WO2016170547A1 - Nouvelle composition d'adn de recombinaison et procédés de lutte contre des agents phytopathogènes - Google Patents

Nouvelle composition d'adn de recombinaison et procédés de lutte contre des agents phytopathogènes Download PDF

Info

Publication number
WO2016170547A1
WO2016170547A1 PCT/IN2016/050116 IN2016050116W WO2016170547A1 WO 2016170547 A1 WO2016170547 A1 WO 2016170547A1 IN 2016050116 W IN2016050116 W IN 2016050116W WO 2016170547 A1 WO2016170547 A1 WO 2016170547A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
rnai
dna construct
target gene
target
Prior art date
Application number
PCT/IN2016/050116
Other languages
English (en)
Inventor
Sandhya AGARWAL
Sarala SHIVAPPA
Mukundan SAMPATH
Sheba Jennifer MOHANDOSS
Kammaragattae Vaishanava PRASANNAKUMAR
Rinku Ranjan SARANGI
Ramanathan VAIRAMANI
Narayanan KOTTARAM KRISHNADAS
Original Assignee
Metahelix Life Sciences Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Metahelix Life Sciences Ltd. filed Critical Metahelix Life Sciences Ltd.
Publication of WO2016170547A1 publication Critical patent/WO2016170547A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01016—Chitin synthase (2.4.1.16)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03016—Phosphoprotein phosphatase (3.1.3.16), i.e. calcineurin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01028—Alpha,alpha-trehalase (3.2.1.28)

