WO2016177660A1 - The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc) - Google Patents

The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc) Download PDF

Info

Publication number
WO2016177660A1
WO2016177660A1 PCT/EP2016/059734 EP2016059734W WO2016177660A1 WO 2016177660 A1 WO2016177660 A1 WO 2016177660A1 EP 2016059734 W EP2016059734 W EP 2016059734W WO 2016177660 A1 WO2016177660 A1 WO 2016177660A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
pyridine
pyrazolo
pyrimidine
amino
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/059734
Other languages
English (en)
French (fr)
Inventor
Claudia Hirth-Dietrich
Peter Sandner
Johannes-Peter Stasch
Michael Hahn
Markus Follmann
Alexandros Vakalopoulos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer Pharma AG
Original Assignee
Bayer Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2017014057A priority Critical patent/MX2017014057A/es
Priority to AU2016258847A priority patent/AU2016258847A1/en
Priority to EP16719430.7A priority patent/EP3291811B1/en
Priority to TNP/2017/000465A priority patent/TN2017000465A1/en
Priority to HK18103264.3A priority patent/HK1243645A1/zh
Priority to BR112017023855-1A priority patent/BR112017023855A2/pt
Priority to US15/571,105 priority patent/US20180169095A1/en
Priority to CN201680026187.XA priority patent/CN107580495A/zh
Priority to KR1020177031942A priority patent/KR20180002657A/ko
Application filed by Bayer Pharma AG filed Critical Bayer Pharma AG
Priority to CA2984983A priority patent/CA2984983A1/en
Priority to EA201792346A priority patent/EA201792346A1/ru
Priority to JP2017557440A priority patent/JP6748113B2/ja
Publication of WO2016177660A1 publication Critical patent/WO2016177660A1/en
Priority to IL255214A priority patent/IL255214A0/en
Priority to PH12017501980A priority patent/PH12017501980A1/en
Anticipated expiration legal-status Critical
Priority to ZA2017/08248A priority patent/ZA201708248B/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/4261,3-Thiazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/53Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/63Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
    • A61K31/635Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • sGC stimulators for the treatment of Digital Ulcers (DU) concomitant to systemic sclerosis (SSc).
  • SSc systemic sclerosis
  • sGC stimulators sGC activators alone, or in combination with PDE5 inhibitors for the prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and scleroderma.
  • SSc Systemic Sclerosis
  • scleroderma is a non-inherited, noninfectious disease and thought to be an autoimmune disease.
  • SSc has a broad variety of symptoms triggered by excessive deposition of extracellular matrix in the dermis resulting in skin fibrosis.
  • SSc is characterized by progressive tissue fibrosis affecting other internal organs as the gut, the lung or the kidneys. Therefore scleroderma is the hallmark of the disease comprising also e.g. lung fibrosis, renal fibrosis, fibrosis of the heart, the gut or the blood vessels.
  • SSc is also characterized by vasculopathies and microangiopahties.
  • vasculopathies and microangiopahties Especially small vessel vasculopathies and concomitant vascular malperfusion and ischemia can cause Raynaud's phenomena (RP) but also to the formation of digital ulcer (DU).
  • RP Raynaud's phenomena
  • DU digital ulcer
  • tissue fibrosis can cause end organ failure and lead to high morbidity and mortality in patients with end-stage SSc
  • formation of DU substantially reduce the quality of life of SSc patients, impairs hand function and leads to disability.
  • SSc Systemic Sclerosis
  • kinase inhibitors and anti-inflammatory drugs are under investigation as immunosuppressant and antifibrotic agents in SSc, but tolerability is limited in SSc patients (Khanna and Denton 2010 - Best. Pract. Res. Clin. Rheumatol. 24:387-400, Ong and Denton 2010 - Curr. Opin. Rheumatol. 22:264-272, Spiera 2011 - Ann. Rheum. Dis. Epub Mar 2011).
  • cyclic nucleotides cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP)
  • cAMP cyclic adenosine monophosphate
  • cGMP cyclic guanosine monophosphate
  • PDE5 inhibitors are the gold-standard for the treatment of erectile dysfunction (ED) but it was shown that PDE5 inhibitors could be useful for the treatment of symptomatic BPH which is characterized by Overactive Bladder (OAB) and Lower Urinary Tract Symptoms (LUTS) (Porst et al. 2008 - Curr. Urol. Rep. 9:295-301; .McVary et al. 2007 - J. Urol. 177: 1071-1077, J Urol. 177: 1401-1407, Kaplan and Gonzalez. 2007 - Rev. Urol. 9:73-77).
  • OAB Overactive Bladder
  • LUTS Lower Urinary Tract Symptoms
  • vasculopathies in SSc patients which lead e.g. to DU formation which are one of the most bothersome symptoms in SSc, could be also efficiently treated with sGC stimulators, sGC activators, alone and combinations with PDE5 inhibitors. Since these compounds can induce peripheral vasodilation it could be assumed that SSc driven vasculopathies might be reduced, preventing new formation of DU. However, it was unclear if SSc-driven DU could be also healed giving the antifibrotic mode of action of sGC stimulators/sGC activators alone and in combination with PDE5 inhibitors.
  • TSK mice have an attenuated wound healing compared to WT mice.
  • sGC stimulators or sGC activators i.e. compounds according to formulae (27) and (3) significantly and dose-dependently accelerated wound healing in the TSK mice.
  • Fibrotic disorders addressed by therapeutic agents of the invention which in particular and with substantial advantage can be treated by the above mentioned sGC stimulators or sGC activators alone or in combination with PDE5 inhibitors comprise but are not limited to Systemic Sclerosis (SSc), Systemic Sclerosis (SSc) concomitant fibrosis and fibrotic diseases.
  • SSc Systemic Sclerosis
  • SSc Systemic Sclerosis
  • Fibrotic disorders addressed by therapeutic agents of the invention which in particular and with substantial advantage can be treated by the above mentioned sGC stimulators or sGC activators alone or in combination with PDE5 inhibitors comprise but are not limited to Systemic Sclerosis (SSc) concomitant vasculopathies, to Raynaud's phenomena (RD) and the formation and healing of digital ulcers (DU)
  • SSc Systemic Sclerosis
  • RD Raynaud's phenomena
  • DU digital ulcers
  • SSc Systemic Sclerosis refers to but is not limited to diffuse Systemic Sclerosis (dSSc), limited Systemic Sclerosis (ISSc), overlap type of Systemic Sclerosis, undifferentiated type of Systemic Sclerosis, Systemic Sclerosis sine scleroderma, skin fibrosis, scleroderma, nephrogenic fibrosing dermopathy (NFD), nephrogenic systemic fibrosis (NSF), keloid formation.
  • SSc concomitant fibrosis refers to fibrosis of internal organs, comprising but not limited to the gut, the lung, the kidney and the blood vessels.
  • Fibrotic diseases comprises but are not limited to a condition in which collagen excess - independent of the etiology i.e. autoimmune disorders, chronic graft versus host disease, radiation therapy, intoxications, diabetes, surgery - lead to fibrosis of the skin, gut, liver, lung, heart, bladder, prostate, blood vessels or any other localized or generalized fibrotic condition in tissues.
  • fibrotic diseases comprises in particular the following terms: hepatic fibrosis, hepatic cirrhosis, pulmonary fibrosis, endomyocardial fibrosis, nephropathy, glomerulonephritis, interstitial renal fibrosis, fibrotic lesions as a consequence of diabetes, bone marrow fibrosis and similar fibrotic diseases, scleroderma, morphea, keloids, hypertrophic scars (including after surgery), naevi, diabetic retinopathy, proliferative vitreoretinopathy and connective tissue diseases (e.g. sarcoidosis
  • sarcoidosis e.g. sarcoidosis
  • SSc concomitant vasculopathies comprise but are not limited to vascular occlusive diseases vasculitis, micro and macroangiopathies, Raynaud's Phenomena, digital ischemic lesions, digital ulcer, digital necrotic lesions, gangrene anddigital loss.
  • sGC stimulators are nitric oxide (NO) independent and heam- dependent modulators of the soluble guanylate cyclase.
  • sGC activators are nitric oxide (NO) and heam- independent modulators of the soluble guanylate cyclase.
  • a preferred embodiment of the invention is the use of compounds according to compounds disclosed in WO03/097063, WO03/09545, WO04/009589, WO03/004503, WO02/070462, WO2007/045366, WO2007/045369, WO2007/045370, WO2007/045433, WO2007/045367, WO2007/124854, WO2007/128454, WO2008/031513, WO2008/061657, WO2008/119457, WO2008/119458, WO2009/127338, WO2010/079120, WO2010/102717, WO2011/051165, WO2011/147809, WO2011/141409, WO2014/012935, WO2012/059549, WO2012/004259, WO2012/004258, WO2012/059548, WO2012/028647, WO2012/152630, WO 2012/076466, WO2014/068099, WO2014/
  • a preferred embodiment of the invention is the use of compounds according to formulae (l)-(28) for the manufacture of a medicament for prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and scleroderma., as shown below:
  • a further embodiment of the invention is the use of the combination of stimulators and/or activators of the soluble guanylate cyclase with PDE5 inhibitors for the manufacture of a medicament for prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and scleroderma.
  • PDE 5 inhibitors are preferred for the combination with sGC stimulators and/or activators:
  • Tadalafil ((6R,12aR) -2,3,6,7,12,12a - Hexahydro - 2 - methyl - 6 - (3,4-methylene -dioxyphenyl) pyrazino( 1 ',2': 1,6) pyrido(3,4-b)indole- 1 ,4-dione), Vardenafil (2-(2-Ethoxy-5-(4-ethylpiperazin- 1 - yl-l-sulfonyl)phenyl)-5-methyl-7-propyl-3H-imidazo (5,1-f) (l,2,4)triazin-4-one), Sildenafil (3-[2- ethoxy-5-(4-methylpiperazin-l-yl)sulfonyl-phenyl]- 7- methy 1- 9- propy 1-2,4,7,8- tetrazabicyclo [4.3.0]nona -3,8,10-
  • vardenafil or sildenafil for the manufacture of a medicament for the prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and scleroderma.
  • the sGC stimulator such as compound according to formula (3) dose-dependently and significantly accelerated wound healing in the tsk-1 skin fibrosis model in mice.
  • the tsk-1 mouse model is characterized by substantial skin fibrosis reflecting a non-inflammatory driven, stable SSc phenotype.
