those that protect against cancer and viral infection.
- Biochemically a number of TRIM proteins exhibit ubiquitin E3 ligase activity, which is attributed to the RING domain within the TREVI/RBCC region.
- E3 ligases for protein conjugation to SUMO (small ubiquitin-like modifier).
- an outstanding issue has remained as to the substrates of the TRIM family of SUMO E3.
- PML promyelocytic leukemia protein
- PML promyelocytic leukemia. It is the major structural and the namesake component of the PML nuclear bodies. It was shown that PML is able to specifically bind to and promote the degradation of a range of misfolded protein. Via distinct regions, PML can discern common features found in misfolded proteins, including peptides enriched in aromatic amino acid residues and coiled coil structures. PML then tags misfolded proteins with poly-SUM02/3 chains through its SUMO E3 activity. This permits modified misfolded proteins to be recognized by the SUMO-targeted ubiquitin ligase (STUbL) RNF4, which ubiquitinates misfolded proteins and target them for with the consequential degradation in the proteasome.
- STUbL SUMO-targeted ubiquitin ligase
- PML protein quality control
- SCA1 spinocerebellar ataxia type 1
- polyQ polyglutamine
- FLAG-TRIM27, FLAG-TRIM32, and FLAG-TRIM55 were made in pRK5 by PCR. Templates for PCR amplification were purchased from Open Biosystems, and the corresponding gene accession numbers are BC013580, BC003154 and
- Triml 1 M_145214.2
- Triml5 NM_033229.2
- Trim28 M_005762.2
- SUM02/3 siRNAs (Santa Cruz sc-37167) was a pool of three different siRNA duplexes with the sense strand sequences of 5 ' -CCC AUUCCUUUAUUGUAC A- 3' (SEQ ID NO: 157), 5'-CAGAGAAUGACCACAUCAA-3' (SEQ ID NO: 158), and 5'-CAGUUAUGUUGUCGUGUAU-3' (SEQ ID NO: 159).
- TRIM27 siRNA was purchased from Qiagen, with the sense strand sequences being 5'-AACTCTTAGGCCTAACCCAGA-3' (SEQ ID NO: 162).
- Cells cultured on coverslips were fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.2% Triton X-100 for 15 minutes, and incubated sequentially with primary and secondary antibodies.
- Primary antibodies were anti-HA, anti-FLAG (mouse mAb M2, 1 :2,000) (Sigma), and anti-TRIM27.
- Secondary antibodies were FITC-conjugated anti-mouse, anti-rabbit (Zymed), and anti-goat (Invitrogen) IgGs; Texas Red-conjugated anti-mouse and anti-rabbit IgGs (Vector labs); and Rhodamine Red-X conjugated anti-goat (Jackson ImmunoResearch Labs). Afterwards, cells were mounted with medium containing DAPI (Vector Labs), and the images were acquired with a Nikon Eclipse E800 or Olympus 1X81 microscope.
- the pellet was resuspended in the pellet buffer (20 mM Tris, pH 8.0, 15 mM MgC12, 2 mM DTT) supplemented with 250 IU/ml benzonase, 1 mM PMSF, IX complete protease cocktail, and 20 mM NEM.
- the pellet fraction was boiled in 2% SDS plus 50 mM DTT and was resolved by SDS-PAGE. Proteins entering the gel (SDS-soluble, SS) were detected by Western blot.
- SR SDS-resistant aggregates retained on the filter was analyzed by immunoblotting.
- Primary antibodies were: anti-HA (rabbit, Y-l l, 1 :500) (Santa Cruz Biotechnology); anti-FLAG (mouse, M2, 1 :7,500) and anti-actin (rabbit, 1 : 10,000)
- the secondary antibodies were either conjugated to HRP (Santa Cruz Biotechnology), or labeled with IRD Fluor 800 or IRD Fluor 680 (LI-COR, Inc.).
- Western blots were developed using ECL reagents and analyzed using ImageJ, or scanned with the Odyssey infrared imaging system, and analyzed using Image Studio Lite (LI-COR, Inc.).
- FLAG-TRIM27 and HA-Atxnl 82Q-FLAG were expressed in 293T cells and purified by anti-FLAG M2 beads (Sigma) as previously described (Tang et al., 2006, Nat Cell Biol, 8: 855-862; Tang et al., 2004, J Biol Chem, 279: 20369-20377) with modifications.
- Cells were lysed in IP-lysis buffer (50mM Tris, pH 7.5, 150 mM NaCl, 0.5% Triton X-100, 0.5% NP-40 and 2 mM DTT) supplemented with 1 mM PMSF and lx complete protease cocktail.
- IP-lysis buffer was also supplemented with 20 ⁇ ZnCl 2 .
- the lysates were incubated with anti-FLAG M2 beads at 4°C for 4 hours to overnight.
- M2 beads were washed with IP -lysis buffers containing 0, 0.5, and 1 M KCl, and with the elution buffer (50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM DTT).
- the bound proteins were eluted in the elution buffer containing 0.1-0.3 mg/ml 3xFLAG peptide (Sigma).
- In vitro SUMOylation assays were performed at 37 °C for 1.5 hours in 30 ⁇ reaction buffer (50 mM Tris pH 7.5, 5.0 mM Mg2+-ATP, and 2.5 mM DTT) containing purified HA-Atxnl 82Q-FLAG (600 ng /200 nM), FLAG-TRIM27, SAE1/SAE2 (125 nM), Ubc9 (1 ⁇ ), His-SUM02 (25 ⁇ ), and BSA (0.1 ⁇ g/ml).
- the reaction mixtures were denatured by the addition of 30 ⁇ IP -lysis buffer containing 2% SDS and 50 mM DTT and heating at 95°C for 10 minutes.
- One aliquot of the heated reaction mixes were saved for Western blot analysis, and the rest were diluted 20-fold in IP-lysis buffer without SDS.
- HA-Atxnl 82Q-FLAG was immunoprecipitated by anti-HA beads (Roche) and analyzed for SUM02/3 modification using an anti-SUM02/3 antibody. The results of the experiments are now described.
- PML/TRIM19 can recognize and promote the degradation of various nuclear misfolded proteins including Atxnl 82Q, a pathogenic ataxin 1 protein with a stretch of eight-two glutamine that is associated with
- TRIM1 spinocerebellar ataxia type 1 (SCA1) (Guo et al., 2014, Mol Cell, 55(1): 15-30).
- SCA1 spinocerebellar ataxia type 1
- the TRIM family of proteins in humans and mice consists of over seventy members that can be distinguished based on structural features of the region C-terminal to the conserved TRIM/RBCC motif (Ozato et al., 2008, Nat Rev Immunol, 8: 849-860).
- the majority of TRIM proteins contain in this region one or more conserved domains, the most common of which include the PRY-SPRY domain (present in -40 TRIM proteins) and multiple NHL domains (present in 4 TRIM proteins).
- PRY-SPRY domain present in -40 TRIM proteins
- NHL domains present in 4 TRIM proteins
- several TRIM proteins do not contain a recognizable motif in the C-terminal region.