Definitions

  • the present invention relates to novel DNA constructs composition and methods to control phytopathogens. More specifically, the present invention relates to method for controlling phytopathogens by silencing the gene expression in said phytopathogens using RNAi (RNA Interference) technology.
  • RNAi RNA Interference
  • Cereals such as rice, wheat and barley are staple food for one half of the world's population making diseases of such crops of special concern.
  • Magnaporthe grisea is a major fungal phytopathogen causing a devastating disease called blast, which usually affects the most important cereals such as rice, wheat and barley.
  • Blast was first reported in Asia more than three centuries ago and is now present in over 85 countries. It is highly adaptable to different environmental conditions and can be found in irrigated lowland, rain-fed upland, or deep water rice fields. The yield loss may be as high as 75% or more depending upon the growing conditions. Rice blast is one of the most widespread diseases which cause significant crop losses throughout India, South East Asia and South America. Blast is presently controlled using resistant cultivars or by application of fungicides. However, resistant cultivars may have a limited field life, due
  • RNA interference is a technique of sequence- specific down-regulation of gene expression (also referred to as “gene silencing” or “RNA-mediated gene silencing") initiated by double-stranded RNA (dsRNA) that is complementary in sequence to a region of the target gene to be down-regulated (Fire, A. Trends Genet. Vol. 15,358-363, 1999; Sharp, P. A. Genes Dev. Vol. 15, 485-490, 2001).Over the last few years, RNA interference (RNAi) has become a well established technique.
  • RNAi comprises contacting the organism with a double- stranded RNA fragment (generally either as two annealed complementary single-strands of RNA or as a hairpin construct) having a sequence that corresponds to at least part of a gene to be down-regulated (the "target gene").
  • a double- stranded RNA fragment generally either as two annealed complementary single-strands of RNA or as a hairpin construct
  • the target gene the target gene
  • RNAi induced gene silencing is widely characterized in eukaryotic organisms including various fungi to down regulate any gene of interest. Down regulation is by 21-25 bases siRNA, which are generated by processing of dsRNA designed from the target gene. Expression of dsRNA in host plants targeting essential genes of a pathogen feeding on host, restricts pathogen growth/ establishment on host system. The concept known as 'Host Induced Gene Silencing' (HIGS), has emerged as an alternate strategy to design pathogen resistant plants (Panwar et al., 2013). A method to alleviate plants from fungal pests, whereby the intact fungal cell(s) when in contact with dsRNA from outside the fungal cells, showed growth inhibition, was described by Marc Van et al. (US2006/ 0247197).
  • Delebarra et a/.(WO 2013/050410) demonstrated inhibition of fungus development, growth and pathogenicity by down regulation of saccharopine dehydrogenase gene, expressed in transgenic host plants.
  • One of the bottlenecks of HIGS is the selection of appropriate target gene/ gene fragments of pathogen for down regulation.
  • the target gene down regulation by dsRNA or siRNA should induce sufficient inhibition of pathogen growth, up to a level which can be commercially used to obtain resistance in host, without any deleterious effect on host growth or yield potential.
  • One such target gene is Con7 from Magnaporthe grisea. Found to be essential for appresorium formation and in planta growth, Con7 encodes a transcription factor required for transcription of several disease related genes of Magnaporthe grisea (Odenbach et. al., 2007).
  • RNA interference which is facilitated by siRNA can be derived from gene constructs expressing dsRNA delivered directly to fungal cells through plasmids or to plant cells where the generated siRNA are absorbed by fungal cells, once fungus attacks such transgenic plants.
  • This ability of fungal cells to take-up siRNA fragments generated in host plants can be exploited to design plants resistant to phytopathogenic fungi by targeting fungal genes responsible for pathogenicity.
  • the present invention describes fungus specific novel DNA sequences which can be designed to follow RNAi pathway in a plant system in a manner that the fungus such as Magnaporthe is not able to establish in case of an attack on such plants.
  • the present invention describes novel gene fragments that confers strain nonspecific tolerance in plants against blast fungus and thereby overcome the limitations of the existing state-of-the-art.
  • the main object of present invention is to provide novel DNA constructs composition to obtain disease resistant plants.
  • Another object of present invention is to identify suitable DNA fragments to control blast fungus.
  • Yet another object of the present invention is to provide method for controlling fungal infection of plants by silencing the gene expression in fungi using RNAi technology.
  • Yet another object of the present invention is to provide strain non-specific or race non-specific tolerance against blast fungus.
  • Yet another object of present invention is to provide methods to control blast fungus.
  • the present invention relates to novel DNA constructs composition and methods to control blast fungus.