  • the sGC stimulators such as compound according to formula (3) could become an efficacious treatment option for SSc-related vasculopathies, especially for prevention and healing of Digital Ulcer.
  • the compounds according to the invention can be used alone or in combination with other active substances if necessary.
  • the present invention further relates to medicinal products containing at least one of the compounds according to the invention and one or more further active substances, in particular for the treatment and/or prophylaxis of the aforementioned diseases.
  • suitable combination active substances we may mention for example and preferably:
  • organic nitrates and NO-donors for example sodium nitroprusside, nitroglycerin, isosorbide mononitrate, isosorbide dinitrate, molsidomine or SIN-1, and inhalational NO;
  • vasoactive drugs for examples prostanoids, such as iloprost, beraprost, cicaprost, epoprostenol, treprostinil;
  • vasoactive drugs for example Rho-kinase inhibitors such as fasudil;
  • vasoactive drugs for example endothelin receptor antagonists such as bosentan, darusentan, ambrisentan or sitaxsentan, macitentan;
  • active substances for lowering blood pressure for example and preferably from the group of calcium antagonists, such as nifedipine, amlodipine, verapamil or diltiazem;
  • ⁇ active substances for lowering blood pressure for example and preferably from the group of angiotensin All antagonists, ACE inhibitors, renin inhibitors, alpha-blockers, beta-blockers, mineralocorticoid receptor antagonists and diuretics; and/or
  • antithrombotic agents for example and preferably from the group of platelet aggregation inhibitors, anticoagulants, thrombin inhibitors or profibrinolytic substances; ⁇ active substances that alter fat metabolism, for example and preferably from the group of thyroid receptor agonists, cholesterol synthesis inhibitors such as for example and preferably HMG-CoA-reductase or squalene synthesis inhibitors, ACAT inhibitors, CETP inhibitors, MTP inhibitors, PPAR-alpha, PPAR-gamma and/or PPAR-delta agonists, cholesterol absorption inhibitors, lipase inhibitors, polymeric bile acid adsorbers, bile acid reabsorption inhibitors and lipoprotein(a) antagonists;
  • ⁇ active substances that alter fat metabolism for example and preferably from the group of thyroid receptor agonists, cholesterol synthesis inhibitors such as for example and preferably HMG-CoA-reductase or squalene synthesis inhibitors, ACAT inhibitors, CETP inhibitors
  • active substances that are used in fibrotic disorders for examples and preferable from the group of proteinkinase inhibitors such as sorafenib, regorafenib, imatinib, dasatinib, nilotinib nintedanib, bortezomib and/or pirfenidone; • active substances that alter inflammatory responses and/or supress immune responses, for example such as, cyclophosphamide, methotrexate, rapamycin, azathioproin, tocilizumab, infliximab, rituximab, adalimumab, belimumab, abatacept, SAR100842, thalidomide derivates;
  • active substances working on different pathways for example pirfenidone, SAR100842, thalidomide derivatives, integrin inhibitors.
  • Another preferred embodiment of the invention are compounds and/or combinations indicated above for use in the prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and/or scleroderma.
  • Another preferred embodiment of the invention is the use for the production of a medicament for prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and/or scleroderma comprising an effective amount of a compound and/or a combination as indicated above.
  • Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and/or scleroderma comprising an effective amount of a compound and/or a combination as indicated above.
  • Another preferred embodiment of the invention is the pharmaceutical formulation comprising at least one compound or one combination as indicated above for the use in the prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and/or scleroderma.
  • kits comprising at least one sGC stimulator and/or activator as indicated above or a combination as indicated above for the use in the prevention and healing of Digital Ulcers which are concomitant to fibrotic diseases, such as systemic sclerosis and/or scleroderma.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral e.g., intravenous, intradermal, subcutaneous' oral (e.g.' inhalation)' transdermal (topical) transmucosal and rectal administration.
  • Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a pharmaceutically acceptable polyol like glycerol, propylene glycol, liquid polyetheylene glycol, and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • a coating such as lecithin
  • surfactants Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as maitol sorbitol sodium chloride in the composition.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
  • compositions can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or conl starch; a lubricant such as magnesium stearate or sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or conl starch
  • a lubricant such as magnesium stearate or sterotes
  • a glidant such as colloidal silicon dioxide
  • a sweetening agent such as sucrose or sac
  • the compounds are delivered in the form of an aerosol spray from a pressurized container or dispenser which contains a suitable propellant, e.g.' a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g.' a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Bio degradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • the tight-skin (Tsk-1) mouse model of SSc was used to evaluate the effects of compound according to formula (27) and (3) (BAY 41-2272 and BAY 63-2521) on wound healing in mice with substantial skin fibrosis. Due to an autosomal dominant mutation namely a tandem duplication of the fibrillin- 1 gene, the phenotype of tsk-1 mice is characterized by an increased hypodermal thickness (Beyer et al. 2010).
  • Tsk-1 mice Genotyping of Tsk-1 mice was performed by PCR with the following primers: mutated fibrillin- 1/ tsk-1 forward primer: 5' - GTTGGCAACTATACCTGCAT - 3', reverse primer: 5' - CCTTTCCTGGTAACATAGGA - 3'.
  • mice were anaesthetized and carefully shaved 3 days before setting the wounds for exact quantification of the wound size.
  • WT mice and Tsk-1 mice received normal mice chow (placebo) which started on the day of shaving. Three days after shaving, mice were carefully anesthetized and round wounds were punched with 4 mm in diameter. 3 days after punching, mice were euthanized and the wound size was assessed.
  • Statistical analysis of data was done by one-way ANOVA followed by Tuckey's multiple comparison post-hoc analysis
  • Tsk- 1 mice Tsk-1 mice were anaesthetized and carefully shaved 3 days before setting the wounds for exact quantification of the wound size. In order to avoid influences on wound healing by daily handling of the animals, the bi-daily gavage treatment was replaced by drug administration in the food.
  • mice received either normal mice chow (placebo) or mice chow, containing 15 and 45 ppm of compound according to formula (27), (BAY 41-2272) or containing 5ppm, 15 ppm and 45 ppm of compound according to formula (3), (BAY 63-2521), respectively.
  • These dosages - as confirmed by an orientating DMPK-study - resulted in similar exposures as 1 and 3 mg kg of compound according to formula (27), (BAY 41-2272) BID and 0.3, 1 and 3 mg kg of compound according to formula (3), (BAY 63-2521) BID, respectively.
  • Treatment groups consist of at least 8 tsk-1 mice per group. Treatment started on the day of shaving to achieve steady state exposure.
  • Tsk-1 mice are an animal model with extensive skin fibrosis reflecting the conditions in SSc this data indicate that the aforementioned compounds could not only reduce fibrosis but also accelerate wound healing in SSc, implying that these compounds are useful for the treatment of DU in SSc patients.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2016/059734 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc) Ceased WO2016177660A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
KR1020177031942A KR20180002657A (ko) 2015-05-06 2016-05-02 전신 경화증 (SSc)에 수반되는 수족지 궤양 (DU)의 치료를 위한 sGC 자극제, sGC 활성화제 단독 및 PDE5 억제제와의 조합물의 용도
EP16719430.7A EP3291811B1 (en) 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
CA2984983A CA2984983A1 (en) 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
HK18103264.3A HK1243645A1 (zh) 2015-05-06 2016-05-02 单独和与pde5抑制剂组合的sgc刺激剂、sgc活化剂用於治疗伴随系统性硬化症(ssc)的指溃疡(du)的用途
BR112017023855-1A BR112017023855A2 (pt) 2015-05-06 2016-05-02 o uso de estimulantes de sgc, ativadores de scg, em separado e combinações com inibidores de pde5 para o tratamento de úlceras digitais (du) concomitantes à esclerose múltipla (ssc)
US15/571,105 US20180169095A1 (en) 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
CN201680026187.XA CN107580495A (zh) 2015-05-06 2016-05-02 单独和与PDE5抑制剂组合的sGC刺激剂、sGC活化剂用于治疗伴随系统性硬化症(SSc)的指溃疡(DU)的用途
MX2017014057A MX2017014057A (es) 2015-05-06 2016-05-02 El uso de estimuladores sgc, activadores gc, solos y combinaciones con inhibidores pde5 para el tratamiento de ulceras digitales (du) concomitante con esclerosis sistemica (ssc).
TNP/2017/000465A TN2017000465A1 (en) 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
AU2016258847A AU2016258847A1 (en) 2015-05-06 2016-05-02 The use of sGC stimulators, sGC activators, alone and combinations with PDE5 inhibitors for the treatment of Digital Ulcers (DU) concomitant to Systemic Sclerosis (SSc)
EA201792346A EA201792346A1 (ru) 2015-05-06 2016-05-02 ПРИМЕНЕНИЕ sGC СТИМУЛЯТОРОВ, sGC АКТИВАТОРОВ, ОТДЕЛЬНО И В КОМБИНАЦИЯХ С PDE5 ИНГИБИТОРАМИ, ДЛЯ ЛЕЧЕНИЯ ПАЛЬЦЕВИДНЫХ ЯЗВ (DU), СОПУТСТВУЮЩИХ СИСТЕМНОМУ СКЛЕРОЗУ (SSc)
JP2017557440A JP6748113B2 (ja) 2015-05-06 2016-05-02 全身性硬化症(SSc)に付随する指潰瘍(DU)を治療するための単独のまたはPDE5阻害剤と組み合わせたsGC刺激剤、sGC活性化剤の使用
IL255214A IL255214A0 (en) 2015-05-06 2017-10-23 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers accompanying systemic sclerosis
PH12017501980A PH12017501980A1 (en) 2015-05-06 2017-10-27 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
ZA2017/08248A ZA201708248B (en) 2015-05-06 2017-12-05 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15166516.3 2015-05-06
EP15166516 2015-05-06