- TRFM27 with a PRY-SPRY domain
- TRFM32 with multiple NHL domains
- TRIM55 a short splicing variant of TRIM5 with no known domain
- Exogenous TRXM27 and TRIM32 co-localized with Atxnl 82Q-GFP inclusion in the nucleus ( Figure 15 A) and with HA- Httexlp 97QP inclusions in both the nucleus and cytoplasm ( Figure 15B and Figure 15C). Moreover, endogenous TRXM27 also co-localized with Atxnl 82QGFP inclusion ( Figure 15D). Exogenous TRIM55 co-localized only with the cytoplasmic HA-Httexlp 97QP inclusions ( Figure 15B and Figure 15C). Thus, despite the differences in their C- terminal sequence, TRIM27, TRIM32, and TRIM55 are able to recognize misfolded protein formed in their respective cellular compartment(s).
- TRIM27. TRIM32. and TRPM55 reduce the levels of both insoluble and soluble Atxnl 82Q proteins
- each of them was expressed with FLAG-tagged Atxnl 82Q in HeLa cells.
- each TRIM protein was able to reduce the levels of soluble and aggregated Atxnl 82Q protein ( Figure 16A and Figure 16B).
- TRIM27 and TRIM32 also decreased the levels of Atxnl 82Q protein that were resistant to both NB-40 and SDS (SR), which were detected by a filter retardation assay and likely represented ⁇ -amyloid structure (see below).
- TRIM27 When expressed at similar levels, all three TRIM proteins, especially TRIM32, showed stronger activity than PML in reducing the levels of soluble Atxnl 82Q ( Figure 16A). Moreover, while the activity of TRIM27 and TRFM55 was somewhat weaker than, the activity of TRIM32 in reducing aggregated Atxnl 82Q was comparable to that of PML ( Figure 16A and Figure 16B). TRIM27 was chosen for further analysis. The expression of endogenous TRIM27 was knocked down using siRNA, which led to a significant increase in the levels of both soluble and aggregated Atnxl 82Q proteins ( Figure 16C).
- TRIM27 is partially co-localized in PML nuclear bodies (Cao et al., 1998,
- TRIM27. TRIM32. and TRFM55 target Atxnl 82Q for proteasomal degradation in a SUMQ2/3 -dependent manner
- TRIM27 As an example, it was next examined whether TRIM proteins other than PML can act as SUMO E3 ligases for Atxnl 82Q.
- SUMOylation reaction components including SUMO El (SAE1/SAE2), E2 (Ubc9), SUM02, and ATP.
- Atxnl 82Q was minimally conjugated to SUM02.
- conjugation of Atxnl 82Q to SUM02 was enhanced in a TRIM27 dose-dependent manner (Figure 18G), suggesting that TRFM27 is a SUMO E3 for Atxnl 82Q.
- TRIM12 and TRIM30 were tested for their ability to recognize Atxnl 82Q.
- TRIM12 and TRIM30 are present in mice but not in humans, all the other TRIM proteins are of human origin.
- Each TRIM was tagged with either an HA, Flag, or V5 epitope, and was co-expressed with Atxnl 82Q-EGFP in HeLa cells.
- TRFM proteins A previous survey of a subset of TRFM proteins showed that these proteins identify with compartments in both the cytoplasm and nucleus (Reymond et al., 2001, EMBO J, 20: 2140-2151).
- TRIM proteins tested here eleven (TRIM42, 43, 53, 59-61, 67, 70-72, and 75) could not be detected by immunofluorescence.
- the remaining sixty-three TRIM proteins five of them (TRIM22, 28, 33, 65, and 66) were localized exclusively in the nucleus, a localization pattern similar to PML.
- the possibility that certain isoforms of these TRFM proteins that were not tested here may be present in the cytoplasm cannot be excluded.
- cytoplasmic isoforms have been shown for PML.
- Twenty-seven TRIM proteins (TRIMl-5, 7, 9, 10, 13, 18, 20, 24, 25, 29, 34, 36, 37, 39, 45-47, 50, 54, 63, 69, and 76) were localized mainly or exclusively in the cytoplasm.
- Twenty-seven TRIM proteins (TRIM6, 8, 11, 12, 16, 21, 23, 27, 30-32, 35, 38, 40, 44, 48, 49, 51, 52, 55, 56, 58, 62, 64, 68, 73, and 74) were present in a substantially amount in both the nucleus and cytoplasm.
- TRIM proteins either formed speckled or filamentous structures in the nucleus or the cytoplasm, others were localized diffusedly, and a few of them displayed perinuclear localization. Often, a TRFM protein exhibited the combination of these localization patterns either in the same or different cells ( Figure 19 and Table 2).
- TRFM6 Fourteen TRFM proteins (TRFM6, 8, 11, 19, 21, 22, 27, 28, 30, 32, 33, 35, 38, and 51), including PML/TRIM19, co-localized with the nuclear Atxnl 82Q inclusions in a substantial number of cells ( Figure 19 and Table 2), representing nearly 43% of the thirty-two TRIM proteins that were present either partially or exclusively in the nucleus.
- These TRIM proteins are from distinct subgroups with different C-terminal sequences.
- Six proteins (TRIM6, 11, 21, 22, 35, and 38), like TRIM27, are members of the subgroup IV, containing a SPRY motif that is often preceded by a PRY motif.
- TRIM8 like PML, is a member of the group V, containing no known domains.
- TREVI28 and TRIM33 are members of group VI, containing a PHD-BR motif.
- TRIM32 belongs to the subgroup VII, with a five NHL repeats.
- TREVI51 is considered a TRIM-like protein, lacking the two B-boxes but containing the RING domain and the coiled-coil region; it also contains a SPRY domain, like members of the subgroup IV.
- TRIM59 as well as TRIM12 and TRIM30 (of mouse origin), were tested for the ability to degrade Atxnl 82Q.
- Thirty-five of the human TRIM proteins (TRIM3, 4, 5, 6, 7, 9, 11, 13-17, 19, 20, 21, 24, 25, 28, 29, 34, 39, 43-46, 49, 50, 52, 58, 59, 65, 67, 70, 74, and 75) and mouse TRIM30 were able to reduce the levels of NS and/or SS fractions of Atxnl 82Q to different extents ( Figure 20A and Table 2).
- TRIM27 and TRFM32 which were shown above to be able to reduce Atxnl 82Q, did not display an effect in this assay. This difference was likely due to the expression levels.
- TRFM27 and TRFM32 were cloned into the plasmid pRK5. But in the experiments described in this section, TRIM27 and TRFM32 were cloned into pcDNA. Stronger expression from the pRK5 plasmids were consistently observed as compared to expression from the pcDNA plasmid.
- Atxnl 82Q Even for the ones that did not display an activity to degrade Atxnl 82Q, they might do so when their expression levels were elevated. It is therefore concluded that the ability to promote degradation of Atxnl 82Q is prevalent among TRIM proteins. Of note, a few TRIM proteins enhanced, rather than inhibited, the expression of Atxnl 82Q, including TRIM26, 33, 42, 47, 48, 66, 69, and 76. This suggests a diverse effect of different TRIM proteins on Atxnl 82Q.