  • the present invention also relates to method for controlling fungal infection of plants by silencing the gene expression in fungi using RNAi (RNA Interference) technology.
  • RNAi RNA Interference
  • the present invention is not based on the specific virulence and avirulence genes interactions and thus provides durable race and/ or strain non-specific resistance.
  • the invention relates to area of agricultural biotechnology wherein novel DNA constructs confer strain non-specific and/ or race non-specific tolerance against blast fungus.
  • Magnaporthe grisea is the causative agent of blast. As the fungus is constantly evolving, the available measures for developing resistance are not sufficient and need supplementation with new techniques.
  • the major target genes of the present invention are the genes involved in virulence, pathogenicity, establishment and proliferation of fungus inside host system and membrane transporters providing resistance against host resistance machinery. Gene fragments of sizes ranging from approximately 150bp to 400bp are selected from fungal genome such as from Magnaporthe as the target genes. These gene fragments target the pathogen but not the host plant genome.
  • the gene construct have been designed for plant species, including but not limited to, rice, barley, wheat where in target gene fragments do not show biologically significant similarity with host plant genome.
  • RNAi gene cassettes have been designed either with the gene fragment from single gene called single gene targets or with the gene fragments from many genes together called multi-gene targets. While single gene target aims silencing one gene at a time, multi-gene targets induce silencing of the whole class of the target at a time.
  • RNAi targets The non-limiting list of various silencing gene targets (RNAi targets) that have been selected for the experiment are provided in Table below:
  • RNAi targets from M gn porthe
  • the Table 2 below provides a list of primers used in the course of the present invention.
  • Serine threonine 612 GCGTCGACCATCCAGTCATTCTTGGAGG R phosphatase A
  • Multi-drug 635 CCCTCGAGCGAAATCGACGTCAAATGG F resistance/ Fe T
  • Multi-drug 636 CCCAAGCTTGTCTGGGAGACGGTTGATG R resistance/ Fe A
  • Multi-drug 637 CCCAAGCTTGGCCTCACCAGAGGTCTCA F resistance/ Fe A
  • Multi-drug 638 GGAATTCCGTCGTCGGGTCGTAGAA R resistance/ Fe
  • Multi-drug 639 GGAATTCCGAGTCGACCTCGGCCTTGGA F resistance/ Fe
  • Multi-drug 640 CGGGATCCTCATAATAGTGCCCCTTGCT R resistance/ Fe G
  • Membrane 641 F transporters/ MDLB GGGGTACCGCGTCTCAGCACGCTACC
  • Membrane 642 R transporters/ MDLB CCCTCGAGATGCCACATCTCCATCCTTC Membrane 643 F transporters/ MDLB CCCTCGAGCTATTTCCGCATGGTGCAG
  • Membrane 645 F transporters/ MDLB CCCAAGCTTGTTTCCTTGCGACGAGGTG
  • Membrane 646 R transporters/ MDLB GGAATTCGCACTCGGTGTCGTAGCC
  • RNAi machinery produces small interfering RNA (siRNA) in the transformed rice plants, which are very specific to target genes such as the Magnaporthe genes.
  • siRNA small interfering RNA
  • Novel DNA construct composition to provide strain non-specific and/ or race non-specific broad spectrum tolerance against phytopathogen in host plant.
  • the DNA construct composition comprises ofat least one novel RNAi construct, at least one promoter and at least one transcriptional terminator.
  • the novel DNA construct is designed in a manner capable of producing double stranded RNA (dsRNA) to down-regulate pathogen specific gene target by way of RNAi mediated gene silencing and consequently inhibiting growth of phytopathogen.
  • dsRNA double stranded RNA
  • the RNAi gene constructs are designed for both single gene targets and multi-gene targets.
  • This invention also discloses method of preparing novel DNA construct to provide strain non-specific and/ or race non-specific broad spectrum tolerance against phytopathogen in plants which include identifying target gene from total genomic DNA from at least one field isolate of phytopathogen, obtaining target gene fragment of predetermined size range from the target gene, amplifying the target gene fragments to obtain amplicons, designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector, preparing at least one RNAi gene construct, preparing at least one binary RNAi vector from one or more RNAi gene constructs, mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium, mediating transformation of said plant using said transformed Agrobacterium.
  • the DNA construct so formed is capable of producing RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of phytopathogen.
  • the binary RNAi vectors are pMH878 and pMH883.
  • the invention also discloses a method to control phytopathogens using the above method where the transformed Agrobacterium mediates transformation of host plant.
  • the positive transgenic events are converted to homozygous plant population.
  • the positive transgenic event down- regulates pathogen specific gene target by RNAi mediated gene silencing and inhibits growth of the phytopathogen.
  • Fig. 1 collectively depicts the diagrammatic representation of vector construction of pMH878.
  • Fig. 1A depicts the vector construction of pMH722.
  • Fig. IB depicts the vector construction of pMH729.
  • Fig. 1C depicts the binary vector construction of pMH878 by modification of basic binary vector pMH210.
  • Fig. 2 collectively depicts the diagrammatic representation of vector construction of pMH883.
  • Fig. 2A depicts the vector construction of pMH656.
