WO2016117960A1 - 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도 - Google Patents

면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도 Download PDF

Info

Publication number
WO2016117960A1
WO2016117960A1 PCT/KR2016/000701 KR2016000701W WO2016117960A1 WO 2016117960 A1 WO2016117960 A1 WO 2016117960A1 KR 2016000701 W KR2016000701 W KR 2016000701W WO 2016117960 A1 WO2016117960 A1 WO 2016117960A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
grim19
mesenchymal stem
stem cells
disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/000701
Other languages
English (en)
French (fr)
Inventor
조미라
김석중
양철우
박성환
박민정
이선영
이은정
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Catholic University of Korea
Original Assignee
Industry Academic Cooperation Foundation of Catholic University of Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150174165A external-priority patent/KR101739659B1/ko
Application filed by Industry Academic Cooperation Foundation of Catholic University of Korea filed Critical Industry Academic Cooperation Foundation of Catholic University of Korea
Publication of WO2016117960A1 publication Critical patent/WO2016117960A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Definitions

  • the present invention relates to mesenchymal stem cells overexpressed Grim19 having efficacy in treating immunological diseases and uses thereof.
  • a method for treating a disease caused by an excessive immune response is to alleviate or reduce various symptoms caused by the disease by administering an immunosuppressant alone or in combination.
  • Immunosuppressants refer to a variety of substances used to reduce or block the host's ability to produce antibodies (a humoral immune response) or a cellular immune response to the action of an antigen. Such immunosuppressive agents may be useful for autoimmune diseases such as lupus, rheumatoid arthritis, and skin hypersensitivity reactions such as atopy and allergy as well as organ transplant field. A good immunosuppressant should be able to control the imbalance of the immune response, ensure the safety of the human body, and reduce the incidence of disease recurrence during long-term treatment.
  • immunosuppressive agents include cyclosporin A and FK506, which are compounds derived from natural products with complex chemical structures, which are expensive in terms of supply and demand of raw materials, which are uneconomical and may cause various side effects due to long-term administration. There is a risk. Therefore, there is an urgent need for the development of new immunosuppressive agents capable of economic production with low toxicity and induction of immune tolerance.
  • T cells are one of a group of cells that play a central role in the immune system as a biological defense system against various pathogens.
  • T cells are produced in the thymus of the human body and undergo a series of differentiation processes to differentiate into T cells with unique characteristics.
  • T cells which have completed differentiation, are largely divided into type 1 helper cells (Th1) and type 2 according to their function. It is divided into helper cells (Th2).
  • Th1 cells the main function of Th1 cells is involved in cell mediated immunity
  • Th2 cells are involved in humoral immunity
  • these two cell populations are balanced with each other so that they are not activated with each other.
  • immune diseases can be attributed to the imbalance between these two immune cells, for example, when the activity of Th1 cells is abnormally increased, autoimmune diseases may occur, and the activity of Th2 cells is abnormally increased. It is known that immune diseases occur due to hypersensitivity reactions.
  • Tregs immunoregulatory T cells
  • Th17 cells are known to be formed through a process similar to the differentiation of Treg cells during the differentiation of undifferentiated T cells. In other words, differentiation of Treg cells and Th17 cells occurs in the presence of TGF- ⁇ in common, but does not require IL-6 in Treg cells, whereas IL-6 is present in combination with TGF- ⁇ in Th17 cells. Differentiate in situations where In addition, differentiated Th17 cells are characterized by the secretion of IL-17.
  • Th17 cells Unlike Treg cells, Th17 cells have been found to be involved in the forefront of inflammatory reactions seen in immune diseases, maximizing the signal of inflammatory responses and accelerating disease progression. Therefore, in the case of autoimmune diseases which are not controlled by Treg cells among autoimmune diseases, development of therapeutic agents for autoimmune diseases that target the inhibition of Th17 cell activity has been highlighted.
  • immunosuppressive drugs are immunosuppressants that block signal transduction pathways in T cells. These immunosuppressive agents are toxic, infection, lymphoma, diabetes, tremor, headache, diarrhea, high blood pressure, and nausea. There is a problem that side effects such as renal failure occur.
  • the present inventors have confirmed that the Grim19 is introduced and the mesenchymal stem cells overexpressing Grim19 in the cells can be usefully used as a cell therapy for the treatment of various immune-related diseases.
  • an object of the present invention is to provide a cell therapy composition for preventing or treating immune diseases, comprising mesenchymal stem cells transformed with a recombinant vector containing Grim19 gene as an active ingredient.
  • Another object of the present invention is to prepare mesenchymal stem cells overexpressed Grim19 having the efficacy of preventing and treating immune diseases, comprising transforming the mesenchymal stem cells with a recombinant vector containing the Grim19 gene in vitro. To provide a way.
  • another object of the present invention is a regulatory T cell (Treg) of undifferentiated T cells, comprising co-culturing the undifferentiated T cells with mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene. It is to provide a method for promoting the differentiation and activity of the furnace.
  • Reg regulatory T cell
  • the present invention provides a cell therapeutic composition for the prevention or treatment of immune diseases, including mesenchymal stem cells transformed with a recombinant vector containing Grim19 gene as an active ingredient.