- Httexlp 97QP protein in the SS fraction was very low compared to the portion of Atxnl 82Q in the same fraction.
- PML cloned in the pRK5 plasmid
- PML cloned in pcDNA
- the effect of TRIM proteins on Httexlp 97QP might also be influenced by their expression levels.
- TRIM55 was able to promote Atxnl 82Q degradation despite of its cytoplasmic localization. It is possible that TRIM55 can recognize soluble, misfolded Atxnl 82Q in the cytoplasm before it is imported into the nucleus. Also, TRIM27 and TRIM32 show strong ability to degrade soluble Atxnl 82Q, while PML shows less activity. This might be related to the fact that, unlike PML, TRIM27 and TRIM32 are partially localized to the cytoplasm, where Atxnl 82Q protein (and virtually all the other proteins) is generated. Hence, by recognizing misfolded proteins that are destined to the nucleus, the cytoplasmic TRIM proteins may play an important role in protein quality control in the nucleus.
- TRIM55, TRIM27, and TREVI32 rely on SUMO to remove Atxnl 82Q.
- An in vitro assay also confirms the SUMO E3 activity of TRIM27 towards Atxnl 82Q.
- TRIM proteins might employ similar mechanism to rid cells of misfolded proteins.
- the most relevant SUMO proteins for degrading misfolded proteins are SUM02/3.
- TRIM proteins may primarily function as ubiquitin E3s for misfolded proteins.
- TRIM11 possesses a remarkably potent activity to reduce Atxnl 82Q. It remains to be determined what may account for its activity.
- Some TRIM proteins can enhance the expression levels of Atxnl 82Q and especially Httexlp 97QP. This further underscores the functional diversity of these proteins.
- TRIM proteins can function as chaperones to prevent protein misfolding and as disaggregase to dissolve previously formed protein aggregates. These activities may in part account for the effect of TRIM proteins to stabilize Atxnl 82Q and especially Httexlp 97QP.
- TRIM proteins in the therapy of diseases associated with misfolded proteins.
- a number of human diseases are linked closely to the degradation of mutant proteins that are partially functional.
- a notable example is cystic fibrosis (CF), which is caused by mutations in the gene cystic fibrosis transmembrane conductance regulator (CFTR). These mutations are degraded in the cytoplasm. Therapies are being developed to stabilize the mutant CFTR, allowing mutant CFTR to reach the member to fulfill its function. It is envisioned that using TRFM proteins may achieve such a goal in CF and other diseases associated with degradation of partially functional proteins.
- ARFD1 ARF perinuclear foci
- HCGl foci HCGI
- Example 3 Delivery of recombinant TRIMl 1 into mammalian cells promotes the degradation of misfolded proteins
- TRIM proteins are also capable of degrading misfolded proteins in a SUMO-dependent manner.
- TRIM11 one TRIM proteins, TRIM11, exhibits a particularly strong activity to reduce misfolded proteins.
- TRIM11 As an agent for degrading intracellular misfolded proteins associated with neurodegeneration.
- the HIV Tat-derived peptide was used, which is able to deliver proteins into mammalian cells ( Figure 22).
- TRIM11 was fused with the Tat- derived peptide, the fusion protein was expressed in bacteria, and the protein was purified to homogeneity using affinity resin, followed by gel filtration column.
- Tat-peptide-fused SUM02 protein was also purified in parallel.
- HeLa cells were transfected with Atxnl 82Q-GFP, Atxnl 30Q, or Htt 97Q-GFP, and were subsequently incubated with recombinant TRFM11 or SUM02 proteins.
- TRFM11 treatment of HeLa cells with TRFM11 led to strong reduction in the levels of Atxnl 82Q. It also led to strong reduction in the levels of Htt 97Q ( Figure 21B).
- SUM02 had minimal effect on the levels of Atxnl 82Q ( Figure 21C).
- HD patient tissues (globus pallidus) were provided by the Harvard Brain Tissue Resource Center: AN06564, AN12127 and AN12029 (aggregates observed), and AN09048, AN19685, AN14942, AN13612 and AN17467 (no aggregates observed); SCAl patient tissues (basis points) were obtained, National Ataxia Foundation.
- Sections were stained for anti-RNF4 (#1 : Rabbit, 11- 25, 1 :300, Sigma; #2: Goat, C15, 1 :25, Santa Cruz), anti-Huntingtin (mouse, MAB5374, 1 :500; Millipore), anti -ubiquitin (mouse, Ubi-1, MAB1510, 1 :2,000; Millipore), and anti- polyQ (mouse MAB1574, 1C2, 1 : 1,000; Millipore) as indicated. Control rabbit antibodies were used to confirm the specificity of anti-RNF4 staining.
- RNF4 When detected in patient neurons without inclusions, RNF4 tended to distribute diffusely throughout the nucleus or form nuclear foci ( Figure 23). In the two cases of SCAl that were examined, nuclear inclusions reactive to an anti-polyQ antibody (1C2) were present. RNF4 was found in five out of sixteen and four out of seventeen lC2-reactive nuclear inclusions, respectively ( Figure 24). Among the HD patients, cytoplasmic inclusions reactive to either anti- huntingtin or anti-ubiquitin antibody were present in the globus pallidus region in three out of eight patient samples examined. This was in agreement with previous observations that nuclear inclusions were rare in adult-onset HD cases (DiFiglia et al., 1997, Science 277: 1990-3).
- RNF4 co-localized with approximately 20% of the inclusions in the globus pallidus region based on the results with two separate anti-RNF4 antibodies ( Figure 25 and Figure 26).
- the inclusions containing RNF4 tended to show RNF4 immunoreactivity surrounded by a ring of huntingtin or ubiquitin signals ( Figure 25 and Figure 26).
- TRIM11 can function as a molecular chaperone and disaggregase. In one aspect, TRIM11 can prevent aggregate formation. On the other hand, TRIM11 is not only able to refold stress-induced non- amyloid aggregates (luciferase and GFP aggregates), but also disaggregate amyloid aggregates (Atxnl 82Q aggregates and alpha-Synuclein fibrils). Further, it is also shown herein that TRIM11 is also a SUMO E3 ligase that can SUMOylate Atxinl 82Q and subsequent degradation. Therefore, TRFM11 may serve as a link between protein disaggregation and degradation. The materials and methods employed in these experiments are now described. siRNA transfection
- Mouse TRFM11 siRNA (sc-76735) was purchased from Santa Cruz. In the first day, hippocampal neuron cells (15000cells/well) were plated in 96 well plates with plating medium. In the second day (about 18 hours after plating), completely change the plating medium to neuronal medium. In the third day, siRNA (lpmol) was transfected into cells by Lipofectamine RNAiMAX. The transfection methods were carried out according to the manufacturer's instructions.
- HCT16 cells were cultured with Mccoy 5 A medium.
