WO2016195336A1 - 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 - Google Patents

결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2016195336A1
WO2016195336A1 PCT/KR2016/005657 KR2016005657W WO2016195336A1 WO 2016195336 A1 WO2016195336 A1 WO 2016195336A1 KR 2016005657 W KR2016005657 W KR 2016005657W WO 2016195336 A1 WO2016195336 A1 WO 2016195336A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
toxin
antibiotic
mycobacterium tuberculosis
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/005657
Other languages
English (en)
French (fr)
Inventor
이봉진
이인균
이상재
이기영
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Publication of WO2016195336A1 publication Critical patent/WO2016195336A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/48—Medical, disinfecting agents, disinfecting, antibacterial, germicidal or antimicrobial compositions
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D9/00—Compositions of detergents based essentially on soap
    • C11D9/04—Compositions of detergents based essentially on soap containing compounding ingredients other than soaps
    • C11D9/22—Organic compounds, e.g. vitamins
    • C11D9/40—Proteins

Definitions

  • the present invention relates to antibiotic peptides and their use for targeting the toxin-antitoxin system of Mycobacterium tuberculosis.
  • Tuberculosis is a serious and infectious acute and chronic disease that can occur anywhere in the body and can even lead to death. About 85% of the lungs develop in the lungs and the bloodstream It can spread and affect any organ in the body along the lymph nodes. Tuberculosis is transmitted from the patient's cough, runny nose and sputum through the air, killing approximately 9 million people in 2013, killing 1.5 million people. In addition, due to the emergence of multidrug-resistant tuberculosis, and more fully resistant tuberculosis bacteria, new antimicrobial agents for treating tuberculosis bacteria are needed.
  • the toxin-antitoxin gene was first known to play a role in maintaining the plasmid of Escherichia coli. When the plasmid containing the toxin-antitoxin gene is lost, the toxin having a stable structure remains but the toxin protein having an unstable structure It breaks down and eventually E. coli dies. Since the discovery of the first toxin-antitoxin gene, it has been found that the toxin-antitoxin gene is present not only in the plasmid but also in the chromosome of E. coli, and is known to be involved in multidrug resistance, biofilm formation and growth inhibition under stress.
  • Toxin-antitoxin systems can be broadly divided into three types (Type I, II, and III).
  • Type I RNA-type toxins attach to the RNA form of toxins and remove the toxicity.
  • type II protein-type antitoxins also attach to the protein form of the toxin and remove the toxicity.
  • type III systems RNA-type antitoxins attach to protein-form toxins and eliminate their toxicity.
  • Type II The most researched of these three types is the Type II system, in which the genes of toxins and antitoxins are encoded as operons.
  • a difficult external condition is encountered by bacteria, such as a rise in temperature or depletion of nutrients, unstable antitoxins are degraded by stress-inducing proteolytic enzymes and the cells are killed because they do not neutralize the toxin's toxicity.
  • the largest part of the type II is the VapBC family, and to date, the toxin (VapC) of the VapBC family is known to inhibit cell growth based on RNA resolution.
  • Toxin-antitoxin systems can be an attractive target for the development of new antibiotics because the artificial separation of the toxin-antitoxin complex will not neutralize the toxic toxins and eventually kill the cells.
  • Mycobacterium tuberculosis more than half of the toxin-antitoxin systems currently belong to the VapBC family, which is known to be involved in the extreme incubation and drug resistance of Mycobacterium tuberculosis. To date, many efforts have been made to develop tuberculosis therapeutics targeting the toxin-antitoxin complex, but so far no successful cases have been developed.
  • VapC30 or toxin
  • Mycobacterium tuberculosis regulates cell growth based on manganese ion-dependent RNA resolution.
  • the structure of the VapBC30 complex was identified, and based on this structure, a peptide was designed to interfere with the binding of the toxin-antitoxin complex, and the peptide successfully inhibited the binding of the toxin-antitoxin complex in vitro.
  • the present invention was completed by revealing that the peptide can be used as an active ingredient of an antibiotic pharmaceutical composition for treating tuberculosis.
  • the present invention provides an antibiotic peptide that inhibits the binding of toxin-antitoxin.
  • the present invention also provides a pharmaceutical composition for antibiotics containing the antibiotic peptide of the present invention as an active ingredient.
  • the present invention also provides an antibiotic quasi-drug containing the antibiotic peptide of the present invention as an active ingredient.
  • the present invention also provides an antibiotic external preparation containing the antibiotic peptide of the present invention as an active ingredient.
  • the present invention provides antibiotic peptides that inhibit toxin-antitoxin binding.
  • the peptide is preferably composed of any one amino acid sequence selected from the group consisting of SEQ ID NO: 4 to 6, but is not limited thereto.
  • the peptide is characterized in that it has an antimicrobial activity against Mycobacterium tuberculosis.
  • the peptide is characterized in that it inhibits the binding of toxin ⁇ 2, ⁇ 4 and antitoxin ⁇ 1, and does not affect toxin activity.
  • the peptide may also be used an amino acid in which one or several amino acids are added, substituted or deleted.
  • a method for synthesizing the peptide it is preferable to synthesize by conventional chemical synthesis method (WH Freeman and Co., Proteins; structures and molecular principles, 1983), specifically, liquid phase peptide synthesis method (Solution Phase Peptide synthesis) , It is more preferably synthesized by solid-phase peptide syntheses, fragment condensation and F-moc or T-BOC chemistry, and more specifically, it is most preferably synthesized by solid-phase peptide synthesis. It doesn't work.
  • the peptide of the present invention can be prepared by the following genetic engineering method.
  • a DNA sequence encoding the peptide is constructed according to a conventional method.
  • DNA sequences can be prepared by PCR amplification using appropriate primers.
  • DNA sequences may be synthesized by standard methods known in the art, such as using automated DNA synthesizers (eg, products from Biosearch or Applied Biosystems).
  • the DNA sequence is inserted into a vector comprising one or more expression control sequences (e.g., a promoter, an enhancer, etc.) operably linked to regulate expression of the DNA sequence, and the host cell is inserted into a recombinant expression vector formed therefrom.
  • expression control sequences e.g., a promoter, an enhancer, etc.
  • substantially pure peptide it is meant that the peptide according to the invention is substantially free of any other protein derived from the host.
  • Genetic engineering methods for peptide synthesis of the present invention reference may be made to Maniatis et al., Molecular Cloning; A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual et al.
  • the inventors have isolated and purified the VapBC30 complex protein of Mycobacterium tuberculosis (Strain H37Rv) for VapBC30 structural analysis to synthesize an antibiotic peptide that may interfere with toxin-antitoxin binding,
  • the structure was determined through diffraction analysis experiments (see FIG. 2).
  • three peptides designed to affect only the binding site without touching the active site of the toxin SEQ ID NOS: 4 to 6).
  • the antibiotic peptide of the present invention prevents the binding of the toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the active site of the toxin, and as a result, the initiating tRNA is degraded by the isolated toxin to induce the death of Mycobacterium tuberculosis. It can be usefully used as an antibiotic composition for treatment.
  • the present invention also provides an antibiotic composition containing the antibiotic peptide of the present invention as an active ingredient.
  • the peptide is preferably composed of any one amino acid sequence selected from the group consisting of SEQ ID NOs: 4 to 6, but is not limited thereto.
  • composition is characterized by having an antimicrobial activity against Mycobacterium tuberculosis.
  • the peptide may also be used an amino acid in which one or several amino acids are added, substituted or deleted.
  • the antibiotic peptide of the present invention prevents the binding of the toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the active site of the toxin (see FIG. 9). As a result, the initiating tRNA is degraded by the isolated toxin to induce the killing of Mycobacterium tuberculosis. Since it will be useful as an antibiotic composition for the treatment of Mycobacterium tuberculosis.
  • composition comprising the antibiotic peptide of the present invention preferably comprises 0.1 to 50% by weight of the antibiotic peptide relative to the total weight of the composition, but is not limited thereto.
  • composition of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of a medicament.
  • compositions according to the invention can be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories and sterile injectable solutions, respectively, according to conventional methods. have.
  • Carriers, excipients and diluents that may be included in the compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose (sucrose), lactose (lactose), gelatin, etc. are mixed and prepared.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • composition of the present invention can be administered orally or parenterally, any parenteral administration method can be used, systemic or topical administration is possible, but systemic administration is more preferred, and intravenous administration is most preferred.
  • Preferred dosages of the compositions of the present invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the effective dose of the antimicrobial peptide of the present invention is 1 to 2 mg / kg, preferably 0.5 to 1 mg / kg, and can be administered 1 to 3 times a day.
  • the dosage does not limit the scope of the invention in any aspect.
  • the pharmaceutical composition comprising the antibiotic peptide of the present invention as an active ingredient may be administered to a patient in a single dose by bolus form or by infusion for a relatively short period of time. Multiple doses may be administered by a fractionated treatment protocol with long term administration. Since the concentration is determined by taking into consideration various factors such as the age and health condition of the patient as well as the route of administration and the number of treatments of the drug, in view of the above, the present invention is a person having ordinary skill in the art. Appropriate effective dosages for the particular use of the novel peptides as pharmaceutical compositions may be determined.
  • the present invention also provides an antibiotic quasi-drug containing the antibiotic peptide of the present invention as an active ingredient.
  • the antibiotic peptide of the present invention prevents the binding of the toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the active site of the toxin (see FIG. 9). As a result, the initiating tRNA is degraded by the isolated toxin to induce the killing of Mycobacterium tuberculosis. Therefore, it can be usefully used as an antibiotic pharmaceutical composition for treating Mycobacterium tuberculosis, antibiotic quasi-drugs and antibiotic antibiotics.
  • the peptide When the composition of the present invention is used as an quasi-drug additive, the peptide may be added as it is or used together with other quasi-drug or quasi-drug components, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined depending on the intended use.