  • the Grim19 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.
  • the mesenchymal stem cells transformed with the recombinant vector containing the Grim19 gene is inhibited the production of proinflammatory factors and inflammatory cytokines, the differentiation and activity of Th1 and Th17 cells is reduced, Differentiation and activity of Regulatory T cells (Tregs) may be enhanced.
  • the mesenchymal stem cells transformed with the recombinant vector containing the Grim19 gene have increased expression of CCR3, CCR4, CCR7 and CCR9, which are cell migration factors, and thus the ability to move to the lesion site. There is this.
  • COPD chronic obstruct
  • the present invention also provides a method for producing mesenchymal stem cells overexpressed Grim19 having the effect of preventing and treating immune diseases, comprising transforming the mesenchymal stem cells with a recombinant vector containing the Grim19 gene in vitro. to provide.
  • the Grim19 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.
  • the Grim19 overexpressed mesenchymal stem cells are inhibited the production of inflammatory factors and inflammatory cytokines, the differentiation and activity of Th1 and Th17 cells is reduced, regulatory T cells (Regulatory T cells) differentiation and activity of cell: Treg) may be enhanced.
  • the Grim19 overexpressed mesenchymal stem cells may have the ability to move to the lesion site because of increased expression of CCR3, CCR4, CCR7 and CCR9, cell migration factors.
  • the present invention comprises co-culture of undifferentiated T cells with mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene, the differentiation of undifferentiated T cells into Regulatory T cells (Treg) And methods for promoting activity.
  • the co-culture is a mixture of undifferentiated T cells and mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene in a ratio of 1: 1/5 to 1: 1/50 Incubate for 24 to 72 hours at a temperature of 37 °C.
  • Mesenchymal stem cells transformed to overexpress Grim19 can effectively inhibit the expression and production of inflammatory cytokines and inflammatory factors, and inhibit the differentiation of T cells into cytotoxic Th17 and Th1 cells. There is an excellent effect of promoting the differentiation and activity of immunoregulatory T cells (Treg) having the characteristics of inhibiting the function of abnormally activated immune cells and controlling the inflammatory response. Furthermore, mesenchymal stem cells overexpressed with Grim19 have an excellent ability to move easily to the lesion site. Therefore, Grim19 overexpressed mesenchymal stem cells can be used as a cell therapy to prevent or treat immune diseases such as autoimmune diseases, inflammatory diseases and transplant rejection diseases caused by abnormal control of various immune responses.
  • immune diseases such as autoimmune diseases, inflammatory diseases and transplant rejection diseases caused by abnormal control of various immune responses.
  • 1 is a western blot of the overexpression of Grim19 protein in cells targeting mesenchymal stem cells transformed with a recombinant vector containing Grim19 gene and mesenchymal stem cells without Grim19 introduced in one embodiment of the present invention. It shows the result confirmed through.
  • FIG. 2 shows IL-1 beta, IL-6, VEGF, in mesenchymal stem cells transformed with recombinant vectors containing Grim19 gene and control mesenchymal stem cells (cells without Grim19 gene introduced). The results of analyzing the expression level of HMGB-1, IL-10, TGF-beta are shown.
  • Figure 3a shows the expression level of the cell migration factors CCR3, CCR4, CCR7, CCR9 in the mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene and control mesenchymal stem cells (cells without the Grim19 gene introduced) It shows the result of measuring.
  • Figure 3b is a photomicrograph of the results of cell migration analysis of the mesenchymal stem cells transformed with the recombinant vector containing the Grim19 gene and control mesenchymal stem cells (cells without the Grim19 gene introduced) performed by fluorescence microscope It is shown.
  • Figure 4 is a medium for differentiation into adipocytes, bone cells, chondrocytes targeting mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene and control mesenchymal stem cells (cells without the Grim19 gene introduced) After culturing the cells using the cells, differentiation into adipocytes, osteocytes, and chondrocytes is shown by staining with an antibody to each indicator factor.
  • FIG. 5A illustrates intraperitoneal administration of mesenchymal stem cells transformed with a recombinant vector containing Grim19 gene and control mesenchymal stem cells (cells without Grim19 gene introduced) into arthritis-induced mouse groups. The results of measuring the symptoms of arthritis are shown, 5b is the result of measuring the change in the production of inflammatory antibody IgG in serum, 5c and 5d is the result of analyzing the Treg / Th17 cell number.
  • 6A and 6B show the results of analyzing the production of Foxp3 + Treg cells and interferon gamma in mouse-derived T cells after co-culture with mesenchymal stem cells overexpressing Grim19 in mouse-derived T cells.
  • 7A and 7B show the results of analyzing Foxp3 + Treg cell numbers and production of interferon gamma in mouse-derived T cells after co-culture with mesenchymal stem cells overexpressing Grim19 in human-derived T cells.
  • Figure 8a shows the results of analyzing the expression level of cell migration factors in the mesenchymal stem cells overexpressed Grim19, mesenchymal stem cells treated with stat3 inhibitor (STA21) and control mesenchymal stem cells not treated with anything.
  • , 8b shows the results of analysis of arthritis improvement by intraperitoneal injection of these cells in animal models of arthritis.