- A549 cells were cultured with RPMI1640 medium.
- HeLa and HEK293T cells were cultured with DMEM medium.
- FBS Fetal Bovine Serum
- Neuron cells were obtained. Neuron cells were cultured according to previously described methods. Simply, the cells were first plated with plating medium (Combine Neurobasal medium, B27, GlutaMAX , penicillin/streptomycin and 10% FBS by the indicated dilution ratios). After 18-24 h, completely change the plating medium to neuronal medium (Combine Neurobasal medium, B27, GlutaMAX and
- Monoclonal anti-Flag antibody, rabbit Flag antibody and anti-Flag agarose beads purchased from Sigma.
- Anti-HA affinity matrix (clone 3F10, 11815016001) was purchased from Roche.
- Anti-HSFl (sc-9144) was purchased from Santa Cruz.
- Anti-a- Synuclein Phopho-Serl29 (825701) was purchased from Biolegend.
- Anti-Hsp70 (ADI- SPA-810-D) was purchased from Enzo.
- Anti-a-Synuclein (2642) and anti-Hsp90 (4874) was purchased from Cell signaling technology.
- Cells were lysed with the lysis buffer (50 mM Tris, pH 8.8, 100 mM NaCl, 5 mM MgCl 2 , 0.5% IGEPAL CA-630, 1 mM DTT, 250 IU/ml benzonase (Sigma), 1 mM PMSF and lx complete protease cocktail (Roche)) for 30 minutes on ice.
- the supernatant was obtained by centrifuging 13000rpm for 15-20 minutes at 4°C.
- the pellet was further resuspended in the pellet buffer (20 mM Tris, pH 8.0, 15 mM MgC12, 1 mM DTT, 250 IU/ml benzonase, 1 mM PMSF and IX complete protease cocktail) for 30 minutes on ice, followed by directly boiling with 2% SDS buffer. Protein concentration was measured by Bradford assay (Bio-Rad Labs). All protein samples were subjected to immunoblotting by SDS-PAGE. The supernatant was considered as a soluble fraction. The pellet was considered as an insoluble fraction (SDS-soluble). The other portion was subjected to filter retardation assay. Simply, the pellet samples were filtered through a membrane with 0.2 ⁇ pore size, so that the SDS-resistant aggregates retained on the membrane were analyzed by immunoblotting.
- the pellet buffer (20 mM Tris, pH 8.0, 15 mM MgC12, 1 mM DTT, 250 IU/ml benzonase, 1
- Flag-Atxnl-82Q-HA was transfected in 293 T cells and purified by anti- Flag M2 beads. For getting highly purified proteins, the beads were extensively washed with increased concentrations of NaCl.
- His-Luciferase was expressed in BL21 DE3 cells purified.
- native luciferase was first purified from bacterial cell lysates according to the manufacturer's instructions. Second, denatured luciferase was generated by incubating native luciferase with 8 M urea for 5 minutes
- in vivo and in vitro sumoylation assays For in vivo sumoylation assays, cells were transfected with the indicated plasmids. After 48 hours, cells were lysed in lysis buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 0.5% Trition, 1 mM DTT, 1 mM PMSF and lx complete protease cocktail) supplemented with 2% SDS and 50 mM DTT. Cell lysates were further boiled at 95°C for 10 minutes. One aliquot was saved for input. The rest of cell lysates were diluted 10- fold in lysis buffer and then incubated with anti-HA beads at 4°C overnight.
- lysis buffer 50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 0.5% Trition, 1 mM DTT, 1 mM PMSF and lx complete protease cocktail
- Flag-TRIMl 1 was constructed by inserting Kpnl/Xbal TRIMl 1 cDNA into Kpnl/Xbal digested pcDNA3.1-Flag vector.
- Flag-TRIMl lmutation (12/13EE to 12/13AA) was generated by site-directed mutation.
- GST-TRIM11 was constructed by inserting Bglll/Sall TRIMl 1 cDNA into BamHI/Sall digested pGEX- ⁇ vector.
- GFP- Hsp70 and GFP-TRIMl 1 were constructed by inserting Hsp70 and TRIMl 1 cDNA into pEGFP-Cl vector. All the constructs were verified by DNA sequencing.
- firefly luciferase ( ⁇ ) in luciferase refolding buffer (LRB; 25 mM HEPES-KOH [pH 7.4], 150 mM KAOc, 10 mM MgAOc, 10 mM DTT) was heated at 45°C for 8-10 minutes.
- 5mM ATP and an ATP regeration system were required for Hspl04/Hsp70-Hsp40 di-chaperone system.
- luciferase refolding assay For in vivo luciferase refolding assay, cells in 96 well plate were transiently transfected with wild type luciferase . After 24 hours, cells were heated at 42°C or 45°C for 1 hour or 30 minutes, respectively. Prior to heat shock, 20 ⁇ g/ml cycloheximide was added into culture medium. After heat shock, cells were transferred to 37°C incubator for another 1.5 or 3 hours. Luciferase activity was measured with Promega Luciferase System. GFP Disaggregation Assay
- GFP (4.5 ⁇ ) in buffer A (20 mM Tris-HCl, pH 7.5, 100 mM KC1, 20 mM MgCl 2 , 5 mM DTT, 0.1 mM EDTA, 10% (v/v) glycerol) was incubated for 15 minutes at 85°C.
- GFP aggregates (0.45 ⁇ ) were incubated with the indicated proteins with different amounts at 25°C for 60 minutes. Disaggregation of GFP aggregates was detected by measuring fluorescence at 510nm upon excitation at 395nm (Infinite M200 pro).
- Luciferase (L9506), Mg-ATP (A9187), phosphocreatine (P1937) and creatine kinase (C3755) were purchased from Sigma.
- KRIBB 11 (385570) was purchased from Millipore.
- Beta- Amyloid (1-42) (RP10017) was purchased from GenScript.
- TRFM9 SUMOylated misfolded protein that can be recognized by R F4 to be degraded through proteasome.
- TRFM11 is also a SUMO E3 ligase.
- Glu9 and GlulO two highly conserved glutamates (Glu9 and GlulO) of TRIM25 are required for its ubiquitin E3 ligase activity. Therefore mutated TRIMl 1 (Glul2/Glul3 to Alal2/Alal3) were generated that lacked E3 ligase activity ( Figure 27A and Figure 27B).
- TRFM11 was also a SUMO E3 ligase for Atxnl 82Q.
- TRFM11 like Hsp70 was mainly localized in the cytoplasm ( Figure 28A and Figure 28B).
- TRIMl 1 or Hsp70 could be recruited into the aggregates of Atxnl 82Q ( Figure 28C and Figure 28D), suggesting that there might be an interaction between TRIMl 1 and Atxnl 82Q.
- pull down analysis presented that TRIMl 1 selectively bound to Atxnl 82Q ( Figure 29A).
- TRFM11 preferentially interacted with pathologic form Atxnl 82Q, not Atxnl 30Q ( Figure 29B). Therefore it was hypothesized that TRIMl 1 had a potential to selectively bind to misfolded proteins.