Publications (1)

Publication Number Publication Date
WO2016177660A1 true WO2016177660A1 (en) 2016-11-10

Family

ID=53040455

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/059734 Ceased WO2016177660A1 (en) 2015-05-06 2016-05-02 The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)

Country Status (17)

Country Link
US (1) US20180169095A1 (https=)
EP (1) EP3291811B1 (https=)
JP (1) JP6748113B2 (https=)
KR (1) KR20180002657A (https=)
CN (1) CN107580495A (https=)
AU (1) AU2016258847A1 (https=)
BR (1) BR112017023855A2 (https=)
CA (1) CA2984983A1 (https=)
CL (1) CL2017002765A1 (https=)
EA (1) EA201792346A1 (https=)
HK (1) HK1243645A1 (https=)
IL (1) IL255214A0 (https=)
MX (1) MX2017014057A (https=)
PH (1) PH12017501980A1 (https=)
TN (1) TN2017000465A1 (https=)
WO (1) WO2016177660A1 (https=)
ZA (1) ZA201708248B (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180221385A1 (en) * 2015-07-28 2018-08-09 Societe De Commercialisation Des Produits De La Recherche Appliquee Socpra Sciences Sante Et A pharmaceutical preparation for improving absorption and postprandial hypoglycemic action of insulin
EP3574905A1 (en) 2018-05-30 2019-12-04 Adverio Pharma GmbH Method of identifying a subgroup of patients suffering from dcssc which benefits from a treatment with sgc stimulators and sgc activators in a higher degree than a control group
WO2022053651A2 (en) 2020-09-10 2022-03-17 Precirix N.V. Antibody fragment against fap
WO2023203135A1 (en) 2022-04-22 2023-10-26 Precirix N.V. Improved radiolabelled antibody
WO2023213801A1 (en) 2022-05-02 2023-11-09 Precirix N.V. Pre-targeting
WO2024097316A1 (en) * 2022-11-04 2024-05-10 Boehringer Ingelheim International Gmbh Soluble guanylate cyclase activators for treating systemic sclerosis

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020210707A1 (en) * 2019-04-10 2020-10-15 Mayo Foundation For Medical Education And Research Methods and materials for gender-dependent treatment of cardiovascular dysfunction