  • FIG. 9 shows a vector manufacturing process and a vector map of pMX-IRES-GFP-hGrim19, a recombinant vector into which the Grim19 gene is introduced in one embodiment of the present invention.
  • Figure 10 shows the process for stem cell injection timing in a mouse model induced Lupus according to an embodiment of the present invention.
  • Figure 11a shows the result of analyzing the amount of IgG in the mouse serum following the injection of MSC with the Grim19 gene introduced to the mice induced lupus in one embodiment of the present invention using ELISA.
  • Figure 11b shows the result of analyzing the number of Th2, Th1, Th17 cell group in the splenic immune cell group following the injection of MSC with the Grim19 gene introduced to the mice induced lupus in one embodiment of the present invention by flow cytometry .
  • Figure 12a shows the results of analyzing the activity of Tfh cells following the injection of MSC with the Grim19 gene introduced in the mice induced lupus in one embodiment of the present invention.
  • Figure 12b shows the results of analyzing the activity of Germinal center B cells and plasma cells according to the MSC injection of the Grim19 gene introduced to the mice induced lupus in one embodiment of the present invention.
  • Figure 13 shows the results of analyzing the cell number and activity of immunoregulatory T cells and immunoregulatory B cells following the injection of MSC with the Grim19 gene introduced into lupus-induced mice.
  • Figure 14 shows the stem cell injection and experimental procedures in a mouse model induced inflammatory bowel disease according to an embodiment of the present invention.
  • FIG. 15A and 15B show the results of analyzing the improvement of disease symptoms (FIG. 15A) and intestinal length improvement (FIG. 15B) of inflammatory bowel disease according to the MSC injection in which the Grim19 gene was introduced in mice induced with inflammatory bowel disease. It is shown.
  • the present invention while studying to develop a cell therapy that can more effectively treat immune diseases, by confirming that mesenchymal stem cells prepared to overexpress Grim19 is excellent in the treatment of immune diseases, recombinant vector containing the Grim19 gene It is characterized by providing a cell therapy composition for the prevention or treatment of immune diseases comprising the mesenchymal stem cells transformed as an active ingredient.
  • the Grim19 (gene associated with retinoid-IFN-induced mortality 19) noted in the present invention has been found to be a gene associated with cell death, and recently known as a partner that interacts with STAT3 through yeast-2-hybrid screening. (Zhang J, Yang J, Roy SK, Tininini S, Hu J, Bromberg JF.The cell death regulator Grim-19 is an inhibitor of signal transducer and activator of transcription 3.Proc Natl Acad Sci USA . 2003; 100: 9342 -9347).
  • PIAS3 and suppressor of cytokine signaling 3 have been cited as inhibitory feedback of STAT3, and SOCS proteins have the activity of inhibiting ligand-induced responses by inhibiting JAKs
  • the PIAS protein is known to have activity that inhibits the phosphorylation of STAT3 (Starr R, Hilton DJ. Negative regulation of the JAK / STAT pathway. Bioessays 1999; 21: 4752).
  • Grim19 is also known to play a role in inhibiting STAT3-induced transcription. Interestingly, Grim19 does not inhibit the phosphorylation of tyrosin and serine residues or interfere with DNA binding, unlike SOCS3 and PIAS3.
  • STAT Signal transducers and activators of transcription
  • cytokines cytokines, hormones, growth factors, etc.
  • phosphorylation of tyrosine residues dimers by the interaction of the SH2 domain A dimer is formed that enters the nucleus and binds to a specific promoter.
  • the signaling system of these STAT proteins can be inhibited by dephosphorylation and protein degradation.
  • STAT3 is not only a hematological cancer such as leukemia, but also breast cancer, head and neck cancer, melanoma, ovarian cancer, lung cancer, pancreatic cancer and prostate cancer. It is active in various solid cancers and has become an important anticancer target (Hua Yu and Richard Jove, Nature Reviews Cancer ., 2004, 4, 97-105).
  • STAT3 has been known to inhibit apoptosis, induce angiogenesis, and induce immune evasion (Wang T. et al., Nature Medicine ., 2004, 10, 48). Therefore, inhibition of STAT3 activity is effective in controlling tumors by a complex anti-cancer mechanism, and since STAT3 protein is involved in various intracellular functions as well as tumors, its inhibitor discovery can be developed as an immunosuppressive agent.
  • the immune system controls specific immune responses to autoantigens in a normal state, and also suppresses immune responses to external antigens. For example, a pregnant woman's response to an unborn baby and a chronically infected microorganism Reaction. These phenomena are known to be induced by clonal deletion, clone anergy and active control by immunoregulatory T cells (Treg) as a mechanism by which antigen specific immunotolerance can be induced.
  • Treg immunoregulatory T cells
  • Investigating some patients who accidentally acquired immunotolerance against transplanted antigens or experimentally induced animal models showed that all three of these mechanisms are involved in immunological tolerance. Is attracting attention as an important cell involved in controlling almost all immune responses of living body such as autoimmune, tumoral immunity, infectious immune response as well as transplantation immune response.
  • immunoregulatory T cells ie immunoregulatory T lymphocytes (Tregs), which have recently been identified, can be largely divided into natural and adaptive Treg cells, and CD4 + CD25 + T cells, which are natural Tregs, It is given immunosuppressive function when newly created in the thymus, and is present in the frequency of 5-10% of peripheral CD4 + T lymphocytes of normal individuals.