- native or denatured luciferase beads were further generated and then a pull down assay was performed. As shown in Figure 29C, in contrast to control GST proteins, TIRM11 specifically bound to denatured luciferase, which indicated that TR Ml 1 was capable of binding misfolded proteins.
- Hsp70 a molecular chaperone
- Hsp70 can suppress the expression of pathology associated Atxnl 82Q in SCA1 mice. Additionally, Hsp70 reduced the protein level of the detergent-insoluble fraction of Atxnl 82Q, which was consistent with the results presented herein ( Figure 28E). It was next investigated whether there was a similarity between TRIMl 1 and Hsp70 for aggregate formation. To study this, the solubilized feature of Atxnl 82Q was analyzed by detergent fractionation. As show in Figure 28E, TRFM11, like Hsp70, reduced the detergent-insoluble fraction of Atxnl 82Q, suggesting that TRIMl 1 could control protein aggregation.
- TRIMl 1 had an effect on amyloid like aggregates in cells
- wild type or mutant TRIMl 1 was transfected into the cells and ThT staining showed that wild type and mutant TRFM11 could both down- regulate the level of amyloid like aggregates (Figure 28G).
- Stable overexpression of Atxnl 82Q moderately enhanced the ThT staining ( Figure 30A).
- TRIMl 1 could also reduce the detergent-insoluble fractions of Atxnl 82Q in stable cells (Figure 30B).
- wild type TRIMl 1 had a stronger ability than mutant TRFM11 could to reduce the cellular aggregates ( Figures 30C and 30D).
- TRIMl 1 might function as molecular chaperone for controlling protein aggregation.
- chaperones have a capacity of preventing aggregation-prone misfolded proteins. This is the most primary and effective way to control protein aggregation. Therefore, the prevention function of TRHVIl 1 in the formation of aggregate was investigated. Luciferase activity was rapidly decreased without chaperone in response to heat shock ( Figure 31 A). However, incubation of TRIMl 1 as well as Hsp70 could efficiently protect luciferase from heat inactivation ( Figure 31 A). Similarly, TRFM11 also protect GFP proteins against heat ( Figure 31C).
- TRIMl 1 might function as molecular chaperone like Hsp70.
- stable overexpression of TRIMl 1 was able to moderately protect luciferase against heat shock ( Figure 31C and Figure 3 ID).
- TRIMl 1 could also obviously recover the heat inactivation of luciferase ( Figure 31C and Figure 3 ID), which further confirmed the chaperone like function of TRIMl 1.
- TRIMl 1 overexpression did not change the protein level of Hsp70 ( Figure 3 IE).
- Alzheimer disease associated beta-amyloid (1-42) was used as a substrate to study the prevention function of TRIMl 1.
- TRIMl 1 could inhibit amyloid fiber formation by ThT analysis. Additionally, Atxnl 82Q was purified to test the process of aggregate formation. Control protein GST could not prevent Atxnl aggregate formation, while TRFM11 efficiently blocked the formation of aggregate ( Figure 31G). Moreover, TRIMl 1 could also prevent amyloid like aggregate of Atxnl 82Q ( Figure 31G). It is known that p53 is prone to form aggregate in vitro. As shown in Figure 31H, TRFM11 significantly prevented p53 from denaturation.
- p53 could be SUMOylated by TRIMl 1 in vitro ( Figure 27C) and
- TRIMl 1 may function as a molecular chaperone to prevent aggregate formation.
- TRIMl 1 could be upregulated in response to heat shock HCT116 cells stably expressing vector or TRFM11 were used. In control stable cells, TRIMl 1 was increased during the recovery after heat shock ( Figure 32A). However, in TRIMl 1 expressing cells, exogenous TRFM11 protein could not be upregulated ( Figure 32B), meaning that the up regulation of TRIMl 1 induced by heat was not due to the change of protein stability. Heat-induced TRIMl 1 up regulation was further confirmed in HeLa cells ( Figure 32C). Because many stress can induce protein misfolding, whether TRIMl 1 could be induced by other stress was examined.
- the protein level of TRFM11 was upregulated in response to As 2 0 3 and H 2 0 2 treatment.
- the mRNA level of TRIMl 1 could be induced in response to heat shock (Figure 32F), which is similar with Hsp70.
- Figure 32F A549 cells were generated which stably express HSF1, a key transcriptional factor to control heat responsive proteins.
- overexpression of HSF1 down- regulated TRIMl 1 protein level with or without heat shock treatment (Figure 32G), suggesting that HSF1 was possible not required for regulating the transcription of TRIMl 1.
- TRIMl 1 Another key transcriptional factor, p53, can be activated during the heat shock response. p53 is also able to directly increase the transcription of TRIMs, for example TRFM21 and TRIM24. Therefore, it was investigated whether TRIMl 1 could be controlled by p53 in response to heat shock. As shown in Figure 33 A, TRFM11 was increased in response to heat shock in p53 wild type but not p53 null HCTl 16 cells. Accordingly, the mRNA level of TRIMl 1 only was enhanced in p53 wild type HCTl 16 cells ( Figure 33B), suggesting that p53 contributed to TRIMl 1 transcription.
- p53 might be a key factor to upregulate TRIMl 1 in heat shock response.
- HSF1 is considered as a safeguard for cell survival following heating stress.
- KRIBB11 a chemical inhibitor, can be used to inhibit HSF1 activity.
- Figure 33E and Figure 33F with KRIBB 11 treatment, p53 nulls were more sensitive to heat shock, which implied that p53 also contributed to cell survival in response to heating stress.
- TRFM11 could efficiently resolubilized Atxnl 82Q aggregates.
- Hsp70/Hsp40 di-chaperone only disaggregated amyloid like structure of Atxnl 82Q into the pellet ( Figure 34F), suggesting that TRIMl 1 might act in a different way.
- TRIMl 1 To determine which functional domain of TRIMl 1 was required for disaggregation activity of TRIMl 1 heated luciferase aggregates were used as substrates. As shown in Figure 35B, TRIMl 1 could efficiently recover heat inactivation of luciferase activity, but RBC or B30.2 fragments of TRFM11 had weaker reactivation ability.
- TRFM11 had a stronger activity than its two fragments to resolubilize preformed luciferase aggregates (Figure 35C). Further, each single domain almost lost the refolding activity by comparing with full length TRIMl 1 (Figure 35D). Furthermoe, full length TRIMl 1 very strongly interacted with Atxnl 82Q, but RBC or B30.2 did not bound to Atxnl 82Q ( Figure 36A). Similarly, single domain of TRIMl 1 did not bind to Atxnl 82Q ( Figure 36B). These results strongly suggested that binding to substrates might be required for TRIMl 1 disaggregation function.