Citations (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998016507A2 (de) 1996-10-14 1998-04-23 Bayer Aktiengesellschaft Neue heterocyclylmethyl-substituierte pyrazolederivate und ihre verwendung in des behandlung von herz-kreislauf-erkrankungen
WO1998016223A1 (de) 1996-10-14 1998-04-23 Bayer Aktiengesellschaft Verwendung von 1-benzyl-3-(substituiertes-hetaryl)-kondensierten pyrazol-derivaten zur belandlung von speziellen erkrankungen des herz-kreislaufsystems und des zentralnervensystems
WO1998023619A1 (de) 1996-11-26 1998-06-04 Bayer Aktiengesellschaft Neue substituierte pyrazolderivate zur behandlung von herzkreislauferkrankungen
WO2000002851A1 (en) 1998-07-08 2000-01-20 Aventis Pharma Deutschland Gmbh Sulfur substituted sulfonylaminocarboxylic acid n-arylamides, their preparation, their use and pharmaceutical preparations comprising them
WO2000006569A1 (de) 1998-07-29 2000-02-10 Bayer Aktiengesellschaft Mit sechsgliedrigen heterocyclischen ringen kondensierte substituierte pyrazolderivate
WO2000006568A1 (de) 1998-07-29 2000-02-10 Bayer Aktiengesellschaft Substituierte pyrazolderivate
WO2001019778A1 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige dicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2001019776A2 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige dicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2001019780A2 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige aminodicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2002036120A1 (de) 2000-11-02 2002-05-10 Bayer Aktiengesellschaft Verwendung von stimulatoren der löslichen guanylatcyclase zur behandlung von osteoporose
WO2002042302A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue sulfonamid-substituierte pyrazolopyridinderivate
WO2002042299A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue lactam-substituierte pyrazolopyridinderivate
WO2002042300A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue carbamat-substituierte pyrazolopyridinderivate
WO2002042301A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue pyridin-substituierte pyrazolopyridinderivate
WO2002070510A2 (de) 2001-03-07 2002-09-12 Bayer Aktiengesellschaft Aminodicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2002070460A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Halogensubstituierte aminodicarbonsäurederivate als arzneimittel zur behandlung von herz-kreislauf-erkrankungen
WO2002070459A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Neuartige aminodicarbonsäurederivate
WO2002070462A1 (de) 2001-03-07 2002-09-12 Bayer Aktiengesellschaft Substituierte aminodicarbonsäurederivate
WO2002070461A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Seitenkettenhalogenierte aminodicarbonsäurederivate als arzneimittel zur behandlung von herz-kreislauf-erkrankungen
WO2002092596A1 (de) 2001-05-11 2002-11-21 Bayer Healthcare Ag Neue sulfonat-substituierte pyrazolopyridinderivate
WO2003004503A1 (de) 2001-07-04 2003-01-16 Bayer Healthcare Ag Morpholin-überbrückte pyrazolopyridinderivate
WO2003009545A2 (en) 2001-07-17 2003-01-30 Intel Corporation (A Delaware Corporation) Fabric bus architeture
WO2003095451A1 (de) 2002-05-08 2003-11-20 Bayer Healthcare Ag Carbamat-substituierte pyrazolopyridine
WO2003097063A1 (de) 2002-05-17 2003-11-27 Bayer Healthcare Ag Derivate-des 2- (1-benzyl-1h-pyrazolo (3, 4-b) pyridin-3-yl) -5-(4-pyridinyl) -4-pyrimidinamins und ihre verwendung als guanylatcyclase-stimulatoren
WO2004009589A1 (de) 2002-07-18 2004-01-29 Bayer Healthcare Ag Neue 2,5-disubstituierte pyrimidinderivate
WO2007045433A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Dicarbonsäure-derivate und ihre verwendung
WO2007045366A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Heterocyclische verbindungen mit carboxyl-isosteren gruppen und ihre verwendung zur behandlung von herz-kreislauf-erkrankungen
WO2007045369A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Difluorphenol-derivate und ihre verwendung
WO2007045367A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Cyclopropylessigsäure-derivate und ihre verwendung
WO2007045370A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Tetrazol-dξrivate und ihre verwendung zur behandlung von herz-kreislauf-erkrankungen
WO2007124854A1 (de) 2006-04-27 2007-11-08 Bayer Healthcare Ag Heterocyclisch substituierte, anellierte pyrazol-derivate und ihre verwendung
WO2007128454A1 (de) 2006-05-09 2007-11-15 Bayer Healthcare Ag 3-tetrazolylindazole und 3-tetrazolylpyrazolopyridine sowie ihre verwendung
WO2008031513A1 (de) 2006-09-15 2008-03-20 Bayer Schering Pharma Aktiengesellschaft Pyrazolopyridin, indazol, imidazopyridin, imidazopyrimidin, pyrazolopyrazin und pyrazolopyridin derivate als stimulatoren der guanylatcyclase zur herz-kreislauferkrankungen
WO2008061657A1 (de) 2006-11-21 2008-05-29 Bayer Schering Pharma Aktiengesellschaft Neue aza-bicyclische verbindungen und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2008119457A2 (de) 2007-03-29 2008-10-09 Bayer Schering Pharma Aktiengesellschaft Lactam-substituierte dicarbonsäuren und ihre verwendung
WO2008119458A1 (de) 2007-03-29 2008-10-09 Bayer Schering Pharma Aktiengesellschaft Substituierte dibenzoesäure-derivate und ihre verwendung
WO2009032249A1 (en) 2007-09-06 2009-03-12 Merck & Co., Inc. Soluble guanylate cyclase activators
WO2009068652A1 (en) 2007-11-30 2009-06-04 Smithkline Beecham Corporation 2, 6-disubstituted pyridines and 2, 4-disubstituted pyrimidines as soluble guanylate cyclase activators
WO2009071504A1 (en) 2007-12-03 2009-06-11 Smithkline Beecham Corporation 2,6-disubstituted pyridines as soluble guanylate cyclase activators
US20090215769A1 (en) * 2005-07-16 2009-08-27 Bayer Healthcare Ag Use of soluble guanylate cyclase activators for the treatment of Raynaud's Phenomenon
US20090221573A1 (en) * 2005-07-06 2009-09-03 Bayer Healthcare Ag Use of Activators of Soluble Guanylate Cyclase for Promoting Wound Healing
WO2009123316A1 (ja) 2008-04-04 2009-10-08 武田薬品工業株式会社 複素環誘導体及びその用途
WO2009127338A1 (de) 2008-04-14 2009-10-22 Bayer Schering Pharma Aktiengesellschaft Oxo-heterocyclisch substituierte carbonsäure-derivate und ihre verwendung
WO2010065275A1 (en) 2008-11-25 2010-06-10 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2010079120A1 (de) 2009-01-09 2010-07-15 Bayer Schering Pharma Aktiengesellschaft Benzimidazol-und pyrazolopyridin-derivate zur behandlung und/oder prävention von herz-kreislauf-erkrankungen
WO2010102717A1 (de) 2009-03-09 2010-09-16 Bayer Schering Pharma Aktiengesellschaft Oxo-heterocyclisch substituierte alkylcarbonsäuren und ihre verwendung
WO2011051165A1 (de) 2009-10-28 2011-05-05 Bayer Schering Pharma Aktiengesellschaft Substituierte 3-phenylpropionsäuren und ihre verwendung
WO2011115804A1 (en) 2010-03-17 2011-09-22 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2011119518A1 (en) 2010-03-25 2011-09-29 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2011141409A1 (de) 2010-05-14 2011-11-17 Bayer Pharma Aktiengesellschaft Substituierte 8-alkoxy-2-aminotetralin-derivate und ihre verwendung
WO2011147809A1 (de) 2010-05-26 2011-12-01 Bayer Pharma Aktiengesellschaft Substituierte 5-fluor-1h-pyrazolopyridine und ihre verwendung
WO2011149921A1 (en) 2010-05-27 2011-12-01 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2011147810A1 (en) 2010-05-26 2011-12-01 Bayer Pharma Aktiengesellschaft THE USE OF sGC STIMULATORS, sGC ACTIVATORS, ALONE AND COMBINATIONS WITH PDE5 INHIBITORS FOR THE TREATMENT OF SYSTEMIC SCLEROSIS (SSc).
WO2012003405A1 (en) 2010-06-30 2012-01-05 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2012004258A1 (de) 2010-07-09 2012-01-12 Bayer Pharma Aktiengesellschaft Annellierte pyrimidine und triazine und ihre verwendung zur behandlung bzw. prophylaxe von herz-kreislauf-erkrankungen
WO2012004259A1 (de) 2010-07-09 2012-01-12 Bayer Pharma Aktiengesellschaft Annellierte 4 -aminopyrimidine und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2012028647A1 (de) 2010-09-03 2012-03-08 Bayer Pharma Aktiengesellschaft Bicyclische aza-heterocyclen und ihre verwendung
WO2012059548A1 (de) 2010-11-04 2012-05-10 Bayer Pharma Aktiengesellschaft Benzyl-substituierte carbamate und ihre verwendung
WO2012059549A1 (de) 2010-11-04 2012-05-10 Bayer Pharma Aktiengesellschaft Substituierte 6-fluor-1h-pyrazolo[4,3-b]pyridine und ihre verwendung
WO2012064559A1 (en) 2010-11-09 2012-05-18 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2012076466A2 (de) 2010-12-07 2012-06-14 Bayer Pharma Aktiengesellschaft Substituierte 1-benzylcycloalkylcarbonsäuren und ihre verwendung
WO2012139888A1 (de) 2011-04-13 2012-10-18 Bayer Intellectual Property Gmbh Verzweigte 3-phenylpropionsäure-derivate und ihre verwendung
WO2012143510A1 (de) 2011-04-21 2012-10-26 Bayer Intellectual Property Gmbh Fluoralkyl-substituierte pyrazolopyridine und ihre verwendung
WO2012152630A1 (de) 2011-05-06 2012-11-15 Bayer Intellectual Property Gmbh Substituierte imidazopyridazine und ihre verwendung
WO2012152629A1 (de) 2011-05-06 2012-11-15 Bayer Intellectual Property Gmbh Substituierte imidazopyridine und imidazopyridazine und ihre verwendung
WO2012165399A1 (ja) 2011-05-30 2012-12-06 アステラス製薬株式会社 イミダゾピリジン化合物
WO2013004785A1 (de) 2011-07-06 2013-01-10 Bayer Intellectual Property Gmbh Heteroaryl-substituierte pyrazolopyridine und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2013030288A1 (de) 2011-09-02 2013-03-07 Bayer Intellectual Property Gmbh Substituierte annellierte pyrimidine und ihre verwendung
WO2013104597A1 (de) 2012-01-11 2013-07-18 Bayer Intellectual Property Gmbh Substituierte triazine derivate und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2013104598A2 (de) 2012-01-11 2013-07-18 Bayer Intellectual Property Gmbh Substituierte, annellierte imidazole und pyrazole und ihre verwendung
WO2013104703A1 (de) 2012-01-11 2013-07-18 Bayer Pharma Aktiengesellschaft Substituierte annellierte pyrimidine und triazine und ihre verwendung
WO2013131923A1 (de) 2012-03-06 2013-09-12 Bayer Intellectual Property Gmbh Substituierte azabicyclen und ihre verwendung
WO2013174736A1 (de) 2012-05-22 2013-11-28 Bayer Pharma Aktiengesellschaft N- [3- (2 -carboxyethyl) phenyl] - piperidin- 1 - ylacetamid - derivate und ihre verwendung als aktivatoren der löslichen guanylatcyclase
WO2014012934A1 (de) 2012-07-20 2014-01-23 Bayer Pharma Aktiengesellschaft Neue 5-aminotetrahydrochinolin-2-carbonsäuren und ihre verwendung
WO2014012935A1 (de) 2012-07-20 2014-01-23 Bayer Pharma Aktiengesellschaft Substituierte aminoindan- und aminotetralin-carbonsäuren und ihre verwendung
WO2014047111A1 (en) 2012-09-18 2014-03-27 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2014047325A1 (en) 2012-09-19 2014-03-27 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2014068104A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Hydroxy-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2014068095A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Carboxy-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2014068099A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Amino-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung
WO2014084312A1 (ja) 2012-11-30 2014-06-05 アステラス製薬株式会社 イミダゾピリジン化合物
WO2014128109A1 (en) 2013-02-21 2014-08-28 Bayer Pharma Aktiengesellschaft Forms of methyl {4,6-diamino-2-[1-(2-fluorobenzyl)-1h-pyrazolo[3,4-b]pyridino-3-yl]pyrimidino-5-yl}methyl carbamate
WO2014131760A1 (de) 2013-03-01 2014-09-04 Bayer Pharma Aktiengesellschaft Trifluormethyl-substituierte annellierte pyrimidine und ihre verwendung
WO2014131741A1 (de) 2013-03-01 2014-09-04 Bayer Pharma Aktiengesellschaft Benzyl-substituierte pyrazolopyridine und ihre verwendung
WO2014195333A1 (de) 2013-06-04 2014-12-11 Bayer Pharma Aktiengesellschaft 3-aryl-substituierte imidazo[1,2-a]pyridine und ihre verwendung
WO2015004105A1 (de) 2013-07-10 2015-01-15 Bayer Pharma Aktiengesellschaft Benzyl-1h-pyrazolo[3,4-b]pyridine und ihre verwendung
WO2015018814A1 (de) 2013-08-08 2015-02-12 Bayer Pharma Aktiengesellschaft Substituierte pyrazolo[1,5-a]pyridin-3-carboxamide und ihre verwendung
WO2015018808A1 (de) 2013-08-08 2015-02-12 Bayer Pharma Aktiengesellschaft Substituierte imidazo[1,2-a]pyrazincarboxamide und ihre verwendung