  • the quasi-drug composition of the present invention is not limited thereto, but may preferably be a disinfectant cleaner, a shower foam, a gagreen, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment, a patch, or a filter filler.
  • the present invention also provides an antibiotic external preparation containing the antibiotic peptide of the present invention as an active ingredient.
  • the external preparation is preferably an antibiotic peptide of the present invention based on the total weight of 0.1 to 50 parts by weight, but is not limited thereto.
  • the external preparations may further comprise fatty substances, organic solvents, solubilizers, thickeners and gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic Emulsifiers, fillers, metal ion sequestrants and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles, any other ingredients commonly used in external preparations or commonly It may contain an adjuvant used.
  • the antibiotic peptide of the present invention prevents the binding of the toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the active site of the toxin (see FIG. 9). As a result, the initiating tRNA is degraded by the isolated toxin to induce the death of Mycobacterium tuberculosis. Therefore, it can be usefully used as an antibiotic pharmaceutical composition for treating Mycobacterium tuberculosis, antibiotic quasi-drugs and antibiotic antibiotics.
  • the antibiotic peptide of the present invention prevents the binding of the toxin-antitoxin complex of Mycobacterium tuberculosis without affecting the active site of the toxin. Since it will induce the death of can be useful as an antibiotic composition for the treatment of Mycobacterium tuberculosis.
  • 1 is a diagram showing the overall structure of the VapBC30 complex.
  • Figure 2 is a diagram showing the binding structure of VapB30 and VapC30 in the VapBC30 complex.
  • Figure 3 is a diagram showing the overall structure of the VapC30 toxin protein.
  • FIG. 4 is a diagram showing the structure of the active site of the VapC30 toxin protein.
  • Figure 5 shows the VapB protein structure of each species.
  • FIG. 6 is a diagram showing the growth curve of E. coli expressing VapC30 protein or VapBC30 complex through OD 600 measurement.
  • Figure 7 is a diagram showing the results of acrylamide modified gel electrophoresis for the experiment in which VapC30 or VapBC30 protein to the tRNA fMet of Mycobacterium tuberculosis (Strain H37Rv).
  • FIG. 8 is a diagram showing the results of fluorescence quenching assay for the manganese ion dependence of the VapC30 protein.
  • Figure 9 is a diagram showing the results of fluorescence disappearance analysis for the experiment in which the peptide (SEQ ID NO: 4 to 6) to the VapBC30 complex.
  • VapB30 gene (SEQ ID NO: 7) of Mycobacterium tuberculosis (Strain H37Rv) was recombined into a pET28a (Novagen) expression vector, the VapC30 gene (SEQ ID NO: 8) to a pET21a (Novagen) expression vector, and the VapB30 protein was N-terminally. It is designed to contain histidine.
  • the recombinant vector thus prepared was transformed into Escherichia coli Rosetta2 (DE3) cells, which were incubated at 37 ° C. until the optical density was 0.5 at 600 nm in 600 LB (Luria Bertani) medium containing ampicillin and kanamycin. . Then 0.5 mM isopropyl 1-thio-beta-di-galactopyranoside was added to induce overexpression, and after 4 hours the cultured cells were 5,600 Centrifuged at g.
  • Example ⁇ 1-1> The cells obtained in Example ⁇ 1-1> were resuspended in buffer A (50 mM Tris-HCl, pH 8.0 and 500 mM NaCl), and then disrupted by ultrasonication, and the cells were again centrifuged at 17,900 g. The supernatant was filled into a fixed metal adsorption chromatography column (nickel-nitrilotriacetic acid-agarose, Novagen). The protein was eluted with A buffer containing 500 mM imidazole and then purified once again via size exclusion chromatography (HiLoad 16/60 Superdex 200 prep-grade column, GE Healthcare). Thereafter, 10 mg of human thrombin (thrombin, Sigma-Aldrich, USA) was added to the purified protein and left overnight at 20 ° C. to remove histidine labeling, and isolated via size exclusion chromatography.
  • buffer A 50 mM Tris-HCl, pH 8.0 and 500 mM NaCl
  • Protein crystals of VapBC30 substituted with Seleno-Methionine consisted of 0.2 M sodium acetate, 0.1 M sodium citrate pH 5.5, 5% (w / v) PEG 4,000 Obtained using an induction solution, the protein crystals of VapBC30 in the circular state were derived from 0.1 M sodium citrate tribasic dihydrate (pH 5.6), 1.0 M ammonium phosphate monobasic. It obtained using the liquid.
  • the obtained protein crystals were transferred to cryogenic protection liquid containing 20% glycerol (v / v), and then the ADSC Quantum 315r CCD detector system (Area Detector Systems Corporation, Poway, California) was used in the BL-5C beamline of the Pohang Accelerator Center. The result of diffraction analysis was obtained. Each diffraction image was obtained by rotating the crystal 1 degree, using the HKL2000 program. Both Se-Met substituted proteins and circular protein crystals belonged to the P3 1 21 space group, and the unit cell size was as follows:
  • VapBC30 complex dimers (heterodimer) exist in the asymmetric unit in both the Se-Met substituted protein and the protein crystal in the circular state (Tables 1 and 2).
  • the value in a parenthesis is the value of the high resolution shell (highest resolution shell).
  • phase difference problem is based on the Autosol of the PHENIX program, the protein modeling is done using the Coot, Paul Emsley program, and the Refmac5 (CCP4 Software Suite) and the Phoenix (PHENIX). To improve the structure. R free was calculated using 5 percent of the data, and water molecules were modeled using the Coot program. All structures were checked for accuracy using Morprobity (Table 2).
  • Structural comparison and overlapping were performed using the Secondary Structural Comparison Function (SSM), and solvent access site analysis was carried out using PISA.
  • SSM Secondary Structural Comparison Function
  • the improved structure was visualized using PyMOL and the residue overlap was visualized with the ClusterX 2.0 program and with ESPript 3.0.
  • each heterotetramer is connected to two heterodimers connected via the VapC30-VapC30 interface (see FIG. 1A).
  • heterodimer) complexes are linked, each heterodimer consists of VapC30 chain A and VacB30 chain B, or VapC30 chain C and VapB30 chain D (Fig. 1b).
  • size exclusion chromatography confirmed that the structure of the VapBC30 complex was 92.3 kDa (FIG. 1C), indicating that VapBC30 was present in the form of heterooctamer in aqueous solution.
  • the VapBC30 complex inhibits the activity of VapC30 through swap blocking of VapB30 (FIG. 2A).
  • the C-terminal portion of VapB30 binds to the residue of VapC30 on the far side and interferes with the enzymatic activity of VapC30 through a swapped inactivation process
  • the C-terminal portion of VapB30 chain D is VapC30 chain A
  • the C-terminal portion of VapB30 chain B binds to VapC30 chain C.
  • Asn96 residues in chain A of VapC30 are involved in hydrogen bonding in the molecule together with Asp99 and Asp119 residues in the active site, whereas in chain C of VapC30, Asn96 residues are linked by hydrogen bonds to Leu75 and Gly76 residues of VapB30 chain B (FIG. 2b and 2c).
  • VapC30 protein was obtained from the results of Examples ⁇ 1-3> and ⁇ 1-4>.
  • the VapC30 protein is characterized by a PIN-domain motif and consists of four parallel beta-strands and six alpha-helices in the order of ⁇ 4- ⁇ 1- ⁇ 2- ⁇ 3.
  • FIG. 3A the C-terminal residues of VapC30 (residues 115-131) do not form any secondary structure (FIG. 3b) and each complex is 2 because the VapBC30 complex is in the form of heterooctamer in aqueous solution and crystalline state.
  • FIG. 3C the VapC30 protein is characterized by a PIN-domain motif and consists of four parallel beta-strands and six alpha-helices in the order of ⁇ 4- ⁇ 1- ⁇ 2- ⁇ 3.
  • FIG. 3A the C-terminal residues of VapC30 (residues 115-131) do not form any secondary structure (FIG. 3b) and each complex is 2 because the VapBC30 complex is in the form of heterooctamer in aqueous solution and crystalline
  • RNA molecules In addition, positively charged amino acids (Lys88, Arg90, His91, and Arg92) are located in the loop between ⁇ 5 and ⁇ 6 helix, which are expected to bind RNA molecules (FIG. 4A), and active sites on the concave surface of the VapC30 homodimer interface. Located, the active site is formed by a loop between ⁇ 1 , ⁇ 1, ⁇ 3 and ⁇ 6 and a C-terminal loop. The active site contains Asp4, Glu40 and Asp99 residues, which are essential for RNA degrading enzyme activity, and these three residues form a powerful hydrogen bonding network and bind to water molecules. Comparing the structure of the toxin protein of the different species and the active site, it was confirmed that the water molecule can play the same role as the metal ion of the other species (Fig.
  • the structure of the VapB30 protein was obtained from the results of Examples ⁇ 1-3> and ⁇ 1-4>.
  • the N-terminal part showed almost the same structure consisting of alpha-helix and loop, while the C-terminal part showed various structures. It was confirmed.
  • the N-terminal alpha-helix (residues 49-62) structure of the VapB30 protein was similar to that of other known VapB proteins, but the overall structure was similar (Fig. 5).
  • VapC30 alone or pET28a (+)-His 6 -VapB30 and pCOLD1-His 6 -VapC30 expression vectors were inserted into E. coli BL21 cells and cultured in the same manner as in Example ⁇ 1-1>. Expression was induced and OD 600 was measured at 30 minute intervals for 4 and a half hours.
  • DNA fragments containing the H37Rv tRNA fMet moiety were amplified by a polymerase chain reaction (PCR), and a recognition site of the T7 RNA synthase was attached to the top.
  • PCR polymerase chain reaction
  • tRNA fMet was transcribed and purified using a Megaclear kit (MEGAclear kit, Ambion).
  • VapC30 protein was mixed with tRNA fMet (3 ⁇ m) of Example ⁇ 10-1> at different concentrations (3, 6, 9 ⁇ m) [10 ul reaction solution-0.1 M NaCl, 20 mM Tris-HCL buffer (pH). 8.0) and 40 units of RiboLock TM RNase inhibitor (Thermo scientific)] After 1 hour at 37 ° C, the cut RNA fragments were identified by 15% acrylamide modified gel electrophoresis with 8M urea.
  • the structure of the VapBC30 complex shows that the binding between the toxin-antitoxin complexes is the ⁇ 1-helix of the toxin (amino acid residues 49-62, SEQ ID NO: 1), the ⁇ 2-helix of the toxin (amino acid residues 17-27, SEQ ID NO: 2) and It consists of three structural elements of the ⁇ 4-helix (amino acid residues 52-65, SEQ ID NO: 3). Therefore, we designed three peptides that affect only the binding site without touching the active site of the toxin.
  • Peptide I mimics the ⁇ 1-helix of the antitoxin
  • peptide II mimics the ⁇ 2-helix of the toxin
  • peptide III mimics the ⁇ 4-helix of the toxin:
  • Peptide I (SEQ ID NO: 4): Glu-Leu-Ala-Ala-Ile-Arg-His-Arg;
  • Peptide II (SEQ ID NO: 5): Asp-Glu-Pro-Asp-Ala-Glu-Arg-Phe-Glu-Ala-Ala-Val-Glu-Ala-Asp-His-Ile; And
  • Peptide III (SEQ ID NO: 6): Arg-Phe-Gly-Glu-Pro-Gly-Gly-Arg-Glu.
  • VapC30 (20 ⁇ m) or VapBC30 complex (20 ⁇ m) was mixed with tRNA fMet [40 ul reaction solution—0.1 M NaCl, 20 mM Tris-HCL buffer (pH 8.0) and 40 units of RiboLock TM RNase inhibitor (Thermo. scientific)] and left at 37 ° C. for 60 minutes, and treated with peptide I (SEQ ID NO: 4), peptide II (SEQ ID NO: 5), and peptide III (SEQ ID NO: 6) at 20, 50 and 200 uM concentrations, respectively, at 37 ° C. It was left for 2 hours.
  • tRNA fMet 40 ul reaction solution—0.1 M NaCl, 20 mM Tris-HCL buffer (pH 8.0) and 40 units of RiboLock TM RNase inhibitor (Thermo. scientific)] and left at 37 ° C. for 60 minutes, and treated with peptide I (SEQ ID NO: 4), peptide II (SEQ ID NO
  • SEQ ID NO: 4 Glu Leu Ala Ala Ile Arg His Arg
  • SEQ ID NO: 5 Asp Glu Pro Asp Ala Glu Arg Phe Glu Ala Ala Val Glu Ala Asp His