  • the mechanism of immunosuppression of this cell is not yet known, but it has recently been discovered that the expression control factor of the gene, Foxp3, plays an important role in the differentiation and activity of the cell.
  • peripheral natural T cells can be differentiated into cells that exhibit immunosuppressive effects upon stimulation of autologous or external antigens under certain circumstances, which are called adaptive or inducible Tregs and secrete IL-10. These include Tr1, Th3 and CD8 Ts that secrete TGF- ⁇ .
  • T cells are also differentiated into Th17 cells through differentiation in addition to Treg cells.
  • Th17 cells are formed in the presence of TGF- ⁇ in common with Treg cells, but IL- for Treg cells.
  • Th17 cells are characterized by differentiating in the presence of IL-6 with TGF- ⁇ and secreting IL-17.
  • Th17 cells are characterized by having cytotoxicity that maximizes the signal of the inflammatory response to accelerate disease progression. Therefore, inhibition of differentiation or activity into Th17 cells is one of the ways to treat immune diseases.
  • the present inventors inhibited the differentiation of T cells from pathological cells to Th17 cells, and at the same time, Treg cells promoted differentiation and proliferation, thereby effectively treating immune diseases. It was confirmed that the cells can be used.
  • IL-1 beta, IL-6, VEGF, HMGB-1 inflammatory factors
  • anti-inflammatory factors IL-10, TGF-beta
  • mesenchymal stem cells overexpressed by the introduction of grim19 according to the present invention were shown to maintain their function as stem cells, and in particular, the expression of factors involved in cell migration was significantly increased, which effectively caused the lesion site. I could see that I could move.
  • stem cell-based therapeutics there should be an excellent therapeutic effect and the ability to move quickly and accurately to the lesion site.
  • stem cells In general, stem cells have weak mobility to the lesion site, requiring a large amount of cells to be administered. There is a problem, the loss of the inherent function of stem cells can not play a role as a therapeutic agent.
  • the mesenchymal stem cells overexpressed by Grim19 produced in the present invention have the inherent ability of stem cells as the cell differentiation ability is maintained, and furthermore, the cell migration ability is excellent, and even a small amount of cell administration is possible. There is a characteristic that can effectively move to the target site and exert a therapeutic effect.
  • mesenchymal stem cell is a stem cell isolated from bone marrow, blood, dermis, and periosteum, and is capable of differentiating into various cells such as adipocytes, chondrocytes, bone cells, and the like. pluripotent) or multipotent cells.
  • the mesenchymal stem cells may be mesenchymal stem cells of animals, preferably mammals, more preferably humans.
  • the mesenchymal stem cells are present in very small amounts, such as bone marrow, but the process of isolating and culturing them is well known in the art, for example, disclosed in US Pat. No. 5,486,359, which is incorporated herein by reference. Is inserted.
  • the mesenchymal stem cells can be obtained by separating them from the hematopoietic stem cells of bone marrow according to a known method and then proliferating without losing differentiation ability.
  • the process of obtaining mesenchymal stem cells is as follows.
  • the mesenchymal stem cells are isolated from mammalian, preferably human, mesenchymal stem cell sources, such as blood or bone marrow, including humans or mice.
  • the bone marrow can be extracted from the tibia, femur, spinal cord or iliac bone. Cells are then obtained from the bone marrow and these cells are cultured in a suitable medium. Suspension cells are removed during the culturing and passaged cells attached to the culture plate are obtained to finally obtain mesenchymal stem cells.
  • any medium commonly used for culturing stem cells can be used.
  • the medium contains serum (eg fetal calf serum, horse serum and human serum).
  • serum eg fetal calf serum, horse serum and human serum.
  • Medium that can be used in the present invention is, for example, RPMI series, Eagles's MEM, ⁇ -MEM, Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, DMEM, a mixture of DMEM and F12, Way- mo, h's MB752 / 1, McCoy's 5A and MCDB series, including but not limited to.
  • the medium may include other components such as antibiotics or antifungal agents (eg, penicillin, streptomycin), glutamine, and the like. General description of the medium and culture is described in Korean Patent No. 10-1446328, which is incorporated herein by reference.
  • Grim19-overexpressed mesenchymal stem cells having therapeutic efficacy for immunological diseases prepared in the present invention can be prepared by transforming the mesenchymal stem cells with a recombinant vector containing a Grim19 gene.
  • a polynucleotide encoding Grim19 protein is inserted into an appropriate expression vector, and the recombinant vector is transformed into mesenchymal stem cells to prepare mesenchymal stem cells overexpressing Grim19.
  • the recombinant vector may be a vector comprising a promoter and a polynucleotide encoding Grim19 operably linked thereto, but is not limited thereto, and a plasmid, phage, cosmid, viral vector or other known in the art. Means a medium.
  • the polynucleotide encoding the Grim19 in the present invention may be isolated or artificially modified in nature, the base sequence encoding the Grim19 protein may be modified by substitution, deletion or insertion of one or more nucleic acid base, Proteins expressed by such modifications should not include significant changes in their biological functionality. Such modifications include modifications to heterologous homologous genes.