- mutant TRIMl 1 was used to test its disaggregation activity. As shown in Figure 37 A, mutant TRIMl 1 maintained the ability to prevent luciferase from heat inactivation like wild type TRFM11. Moreover, mutant TRIMl 1 also had a similar potential with wild type TRIMl 1 to recover denatured luciferase activity ( Figure 37B). Mutant TRFM11 was still able to selectively bind to denature luciferase ( Figure 37C). All these results indicated that in vitro, TRIMl 1 performed its disaggregation function independently of its E3 activity. Notably, mutant TRFM11 was largely localized in the nucleus ( Figure 37D), which was different from wild type TRIMl 1. Further, mutant TRIMl 1 could also be co-localized with Atxnl 82Q.
- TRIM21 was selected because it shares the same domains with TRFM11.
- In vitro pull down assay revealed that TRIM21 also preferentially bound to denatured luciferase ( Figure 39A).
- TRFM21 could moderately solubilized heated luciferase aggregates ( Figure 39B) and recovered heat inactivation of luciferase ( Figure 39C).
- TRIM21 also was able to protect luciferase against heat inactivation (Figure 39D).
- PML could degrade Atxnl 82Q aggregates through proteasome.
- mice primary hippocampal neurons were used as a model.
- Alpha-Synuclein fibrils (PEF) were generated with GST or TRIMl 1 in vitro (GST-PEF and TRFM11-PEF).
- GST or TRIMl 1 in vitro GST or TRIMl 1 in vitro
- TRFM 11-PEF has a lower toxic to neurons ( Figure 41 A).
- TRFM11-PEF a prevention function in formation of alpha-Synuclein fibers.
- TRXM11 could be up-regulated in response to heat shock ( Figure 42 A and Figure 42B).
- the mRNA level of TRIM11 was also increased in hippocampal neurons ( Figure 42C). It was of interest that TRIM11 was likely involved in controlling neurodegenerative disease.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (18)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020247021052A KR20240108531A (ko) | 2015-05-29 | 2016-05-27 | 잘못 접혀진 단백질의 분해를 위한 조성물 및 방법 |
| BR112017025574-0A BR112017025574A2 (en) | 2015-05-29 | 2016-05-27 | compositions and methods for degradation of bad fold proteins |
| JP2017561811A JP7011467B2 (ja) | 2015-05-29 | 2016-05-27 | ミスフォールドタンパク質の分解のための組成物及び方法 |
| RU2017144862A RU2761564C9 (ru) | 2015-05-29 | 2016-05-27 | Композиции и способы деградации неправильно упакованных белков |
| IL322085A IL322085A (en) | 2015-05-29 | 2016-05-27 | Compositions and methods for reducing unfolded proteins |
| KR1020177037891A KR20180011276A (ko) | 2015-05-29 | 2016-05-27 | 잘못 접혀진 단백질의 분해를 위한 조성물 및 방법 |
| MX2017015373A MX2017015373A (es) | 2015-05-29 | 2016-05-27 | COMPOSICIONES Y MíTODOS PARA LA DEGRADACIíN DE PROTEíNAS MAL PLEGADAS. |
| CN201680044063.4A CN108271364A (zh) | 2015-05-29 | 2016-05-27 | 用于降解错误折叠的蛋白质的组合物和方法 |
| IL255912A IL255912B2 (en) | 2015-05-29 | 2016-05-27 | Preparations and methods for reducing unfolded proteins |
| AU2016271635A AU2016271635B2 (en) | 2015-05-29 | 2016-05-27 | Compositions and methods for degradation of misfolded proteins |
| IL302965A IL302965B2 (en) | 2015-05-29 | 2016-05-27 | Compositions and methods for degradation of misfolded proteins |
| US15/577,915 US11542500B2 (en) | 2015-05-29 | 2016-05-27 | TRIM11 for degradation of protein aggregates |
| CA2987057A CA2987057A1 (en) | 2015-05-29 | 2016-05-27 | Compositions and methods for degradation of misfolded proteins |
| EP16804142.4A EP3302706A4 (en) | 2015-05-29 | 2016-05-27 | COMPOSITIONS AND METHODS FOR REMOVING MISINTEGRATED PROTEINS |
| ZA2017/08067A ZA201708067B (en) | 2015-05-29 | 2017-11-28 | Compositions and methods for degradation of misfolded proteins |
| AU2022200673A AU2022200673B2 (en) | 2015-05-29 | 2022-02-02 | Compositions and methods for degradation of misfolded proteins |
| US18/057,308 US20230313190A1 (en) | 2015-05-29 | 2022-11-21 | Compositions and Methods for Degradation of Misfolded Proteins |
| AU2025230665A AU2025230665A1 (en) | 2015-05-29 | 2025-09-09 | Compositions and methods for degradation of misfolded proteins |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562168309P | 2015-05-29 | 2015-05-29 | |
| US62/168,309 | 2015-05-29 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/577,915 A-371-Of-International US11542500B2 (en) | 2015-05-29 | 2016-05-27 | TRIM11 for degradation of protein aggregates |
| US18/057,308 Continuation US20230313190A1 (en) | 2015-05-29 | 2022-11-21 | Compositions and Methods for Degradation of Misfolded Proteins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016196328A1 true WO2016196328A1 (en) | 2016-12-08 |
Family
ID=57441753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/034751 Ceased WO2016196328A1 (en) | 2015-05-29 | 2016-05-27 | Compositions and methods for degradation of misfolded proteins |
Country Status (15)
| Country | Link |
|---|---|
| US (2) | US11542500B2 (https=) |
| EP (1) | EP3302706A4 (https=) |
| JP (3) | JP7011467B2 (https=) |
| KR (2) | KR20240108531A (https=) |
| CN (1) | CN108271364A (https=) |
| AU (3) | AU2016271635B2 (https=) |
| BR (1) | BR112017025574A2 (https=) |
| CA (1) | CA2987057A1 (https=) |
| HK (1) | HK1252757A1 (https=) |
| IL (3) | IL302965B2 (https=) |
| MX (3) | MX2017015373A (https=) |
| RU (2) | RU2021134920A (https=) |
| SG (1) | SG10202011833TA (https=) |
| WO (1) | WO2016196328A1 (https=) |
| ZA (1) | ZA201708067B (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018303A (zh) * | 2017-12-20 | 2018-05-11 | 江苏浩欧博生物医药股份有限公司 | 一种人Ro52重组蛋白的制备方法 |
| US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
| CN110753557A (zh) * | 2017-03-22 | 2020-02-04 | 清华大学 | Trim72通过泛素化fus蛋白突变体作为als的潜在治疗性靶标 |
| US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| WO2020227515A1 (en) * | 2019-05-07 | 2020-11-12 | Voyager Therapeutics, Inc. | Compositions and methods for the vectored augmentation of protein destruction, expression and/or regulation |
| EP3765077A4 (en) * | 2018-03-14 | 2022-01-05 | Technion Research & Development Foundation Limited | PROGNOSTIC BIOMARKER IN CANCER |
| WO2022165313A1 (en) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Gene therapy for neuronal ceroid lipofuscinoses |