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도에 관한 것으로, 구체적으로 결핵균의 독소-항독소 결합을 억제하는 서열번호 4 내지 6으로 기재되는 아미노산 서열을 가지는 펩타이드가 독소의 활성부위에는 영향을 미치지 않으면서 결핵균의 독소-항독소 복합체의 결합을 방해하고, 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로, 결핵균의 독소-항독소 결합을 억제하는 상기 펩타이드는 항생용 조성물로 유용하게 사용될 수 있다.

Description

결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
본 발명은 결핵균(Mycobacterium tuberculosis)의 독소-항독소 체계(toxin-antitoxin system)를 표적으로 하는 항생 펩타이드 및 이의 용도에 관한 것이다.
결핵(tuberculosis)은 인체의 어느 곳에나 발생할 수 있는 전염성인 동시에 감염성인 급성 및 만성질환이며 심지어는 사망에 이르게 할 수도 있는 무서운 질환으로, 폐에 잘 걸리는데 약 85% 정도가 폐에 발생하며, 혈류나 임파선을 따라 몸의 어느 기관에나 전파되어 영향을 줄 수 있다. 결핵은 환자의 기침, 콧물 및 가래로부터 공기를 통해 전염되며, 대략 900만명의 사람들이 2013년 결핵에 감염되어 150만명의 사람이 목숨을 잃었다. 또한 다제 내성 결핵, 더 나아가 완전내성 결핵균이 출현하고 있기 때문에 결핵균을 치료하기 위한 새로운 항균제가 필요해지고 있다.
독소-항독소 유전자는 맨 처음 대장균의 플라스미드를 유지하는 것에 관여하는 역할로써 알려졌으며, 독소-항독소 유전자를 가지고 있는 플라스미드가 소실되면 안정한 구조를 가지고 있는 독소는 그대로 유지되지만 불안정한 구조를 가지고 있는 항독소 단백질은 분해되어 결국 대장균이 죽게 되는 것이다. 처음 독소-항독소 유전자의 발견 이후로, 플라스미드뿐만 아니라 대장균의 염색체에도 독소-항독소 유전자가 있음이 밝혀졌고, 다제내성, 생물막 형성(biofilm formation) 및 스트레스 상황에서의 생장 억제 등에 관여한다고 알려져 있다.
독소-항독소 체계는 크게 세 가지 종류(Type I, II, III)로 나눌 수 있다. 타입 I 체계에서는 RNA 형태의 항독소가 RNA 형태의 독소에 붙어 그 독성을 제거하며, 타입 II 체계에서는 단백질 형태의 항독소가 역시 단백질 형태의 독소에 붙어 그 독성을 제거한다. 타입 III 체계에서는 RNA 형태의 항독소가 단백질 형태의 독소에 붙어 그 독성을 제거한다.
이 세 가지 타입 중에서 가장 연구가 많이 이루어진 것이 타입 II 체계이며, 타입 II 체계에서는 독소와 항독소의 유전자가 오페론(operon)을 이루며 암호화(coding)되어 있다. 온도 상승 또는 영양분의 고갈과 같이 박테리아에게 힘든 외부 상황이 닥치게 되면, 스트레스 유도성 단백질 분해 효소에 의해서 불안정한 항독소는 분해되고, 독소의 독성을 중화하지 못하게 되어 세포가 사멸하게 된다. 타입 II 중에서도 가장 많은 부분을 차지하고 있는 것이 VapBC family이며, 현재까지 VapBC family의 독소(VapC)는 RNA 분해능을 바탕으로 세포의 생장을 억제 한다는 것이 알려져 있다.
독소-항독소 복합체를 인위적으로 분리할 수 있으면 독성을 가지고 있는 독소가 중화되지 못하여 결국 세포가 사멸할 것이기 때문에 독소-항독소 체계는 새로운 항생제 개발에 매력적인 표적이 될 수 있다. 결핵균(Mycobacterium tuberculosis)에서는 현재 독소-항독소 체계 중 반 이상이 VapBC family에 속하는 것으로 밝혀져 있으며, 이러한 VapBC family는 결핵균의 극단적인 잠복기와 약제 내성에 관련이 있는 것으로 알려져 있다. 현재까지 독소-항독소 복합체를 표적으로 하는 결핵 치료제를 개발하기 위한 많은 노력들이 이행되어 왔지만 현재까지는 성공적인 예가 없었다.
이에, 본 발명자들은 결핵균 유전자에 암호화되어있는 독소-항독소 체계에 관한 연구를 시작하였고, 이번 연구를 통하여 결핵균의 VapC30 즉 독소가 세포의 생장을 망간 이온 의존적인 RNA 분해능을 바탕으로 조절한다는 것을 밝혀내었다. 또한 VapBC30 복합체의 구조를 규명하였으며, 이 구조를 바탕으로 독소-항독소 복합체의 결합을 방해할 수 있는 펩타이드를 디자인하고 상기 펩타이드가 시험관(in vitro) 내에서 독소-항독소 복합체의 결합을 성공적으로 저해하는 것을 확인하여, 상기 펩타이드를 결핵 치료를 위한 항생용 약학적 조성물의 유효성분으로 사용할 수 있음을 밝힘으로써, 본 발명을 완성하였다.
본 발명의 목적은 결핵균(Mycobacterium tuberculosis)의 독소-항독소 체계(toxin-antitoxin system)를 표적으로 하는 항생 펩타이드 및 이를 유효성분으로 함유하는 약학적 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 독소-항독소의 결합을 억제하는 항생 펩타이드를 제공한다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 약학적 조성물을 제공한다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품을 제공한다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제를 제공한다.
이하, 본 발명을 자세히 설명한다.
본 발명은 독소-항독소 결합을 억제하는 항생 펩타이드를 제공한다.
*상기 펩타이드는 서열번호 4 내지 6으로 구성된 군으로부터 선택되는 어느 하나의 아미노산 서열로 구성되는 것이 바람직하나 이에 한정되지 않는다.
상기 펩타이드는 결핵균에 대해 항균활성을 갖는 것을 특징으로 한다.
상기 펩타이드는 독소의 독소의 α2, α4 및 항독소의 α1의 결합을 억제하는 것을 특징으로 하는 하며, 독소의 활성에는 영향을 미치지 않는다.
상기 펩타이드는 하나 또는 몇 개의 아미노산이 첨가, 치환 또는 결실된 아미노산도 사용 가능하다.
상기 펩타이드 합성을 위한 방법으로 당업계의 통상적인 화학적 합성 방법(W. H. Freeman and Co., Proteins; structures and molecular principles, 1983)으로 합성하는 것이 바람직하며, 구체적으로는 액상 펩타이드 합성법(Solution Phase Peptide synthesis), 고상 펩타이드 합성법(solid-phase peptide syntheses), 단편 응축법 및 F-moc 또는 T-BOC 화학법으로 합성하는 것이 보다 바람직하고, 더욱 구체적으로는 고상 펩타이드 합성법으로 합성하는 것이 가장 바람직하나, 이에 한정되지 않는다.
또한, 본 발명의 펩타이드는 하기와 같은 유전공학적 방법에 의해 제조될 수 있다. 우선, 통상적인 방법에 따라 상기 펩타이드를 코딩하는 DNA 서열을 작제한다. DNA 서열은 적절한 프라이머를 사용하여 PCR 증폭함으로써 제작할 수 있다. 다른 방법으로 당업계에 공지된 표준 방법에 의해, 예컨대, 자동 DNA 합성기(예를 들면, Biosearch 또는 Applied Biosystems사의 제품)를 사용하여 DNA 서열을 합성할 수도 있다. 상기 DNA 서열은 이에 작동가능하게 연결되어 DNA 서열의 발현을 조절하는 하나 또는 그 이상의 발현 조절 서열(예: 프로모터, 인핸서 등)을 포함하는 벡터에 삽입하고, 이로부터 형성된 재조합 발현 벡터로 숙주세포를 형질전환한 다음, 생성된 형질전환체를 상기 DNA 서열이 발현되도록 하기에 적절한 배지 및 조건 하에서 배양하여, 배양물로부터 상기 DNA 서열에 의해 코딩된 실질적으로 순수한 펩타이드를 당업계에 공지된 방법(예컨대, 크로마토그래피)을 이용하여 회수한다. 상기 '실질적으로 순수한 펩타이드'라 함은 본 발명에 따른 펩타이드가 숙주로부터 유래된 어떠한 다른 단백질도 실질적으로 포함하지 않는 것을 의미한다. 본 발명의 펩타이드 합성을 위한 유전공학적 방법은 다음의 문헌을 참고할 수 있다: Maniatis et al., MolecularCloning; A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual 등.
본 발명의 구체적인 실시예에서, 본 발명자들은 독소-항독소 결합을 방해할 수 있는 항생 펩타이드를 합성하기 위한 VapBC30 구조분석을 위해 결핵균(Strain H37Rv)의 VapBC30 복합체 단백질을 분리 및 정제한 후, 엑스-레이 회절 분석 실험을 통해 구조를 결정하였다(도 2 참조). 그 결과, 독소의 활성 자리는 건드리지 않으면서 결합부위에만 영향을 미치는 3가지 펩타이드를 디자인하였다(서열번호 4 내지 6).
또한, 합성 펩타이드를 VapBC30 복합체에 처리한 경우 펩타이드의 농도에 비례하여 형광이 증가하는 것을 확인하였으며, 이는 펩타이드에 의해 VapBC간의 복합체 형성이 저해되어 VapC30에 의해 RNA가 분해된다는 것을 의미한다. 특히, 독소의 α-4 나선을 모방한 펩타이드 III를 첨가하였을 때 RNA의 분해가 가장 많은 것을 확인하였다(도 9 참조).