  • Fig. 2B depicts the vector construction of pMH734,
  • Fig. 2C depicts the vector construction of pMH737,
  • Fig. 2D depicts the vector construction of pMH738,
  • Fig. 2E depicts the vector construction of pMH788,
  • Fig. 2F depicts the vector construction of pMH808,
  • Fig. 2G depicts the vector construction of pMH811,
  • Fig. 2H depicts the vector construction of pMH671,
  • Fig. 21 depicts the binary vector construction of pMH883 by modification of basic binary vector pMH210.
  • Fig. 3A Gel image of 200bp dsRNA
  • Fig. 3B Gel image of siRNA generated from dsRNA
  • Fig. 3C Multi-well plate showing fungal growth inhibition upon incubation with in-vitro generated siRNA.
  • Fig. 4 A picture showing differential disease reaction by negative check (Co-39) and transgenic events.
  • Fig. 6A Multi-sequence alignment of chitin synthase 1 (XM_361671) gene fragments from six Magnaporthe strains showing 100% similarity
  • Fig. 6B Multi-sequence alignment of chitin synthase 2 (XM_ 363876) gene fragments from six Magnaporthe strains showing 100% similarity
  • Fig. 6C Multi-sequence alignment of chitin synthase 3 (XM_364706) gene fragments from six Magnaporthe strains showing 100% similarity.
  • Fig. 6D Multi-sequence alignment of chitin synthase 4 (XM_001403947) gene fragments from six Magnaporthe strains showing 100% similarity.
  • Fig. 6E Multi-sequence alignment of chitin synthase 5 (XM_001403948) gene fragments from six Magnaporthe strains showing 100% similarity.
  • Fig. 7 Gel image showing reverse transcriptase PCR results. DETAILED DESCRIPTION OF THE INVENTION WITH ILLUSTRATIVE EXAMPLES
  • the present invention discloses a novel DNA construct composition capable of providing strain non-specific and/ or race non-specific broad spectrum tolerance against phytopathogens.
  • the DNA construct composition of the present invention is capable of being expressed in a transgenic plant cell.
  • the present invention further provides a method to control phytopathogens. The method comprises the steps of target gene selection i.e. identification of gene of interest from said phytopathogen, isolation of specific gene fragments of specific size range, amplification of said gene fragments and associating said gene fragments with an appropriate promoter, cloning of said specific gene fragments into a vector, thereby making specific RNAi constructs.
  • the RNAi constructs thus obtained are transferred into plant causing plant transformation.
  • Target genes are selected from at least one phytopathogen.
  • Said phytopathogen is blast fungus such as but not limited to Magnaporthe sp.
  • the selection of target gene is based on their involvement in virulence, pathogenicity, establishment and proliferation of fungus inside plant system.
  • gene fragments of sizes ranging from 150bp to 400bp are selected as given in SEQ. ID 1 to SEQ. ID 24 (Table 3).
  • Said gene fragments within the sizes ranging from 150-400bp are referred to herein as target gene fragments.
  • Table 3 Target gene fragment sequence obtained from selected target gene: SEQ. ID 1 to SEQ. ID 24
  • Transporter acgaaccgctgtcccgtccgatccacgccctcacagtcgcccaattcctc gaggagatcaagggcgacgccgaagatggcctcaagccggaggag gccaagaggcgcctggagcagtacggcaacaatgactttggcgaggg cgagggcgtctctgccatcaagatttttt
  • Transporter acccaccaacagcacccaggcaagttggtgccagacaacgcgcaagc gattggttcgccaaagtctcccaagaggggttattccataaacctctacct ccctcaaaggatggtcgccatgttcccataagatttgcgggaagccagg acggcgacaaagctact
  • MDR cagcgcaaccgccgacacgaaacagcctcttgcggaaacgccgagg genes/ ABC gatggggcccgctcagcccattccgatatgactttacaccttgctttatcg transporter acgtatgggtggcttcagtagccgtcttcggcctcatctttgggcctatcg s ccttgtggtggttgt
  • transporter gcgtctcagcacgctaccggcgaaggcgcccacgtcatttttaggcctg s/MDLB gggaaccggttcagctcgccatcgggcgtcctgcgacgattctcgacg actcaaacgccatggaagcagtctgttaaggagacgagcctgcaagat gattcgcgggaagatggcaaggcgctggagaacgcggaagctaaga aggatggagatgtggcat
  • transporter 121 ctatttccgcatggtgcaggcgcagaggctctccaagatgtcggccgcg s/MDLB gccgagggcgacgacggcgtggagggcggcgctgcgaaatcg gtcgacagctccgacgacgaaggcaacaagcgaggtgttggcgtcga gggcgatgcgccatggacgatgtggcgcagatgcagtccgtcgtca ggtacaa
  • each said target gene fragment is aligned against at least one plant genome sequence to identify said target gene fragment sequence similarity with said host plant genome sequence.
  • the target gene fragments showing less than 10 bp to 20 bp continuous sequence similarity with said host plant genome are selected.
  • Total genomic DNA has been isolated from two field isolates of Magnaporthe, collected from Almora district of Tamilakhand and Nellore district of Tamil Nadu. From said DNA, five different single gene fragments have been selected for amplification. Target gene fragments within the size range from 150 bp to 400 bp obtained from said five selected single gene fragments have been amplified from both the strains of Magnaporthe followed by amplicons sequencing. Sequencing results showed no difference in the sequences of target gene fragments obtained from said Almora strain and said Nellore strain. Total genomic DNA from said Almora strain has been used further in all experiments, related to gene constructs development.
  • Gene construct designing commenced with PCR amplification of said target gene fragment obtained from said selected total genomic DNA. Primers were designed with specific restriction sites for directional cloning of said target gene fragment into a vector. Cloning of said target gene fragment in sense orientation (5' to 3') was followed by cloning of spacer - bean catalase intron and further cloning of said target gene fragment in anti-sense orientation (3'to 5'), thus making a hairpin structure or RNAi construct.