  • the polynucleotide encoding the Grim19 protein is preferably characterized in that it is represented by the nucleotide sequence of SEQ ID NO: 1, but is not limited to the above polynucleotide, that is, at least 70%, preferably at least 80% More preferably, it is represented by the base sequence which has 90% or more homology.
  • the expression vector according to the present invention can be introduced into cells using methods known in the art. For example, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran- DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene guns and other known methods for introducing nucleic acids into cells Can be introduced into cells by the method of (Wu et al., J. Bio. Chem., 267: 963-967, 1992; Wu and Wu, J. Bio. Chem., 263: 14621-14624, 1988). .
  • Treg cells can promote differentiation and proliferation while inhibiting differentiation from T cells to pathological Th17 cells. May be usefully used as a cell therapy for treating immune diseases.
  • the present invention comprises co-culture of undifferentiated T cells with mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene, the differentiation of undifferentiated T cells into Regulatory T cells (Treg) and Methods for amplifying and promoting activity can be provided.
  • the activity means that all the mechanisms of the regulatory T cells (Treg), ie, Treg cells including both natural and adaptive Treg cells, are promoted or promoted in vivo.
  • Treg regulatory T cells
  • the immunomodulatory action such as immunosuppression is promoted or promoted so that the immune response in the body is maintained in a normal state.
  • the amplification refers to the differentiation and proliferation of undifferentiated T cells into regulatory T cells
  • 'differentiation' is a phenomenon that the structure or function of each other during the division and growth of cells, that is, the organism Cells or tissues are changed in form or function in order to perform a given task
  • 'proliferation' refers to the division of cells and homogeneous ones, which usually increase the number of cells in the body of a multicellular organism. I say going.
  • the immune disease means a disease in which components of the mammalian immune system cause, mediate or otherwise contribute to the pathology of the mammal.
  • stimulation or interruption of an immune response may include any disease that has a compensatory effect on the progression of the disease, and in the present invention may include diseases caused by an overactive immune response.
  • immune diseases include, but are not limited to, autoimmune diseases; Inflammatory diseases; And transplant rejection of cells, tissues, or organs.
  • the immune disease of the present invention is not limited thereto, but is not limited thereto, rheumatoid arthritis, asthma, dermatitis, psoriasis, cystic fibrosis, late organ transplantation, and chronic Post transplantation late and chronic solid organ rejection, Multiple Sclerosis, systemic lupus erythematosus, Sjogren syndrome, Hashimoto thyroiditis, polymyositis, scleroderma (scleroderma), Addison disease, vitiligo, pernicious anemia, glomerulonephritis and pulmonary fibrosis, inflammatory growth disease (Inflammatory Bowel Imses), autoimmune diabetes (Autoimmune) Diabetes, Diabetic retinopathy, Rhinitis, Ischemia-reperfusion injury, Post-angioplasty r estenosis, Chronic obstructive pulmonary diseases (COPD), Graves disease, Gastrointestinal allergies, Conjunctivitis, Atherosclerosis, Coronary artery disease An
  • an immune response occurs to autoantigens, which causes the attack of one's own tissue.
  • the disease caused by this process is called an autoimmune disease. .
  • Inflammatory diseases include excessive necrosis factor- ⁇ (TNF- ⁇ ) and IL-1 (interleukin- ⁇ ) secreted by immune cells such as macrophages due to excessive stimulation of the human immune system due to harmful stimuli such as inflammation-inducing factors or irradiation.
  • TNF- ⁇ necrosis factor- ⁇
  • IL-1 interleukin- ⁇ secreted by immune cells such as macrophages due to excessive stimulation of the human immune system due to harmful stimuli such as inflammation-inducing factors or irradiation.
  • inflammatory substances inflammatory cytokines
  • IL-6 IL-6
  • prostagladin luecotriene
  • nitric oxide nitric oxide
  • T cell The major mediator of GCC is T cell, which is induced by the T cell receptor to recognize the major histocompatibility complex (MHC) expressed in the graft.
  • MHC major histocompatibility complex
  • immunosuppressive agents are used to reduce the graft immune rejection response.
  • the common purpose of these immunosuppressive agents is to suppress T cell-mediated immune responses against the graft.
  • transplantation is achieved by suppressing the immune response using regulatory T cells. Attempts have been made to treat rejection diseases.
  • composition containing mesenchymal stem cells overexpressing Grim19 according to the present invention can be used as a pharmaceutical composition, preferably a cell therapy composition, which can prevent or treat immune diseases.
  • Treatment means to reverse, alleviate, inhibit the progression of, or prevent a disease or condition to which the term applies, or one or more symptoms of the disease or condition, unless otherwise stated, Treatment or therapy of immune diseases in mammals may comprise one or more of the following:
  • composition for preventing or treating immune diseases according to the present invention may include mesenchymal stem cells overexpressing a pharmaceutically effective amount of Grim19 alone or may include one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the pharmaceutically effective amount herein refers to an amount sufficient to prevent, ameliorate and treat the symptoms of an immune disease.
  • pharmaceutically acceptable refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction, such as gastrointestinal disorders, dizziness, or the like when administered to a human.
  • carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included.
  • compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.
  • the formulations may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, sterile powders.
  • composition for preventing or treating immune diseases according to the present invention may be administered through various routes including oral, transdermal, subcutaneous, intravenous or intramuscular, and the dosage of the active ingredient is determined by the route of administration, age, sex, It may be appropriately selected according to various factors such as the weight and the severity of the patient, and the composition for preventing or treating an immune disease according to the present invention is combined with a known compound having the effect of preventing, ameliorating or treating the symptoms of an immune disease. It may be administered, preferably parenterally. When administered parenterally, the pharmaceutical composition of the present invention may be administered by intravenous infusion, subcutaneous infusion, intramuscular infusion, intraperitoneal infusion, or the like.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to the recipient. Can be.
  • the dosage of the pharmaceutical composition of the present invention is preferably 1 ⁇ 10 3 -1 ⁇ 10 12 cells / kg per day.
  • the present invention also provides a method for producing mesenchymal stem cells overexpressed Grim19 having the effect of preventing and treating immune diseases, comprising transforming the mesenchymal stem cells with a recombinant vector containing the Grim19 gene in vitro.
  • Regulatory T cells (Tregs) of undifferentiated T cells which may also be provided, further comprising co-culturing the undifferentiated T cells with mesenchymal stem cells transformed with a recombinant vector containing the Grim19 gene. It is possible to provide a method for promoting the differentiation and activity of the furnace.
  • a method of reducing or inhibiting differentiation of undifferentiated T cells into Th17 cells in vitro and a method of activating regulatory T cells include Grim19 in a medium for culturing the T cells.
  • the overexpressed mesenchymal stem cells can be added and cultured together, and the co-cultivation of the mesenchymal stem cells transformed with the recombinant vector containing the undifferentiated T cells and the Grim19 gene is 1: 1/5 to 1: 1 /. It is desirable to mix at a cell number ratio of 50 and incubate at a temperature of 37 ° C. for 24 to 72 hours.
  • the mesenchymal stem cells overexpressing Grim19 according to the present invention can be easily mass-produced Treg cells by enabling undifferentiated T cells to be activated as cells for the treatment of immune diseases.
  • the present invention also provides a method for preventing or treating an immune disease comprising administering a mesenchymal stem cell transformed with a recombinant vector containing a Grim19 gene to a subject having an immune disease.
  • the immune diseases include rheumatoid arthritis, asthma, dermatitis, psoriasis, cystic fibrosis, late organ transplantation and chronic rejection, multiple sclerosis, systemic lupus erythematosus, Sjogren's syndrome, Hashimoto's thyroid, multiple myositis, scleroderma, Addison's disease, vitiligo, pernicious anemia , Glomerulonephritis and pulmonary fibrosis, inflammatory growth disease, autoimmune diabetes, diabetic retinopathy, rhinitis, tongue-reperfusion injury, restenosis after angioplasty, chronic obstructive heart disease, Grave disease, gastrointestinal allergy, conjunctivitis, atherosclerosis, coronary artery Diseases, angina pectoris, cancer metastasis, arterial disease, graft-versus-host disease and mitochondrial related syndromes, but is not limited thereto.
  • the adipose tissue obtained after surgical operation was washed 10 times with PBS containing 10% penicillin-streptomycin to remove blood and foreign matter, and the tissue was chopped to 0.2 g. Then, the tissue was added to a 0.2% collagenase (Roche, Sandhofer Strasse, Mannheim, Germany) solution and reacted at 100 rpm for 1 hour at a temperature of 37 °C. A 100 ⁇ m mesh was used to separate the solution layer digested with collagenase and the undigested pieces, followed by addition of the same amount of PBS to the separated collagenase solution. Subsequently, centrifugation was performed at 4 ° C.
  • MSC mesenchymal stem cells
  • MSCGM mesenchymal stem cell growth media: MSC basal medium (Cambrex, Walkersville, MD, USA), mesenchymal cell growth aids (Cambrex, Walkersville, MD, USA), 4 mM L-glutamine and penicillin (0.025 unit / 500 mL) / streptomycin (0.025 mg / 500 mL)] were added and again centrifuged at 4 ° C., 1200 rpm for 5 minutes.
  • MSCGM is a medium based on Dulbecco's modified Eagle's medium (DMEM) containing fetal calf serum. Subsequently, the supernatant was removed and the obtained MSC was inoculated into a culture dish and incubated in a 37 ° C., 5% CO 2 incubator with MSCGM. Thereafter, the culture medium was replaced every two days to obtain mesenchymal stem cells to be used in the following examples.
  • DMEM Dulbecco's modified Eagle's medium
  • the human grim19 gene sequence was first cloned into a viral vector using BamHI and XhoI restriction enzymes to prepare a human grim19 viral vector.
  • a vector map of the prepared PMX-IRES-GFP-hGrim19 is shown in FIG. 9.
  • PMX-IRES-GFP-hGrim19 a Grim19-containing vector
  • PMX-IRES-GFP-hGrim19 a Grim19-containing vector
  • the mesenchymal stem cells obtained in Example ⁇ 1-1> that is, the number of cells of mesenchymal stem cells 3 ⁇ 10 5 in a 60 mm dish.