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2010330813B2 (en) * 2009-12-18 2016-04-28 Exodos Life Sciences Limited Partnership Methods and compositions for treating peripheral vascular disease

Patent Citations (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998016507A2 (de) 1996-10-14 1998-04-23 Bayer Aktiengesellschaft Neue heterocyclylmethyl-substituierte pyrazolederivate und ihre verwendung in des behandlung von herz-kreislauf-erkrankungen
WO1998016223A1 (de) 1996-10-14 1998-04-23 Bayer Aktiengesellschaft Verwendung von 1-benzyl-3-(substituiertes-hetaryl)-kondensierten pyrazol-derivaten zur belandlung von speziellen erkrankungen des herz-kreislaufsystems und des zentralnervensystems
WO1998023619A1 (de) 1996-11-26 1998-06-04 Bayer Aktiengesellschaft Neue substituierte pyrazolderivate zur behandlung von herzkreislauferkrankungen
WO2000002851A1 (en) 1998-07-08 2000-01-20 Aventis Pharma Deutschland Gmbh Sulfur substituted sulfonylaminocarboxylic acid n-arylamides, their preparation, their use and pharmaceutical preparations comprising them
WO2000006569A1 (de) 1998-07-29 2000-02-10 Bayer Aktiengesellschaft Mit sechsgliedrigen heterocyclischen ringen kondensierte substituierte pyrazolderivate
WO2000006568A1 (de) 1998-07-29 2000-02-10 Bayer Aktiengesellschaft Substituierte pyrazolderivate
WO2001019778A1 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige dicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2001019776A2 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige dicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2001019780A2 (de) 1999-09-13 2001-03-22 Bayer Aktiengesellschaft Neuartige aminodicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2002036120A1 (de) 2000-11-02 2002-05-10 Bayer Aktiengesellschaft Verwendung von stimulatoren der löslichen guanylatcyclase zur behandlung von osteoporose
WO2002042302A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue sulfonamid-substituierte pyrazolopyridinderivate
WO2002042299A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue lactam-substituierte pyrazolopyridinderivate
WO2002042300A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue carbamat-substituierte pyrazolopyridinderivate
WO2002042301A1 (de) 2000-11-22 2002-05-30 Bayer Aktiengesellschaft Neue pyridin-substituierte pyrazolopyridinderivate
WO2002070460A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Halogensubstituierte aminodicarbonsäurederivate als arzneimittel zur behandlung von herz-kreislauf-erkrankungen
WO2002070459A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Neuartige aminodicarbonsäurederivate
WO2002070461A1 (de) 2001-03-01 2002-09-12 Bayer Aktiengesellschaft Seitenkettenhalogenierte aminodicarbonsäurederivate als arzneimittel zur behandlung von herz-kreislauf-erkrankungen
WO2002070510A2 (de) 2001-03-07 2002-09-12 Bayer Aktiengesellschaft Aminodicarbonsäurederivate mit pharmazeutischen eigenschaften
WO2002070462A1 (de) 2001-03-07 2002-09-12 Bayer Aktiengesellschaft Substituierte aminodicarbonsäurederivate
WO2002092596A1 (de) 2001-05-11 2002-11-21 Bayer Healthcare Ag Neue sulfonat-substituierte pyrazolopyridinderivate
WO2003004503A1 (de) 2001-07-04 2003-01-16 Bayer Healthcare Ag Morpholin-überbrückte pyrazolopyridinderivate
WO2003009545A2 (en) 2001-07-17 2003-01-30 Intel Corporation (A Delaware Corporation) Fabric bus architeture
WO2003095451A1 (de) 2002-05-08 2003-11-20 Bayer Healthcare Ag Carbamat-substituierte pyrazolopyridine
WO2003097063A1 (de) 2002-05-17 2003-11-27 Bayer Healthcare Ag Derivate-des 2- (1-benzyl-1h-pyrazolo (3, 4-b) pyridin-3-yl) -5-(4-pyridinyl) -4-pyrimidinamins und ihre verwendung als guanylatcyclase-stimulatoren
WO2004009589A1 (de) 2002-07-18 2004-01-29 Bayer Healthcare Ag Neue 2,5-disubstituierte pyrimidinderivate
US20090221573A1 (en) * 2005-07-06 2009-09-03 Bayer Healthcare Ag Use of Activators of Soluble Guanylate Cyclase for Promoting Wound Healing
US20090215769A1 (en) * 2005-07-16 2009-08-27 Bayer Healthcare Ag Use of soluble guanylate cyclase activators for the treatment of Raynaud's Phenomenon
WO2007045433A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Dicarbonsäure-derivate und ihre verwendung
WO2007045366A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Heterocyclische verbindungen mit carboxyl-isosteren gruppen und ihre verwendung zur behandlung von herz-kreislauf-erkrankungen
WO2007045369A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Difluorphenol-derivate und ihre verwendung
WO2007045367A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Cyclopropylessigsäure-derivate und ihre verwendung
WO2007045370A1 (de) 2005-10-21 2007-04-26 Bayer Healthcare Ag Tetrazol-dξrivate und ihre verwendung zur behandlung von herz-kreislauf-erkrankungen
WO2007124854A1 (de) 2006-04-27 2007-11-08 Bayer Healthcare Ag Heterocyclisch substituierte, anellierte pyrazol-derivate und ihre verwendung
WO2007128454A1 (de) 2006-05-09 2007-11-15 Bayer Healthcare Ag 3-tetrazolylindazole und 3-tetrazolylpyrazolopyridine sowie ihre verwendung
WO2008031513A1 (de) 2006-09-15 2008-03-20 Bayer Schering Pharma Aktiengesellschaft Pyrazolopyridin, indazol, imidazopyridin, imidazopyrimidin, pyrazolopyrazin und pyrazolopyridin derivate als stimulatoren der guanylatcyclase zur herz-kreislauferkrankungen
WO2008061657A1 (de) 2006-11-21 2008-05-29 Bayer Schering Pharma Aktiengesellschaft Neue aza-bicyclische verbindungen und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2008119457A2 (de) 2007-03-29 2008-10-09 Bayer Schering Pharma Aktiengesellschaft Lactam-substituierte dicarbonsäuren und ihre verwendung
WO2008119458A1 (de) 2007-03-29 2008-10-09 Bayer Schering Pharma Aktiengesellschaft Substituierte dibenzoesäure-derivate und ihre verwendung
WO2009032249A1 (en) 2007-09-06 2009-03-12 Merck & Co., Inc. Soluble guanylate cyclase activators
WO2009068652A1 (en) 2007-11-30 2009-06-04 Smithkline Beecham Corporation 2, 6-disubstituted pyridines and 2, 4-disubstituted pyrimidines as soluble guanylate cyclase activators
WO2009071504A1 (en) 2007-12-03 2009-06-11 Smithkline Beecham Corporation 2,6-disubstituted pyridines as soluble guanylate cyclase activators
WO2009123316A1 (ja) 2008-04-04 2009-10-08 武田薬品工業株式会社 複素環誘導体及びその用途