또한, VapC30 단백질의 활성을 확인하기 위해 VapC30 단독으로 대장균에 발현시킨 경우 VapBC30 복합체를 발현시킨 경우와 비교하여 대장균의 생장 억제되는 것을 확인하였고(도 6 참조), 결핵균의 개시 tRNA(initiator tRNA)와 반응시킨 경우 RNA를 분해하는 것을 확인하였고(도 7 참조), 특히 망간 이온(Mn2 +)이 존재하는 경우 VapC30의 RNA 분해효소 활성이 증가하는 것을 확인할 수 있었다(도 8 참조).
따라서, 본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 결핵균의 독소-항독소 복합체의 결합을 방해하며, 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로 결핵균 치료를 위한 항생용 조성물로 유용하게 사용될 수 있다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 조성물을 제공한다.
상기 펩타이드는 서열번호 4 내지 6으로 구성된 군으로부터 선택되는 어느 하나의 아미노산 서열로 구성되는 것이 바람직하나 이에 한정되지 않는다.
상기 조성물은 결핵균에 대해 항균활성을 갖는 것을 특징으로 한다.
상기 펩타이드는 하나 또는 몇 개의 아미노산이 첨가, 치환 또는 결실된 아미노산도 사용 가능하다.
본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 결핵균의 독소-항독소 복합체의 결합을 방해하며(도 9 참조), 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로 결핵균 치료를 위한 항생용 조성물로 유용하게 사용될 수 있다.
본 발명의 항생 펩타이드를 포함하는 조성물은, 조성물 총 중량에 대하여 상기 항생 펩타이드를 0.1 내지 50 중량%로 포함하는 것이 바람직하나 이에 한정되지 않는다.
본 발명의 조성물은 약제의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.
본 발명에 따른 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여법이라면 어느 것이나 사용 가능하고, 전신 투여 또는 국소 투여가 가능하나, 전신 투여가 더 바람직하며, 정맥 내 투여가 가장 바람직하다.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 항균 펩타이드의 유효용량은 1∼2 ㎎/㎏이고, 바람직하게는 0.5∼1 ㎎/㎏ 이며, 하루 1 내지 3회 투여될 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다
본 발명의 항생 펩타이드를 유효성분으로 하는 약학적 조성물은 볼루스(bolus) 형태 혹은 상대적으로 짧은 기간동안 주입(infusion) 등에 의해 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 상기 농도는 약의 투여 경로 및 치료 횟수뿐만 아니라 환자의 나이 및 건강상태 등 다양한 요인들을 고려하여 환자의 유효 투여량이 결정되는 것이므로 이러한 점을 고려할 때, 이 분야의 통상적인 지식을 가진 자라면 본 발명의 신규한 펩타이드의 약학적 조성물로서의 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품을 제공한다.
본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 결핵균의 독소-항독소 복합체의 결합을 방해하며(도 9 참조), 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로 결핵균 치료를 위한 항생용 약학적 조성물, 항생용 의약외품 및 항생용 외용제로 유용하게 사용될 수 있다.
본 발명의 조성물을 의약외품 첨가물로 사용할 경우, 상기 펩타이드를 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합량은 사용 목적에 따라 적합하게 결정될 수 있다.
본 발명의 의약외품 조성물은 이에 제한되지는 않으나, 바람직하게는 소독청결제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제, 패치, 또는 필터 충진제일 수 있다.
또한, 본 발명은 본 발명의 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제를 제공한다.
상기 외용제는, 총 중량에 대하여 본 발명의 항생 펩타이드를 0.1 내지 50 중량부로 함유되는 것이 바람직하나 이에 한정되지 않는다.
상기 외용제는, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭, 외용제에 통상적으로 사용되는 임의의 다른 성분 또는 통상적으로 사용되는 보조제를 함유할 수 있다.
본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 결핵균의 독소-항독소 복합체의 결합을 방해하며(도 9 참조), 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로 결핵균 치료를 위한 항생용 약학적 조성물, 항생용 의약외품 및 항생용 외용제로 유용하게 사용될 수 있다.
본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 결핵균(Mycobacterium tuberculosis)의 독소-항독소(toxin-antitoxin) 복합체의 결합을 방해하며, 그 결과 분리된 독소에 의해 개시 tRNA가 분해되어 결핵균의 사멸을 유도할 것이므로 결핵균 치료를 위한 항생용 조성물로 유용하게 사용될 수 있다.
도 1은 VapBC30 복합체의 전체 구조를 나타낸 도이다.
도 2는 VapBC30 복합체에서 VapB30 및 VapC30의 결합구조를 나타낸 도이다.
도 3은 VapC30 독소 단백질의 전체 구조를 나타낸 도이다.
도 4는 VapC30 독소 단백질의 활성부위의 구조를 나타낸 도이다.
도 5는 각 종들의 VapB 단백질 구조를 나타낸 도이다.
도 6은 VapC30 단백질 또는 VapBC30 복합체를 발현시킨 대장균의 생장곡선을 OD600 측정을 통해 나타낸 도이다.
도 7은 결핵균(Strain H37Rv)의 tRNAfMet에 VapC30 또는 VapBC30 단백질을 처리한 실험에 대하여 아크릴아마이드(acrylamide) 변성 젤 전기영동 결과를 나타낸 도이다.
도 8은 VapC30 단백질의 망간 이온 의존성에 대하여 형광 소멸 분석(fluorescence quenching assay) 결과를 나타낸 도이다.
도 9는 VapBC30 복합체에 펩타이드(서열번호 4 내지 6)를 처리한 실험에 대하여 형광 소멸 분석 결과를 나타낸 도이다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 한정되는 것은 아니다.
< 실시예 1> 결핵균(Mycobacterium tuberculosis)의 VapBC30 복합체의 구조 결정
<1-1> 독소( VapC30 ) 및 항독소( VapB30 ) 유전자 재조합 벡터 제작 및 발현 유도
결핵균의 독소 및 항독소 복합체의 구조를 결정하기 위하여 먼저 독소 및 항독소 유전자를 포함하는 재조합 벡터를 제작하여 이를 대장균에서 발현시켰다.
구체적으로, 결핵균(Strain H37Rv)의 VapB30 유전자(서열번호 7)는 pET28a(Novagen) 발현벡터에, VapC30 유전자(서열번호 8)는 pET21a(Novagen) 발현벡터에 각각 재조합하였고, VapB30 단백질은 N-말단에 히스티딘(histidine)을 포함하도록 제작되었다. 상기 제작된 재조합 벡터를 대장균인 Rosetta2(DE3) 세포에 같이 형질전환하였고, 이를 암피실린 및 카나마이신이 포함된 LB(Luria Bertani) 배지에서 UV 600 nm에서 광학 밀도가 0.5 가 될 때까지 37℃에서 배양하였다. 그 후 0.5 mM 이소프로필 1-티오-베타-디-갈락토피라노시데(isopropyl 1-thio-β-D-galactopyr ano side)를 첨가하여 과량발현을 유도하고, 4 시간 후에 배양된 세포를 5,600 g에서 원심분리하였다.
VapC30 단독의 단백질을 얻기 위하여 pCOLD1(Takara) 발현벡터에 재조합하여 대장균 BL21 세포에 삽입했으며, GroES와 GroEL chaperon 단백질과 함께 발현시킨 뒤, 상기와 동일한 방법으로 발현 및 분리하였다.
위상차 해결을 위해 메티오닌(methionine)을 셀레노메티오닌(Se-Met)으로 치환한 단백질은 셀레노메티오닌이 포함된 M9 배지에서 상기와 동일한 방법으로 발현 및 분리하였다.
분리한 모든 단백질은 결정 형성을 위해 원심분리필터(Amicon)를 이용하여 농축하였다.
<1-2> 발현된 독소 및 항독소 단백질의 분리 및 정제
실시예 <1-1>에서 수득한 세포를 buffer A(50 mM Tris-HCl, pH 8.0 및 500 mM NaCl)에 재부유한 후 초음파를 이용하여 파쇄하고, 파쇄된 세포는 다시 17,900 g에서 원심분리하여, 상등액을 고정금속흡착크로마토그래피 컬럼(nickel-nitrilotriacetic acid-agarose, Novagen)에 충진하였다. 단백질을 500 mM 이미다졸(imidazole)을 포함한 A buffer로 용출시킨 후 크기 배제 크로마토그래피(HiLoad 16/60 Superdex 200 prep-grade column, GE Healthcare)를 통하여 다시 한번 정제하였다. 이후, 히스티딘 표지를 제거하기 위해 인간 트롬빈(thrombin, 시그마-알드리치, 미국) 10 ㎎을 정제된 단백질에 첨가하여 20℃에서 밤새 방치하고, 크기 배제 크로마토그래피를 통해 분리하였다.