  • RNAi gene constructs are designed for single gene target and multi-gene targets.
  • RNAi gene constructs When said RNAi gene constructs are designed with the gene fragment obtained from single target gene, they are referred to as 'single gene targets' .
  • Said single gene targets are aimed to silencing of one gene at a time. Only those target genes are selected for single gene silencing which are shown to be indispensable for fungus survival inside a host system.
  • SEQ ID 25 to Seq ID 29 of the present invention have been identified as the hairpin sequences of single gene targets.
  • RNAi gene constructs When said RNAi gene constructs are designed with the gene fragments obtained from many genes together in single gene cassette, they are referred to as 'multi-gene targets' (Table 1).
  • 'Multi gene targets' are selected from different classes of membrane transporters which protect fungus against plant resistance machinery.
  • Various genes from one class of multi-gene targets are first aligned by multiple sequence alignment, followed by identification of conserved domains, if present, and further construction of dendrogram.
  • At-least four targets representing widely related genes are selected from one class, targeting silencing of entire class, simultaneously.
  • said target gene fragments obtained from different genes are cloned sequentially, in sense orientation, followed by insertion of bean catalase intron as spacer and further cloning of all said target gene fragments in anti-sense orientation.
  • Sequences from SEQ. ID 30 to SEQ. ID 34 of the present invention have been identified as the hairpin sequences of multi-gene targets.
  • Hairpin loop sequences of single gene targets and multi-gene targets are given below:
  • the gene constructs are designed for single gene targets and multi-gene targets.
  • the gene construct design comprises of amplification of specific target gene fragment with primers which are designed with restriction sites towards 5' and 3' ends in that order. Thereafter the amplicons are cloned in a preferred cloning vector within the preferred restriction sites in sense orientation to create a plasmid. This process is repeated till a new plasmid of preferred hairpin orientation is created.
  • RNAi vector pMH878 The single gene construct designing for con7 RNAi vector pMH878 is depicted in Fig. 1.
  • Said 363 bp amplicon in cloned in pMH45 which is a basic cloning vector within Kpnl and BamHI restriction sites in sense orientation.
  • the plasmid thus created is named as pMH722 (Fig.lA).
  • Amplification of 302 bp target gene fragment with primer nos. 601 and 602 are designed with BamHI and Sari restriction sites at 5' and 3' ends, respectively.
  • Said 302 bp amplicon is cloned in said pMH722 within BamHI and Sari in antisense orientation and results in a hairpin structure.
  • the plasmid thus created is named as pMH729 (Fig. IB). Restriction of said hairpin structure from pMH729 as Kpnl and Sari fragment and ligation to similarly digested binary vector pMH210, under Metahelix proprietary chimeric promoter (patent no. 260535) and NOS 3'UTR, resulted in vector which was named as pMH878 (Fig.
  • pMH878 is a binary vector, ready to mobilize to Agrobacterium.
  • Said pMH210 is a binary vector with hygromycin as plant selectable marker.
  • Vector contains a promoter and 3'UTR, where any gene of interest can be cloned.
  • Fig. 2 The multi-gene construct designing for chitin synthase RNAi vector pMH883 is depicted in Fig. 2.
  • Chitin synthase RNAi construct is designed with five different target gene fragments, targeting simultaneous silencing of all known chitin synhthase genes in Magnaporthe.
  • Abbreviated as chs chitin synthase gene fragments are amplified from Magnaporthe genomic DNA.
  • Chitin synthasel or chsl a 201bp fragment is amplified using primers no. 615 and 616 (Table 2), designed with Kpnl and Xhol restriction sites. Amplicon thus obtained are cloned at similarly digested cloning vector pMH45 in sense orientation and resulting vector is named as pMH656 (Fig. 2A).
  • Second, third, fourth and fifth gene fragments named as chs2 (Fig. 2B), chs3 (Fig. 2C), chs4 (Fig. 2D) and chs5 (Fig. 2E) are amplified by using 617/ 618, 619/620, 621/622 and 623/624 primers, respectively (Table 2) and result into vector construction of pMH734, pMH737, pMH738, pMH788, respectively.
  • Amplicon sizes of chs2, chs3, chs4 and chs5 are 200bp, 205bp, 186bp and 192bp, respectively.
  • Each amplicon is cloned sequentially in pMH656 by making use of specific restriction sites.
  • pMH788 Final vector containing all the five gene fragments, in sense orientation between Kpnl and BamHI restriction sites is named as pMH788 (Fig. 2E).Bean catalase intron is cloned between Sail and BamHI sites of pMH788, as a spacer to obtain plasmid named as pMH808 (Fig. 2F).
  • Kpnl/ BamHI fragment from pMH788 is digested and ligated to similarly digested basic cloning vector pMH022, where these sites are complementary, resulting in anti-sense orientation of targeted five fragments.
  • the resultant plasmid is named as pMH811 (Fig. 2G).
  • Kpnl/ Sad fragment of pMH811, representing five gene fragments in reverse orientation is eluted and ligated to Kpnl/ Sad digested pMH808.