WO2009127338A1 (de) 2008-04-14 2009-10-22 Bayer Schering Pharma Aktiengesellschaft Oxo-heterocyclisch substituierte carbonsäure-derivate und ihre verwendung
WO2010065275A1 (en) 2008-11-25 2010-06-10 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2010079120A1 (de) 2009-01-09 2010-07-15 Bayer Schering Pharma Aktiengesellschaft Benzimidazol-und pyrazolopyridin-derivate zur behandlung und/oder prävention von herz-kreislauf-erkrankungen
WO2010102717A1 (de) 2009-03-09 2010-09-16 Bayer Schering Pharma Aktiengesellschaft Oxo-heterocyclisch substituierte alkylcarbonsäuren und ihre verwendung
WO2011051165A1 (de) 2009-10-28 2011-05-05 Bayer Schering Pharma Aktiengesellschaft Substituierte 3-phenylpropionsäuren und ihre verwendung
WO2011115804A1 (en) 2010-03-17 2011-09-22 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2011119518A1 (en) 2010-03-25 2011-09-29 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2011141409A1 (de) 2010-05-14 2011-11-17 Bayer Pharma Aktiengesellschaft Substituierte 8-alkoxy-2-aminotetralin-derivate und ihre verwendung
WO2011147809A1 (de) 2010-05-26 2011-12-01 Bayer Pharma Aktiengesellschaft Substituierte 5-fluor-1h-pyrazolopyridine und ihre verwendung
WO2011147810A1 (en) 2010-05-26 2011-12-01 Bayer Pharma Aktiengesellschaft THE USE OF sGC STIMULATORS, sGC ACTIVATORS, ALONE AND COMBINATIONS WITH PDE5 INHIBITORS FOR THE TREATMENT OF SYSTEMIC SCLEROSIS (SSc).
WO2011149921A1 (en) 2010-05-27 2011-12-01 Merck Sharp & Dohme Corp. Soluble guanylate cyclase activators
WO2012003405A1 (en) 2010-06-30 2012-01-05 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2012004258A1 (de) 2010-07-09 2012-01-12 Bayer Pharma Aktiengesellschaft Annellierte pyrimidine und triazine und ihre verwendung zur behandlung bzw. prophylaxe von herz-kreislauf-erkrankungen
WO2012004259A1 (de) 2010-07-09 2012-01-12 Bayer Pharma Aktiengesellschaft Annellierte 4 -aminopyrimidine und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2012028647A1 (de) 2010-09-03 2012-03-08 Bayer Pharma Aktiengesellschaft Bicyclische aza-heterocyclen und ihre verwendung
WO2012059548A1 (de) 2010-11-04 2012-05-10 Bayer Pharma Aktiengesellschaft Benzyl-substituierte carbamate und ihre verwendung
WO2012059549A1 (de) 2010-11-04 2012-05-10 Bayer Pharma Aktiengesellschaft Substituierte 6-fluor-1h-pyrazolo[4,3-b]pyridine und ihre verwendung
WO2012064559A1 (en) 2010-11-09 2012-05-18 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2012076466A2 (de) 2010-12-07 2012-06-14 Bayer Pharma Aktiengesellschaft Substituierte 1-benzylcycloalkylcarbonsäuren und ihre verwendung
WO2012139888A1 (de) 2011-04-13 2012-10-18 Bayer Intellectual Property Gmbh Verzweigte 3-phenylpropionsäure-derivate und ihre verwendung
WO2012143510A1 (de) 2011-04-21 2012-10-26 Bayer Intellectual Property Gmbh Fluoralkyl-substituierte pyrazolopyridine und ihre verwendung
WO2012152630A1 (de) 2011-05-06 2012-11-15 Bayer Intellectual Property Gmbh Substituierte imidazopyridazine und ihre verwendung
WO2012152629A1 (de) 2011-05-06 2012-11-15 Bayer Intellectual Property Gmbh Substituierte imidazopyridine und imidazopyridazine und ihre verwendung
WO2012165399A1 (ja) 2011-05-30 2012-12-06 アステラス製薬株式会社 イミダゾピリジン化合物
WO2013004785A1 (de) 2011-07-06 2013-01-10 Bayer Intellectual Property Gmbh Heteroaryl-substituierte pyrazolopyridine und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2013030288A1 (de) 2011-09-02 2013-03-07 Bayer Intellectual Property Gmbh Substituierte annellierte pyrimidine und ihre verwendung
WO2013104597A1 (de) 2012-01-11 2013-07-18 Bayer Intellectual Property Gmbh Substituierte triazine derivate und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2013104598A2 (de) 2012-01-11 2013-07-18 Bayer Intellectual Property Gmbh Substituierte, annellierte imidazole und pyrazole und ihre verwendung
WO2013104703A1 (de) 2012-01-11 2013-07-18 Bayer Pharma Aktiengesellschaft Substituierte annellierte pyrimidine und triazine und ihre verwendung
WO2013131923A1 (de) 2012-03-06 2013-09-12 Bayer Intellectual Property Gmbh Substituierte azabicyclen und ihre verwendung
WO2013174736A1 (de) 2012-05-22 2013-11-28 Bayer Pharma Aktiengesellschaft N- [3- (2 -carboxyethyl) phenyl] - piperidin- 1 - ylacetamid - derivate und ihre verwendung als aktivatoren der löslichen guanylatcyclase
WO2014012934A1 (de) 2012-07-20 2014-01-23 Bayer Pharma Aktiengesellschaft Neue 5-aminotetrahydrochinolin-2-carbonsäuren und ihre verwendung
WO2014012935A1 (de) 2012-07-20 2014-01-23 Bayer Pharma Aktiengesellschaft Substituierte aminoindan- und aminotetralin-carbonsäuren und ihre verwendung
WO2014047111A1 (en) 2012-09-18 2014-03-27 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2014047325A1 (en) 2012-09-19 2014-03-27 Ironwood Pharmaceuticals, Inc. Sgc stimulators
WO2014068104A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Hydroxy-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2014068095A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Carboxy-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung als stimulatoren der löslichen guanylatcyclase
WO2014068099A1 (de) 2012-11-05 2014-05-08 Bayer Pharma Aktiengesellschaft Amino-substituierte imidazo[1,2-a]pyridincarboxamide und ihre verwendung
WO2014084312A1 (ja) 2012-11-30 2014-06-05 アステラス製薬株式会社 イミダゾピリジン化合物
WO2014128109A1 (en) 2013-02-21 2014-08-28 Bayer Pharma Aktiengesellschaft Forms of methyl {4,6-diamino-2-[1-(2-fluorobenzyl)-1h-pyrazolo[3,4-b]pyridino-3-yl]pyrimidino-5-yl}methyl carbamate
WO2014131760A1 (de) 2013-03-01 2014-09-04 Bayer Pharma Aktiengesellschaft Trifluormethyl-substituierte annellierte pyrimidine und ihre verwendung
WO2014131741A1 (de) 2013-03-01 2014-09-04 Bayer Pharma Aktiengesellschaft Benzyl-substituierte pyrazolopyridine und ihre verwendung
WO2014195333A1 (de) 2013-06-04 2014-12-11 Bayer Pharma Aktiengesellschaft 3-aryl-substituierte imidazo[1,2-a]pyridine und ihre verwendung
WO2015004105A1 (de) 2013-07-10 2015-01-15 Bayer Pharma Aktiengesellschaft Benzyl-1h-pyrazolo[3,4-b]pyridine und ihre verwendung
WO2015018814A1 (de) 2013-08-08 2015-02-12 Bayer Pharma Aktiengesellschaft Substituierte pyrazolo[1,5-a]pyridin-3-carboxamide und ihre verwendung
WO2015018808A1 (de) 2013-08-08 2015-02-12 Bayer Pharma Aktiengesellschaft Substituierte imidazo[1,2-a]pyrazincarboxamide und ihre verwendung