  • the next day of reaction with the vector (2 ⁇ g) and the transfection reagent (X-Treme GENE HP transfection reagent, Rhoshe, 6 ⁇ l) the cells were treated overnight, and then the medium was exchanged with DMEM the next day.
  • the prepared vector was transduced into mesenchymal stem cells.
  • two days later, to confirm whether Grim19 was properly overexpressed in mesenchymal stem cells cell lysates were prepared for transduced mesenchymal stem cells, and Western blot was performed using Grim19 antibodies.
  • IL-1 beta using RT-PCR was performed on cells overexpressed with Grim19 and cells without Grim19. Intracellular expression levels of IL-6, VEGF, HMGB-1, IL-10 and TGF-beta were analyzed. Primers used for RT-PCR used the primer pairs described in the table below.
  • IL-1b As shown in FIG. 2, the expression of inflammatory factors IL-1b, IL-6, VEGF, and HMGB-1 in Grim19 introduced and overexpressed mesenchymal stem cells was significantly higher than that of wild type mesenchymal stem cells. In contrast, IL-10 and TGF-beta were found to have significantly increased expression.
  • mesenchymal stem cells overexpressed with Grim19 have the ability to increase the expression of anti-inflammatory factors while inhibiting the expression of inflammatory factors, that is, inflammatory factor regulation.
  • the present inventors performed the following experiment to check whether the cell migration ability in the mesenchymal stem cells into which Grim19 was introduced.
  • the cell therapeutic agent should be well transferred to a disease site or a target site.
  • the expression levels of CCR3, CCR4, CCR7 and CCR9 were used with the following primer pairs. Analysis by RT-PCR.
  • adipose derived mesenchymal stem cells overexpressed Grim19 analysis using a cell migration kit (Chemicon, Temecula, CA) was also performed. That is, a medium containing SDF-1 (20ng / ml) was placed in the lower chamber, and adipose tissue-derived mesenchymal stem cells were placed in the upper chamber. Since the adipose tissue-derived mesenchymal stem cells put on the top was confirmed by staining the cells passed through the polycarbonate membrane to move to the lower chamber. At this time, as a control of the experiments were used mesenchymal stem cells that Grim19 was not introduced.
  • the cell differentiation ability of the mesenchymal stem cells into which Grim19 was introduced and the mesenchymal stem cells to which Grim19 was not introduced was examined.
  • a differentiation induction culture kit (R & D # sc006) for differentiation into adipocytes, osteoblasts and chondrocytes was used. After dispensing the cells in a number of 1 ⁇ 10 4 cells in a 24-well plate, a culture kit was added. The cells were differentiated for 2 weeks by changing medium every 4 days. After staining with DAPI using an antibody against adipocyte differentiation factor marker FABP4 and osteoblast differentiation factor marker osteocalcin and chondrocyte differentiation factor aggrecan, cell differentiation was observed using a fluorescence microscope.
  • type II collagen (CII) and CFA (adjuvant) 1: 1 were mixed in DBA / 1J mice, and 100 ⁇ g of CII per mouse was injected at 50 ⁇ l into the tail base.
  • CII and IFA 1: 1 Arthritis animals were prepared by a second injection of the mixed solution at 100 ⁇ g / 50 ⁇ l.
  • IgG antibody is applied to a 96-well microtitier plate for 2 hours at room temperature, and then 50 ⁇ l of a serum sample collected from the mouse group used in the above ⁇ 5-1> is added to 1 well at room temperature. The reaction was time. After the reaction, the solution was washed three times with TBS (pH 8.0) solution containing 0.05% Tween 20 (Amresco), and then the IgG antibody was reacted for 1 hour. After washing with the above solution, the TMB + H 2 O 2 system (KPL , Gaithersburg, MD). This was read as absorbance at 450 nm, and the results of antibody measurements were expressed as absorbance itself.
  • TBS pH 8.0
  • Tween 20 Amresco
  • Splenocytes were obtained from each mouse used in the experiment, and the activity of Treg and Th17 cells in the splenocytes was analyzed by FACS.
  • the splenocytes of each mouse were collected and washed with FACs buffer for flow cytometry, which is used in the art, and then reacted with a perm wash buffer for 15 minutes at 4 ° C to block nonspecific binding. Washed. Thereafter, Anti Foxp3-FITC and anti IL-17 PE were added thereto, reacted at 4 ° C. for 30 minutes, and washed with perm wash buffer. After staining, the cells were washed with FACs buffer and analyzed for the number of Th17 and Treg cells following Grim19 overexpression using a flow cytometer (FACs, fluorescent-activated cell sorter).
  • FACs flow cytometer
  • the present inventors co-cultured Grim19-expressed mesenchymal stem cells with mouse CD4 + T cells to co-culture Grim19-expressed mesenchymal stem cells with mouse CD4 + T cells.
  • the change in cell number was analyzed. Specifically, the spleen extracted from the B6 mouse was chopped to the spleen tissue using a glass slide, and then erythrocytes in the spleen were removed with erythrocyte hemolysis solution, and then PBS buffer solution was added and centrifuged. Splenocytes were obtained, and then CD4 + T cells were separated using CD4 micro bead.