  • Resultant plasmid named as pMH671 (Fig. 2H), harbours all five gene fragments between Kpnl/ Sad sites in sense and antisense orientation, separated by bean catalase intron spacer.
  • Hairpin structure from pMH671 (Fig. 2H), digested as Kpnl/ Sacl fragment is ligated between chimeric promoter and NOS 3'UTR of pMH210 and is named as pMH883 (Fig. 21).
  • Said pMH883 is a binary vector ready to mobilize to Agrobacterium. Both the plasmids pMH878 and pMH883 are deposited at MTCC, IMTECH Chandigarh under Budapest treaty, IDA.
  • Binary RNAi vectors harbouring RNAi constructs, such as but not limited to pMH878 and pMH883 are mobilized to Agrobactenum by standard techniques.
  • One of the non-limiting Agrobactenum strain is Agrobactenum strain EHA105. Said mobilization of the binary RNAi vector into the Agrobactenum is carried out by tri-parental mating with the help of a helper plasmid pRK2013.
  • said binary RNAi vectors are streaked on petri plates containing culture medium.
  • the culture medium is LB medium comprising the composition of tryptone lOg/L, yeast extract 5g/L and sodium chloride 2.5g/L, pH 7.0, supplemented with 50mg/L kanamycin sulphate.
  • Culture medium of same composition is also used to streak said helper strain. Both, said binary RNAi vectors and said helper strain are grown overnight at 37°C.
  • Agrobactenum is streaked on a culture medium, such as but not limited to, AB medium comprising the composition of Glucose 5g/L added with AB salts- Ammonium Chloride lg/L, Magnesium sulfate, heptahydrate 0.3g/L, Potassium chloride 0.150g/L, Calcium chloride dihydrate O.OlOg/L, Ferrous sulfate, heptahydrate 0.0025g/L and AB buffer- Potassium phosphate, dibasic 3g/L, Sodium dihydrogen phosphate lg/L, pH7.0 after autoclaving and supplemented with rifampicin lOmg/L and grown for 48h at 28°C.
  • AB medium comprising the composition of Glucose 5g/L added with AB salts- Ammonium Chloride lg/L, Magnesium sulfate, heptahydrate 0.3g/L, Potassium chlor
  • siRNA When cultured with siRNA, said fungal hyphae up-take siRNA along with other nutrients from culture medium. Inside the cells of said fungal hyphae, siRNA down regulate specific gene target by RNAi mediated gene silencing and inhibit fungal growth. Proof of concept has been showcased with siRNA generated by 200bp dsRNA, targeting silencing of beta tubulin gene.
  • the dsRNA double stranded RNA
  • siRNA double stranded RNA
  • the fungal genomic DNA such as the Magnaporthe genomic DNA is used to run two separate PCR reactions to anchor T7 promoter with target DNA template at 5' ends, generating sense and anti-sense templates with T7 promoter.
  • Primers numbered 853 and 854 are used to generate sense template, while primers numbered 855 and 856 have generated anti-sense template.
  • dsRNA is obtained following in vitro transcription and annealing of in vitro generated RNA strands using Megascript RNAi Kit (Ambion) as per supplier's instructions (Fig. 3A). Said dsRNA is digested to siRNA by RNAse III treatment (Fig. 3B).
  • dsRNA is treated with ShortCut Rnase III (NEB), wherein the reaction of 20 ⁇ 1, 2 ⁇ g dsRNA is converted completely to siRNA (21 to 25nucleotides) using 2.6 units of enzyme with an incubation of 30 min at 37°C. The reaction is stopped by EDTA, followed by ethanol precipitation of siRNA and dissolution in sterilized RNase free water.
  • NEB ShortCut Rnase III
  • the fungal mycelial bit from an actively growing culture of fungus such as Magnaporthe is inoculated in a culture broth and incubated for specific period at specific conditions to obtain mycelia/ hyphae of uniform size.
  • 50ml of PDB-potato dextrose broth potato infusion 200g/L, dextrose 20g/L, pH 7.0
  • the culture is filtered through autoclaved muslin cloth and 10 ml of filtrate is used to inoculate another 50ml of potato dextrose broth medium and grown at 28°C for 24hrs with constant shaking. After 24hrs, the culture is dispensed in oak ridge tubes, vortexed and filtered through autoclaved Whatman no. 3 filter paper. Mycelia/ hyphae thus obtained have uniform size ranging from 0.01 to 0.03mm.
  • tubulin siRNA are effective to inhibit growth at both the concentrations of and 2 ⁇ g per well.
  • Experimental control where no siRNA are added with fungal culture, have not shown any kind of growth inhibition/ retardation. This provides a clear indication that fungal hyphae up-take siRNA available in the medium outside fungal cells. It also indicates up-take of siRNA targeting a gene important for fungus survival shall lead to fungal growth inhibition.
  • Agrobacterium tumefaciens mediated rice transformation is carried out.
  • said rice transformation is carried out with five single gene constructs and five multi-gene constructs, using rice immature embryos as explants.
  • Agrobacterium culture is revived from deep freezer on AB minimal medium, supplemented with 100 ⁇ acetosyringone, 50mg/L kanamycin sulphate and lOmg/L rifampicin. Culture is grown till it reached to optical density of 1 at 600nm and is used for co-cultivation with rice genotype IR58025B immature embryos. Rice immature embryos are obtained from panicles 14- 16 days post-anthesis.
  • Co-cultivation with Agrobacterium for 15 min is followed by embryogenic callus induction and selection on MS medium supplemented with hygromycin (50mg/L), 2,4-D (2mg/L), BAP (O.lmg/L) and cefotaxime (250mg/L).
  • hygromycin 50mg/L
  • 2,4-D 2mg/L
  • BAP O.lmg/L
  • cefotaxime 250mg/L
  • culture plates are incubated at 26°C ⁇ 2°C in dark for five weeks.