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Bayer to Evaluate sGC Stimulator Riociguat in Patients With Diffuse Cutaneous Systemic Sclerosis - News Release", 13 November 2014 (2014-11-13), XP002759127, Retrieved from the Internet <URL:http://www.epresspack.net/bayer-riociguat/bayer-to-evaluate-sgc-stimulator-riociguat-in-patients-with-diffuse-cutaneous-systemic-sclerosis/> [retrieved on 20160622] *
ANONYMOUS: "Digital ulcers: sildenafil", 24 March 2015 (2015-03-24), XP002759128, Retrieved from the Internet <URL:https://www.nice.org.uk/guidance/esuom42/resources/digital-ulcers-sildenafil-54116459119149253> [retrieved on 20160622] *
BEYER C; SCHETT G; DISTLER O; DISTLER JH: "Animal models of systemic sclerosis: prospects and limitations", ARTHRITIS RHEUM., vol. 62, no. 10, 2010, pages 2831 - 44
BEYER CHRISTIAN ET AL: "Stimulation of soluble guanylate cyclase reduces experimental dermal fibrosis", ANNALS OF THE RHEUMATIC DISEASES, BRITISH MEDICAL ASSOCIATION, LONDON, GB, vol. 71, no. 6, 1 June 2012 (2012-06-01), pages 1019 - 1026, XP009167097, ISSN: 0003-4967 *
DEES CLARA ET AL: "Stimulators of soluble guanylate cyclase (sGC) inhibit experimental skin fibrosis of different aetiologies", ANNALS OF THE RHEUMATIC DISEASES, BRITISH MEDICAL ASSOCIATION, LONDON, GB, vol. 74, no. 8, 1 January 2015 (2015-01-01), pages 1621 - 1625, XP008180685, ISSN: 0003-4967 *
EVGENOV ET AL., NAT. REV. DRUG. DISCOV., vol. 5, no. 9, 2006, pages 755 - 768
EVGENOV OV; PACHER P; SCHMIDT PM ET AL.: "NO-independent stimulators and activators of soluble guanylate cyclase: discovery and therapeutic potential", NAT. REV. DRUG. DISCOV, vol. 5, no. 9, 2006, pages 755 - 68
FERRINI ET AL., B. J. UROL, vol. 97, 2006, pages 625 - 633
FERRINI MG; KOVANECZ I; NOLAZCO G: "Effects of long-term vardenafil treatment on the development of fibrotic plaques in a rat model of Peyronie's disease", B. J. U., vol. 97, 2006, pages 625 - 633
HARRIS ED ET AL.: "Kelley's Textbook of Rhematology 7th edition.", 2005, ELSEVIER SAUNDERS
HARRIS ET AL.: "Kelley's Textbook of Rhematology 7th edition.", 2005, ELSEVIER SAUNDERS
J UROL., vol. 177, pages 1401 - 1407
KAPLAN SA; GONZALEZ RR: "Phosphodiesterase type 5 inhibitors for the treatment of male lower urinary tract symptoms", REV. UROL., vol. 9, no. 2, 2007, pages 73 - 77
KAPLAN; GONZALEZ, REV. UROL., vol. 9, 2007, pages 73 - 77
KHANNA D; DENTON CP: "Evidence-based management of rapidly progressing systemic sclerosis", BEST. PRACT. RES. CLIN. RHEUMATOL., vol. 24, 2010, pages 387 - 400
KHANNA; DENTON, BEST. PRACT. RES. CLIN. RHEUMATOL., vol. 24, 2010, pages 387 - 400
KNORR A; HIRTH-DIETRICH C; ALONSO-ALIJA C ET AL.: "Nitric oxide-independent activation of soluble guanylate cyclase by BAY 60-2770 in experimental liver fibrosis", ARZNEIMITTELFORSCHUNG, vol. 58, 2008, pages 71 - 80
KNORR ET AL., ARZNEIMITTELFORSCHUNG, vol. 58, 2008, pages 71 - 80
M. OLLÉ: "The European League Against Rheumatism (EULAR) - 16th Annual European Congress (June 10-13, 2015 - Rome, Italy).", DRUGS OF TODAY, vol. 51, no. 6, June 2015 (2015-06-01) - June 2015 (2015-06-01), pages 387 - 392, XP002759130, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/26261853> [retrieved on 20160622] *
MCVARY ET AL., J. UROL., vol. 177, 2007, pages 1071 - 1077
MCVARY KT; ROEHRBORN CG; KAMINETSKY JC; AUERBACH SM; WACHS B; YOUNG JM; ESLER A; SIDES GD; DENES BS: "Tadalafil relieves lower urinary tract symptoms secondary to benign prostatic hyperplasia", J UROL., vol. 177, 2007, pages 1401 - 1407
MVARY K K; T. MCVARY; W. MONNIG; J. L. CAMPS, JR.; J. M. YOUNG; L. J. TSENG; G. VAN DEN ENDE: "Sildenafil citrate improves erectile function and ur inary symptoms in men with erectile dysfunction and lower urinary tract symptoms associated with benign prostatic hyperplasia: a randomized, double-blind trial", J. UROL., vol. 177, 2007, pages 1071 - 1077
ONG VH; DENTON CP: "Innovative therapies for systemic sclerosis", CURR. OPIN. RHEUMATOL., vol. 22, 2010, pages 264 - 272
ONG; DENTON, CURR. OPIN. RHEUMATOL., vol. 22, 2010, pages 264 - 272
PORST ET AL., CURR. UROL. REP., vol. 9, 2008, pages 295 - 301
PORST H; SANDNER P; ULBRICH E.: "Vardenafil in the treatment of lower urinary tract symptoms secondary to benign prostatic hyperplasia", CURR. UROL. REP., vol. 9, 2008, pages 295 - 301
S. KOTZKI ET AL: "Anodal Iontophoresis of a Soluble Guanylate Cyclase Stimulator Induces a Sustained Increase in Skin Blood Flow in Rats", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 346, no. 3, 9 July 2013 (2013-07-09), pages 424 - 431, XP055282639, DOI: 10.1124/jpet.113.205484 *
SANDNER ET AL.: "Handbook Exper. Pharmacol.", vol. 191, 2009, pages: 507 - 531
SANDNER P; NEUSER D; BISCHOFF E: "Handb. Exp. Pharmacol.", vol. 191, 2009, article "Erectile dysfunction and lower urinary tract", pages: 507 - 531
SANDNER PETER ET AL: "Stimulators of Soluble Guanylate Cyclase (sGC) Improve Wound Healing in the Tsk-1 Mouse Skin Fibrosis Mode", ARTHRITIS & RHEUMATOLOGY, vol. 67, no. Suppl. 10, ABS.1906, October 2015 (2015-10-01), & ANNUAL MEETING OF THE AMERICAN-COLLEGE-OF-RHEUMATOLOGY (ACR) AND ASSOCIATION-OF-RHEUMATOLOGY-HEALTH-; SAN FRANCISCO, CA, USA; NOVEMBER 06 -11, 2015, XP002759129 *
SPIERA R; GORDON J; MERSTEN J; MAGRO C; MEHTA M; WILDMANN H; KLOIBER S; KIROU K; LYMAN S; CROW M: "Imatinib mesylate (Gleevec) in the treatment of diffuse cutaneous systemic sclerosis: results of a lyear, phse Ila, single-arm open-label clinical trial", ANN. RHEUM. DIS., 11 March 2011 (2011-03-11)
SPIERA, ANN. RHEUM. DIS, March 2011 (2011-03-01)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180221385A1 (en) * 2015-07-28 2018-08-09 Societe De Commercialisation Des Produits De La Recherche Appliquee Socpra Sciences Sante Et A pharmaceutical preparation for improving absorption and postprandial hypoglycemic action of insulin
US12329762B2 (en) 2015-07-28 2025-06-17 Eli Lilly And Company Pharmaceutical preparation for improving absorption and postprandial hypoglycemic action of insulin
EP3574905A1 (en) 2018-05-30 2019-12-04 Adverio Pharma GmbH Method of identifying a subgroup of patients suffering from dcssc which benefits from a treatment with sgc stimulators and sgc activators in a higher degree than a control group
US11508483B2 (en) 2018-05-30 2022-11-22 Adverio Pharma Gmbh Method of identifying a subgroup of patients suffering from dcSSc which benefits from a treatment with sGC stimulators and sGC activators in a higher degree than a control group
WO2022053651A2 (en) 2020-09-10 2022-03-17 Precirix N.V. Antibody fragment against fap
WO2023203135A1 (en) 2022-04-22 2023-10-26 Precirix N.V. Improved radiolabelled antibody
WO2023213801A1 (en) 2022-05-02 2023-11-09 Precirix N.V. Pre-targeting
WO2024097316A1 (en) * 2022-11-04 2024-05-10 Boehringer Ingelheim International Gmbh Soluble guanylate cyclase activators for treating systemic sclerosis
US12600715B2 (en) 2022-11-04 2026-04-14 Boehringer Ingelheim International Gmbh Soluble guanylate cyclate activators for treating systemic sclerosis