<1-3> 독소-항독소 단백질의 구조 분석
상기 <1-2>에서 정제한 단백질의 구조를 확인하기 위하여 싯팅 드롭 증발법(sitting drop vapor diffusion method)으로 단백질 결정을 형성하여 구조를 분석하였다.
구체적으로, 정제된 단백질액과 결정형성 유도를 위한 결정 유도액을 각각 0.5 ㎕씩 섞어 싯팅 드롭(sitting drop)을 만든 후 20℃에서 방치하였다. 셀레노-메티오닌(Seleno-Methionine)으로 치환된 VapBC30의 단백질 결정은 0.2 M 소듐 아세테이트(sodiuim acetate), 0.1 M 소듐 시트레이트(sodium citrate pH 5.5), 5% (w/v) PEG 4,000으로 구성된 결정 유도액을 사용하여 얻었으며, 원형 상태의 VapBC30의 단백질 결정은 0.1 M 소듐 시트레이트 트리베이직 디하이드레이트(sodium citrate tribasic dihydrate, pH 5.6), 1.0 M 암모늄 포스페이트 모노베이직(ammonium phosphate monobasic)으로 구성된 결정 유도액을 사용하여 얻었다.
수득한 단백질 결정을 20% 글리세롤(glycerol, v/v)이 포함된 극저온 보호액에 옮긴 후, 포항 가속기 센터의 BL-5C 빔라인에서 ADSC Quantum 315r CCD detector system(Area Detector Systems Corporation, Poway, California)을 이용하여 회절분석 결과를 얻었다. 각각의 회절 이미지는 결정을 1도씩 회전해 가면서 얻었으며, HKL2000 프로그램을 이용하였다. Se-Met 치환 단백질과 원형 상태의 단백질 결정 모두 P3121 공간 군에 속하였으며, 단위 격자의 크기는 다음과 같다:
Se-Met 치환 단백질 : a = 96.31 A, b = 96.31 A, and c = 233.03 A; 및
원형 상태의 단백질 : a = 96.38 A, b = 96.38 A, and c = 232.79 A.
그 결과, Se-Met 치환 단백질과 원형 상태의 단백질 결정 모두 비대칭 유닛(asymmetric unit) 안에 네 개의 VapBC30 복합 이합체(heterodimer)가 존재하는 것을 확인하였다(표 1 및 2).
데이터 모음 SAD(Se peak) 단백질 결정 I (Se-Met) 단백질 결정 II (원형)
X-ray wavelength(Å) 0.9791 0.9791 1.0000
Space group P3121 P3121 P3121
Unit cell length(Å) a=b=96.44 a=b=96.31 a=b=96.38
c=233.24 c=233.03 c=232.79
Unit cell angle(˚) α=β=90, γ=120 α=β=90, γ=120 α=β=90, γ=120
Resolution range(Å) 50.0-2.80 (2.75-2.70)a 50.0-2.70 (2.75-2.70)a 50.0-2.70 (2.75-2.70)a
Total /unique reflections 1,093,614/31,502 233,858/34,963 272,621/35,181
Completeness(%) 99.9(100)a 98.9(99.9)a 99.3(99.0)a
<I /σ(I)> 83.4(12.4)a 37.0(4.68)a 41.0(5.39) a
Rmerge b 0.173(0.531)a 0.087(0.613)a 0.088(0.693)a
a 삽입구 안의 값은 가장 높은 해상도 쉘(highest resolution shell)의 값이다.
b Rmerge=ΣhΣi|I(h) i - >I(h)|/ΣhΣi I(h) i, I(h)는 reflection h의 강도를 나타낸 값이고, Σh는 reflection h의 합계, Σi는 reflection h의 i 측정값의 합계를 나타낸다.
<1-4> 단백질 구조결정 및 구조개선
위상차 문제는 피닉스(PHENIX) 프로그램의 오토졸(Autosol)을 이용하고, 단백질 모델형성은 쿠트(Coot, Paul Emsley) 프로그램을 이용하였으며, 레프맥5(Refmac5, CCP4 Software Suite)와 피닉스(PHENIX)를 이용하여 구조 개선을 하였다. 5퍼센트의 데이터를 이용하여 Rfree 를 계산하였으며, 물 분자는 쿠트(Coot) 프로그램을 이용해 모델링하였다. 모든 구조는 몰프로비티(Molprobity)를 이용하여 그 정확성을 확인하였다(표 2).
Se-Met 치환 단백질과 원형 단백질의 경우 각각 94.79% 와 93.67% 의 단백질 잔기들이 라마찬드란 플롯(Ramachandran plot)의 알맞은(favored) 지역에 분포하였고 아웃라이어(outlier)는 없었다. 몰프로비티(Molprobity)에서 확인한 결과 두 단백질은 1.64와 1.79의 점수로 100th와 99th 퍼센트 안에 속해 있었으며, 100th 퍼센트는 비슷한 해상도의 구조에서 가장 구조정확성이 높음을 의미한다(표 2).
구조 비교와 겹침은 이차구조비교 함수(SSM)를 사용하였고, 용제 접근부위 분석은 피사(PISA)를 이용하였다. 개선된 구조는 파이몰(PyMOL)을 이용하여 시각화하였으며 잔기 겹침은 클러스탈엑스 2.0(ClustalX 2.0) 프로그램을 이용하였고, 에스프리트 3.0(ESPript 3.0)으로 시각화하였다.
모델 구조 개선 데이터 단백질 결정 I(Se-Met) 단백질 결정 II(원형)
Rwork/Rfree c 0.242/0.273 0.205/0.238
No. of nonhydrogen atoms / average B-factor(Å2)
Protein atoms 4,713/59.8 4,944/61.1
Water oxygen atoms 57/48.73 106/48.29
Wilson B-factor(Å2) 59.92 54.2
R.m.s. deviations from ideal geometry
Bond lengths(Å)/bond angles(˚) 0.0113/1.287 0.0112/1.2053
R.m.s. Z-scoresd
Bond lengths/bond angles 0.565/0.585 0.563/0.567
Ramachandran plot(%)
Favored 94.79e 93.67e
Outliers 0.0e 0.0e
Rotamer outliers(%) 2.77e 2.03e
c R=Σ||F obs| -|F calc||/ Σ|F obs|, Rfree 값은 reflection에서 구조 개선에 사용되지 않은 5%를 무작위로 선택해서 계산하였으며, Rwork 값은 남은 reflection에서 계산하였다.
d 레프맥(REFMAC)을 사용하여 얻었다.
e 몰프로비티(MolProbity)를 사용하여 얻었다.
<1-5> VapBC30 복합체의 구조적 특징
상기 <1-3> 및 <1-4>의 결과를 통하여 2.7 Å의 해상도로 VapBC30 복합체의 구조를 구하였다.
도 1에 나타난 바와 같이, 결정형 I 및 II의 각 비대칭 유닛에 두 개의 VapBC30 복합체 헤테로테트라머(heterotetramer)가 존재하고(도 1a), 각 헤테로테트라머는 VapC30-VapC30 인터페이스를 통해 연결된 두 개의 헤테로다이머(heterodimer) 복합체가 연결되어 이루어지는 것을 확인하였으며, 각 헤테로다이머는 VapC30 사슬 A 및 VacB30 사슬 B, 또는 VapC30 사슬 C 및 VapB30 사슬 D로 이루어진다(도 1b). 또한, 크기 배제 크로마토그래피(size exclusion chromatography)를 통해 VapBC30 복합체의 구조가 92.3 kDa임을 확인하였고(도 1c), 이는 수용액 상에서 VapBC30이 헤테로옥타머(heterooctamer)의 형태로 존재한다는 것을 나타낸다.
또한 도 2에 나타난 바와 같이, VapBC30 복합체는 VapB30의 스왑 블로킹(swapped blocking)을 통하여 VapC30의 활성을 저해한다(도 2a). 구체적으로, VapB30의 C-말단 부위가 먼 쪽의 VapC30의 잔기와 결합하여 스왑 불활성화 과정(swapped inactivation process)을 통하여 VapC30의 효소 활성을 방해하며, VapB30 사슬 D의 C-말단 부위는 VapC30 사슬 A와 결합하고, VapB30 사슬 B의 C-말단 부위는 VapC30 사슬 C와 결합한다. VapC30의 사슬 A에서 Asn96 잔기가 활성부위의 Asp99 및 Asp119 잔기와 함께 분자 내의 수소 결합에 관여하는 반면, VapC30의 사슬 C에서는 Asn96 잔기가 VapB30 사슬 B의 Leu75 및 Gly76 잔기에 수소 결합으로 연결된다(도 2b 및 2c).
<1-6> VapC30 단백질의 구조적 특징
*상기 실시예 <1-3> 및 <1-4>의 결과를 통하여 VapC30 단백질의 구조를 구하였다.
도 3에 나타난 바와 같이 VapC30 단백질은 핀-도메인 모티프(PIN-domain motif)의 특징을 가지며, β4-β1-β2-β3 순서로 이루어진 4개의 평행한 베타-스트랜드 및 6 개의 알파-헬릭스로 이루어져 있다(도 3a). 또한, VapC30의 C-말단 잔기들(잔기 115-131)은 어떠한 2차 구조도 형성하지 않으며(도 3b), 수용액 및 결정 상태에서 VapBC30 복합체가 헤테로옥타머의 형태로 존재하기 때문에 각 복합체는 2개의 VapC30 호모다이머(homodimer)를 가지고, 호모다이머 형성은 α3, α4, α5 및 α6 헬릭스의 잔기들에 의한 수소결합 및 소수성 결합에 의해 이루어진다(도 3c).