  • For regeneration actively growing callus is transferred to MS medium supplemented with kinetin (3mg/L), NAA (2mg/L) and hygromycin (50mg/L) and is incubated in dark at 26°C ⁇ 2°C for five days followed by transfer to light with 16hrs photoperiod.
  • Transgenic events thus obtained are tested for disease reaction against fungus such as Magnaporthe using whole plant assay.
  • a uniform, homozygous population is pre-requisite for whole plant assay.
  • Segregating population of generated events across ten RNAi gene constructs are converted to homozygous population by consecutive selection on hygromycin (50 mg/L) containing medium for three generations and seed bulking.
  • hygromycin 50 mg/L
  • sixty seeds per event are sown on Vi MS medium supplemented with 50 mg/L hygromycin with appropriate controls.
  • transgenic seeds are cultured on Vi MS medium supplemented with hygromycin (50mg/L) while non-transgenic and transgenic seeds cultured on Vi MS medium without hygromycin served as controls.
  • Seedlings of transgenic events growing on medium supplemented with hygromycin represented hemizygous or homozygous nature. Five such seedlings are transferred to green house for seed harvesting. Bulk harvesting is done followed by repetition of same process of hygromycin based null elimination for two more generations. Seeds harvested after three such cycles, represent a homozygous line. Homozygous population thus obtained from 236 events across ten constructs, is used for whole plant assay against plant disease such as rice blast disease. Whole Plant assay:
  • nursery generation for blast assay is initiated by making small beds of approximately 3m x lm size. Dense population of susceptible check (Co-39) is sown all around four sides of the beds, as well as after every five test entries to facilitate disease spread. 60-70 seeds from each event are sown in 50cm rows perpendicular to the border rows. 'Tetep', a genotype which shows resistant reaction to the disease is used as positive check and sown with test entries. Experiment is conducted in three replications. 20-25 days old nursery is spray inoculated with Magnaporthe spores at evening hours. After spray, entire bed is covered with polyethylene sheet, over-night to maintain high relative humidity. Polyethylene sheet is removed during day time.
  • MDR Multi-drug resistance
  • RNAi constructs The resistance reaction obtained by RNAi constructs is broad spectrum or non-specific to Magnaporthe strains. Pure strains of blast affected rice samples are isolated from the field collections by culturing samples on oat meal agar medium followed by single spore isolation. Three strains causing leaf blast and another three strains causing neck blast are selected randomly from different locations/ disease hot spots in India. Strains isolated from leaf blast affected samples are coded as APHD01, KNGL02and CHSR01. Neck blast strains collected from disease affected rice panicles are coded as KNSA01, CHMAOl and JHPOOl. Genomic DNA is isolated from said selected strains using CTAB method.
  • Said genomic DNA is used as template for PCR amplification of target gene fragments representing con7 and five different chitin synthase genes using specific primers mentioned above for gene cloning experimentations (Table 2).
  • the amplicons thus obtained are sequenced and aligned using multiple sequence alignment. Alignments showed exactly similar sequences of gene fragments with 100% similarity from all six strains (Fig 5 and Fig 6A to 6E). Since target sequences are same from different strains of the fungus, strain non-specificity of the present resistance strategy is clearly established.
  • RNAi induced gene silencing involves siRNA production from any double stranded RNA.
  • RNAi gene construct designed specifically with sense and anti-sense DNA strands leads to formation of RNA hairpin structure after transcription.
  • RNA hairpin structure is a double stranded RNA, it becomes unstable and is chopped into smaller fragments or siRNA by RNAi machinery.
  • Non-detection of a hairpin transcript in reverse transcriptase- PCR reaction indicates degradation of hairpin RNA into siRNA.
  • An experiment is conducted to find out degradation of RNA hairpin from a few transgenic events of Con7.
  • RNA is extracted from leaves of four randomly selected transgenic events representing Con7 gene construct.
  • RNA is extracted according to manufacturer' s instructions using RNeasy Plant Mini Kit from QIAGEN (cat no. 74903).
  • QIAGEN one step RT PCR Kit (cat no. 210210) is used to set up reverse transcriptase and PCR reactions.
  • Rice house-keeping gene actinl is used to normalize the RT PCR reactions. Reactions are conducted with exactly same concentration of RNA (600ng) for actinl as well as Con7 amplifications. PCR reactions were conducted with primers no. 1042/1043 for actinl and 603/604 for Con7 amplifications. Results, as shown fig. 7, clearly display reduction in Con7 transcripts (Fig.
  • lanes 1-8 represent reverse transcriptase PCR amplicons with actinl primers, amplicon size 540bp (lane V. water control, lane 2: non-transgenic control, lane 3: transgenic DNA control, lanes 5-8: amplicons from Con7 four events, using 600ng RNA in each event).
  • lanes 9-16 represent reverse transcriptase PCR amplicons with Con7 primers, amplicon size 363bp (lane 9: water control, lane 10: non-transgenic control, lane 11: transgenic DNA control, lanes 13- 16: amplicons from Con7 four events, using 600ng RNA in each event).