| US11434502B2 (en) | 2017-10-16 | 2022-09-06 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
| US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US11931375B2 (en) | 2017-10-16 | 2024-03-19 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
| CN118272444A (zh) * | 2024-02-29 | 2024-07-02 | 宜昌市中心人民医院(三峡大学第一临床医学院、三峡大学附属中心人民医院) | 一种慢病毒载体LV-Trim69及其在制备改善心脏衰老药物上的应用 |
| US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609614B (zh) * | 2017-09-30 | 2022-07-15 | 首都医科大学附属北京胸科医院 | 检测trim2、trim4、trim32和/或trim46基因或蛋白产品的用途 |
| WO2020041533A1 (en) * | 2018-08-21 | 2020-02-27 | Sf17 Therapeutics, Inc. | Compositions and methods for treating diseases associated with uncontrolled inflammatory responses |
| EP3863642A4 (en) * | 2018-10-09 | 2022-06-29 | The Regents of the University of California | Covalent targeting of e3 ligases |
| CN110302383A (zh) * | 2019-07-29 | 2019-10-08 | 深圳先进技术研究院 | Trim11基因和蛋白靶点以及抑制剂在乳腺癌中的用途 |
| CN110669791B (zh) * | 2019-10-29 | 2020-08-04 | 成都益安博生物技术有限公司 | 一种提高细胞抗体表达量的方法 |
| KR102114880B1 (ko) * | 2020-01-15 | 2020-05-26 | 서울대학교병원 | 코돈 최적화된 TIF1γ 폴리뉴클레오티드를 포함하는 재조합 벡터 및 이의 용도 |
| GB202005876D0 (en) * | 2020-04-22 | 2020-06-03 | Univ Dundee | Protein degradation |
| CN113292658B (zh) * | 2021-04-17 | 2023-02-28 | 复旦大学 | 一种融合蛋白及其在靶向降解细胞内蛋白中的应用 |
| CN113651879A (zh) * | 2021-08-18 | 2021-11-16 | 武汉华美生物工程有限公司 | 一种trim21全长蛋白的制备方法及应用 |
| CN117159747B (zh) * | 2023-08-30 | 2024-12-20 | 暨南大学 | 一种亨廷顿舞蹈症的药物及其制备方法 |
| CN120209082B (zh) * | 2025-05-28 | 2025-08-05 | 中南大学 | 一种靶向阻断trim25与brd7蛋白结合的多肽及其应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090208455A1 (en) * | 2006-06-23 | 2009-08-20 | Inserm (Institut National De La Sante Et De La Recherche Medical) | Method for Treating Polyglutamine Expansion Neurodegenerative Diseases |
| US20100263062A1 (en) * | 2009-01-14 | 2010-10-14 | The Salk Institute For Biological Studies | Methods for screening and compounds that protect against amyloid diseases |
| WO2014086835A1 (en) * | 2012-12-05 | 2014-06-12 | Ruprecht-Karls-Universität Heidelberg | Conjugates of proteins and multivalent cell-penetrating peptides and their uses |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20010027182A1 (en) * | 1998-05-29 | 2001-10-04 | Huda Y. Zoghbi | Chaperone suppression of ataxin-1 aggregation and altered subcellular proteasome localization imply protein misfilind in sca1 |
| EP1353702A2 (en) | 2000-05-22 | 2003-10-22 | The Johns Hopkins University | Genetic engineering of vascular grafts to resist disease |
| US20040235733A1 (en) * | 2003-02-27 | 2004-11-25 | Steffan Joan S. | Methods and reagents for reducing polyglutamine toxicity |
| US20050215562A1 (en) * | 2003-06-23 | 2005-09-29 | Patrick Tremblay | Methods for treating protein aggregation disorders |
| WO2005081911A2 (en) * | 2004-02-25 | 2005-09-09 | Dana-Farber Cancer Institute, Inc. | METHODS AND COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF HIV INFECTION USING TRIM5α |
| US20140056873A1 (en) | 2004-06-10 | 2014-02-27 | University Of Leicester | Methods for Treating Conditions Associated with MASP-2 Dependent Complement Activation |
| CA2606226A1 (en) * | 2005-04-27 | 2006-11-02 | University Of Florida Research Foundation, Inc. | Materials and methods for enhanced degradation of mutant proteins associated with human disease |
| US7785857B2 (en) | 2006-08-31 | 2010-08-31 | Saint Louis University | Protein C variant |
| EP2561073B1 (en) * | 2010-04-23 | 2016-08-24 | University of Massachusetts | Cns targeting aav vectors and methods of use thereof |
| GB201012410D0 (en) * | 2010-07-23 | 2010-09-08 | Medical Res Council | Intracellular immunity |
| AU2011295629B2 (en) | 2010-09-01 | 2014-05-01 | Organ Transport Pty Ltd | Perfusion composition |
| CN103127492A (zh) * | 2011-11-23 | 2013-06-05 | 中国科学院上海巴斯德研究所 | 一种抗丙型肝炎病毒的蛋白及其用途 |
| US20160136123A1 (en) * | 2013-06-14 | 2016-05-19 | Vojo P. Deretic | Treatment of autophagy-related disorders |
| US10370432B2 (en) * | 2014-10-03 | 2019-08-06 | University Of Massachusetts | Heterologous targeting peptide grafted AAVS |
-
2016
- 2016-05-27 MX MX2017015373A patent/MX2017015373A/es unknown
- 2016-05-27 BR BR112017025574-0A patent/BR112017025574A2/en not_active Application Discontinuation
- 2016-05-27 WO PCT/US2016/034751 patent/WO2016196328A1/en not_active Ceased
- 2016-05-27 US US15/577,915 patent/US11542500B2/en active Active
- 2016-05-27 EP EP16804142.4A patent/EP3302706A4/en active Pending
- 2016-05-27 RU RU2021134920A patent/RU2021134920A/ru unknown
- 2016-05-27 KR KR1020247021052A patent/KR20240108531A/ko active Pending
- 2016-05-27 IL IL302965A patent/IL302965B2/en unknown
- 2016-05-27 AU AU2016271635A patent/AU2016271635B2/en active Active
- 2016-05-27 RU RU2017144862A patent/RU2761564C9/ru active
- 2016-05-27 IL IL255912A patent/IL255912B2/en unknown
- 2016-05-27 HK HK18112082.4A patent/HK1252757A1/zh unknown
- 2016-05-27 CA CA2987057A patent/CA2987057A1/en active Pending
- 2016-05-27 IL IL322085A patent/IL322085A/en unknown
- 2016-05-27 JP JP2017561811A patent/JP7011467B2/ja active Active
- 2016-05-27 SG SG10202011833TA patent/SG10202011833TA/en unknown
- 2016-05-27 CN CN201680044063.4A patent/CN108271364A/zh active Pending
- 2016-05-27 KR KR1020177037891A patent/KR20180011276A/ko not_active Ceased
-
2017
- 2017-11-28 ZA ZA2017/08067A patent/ZA201708067B/en unknown
- 2017-11-29 MX MX2021014954A patent/MX2021014954A/es unknown
- 2017-11-29 MX MX2024001616A patent/MX2024001616A/es unknown
-
2021
- 2021-09-24 JP JP2021155978A patent/JP2022000459A/ja active Pending
-
2022
- 2022-02-02 AU AU2022200673A patent/AU2022200673B2/en active Active
- 2022-11-21 US US18/057,308 patent/US20230313190A1/en active Pending
-
2024
- 2024-08-15 JP JP2024135688A patent/JP2024161501A/ja active Pending
-
2025
- 2025-09-09 AU AU2025230665A patent/AU2025230665A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090208455A1 (en) * | 2006-06-23 | 2009-08-20 | Inserm (Institut National De La Sante Et De La Recherche Medical) | Method for Treating Polyglutamine Expansion Neurodegenerative Diseases |
| US20100263062A1 (en) * | 2009-01-14 | 2010-10-14 | The Salk Institute For Biological Studies | Methods for screening and compounds that protect against amyloid diseases |