또한, 양성 전하 아미노산(Lys88, Arg90, His91 및 Arg92)이 α5와 α6 헬릭스 사이의 루프에 위치해 있어, RNA 분자와 결합할 것으로 예상되고(도 4a), VapC30 호모다이머 인터페이스의 오목한 표면에 활성 부위가 위치해 있으며, α1, β1, α3 및 α6 사이의 루프와 C-말단 루프에 의해 활성 부위가 형성된다. 활성 부위에는 RNA 분해효소 활성에 필수적인 Asp4, Glu40 및 Asp99 잔기가 보전되어 있으며, 이 세 잔기는 강력한 수소 결합 네트워크(hydrogen bonding network)를 형성하고, 물 분자와 결합한다. 다른 종들의 독소 단백질과 활성 부위의 구조를 비교하였을 때 물 분자가 다른 종들의 금속 이온과 같은 역할을 할 수 있음을 확인하였다(도 4b).
<1-7> VapB30 단백질의 구조적 특징
상기 실시예 <1-3> 및 <1-4>의 결과를 통하여 VapB30 단백질의 구조를 구하였다.
도 5에 나타난 바와 같이, 결정형 I 및 II의 비대칭 유닛의 8개의 VapB30 모노머를 비교하였을 때 N-말단 부위는 알파-헬릭스 및 루프로 이루어지는 거의 동일한 구조를 보였지만, C-말단 부위는 다양한 구조를 보이는 것을 확인하였다. 또한, 기존에 알려진 다른 VapB 단백질과 비교하였을 때 VapB30 단백질의 N-말단 알파-헬릭스(잔기 49-62) 구조는 유사하나, 전체적인 구조는 비유사한 것을 확인할 수 있었다(도 5).
<실시예 2> VapC30 단백질의 대장균 생장억제 효과 확인
VapC30 단백질의 대장균 생장조절 효과를 확인하기 위해 하기와 같은 방법으로 실험하였다.
VapC30 단독으로 또는 pET28a(+)-His6-VapB30 및 pCOLD1-His6-VapC30 발현벡터를 같이 대장균(E.coli BL21) 세포에 삽입한 뒤, 실시예 <1-1>과 동일한 방법으로 배양 및 발현을 유도하고, OD600은 4시간 반동안 30분 간격으로 측정하였다.
그 결과, VapC30만을 단독으로 발현시킨 경우 VapBC30 복합체를 발현시킨 경우 및 대조군과 비교하여 대장균의 생장이 억제되었고, VapB30이 VapC30의 생장저해효과를 중화시키는 것을 확인할 수 있었다(도 6).
<실시예 3> VapC30 단백질의 개시 tRNA(initiator tRNA) 분해능력 확인
VspC30 단백질의 RNA 분해효소 활성을 알아보기 위해 하기와 같은 실험을 수행하였다.
<3-1> 기질로 쓰일 tRNA 합성
결핵균(H37Rv) tRNAfMet부분을 포함한 DNA 조각을 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 증폭하고, T7 RNA 합성효소의 인식부위를 그 상부에 부착하였다. T7 RNA 합성효소를 사용하여, tRNAfMet를 전사하고 메가클리어 키트(MEGAclear kit, Ambion)를 이용하여 정제하였다.
<3-2> VapC30의 개시 tRNA 분해효소 활성 확인
VapC30 단백질을 농도(3, 6, 9 ㎛)를 다르게 하여 실시예 <10-1>의 tRNAfMet(3 ㎛)와 섞은 후[10 ul 반응용액- 0.1 M NaCl, 20 mM Tris-HCL buffer(pH 8.0) 및 40 유닛 RiboLockTM RNase inhibitor(Thermo scientific)] 37℃에서 1 시간동안 방치하여, 잘려진 RNA 조각들을 8M 우레아(Urea)를 포함한 15% 아크릴아마이드(acrylamide) 변성 젤 전기영동법으로 확인하였다.
그 결과, VapBC30 복합체(30 ㎛)를 처리한 경우 RNA가 그대로 존재하는 것에 비해, VapC30 단백질을 처리한 경우는 농도 의존적으로 RNA가 완전히 분해되는 것을 확인할 수 있었다(도 7).
<3-3> VapC30 단백질의 망간이온( Mn 2 + ) 의존적 RNA 분해능력 확인
또한, VapC30 단백질의 개시 tRNA 분해에 있어서 망간 이온의 영향을 확인하기 위해 형광 소멸 분석(fluorescence quenching assay)을 수행하였다.
구체적으로, VapC30 또는 VapBC30 단백질과 tRNAfMet를 섞은 후, 각각 10 uM MgCl2, 10 uM MnCl2 및 10 uM EDTA를 처리하여 시간별로 형광(SPECTRAmax GEMINI XS spectrofluorometer)을 측정하였다.
그 결과, 마그네슘 이온(Mg2 +)을 처리한 경우에는 VapC30의 활성이 거의 증가하지 않은 반면, 망간 이온이 존재할 때 VapC30의 활성이 세 배 정도 증가한 것을 확인할 수 있었다(도 8).
<실시예 4> 독소-항독소 결합을 저해하기 위한 펩타이드 디자인
VapBC30 복합체의 구조를 보면 독소-항독소의 복합체간의 결합은 항독소의 α1-나선(아미노산 잔기 49-62, 서열번호 1), 독소의 α2-나선(아미노산 잔기 17-27, 서열번호 2) 및 독소의 α4-나선(아미노산 잔기 52-65, 서열번호 3)의 3가지 구조요소로 이루어져 있다. 따라서 독소의 활성 자리는 건드리지 않으면서 결합부위에만 영향을 미치는 3가지 펩타이드를 디자인하였다. 펩타이드 I은 항독소의 α1-나선, 펩타이드 II는 독소의 α2-나선, 펩타이드 III는 독소의 α4-나선을 모방한 것이다:
펩타이드 I(서열번호 4) : Glu-Leu-Ala-Ala-Ile-Arg-His-Arg ;
펩타이드 II(서열번호 5) : Asp-Glu-Pro-Asp-Ala-Glu-Arg-Phe-Glu-Ala-Ala-Val-Glu-Ala-Asp-His-Ile ; 및
펩타이드 III(서열번호 6) : Arg-Phe-Gly-Glu-Pro-Gly-Gly-Arg-Glu.
<실험예 1> 합성 펩타이드의 복합체 형성 저해능 확인
상기 <실시예 9>에서 합성된 펩타이드의 VapBC30의 복합체 형성 저해능을 확인하기 위하여 하기와 같은 실험 및 형광 소멸 분석을 수행하였다.
구체적으로, VapC30(20 ㎛) 또는 VapBC30 복합체(20 ㎛)를 tRNAfMet와 섞은 후[40 ul 반응용액- 0.1 M NaCl, 20 mM Tris-HCL buffer(pH 8.0) 및 40 유닛 RiboLockTM RNase inhibitor(Thermo scientific)] 37℃에서 60 분동안 방치하고, 펩타이드 I(서열번호 4), 펩타이드 II(서열번호 5), 펩타이드 III(서열번호 6)을 각각 20, 50 및 200 uM 농도로 처리하여 37℃에서 2 시간동안 방치하였다.
그 결과, 20 uM VapC30 단백질을 넣었을 때 나온 형광값을 100%로 잡고 20 uM VapBC30 단백질을 넣었을 때 나온 형광값을 0%로 잡았을 때, 펩타이드를 처리한 경우 농도 의존적으로 형광이 증가하는 것을 확인하였다. 이는 펩타이드에 의해 VapBC간의 복합체 형성이 저해되어 VapC30에 의해 RNA가 분해된다는 것을 의미한다. 특히, 독소의 α-4 나선을 모방한 펩타이드 III를 첨가하였을 때 RNA의 분해가 가장 많은 것을 확인하였다(도 9).
서열번호 1: Leu Arg Asp Glu Leu Ala Ala Ile Arg His Arg Cys Ala Ala
서열번호 2: Asp Ala Glu Arg Phe Glu Ala Ala Val Glu Ala
서열번호 3: Pro Gly Gly Arg Glu Leu Asp Leu Trp Leu His Arg Ala Ala
서열번호 4: Glu Leu Ala Ala Ile Arg His Arg
서열번호 5: Asp Glu Pro Asp Ala Glu Arg Phe Glu Ala Ala Val Glu Ala Asp His
서열번호 6: Arg Phe Gly Glu Pro Gly Gly Arg Glu
서열번호 7: atggcgctgagtatcaagcacccggaagccgaccggctcgcgcgagcgcttgcggcgcgcaccggcgagacgttgaccgaggcagtggttaccgcgttgcgcgagcggctcgctcgtgagactgggcgtgcccgtgttgtcccgttgcgcgacgagcttgccgcgattcggcaccggtgcgcagcgttgccggtggtcgacaaccggtccgctgaggcgattctcggcta tgacgagcgcggattgccggcctga
서열번호 8: atggtgatcgacacgtccgcgctcgttgcgatgctcagcgacgagccagacgcagagcggttcgaggccgccgtcgaagccgaccacatccggctgatgtcgacggcgtcttacctggaaacggcactcgtgatagaagcccgcttcggtgaaccgggcggacgtgagctggatctgtggcttcatcgcgccgcggtcgaccttgttgccgtgcatgccgaccaagcggatgccgcgcgcgccgcctaccgcacgtacggcaagggaaggcatcgtgcggggctcaactacggcgactgcttctcatacggcctcgccaagatcagcggccagccactcctgttcaagggcgaagatttccaacacaccgacatcgccacggtcgcgctgccctaa