Abstract

La présente invention concerne une nouvelle composition d'ADN de recombinaison visant à conférer une tolérance à large spectre non spécifique d'une souche et/ou non spécifique de la race contre un agent phytopathogène dans une plante hôte. La composition d'ADN de recombinaison comprend au moins un nouveau ARNi de recombinaison, au moins un promoteur et au moins un terminateur de transcription et est conçue de manière à produire un gène chimère d'ARNi pour réguler à la baisse une cible génique spécifique d'un agent pathogène au moyen de l'interférence génique médiée par ARNi et par conséquent inhiber la croissance du phytopathogène. Les gènes chimères d'ARNi sont conçus à la fois pour les cibles géniques uniques et les cibles géniques multiples. L'invention concerne également un procédé de préparation d'un nouvel ADN de recombinaison et le procédé permettant de lutter contre les phytopathogènes.
PCT/IN2016/050116 2015-04-21 2016-04-21 Nouvelle composition d'adn de recombinaison et procédés de lutte contre des agents phytopathogènes WO2016170547A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN2044CH2015 2015-04-21
IN2044/CHE/2015 2015-04-21

Publications (1)

Publication Number Publication Date
WO2016170547A1 true WO2016170547A1 (fr) 2016-10-27

Family

ID=57143791

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IN2016/050116 WO2016170547A1 (fr) 2015-04-21 2016-04-21 Nouvelle composition d'adn de recombinaison et procédés de lutte contre des agents phytopathogènes

Country Status (1)

Country Link
WO (1) WO2016170547A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006046148A2 (fr) * 2004-10-25 2006-05-04 Devgen Nv Constructions d'arn
WO2006070227A2 (fr) * 2004-10-04 2006-07-06 Devgen Nv Procede de regulation de l'expression genetique dans des champignons
US20070061918A1 (en) * 2003-12-23 2007-03-15 Rachel Baltz Method for modifying gene expression of a phytopathogenic fungus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070061918A1 (en) * 2003-12-23 2007-03-15 Rachel Baltz Method for modifying gene expression of a phytopathogenic fungus
WO2006070227A2 (fr) * 2004-10-04 2006-07-06 Devgen Nv Procede de regulation de l'expression genetique dans des champignons
WO2006046148A2 (fr) * 2004-10-25 2006-05-04 Devgen Nv Constructions d'arn

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KADOTANI N ET AL.: "RNA silencing in the phytopathogenic fungus Magnaporthe oryzae", MOL PLANT MICROBE INTERACT., vol. 16, no. issue 9, September 2003 (2003-09-01), pages 769 - 776, XP009036113 *
LIU XH ET AL.: "Involvement of a Magnaporthe grisea serine/threonine kinase gene , MgATG1, in appressorium turgor and pathogenesis", EUKARYOTIC CELL, vol. 6, no. 6, 1 June 2007 (2007-06-01), pages 997 - 1005, XP055323959 *
ZHONG S ET AL.: "Construction of hairpin RNA-expressing vectors for RNA-mediated gene silencing in fungi", PLANT FUNGAL PATHOGENS: METHODS AND PROTOCOLS, vol. 835, 2012, pages 623 - 633 *

Similar Documents

Publication Publication Date Title
Bharti et al. Host-induced silencing of pathogenicity genes enhances resistance to Fusarium oxysporum wilt in tomato
Liu et al. Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis
Ojola et al. Overexpression of rice thaumatin-like protein (Ostlp) gene in transgenic cassava results in enhanced tolerance to Colletotrichum gloeosporioides f. sp. manihotis
WO2020156367A1 (fr) Procédé d'amélioration du rendement d'oryza sativa et/ou de la résistance à la coulure et protéine utilisée à cette fin
Mejía et al. Expression of designed antimicrobial peptides in Theobroma cacao L. trees reduces leaf necrosis caused by Phytophthora spp.
CN104480085A (zh) VdUDG基因及其在降低大丽轮枝菌致病性中的应用
EP3696188A1 (fr) Gènes de resistance à des maladies des plantes
CN115305252A (zh) 一种调控水稻抗性的受体激酶基因OsIFBR1
Scindiya et al. RNA-mediated silencing of PKS1 gene in Colletotrichum falcatum causing red rot in sugarcane
WO2016065896A1 (fr) Applications d'une protéine osago18 ou d'un gene codant correspondant pour augmenter la résistance d'une plante au virus du nanisme du riz ou à des virus de la même famille
CN109402171B (zh) 一种松材线虫RNAi调控基因及其应用
US20220154206A1 (en) Gene for resistance to plant disease
Wang et al. Agrobacterium tumefaciens-mediated transformation of Valsa mali: an efficient tool for random insertion mutagenesis
KR100804766B1 (ko) Ｃｍｖ 병원형 감염에 내성인 형질전환 고추
CN113956337B (zh) 基因FoUPE3在防治香蕉枯萎病中的应用
WO2016170547A1 (fr) Nouvelle composition d'adn de recombinaison et procédés de lutte contre des agents phytopathogènes
CN109295068B (zh) 一种三七类甜蛋白基因PnTLP2及应用
CN107164403A (zh) miR319在培育抗灰霉病植物中的应用
Ghag et al. Stacking of host-induced gene silencing mediated resistance to banana bunchy top virus and fusarium wilt disease in transgenic banana plants
CN102206261B (zh) 一种与植物育性相关的蛋白及其编码基因与应用
CN109111510B (zh) 蛋白质及基因的应用、以及重组载体、表达盒、重组菌及构建方法
CN111704659A (zh) 根结线虫ralf蛋白质、编码基因及其应用
CN104531716A (zh) 基因OsABAR1及其在提高水稻干旱和盐胁迫耐性中的应用
CN114773440B (zh) 蛋白FoUpe2在调控香蕉枯萎病菌致病力中的应用
CN106905422B (zh) 大丽轮枝菌的致病基因、蛋白及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16782741

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16782741

Country of ref document: EP

Kind code of ref document: A1