| WO2014086835A1 (en) * | 2012-12-05 | 2014-06-12 | Ruprecht-Karls-Universität Heidelberg | Conjugates of proteins and multivalent cell-penetrating peptides and their uses |
Non-Patent Citations (5)
| Title |
|---|
| AHNER ET AL.: "Small heat shock proteins target mutant cystic fibrosis transmembrane conductance regulator for degradation via a small ubiquitin-like modifier-dependent pathway", MOL BIOL CELL, vol. 24, no. 2, 14 November 2012 (2012-11-14), pages 74 - 84, XP055334157 * |
| CHORT ET AL.: "Interferon beta induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice", BRAIN, vol. 136, 21 March 2013 (2013-03-21), pages 1732 - 45, XP055334156 * |
| HAUPT ET AL.: "Loss of PML cooperates with mutant p53 to drive more aggressive cancers in a gender-dependent manner", CELL CYCLE, vol. 12, no. 11, 1 June 2013 (2013-06-01), pages 1722 - 31, XP055334159 * |
| LUKACS ET AL.: "Conformational maturation of CFTR but not its mutant counterpart (delta F508) occurs in the endoplasmic reticulum and requires ATP", EMBO J., vol. 13, no. 24, 15 December 1994 (1994-12-15), pages 6076 - 86, XP055334162 * |
| URANO ET AL.: "TRIM44 interacts with and stabilizes terf, a TRIM ubiquitin E3 ligase", BIOCHEM BIOPHYS RES COMMUN, vol. 383, no. 2, 7 April 2009 (2009-04-07), pages 263 - 8, XP026057403, DOI: doi:10.1016/j.bbrc.2009.04.010 * |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
| US11975056B2 (en) | 2014-11-05 | 2024-05-07 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US11027000B2 (en) | 2014-11-05 | 2021-06-08 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11542506B2 (en) | 2014-11-14 | 2023-01-03 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US12123002B2 (en) | 2014-11-14 | 2024-10-22 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10920227B2 (en) | 2014-11-14 | 2021-02-16 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US12084659B2 (en) | 2016-05-18 | 2024-09-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11193129B2 (en) | 2016-05-18 | 2021-12-07 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| CN110753557B (zh) * | 2017-03-22 | 2024-03-22 | 神济昌华(北京)生物科技有限公司 | Trim72通过泛素化fus蛋白突变体作为als的潜在治疗性靶标 |
| CN110753557A (zh) * | 2017-03-22 | 2020-02-04 | 清华大学 | Trim72通过泛素化fus蛋白突变体作为als的潜在治疗性靶标 |
| US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US11434502B2 (en) | 2017-10-16 | 2022-09-06 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
| US11931375B2 (en) | 2017-10-16 | 2024-03-19 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
| US12116589B2 (en) | 2017-10-16 | 2024-10-15 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
| CN108018303A (zh) * | 2017-12-20 | 2018-05-11 | 江苏浩欧博生物医药股份有限公司 | 一种人Ro52重组蛋白的制备方法 |
| US11407827B2 (en) | 2018-03-14 | 2022-08-09 | Technion Research & Development Foundation Limited | Prognostic biomarker in cancer |
| EP3765077A4 (en) * | 2018-03-14 | 2022-01-05 | Technion Research & Development Foundation Limited | PROGNOSTIC BIOMARKER IN CANCER |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
| US20240124889A1 (en) * | 2019-05-07 | 2024-04-18 | Voyager Therapeutics, Inc. | Compositions and methods for the vectored augmentation of protein destruction, expression and/or regulation |
| WO2020227515A1 (en) * | 2019-05-07 | 2020-11-12 | Voyager Therapeutics, Inc. | Compositions and methods for the vectored augmentation of protein destruction, expression and/or regulation |
| WO2022165313A1 (en) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Gene therapy for neuronal ceroid lipofuscinoses |
| CN118272444A (zh) * | 2024-02-29 | 2024-07-02 | 宜昌市中心人民医院(三峡大学第一临床医学院、三峡大学附属中心人民医院) | 一种慢病毒载体LV-Trim69及其在制备改善心脏衰老药物上的应用 |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230313190A1 (en) | Compositions and Methods for Degradation of Misfolded Proteins | |
| US20240342241A1 (en) | Compositions and Methods for Treatment and Prevention of Misfolded Proteins | |
| Zhang et al. | MLKL-USP7-UBA52 signaling is indispensable for autophagy in brain through maintaining ubiquitin homeostasis | |
| US20110144029A1 (en) | Model Systems and Materials for the Study and Treatment of Neurodegenerative Diseases | |
| US11129866B2 (en) | Inhibitors of valosin-containing protein and methods of use | |
| US20200230207A1 (en) | Treatment of bone growth disorders | |
| US20210322524A1 (en) | Compositions and methods for treating neurodegenerative disroders | |
| US20250051391A1 (en) | Peptide inhibitors and methods for inhibiting protein aggregation in neurons and neurodegenerative diseases | |
| US20250074951A1 (en) | Compositions and methods for altering amyloid precursor protein (app) processing | |
| HK40110077A (zh) | 用於治疗和预防错误折叠的蛋白的组合物和方法 | |
| KR20260028192A (ko) | 신경퇴행성 질환 및 장애의 치료 및 예방용 조성물 및 방법 | |
| RU2812207C2 (ru) | Способы и фармацевтические композиции для лечения заболеваний, связанных с тубулин карбоксипептидазами (tcp) | |
| CN118786138A (zh) | 载脂蛋白E的C端片段及其在抑制γ分泌酶酶活中的应用 | |
| de Pril | The Ubiquitin Proteasome System in Huntington disease | |
| AU2006240181A1 (en) | Ubiquilin regulation of presenilin endoproteolysis, and suppression of polyglutamine-induced toxicity in cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16804142 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2987057 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201709735T Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 255912 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2017561811 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/015373 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20177037891 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017144862 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2016804142 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2016271635 Country of ref document: AU Date of ref document: 20160527 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017025574 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112017025574 Country of ref document: BR Kind code of ref document: A2 Effective date: 20171128 |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 322085 Country of ref document: IL |