Claims (10)

  1. 독소-항독소의 결합을 억제하는 항생 펩타이드.
  2. 제 1항에 있어서, 상기 펩타이드는 서열번호 4 내지 6으로 구성된 군으로부터 선택되는 어느 하나의 아미노산 서열로 구성되는 것을 특징으로 하는 항생 펩타이드.
  3. 제 1항에 있어서, 상기 펩타이드는 결핵균에 대해 항균활성을 갖는 것을 특징으로 하는 항생 펩타이드.
  4. 제 1항에 있어서, 상기 펩타이드는 독소의 α2, α4 및 항독소의 α1의 결합을 억제하는 것을 특징으로 하는 항생 펩타이드.
  5. 제 1항에 있어서, 상기 펩타이드는 독소의 활성에는 영향을 미치지 않는 것을 특징으로 하는 항생 펩타이드.
  6. 제 1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 조성물.
  7. 제 6항에 있어서, 상기 펩타이드는 서열번호 4 내지 6으로 구성된 군으로부터 선택되는 어느 하나의 아미노산 서열로 구성되는 것을 특징으로 하는 항생용 조성물.
  8. 제 6항에 있어서, 상기 조성물은 결핵균에 대하여 항균활성을 갖는 것을 특징으로 하는 항생용 조성물.
  9. 제 1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품.
  10. 제 1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제.
PCT/KR2016/005657 2015-05-29 2016-05-27 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 Ceased WO2016195336A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020150076355A KR101746160B1 (ko) 2015-05-29 2015-05-29 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
KR10-2015-0076355 2015-05-29