Also Published As

Publication number Publication date
MX2017014057A (es) 2018-04-10
PH12017501980A1 (en) 2018-03-19
EP3291811B1 (en) 2019-08-07
ZA201708248B (en) 2020-01-29
HK1243645A1 (zh) 2018-07-20
EA201792346A1 (ru) 2018-05-31
CA2984983A1 (en) 2016-11-10
CL2017002765A1 (es) 2018-05-18
JP6748113B2 (ja) 2020-08-26
TN2017000465A1 (en) 2019-04-12
BR112017023855A2 (pt) 2018-07-17
IL255214A0 (en) 2017-12-31
KR20180002657A (ko) 2018-01-08
JP2018519259A (ja) 2018-07-19
CN107580495A (zh) 2018-01-12
AU2016258847A1 (en) 2017-11-16
US20180169095A1 (en) 2018-06-21
EP3291811A1 (en) 2018-03-14

Similar Documents

Publication Publication Date Title
EP3291811B1 (en) The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of digital ulcers (du) concomitant to systemic sclerosis (ssc)
CA2749730C (en) Sgc stimulators of sgc activators in combination with pde5 inhbitors for the treatment of erectile dysfunction
CA2800709C (en) The use of sgc stimulators, sgc activators, alone and combinations with pde5 inhibitors for the treatment of systemic sclerosis (ssc)
US10918639B2 (en) Combination containing SGC stimulators and mineralocorticoid receptor antagonists
CA2788969C (en) Sgc stimulators or sgc activators alone and in combination with pde5 inhbitors for the treatment of cystic fibrosis
JP7237823B2 (ja) Sgcアクチベーターとミネラルコルチコイド受容体アンタゴニストとを含む組合せ
EP3024455A1 (en) Sgc stimulators or sgc activators and pde5 inhibitors in combination with additional treatment for the therapy of cystic fibrosis
JP2007169278A (ja) Luts処置用の医薬組合せ
JP2009520806A (ja) PDE−5阻害薬と5−α還元酵素阻害薬の医薬組合せ
HK1164124A (en) Sgc stimulators of sgc activators in combination with pde5 inhibitors for the treatment of erectile dysfunction
HK1178431A (en) Sgc stimulators or sgc activators alone and in combination with pde5 inhibitors for the treatment of cystic fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16719430

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 255214

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 12017501980

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 11201709000W

Country of ref document: SG

Ref document number: 15571105

Country of ref document: US

Ref document number: MX/A/2017/014057

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2017557440

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2984983

Country of ref document: CA

Ref document number: 20177031942

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016258847

Country of ref document: AU

Date of ref document: 20160502

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201792346

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: DZP2017000678

Country of ref document: DZ

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017023855

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112017023855

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20171106