Publications (1)

Publication Number Publication Date
WO2016195336A1 true WO2016195336A1 (ko) 2016-12-08

Family

ID=57441486

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/005657 Ceased WO2016195336A1 (ko) 2015-05-29 2016-05-27 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101746160B1 (ko)
WO (1) WO2016195336A1 (ko)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101919364B1 (ko) * 2016-12-07 2018-11-19 한양대학교 산학협력단 결핵균 ＣｌｐＣ１ 결합용 펩타이드
KR101849347B1 (ko) * 2017-07-31 2018-04-16 서울대학교 산학협력단 결핵균 독소-항독소 체계를 표적으로 하는 펩타이드 및 이의 용도
KR102083398B1 (ko) * 2018-07-18 2020-03-02 서울대학교산학협력단 결핵균 내인성 독소의 독성을 증가시키며, 독소-항독소 체계를 표적으로 하는 항결핵 펩타이드 및 이의 용도
KR102097040B1 (ko) * 2018-08-10 2020-04-03 서울대학교산학협력단 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
KR102521182B1 (ko) * 2020-11-06 2023-04-12 서울대학교산학협력단 결핵균 독소-항독소 시스템을 표적으로 하는 항균 스테이플 펩타이드 및 이의 용도
KR102551038B1 (ko) * 2020-12-30 2023-07-05 서울대학교산학협력단 폐렴구균 내인성 독소의 독성을 증가시키며, HigBA 독소-항독소 체계를 표적으로 하는 항균 펩타이드 및 이의 용도
KR102581500B1 (ko) * 2021-01-20 2023-09-20 서울대학교산학협력단 폐렴간균 독소-항독소 시스템을 표적으로 하는 항균 펩타이드 및 화합물, 및 이들의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007039398A (ja) * 2005-08-04 2007-02-15 Institute Of Physical & Chemical Research トキシン−アンチトキシン複合体の形成を指標とする抗生物質のスクリーニング方法
US20070298043A1 (en) * 2003-10-02 2007-12-27 Ehud Gazit Novel Antibacterial Agents and Methods of Identifying and Utilizing Same
KR20090013762A (ko) * 2006-03-22 2009-02-05 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 신규 항생제 개발을 위한 박테리아 자멸 경로의 표적화
US20110028697A1 (en) * 2008-03-27 2011-02-03 Takara Bio Inc. Prophylactic/therapeutic agent for infectious disease

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070298043A1 (en) * 2003-10-02 2007-12-27 Ehud Gazit Novel Antibacterial Agents and Methods of Identifying and Utilizing Same
JP2007039398A (ja) * 2005-08-04 2007-02-15 Institute Of Physical & Chemical Research トキシン−アンチトキシン複合体の形成を指標とする抗生物質のスクリーニング方法
KR20090013762A (ko) * 2006-03-22 2009-02-05 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 신규 항생제 개발을 위한 박테리아 자멸 경로의 표적화
US20110028697A1 (en) * 2008-03-27 2011-02-03 Takara Bio Inc. Prophylactic/therapeutic agent for infectious disease

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Genbank [O] 29 April 2014 (2014-04-29), XP055332822, Database accession no. KAY40319.1 *
LEE ET AL.: "Structural and Functional Studies of the Mycobacterium Tuberculosis VapBC30 Toxin-antitoxin System: Implications for the Design of Novel Antimicrobial Peptides", NUCLEIC ACIDS RESEARCH, vol. 43, no. 15, 6 July 2015 (2015-07-06), pages 7624 - 7637, XP055332825 *

Also Published As

Publication number Publication date
KR20160140137A (ko) 2016-12-07
KR101746160B1 (ko) 2017-06-12

Similar Documents

Publication Publication Date Title
WO2016195336A1 (ko) 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
WO2013169060A1 (ko) 패혈증 예방 또는 치료용 조성물
HUP0104548A2 (hu) Hepatitis C inhibitor peptidek, eljárás előállításukra, azokat tartalmazó gyógyszerkészítmények és alkalmazásuk
WO2012050402A2 (ko) 세포투과성 parkin 재조합 단백질 및 이를 함유하는 퇴행성 뇌질환 치료용 약학적 조성물
WO2018092955A1 (ko) 전복에서 유래한 항균 펩타이드 유사체 및 이를 포함하는 항균용 약학 조성물
CN103209700A (zh) 广谱抗生素Arylomycin类似物
EP3240802A1 (en) Glucagon derivatives
WO2023277432A1 (ko) 재조합 보툴리눔 독소 타입 a 경쇄, 재조합 보툴리눔 독소 및 이의 조성물, 용도 및 방법
Bowers et al. Isolation, sequencing and expression of the gene encoding a major protein from the backteriophage associated with Bartonella henselae
WO2019027224A2 (ko) 결핵균 독소-항독소 체계를 표적으로 하는 펩타이드 및 이의 용도
WO2020032324A1 (ko) 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
WO2019004674A1 (ko) 아세틸콜린수용체 결합 펩타이드
WO2019022469A1 (ko) 니코틴아마이드 아데닌 다이뉴클레오타이드 인산(nadph) 또는 이의 유도체의 베타 락타메이즈 저해제로서의 용도
WO2022098220A1 (ko) 인플라마솜 어댑터 단백질(asc)의 중합체화 도메인에 결합하는 신규한 폴리펩타이드 및 이의 용도
WO2019240429A1 (ko) 세포 투과 펩티드 및 아데노신 탈아미노화효소의 융합 단백질을 포함하는 중증복합면역결핍증 치료용 약학적 조성물
WO2011090345A2 (ko) 플루페나믹산을 유효성분으로 포함하는 신규한 항생제 조성물
WO2022158875A1 (ko) 폐렴간균 독소-항독소 시스템을 표적으로 하는 항균 펩타이드 및 화합물, 및 이들의 용도
WO2021242046A1 (ko) 신규한 항염증성 펩타이드 및 이의 용도
WO2023277433A1 (ko) 재조합 보툴리눔 독소 타입 a 경쇄, 재조합 보툴리눔 독소 및 이의 조성물, 용도 및 방법
WO2020263062A1 (ko) 구제역 바이러스 백신 조성물
Tsai et al. Effect of site directed mutagenesis on the activity of recombinant trimucrotoxin, a neurotoxic phospholipase from Trimeresurus mucrosquamatus venom
WO2021242045A1 (ko) Nlrx1 유래의 신규한 항염증성 펩타이드 및 이의 용도
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2024248482A1 (ko) 세포 투과가 가능한 펩타이드-핵산 올리고머를 유효성분으로 포함하는 코로나바이러스 감염 질환 예방 또는 치료용 약학적 조성물
US20250320248A1 (en) Menaquinone-binding compounds and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16803691

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16803691

Country of ref document: EP

Kind code of ref document: A1