  • the isolated CD4 + T cells were co-cultured with mesenchymal stem cells overexpressing Grim19 of the present invention for 3 days, and the activity of CD4 + T cells to Treg cells according to the coculture was analyzed using a flow cytometer. The amount of IFN-r in the co-culture was measured through.
  • the isolated CD4 + T cells (1 ⁇ 10 6 ) cells and mesenchymal stem cells (1 ⁇ 10 5 ) cells were laid on a 24-well plate and co-cultured in 1 ml of RPMI culture solution for 3 days, and the cells were cultured after 3 days. Collected, flow cytometry was performed, and the amount of cytokines was measured by ELISA in culture.
  • the cells were treated with anti-CD4-percp antibody and anti-CD25-APC antibody, reacted at 4 ° C for 30 minutes, permeabilized the cells, and then reacted with anti-Foxp3-PE antibody. Analyzed with an analyzer. To analyze the activity of Tregs, cells expressing CD4 + CD25 + Foxp3 markers were analyzed.
  • Treg cells with immunomodulatory capacity expressing foxp3 were significantly increased by co-culture (increased from 1.74 to 4.87), whereas the inflammatory factor IFN The production of -r was found to be significantly reduced by coculture.
  • Treg cells expressing foxp3 expressing immunoregulatory ability increased significantly by co-culture (increased from 7.32 to 12.1). Production of IFN-r and IL-17 was found to be significantly reduced by coculture.
  • the present inventors performed the cell migration assay performed in Example 3 on mesenchymal stem cells overexpressed Grim19 and mesenchymal stem cells treated with STAT3 inhibitors STA21 and AG-490, respectively, mesenchymal stem cells was spread in a 60 mm dish with a cell number of 3 ⁇ 10 5 , and the next day, STA-21 and AG-490 were stimulated with 10 uM, and then cultured for 3 days, and the cultured cells were analyzed.
  • the mesenchymal stem cells of the present invention Grim19 overexpression of mesenchymal stem cells treated with STAT3 inhibitors showed that the expression of cell migration factors increased significantly. Therefore, these results showed that Grim19-induced mesenchymal stem cells can move more effectively to the lesion than stat3 inhibitors.
  • the present inventors target arthritis mouse animal models in the same manner as in Example ⁇ 5-1> of mesenchymal stem cells overexpressed with Grim19 and mesenchymal stem cells treated with STAT3 inhibitors STA21 and AG-490, respectively. Arthritis index was measured by.
  • the arthritis index showed that the mesenchymal stem cells overexpressed Grim19 was significantly reduced compared to the mesenchymal stem cells treated with STAT3 inhibitors. These results indicate that Grim19 overexpressed mesenchymal stem cells are more useful as cell therapy for the treatment of arthritis.
  • the present inventors performed the following experiment to determine whether the Grim19-produced mesenchymal stem cells prepared in Example ⁇ 1-2> can effectively treat Lupus disease.
  • Experiments were performed in Roquin mice (15 weeks old) who showed symptoms of lupus disease in the MSC injection group overexpressing Grim19, the MSC injection group without Grim19 introduction, and the Lupus disease mouse group without MSC injection.
  • the injection group was injected with 3 ⁇ 10 5 cells twice per mouse, injected at intervals of 1 week, and splenocytes were separated three days after completion of the injection to analyze the immune cells (T / B cell) group.
  • the assay serum was separated from each mouse, and then the amount of IgG was measured by ELISA. Also, the immune cells isolated from splenocytes were analyzed by flow cytometry to determine the number of cells in the Th2 and Th1 and Th17 cell groups. Analyzed.
  • FIG. 10 shows a time schedule of injecting Grim19-overexpressed MSC in the lupus disease mouse group, and the analysis of the immune cell group is shown in FIGS. 11A and 11B.
  • Tfh cells are overactive and B cell and antibody secretion are excessively increased.
  • Tfh cells we analyzed the activity of Tfh cells to determine whether Grim19 overexpressed MSCs could inhibit excessive activity of Tfh cells.
  • the amount of CD4 + PD-1 + CXCR5 + cells from mouse splenocytes was observed by flow cytometry, and the expression of ICOS in Tfh cells (CD4 + PD-1 + CXCR5 +) was expressed by histogram. Observed.
  • the degree of activity of germinal center B cells and plasma cells was analyzed.
  • the germinal center B cells analyzed GL-1 + CD95 + cells among B220 + cells, and the plasma cells showed the amount of B220-CD138 + cells. was observed by flow cytometry.
  • Tfh cells were shown to be reduced by the injection of MSC, ICOS expression was also reduced, but Grim19 overexpressed MSC injected group Tfh compared to MSC injection group It has been shown that the expression of cells and ICOS is further reduced.
  • Germinal center B cells and plasma cells were also significantly reduced in the group injected with Grim19-overexpressed MSC compared to the group injected with MSC (see FIG. 12B).
  • Regulatory B cells (Breg, CD1d + CD5 + CD19 + IL-10 +) and regulatory T cells (Treg, CD4 + CD25 + Foxp3 +) cell subtypes known as immunoregulatory cells were examined.
  • Breg cells analyzed IL-10-expressing cells among CD1d + CD5 + cells among CD19 cells, and Treg observed the amount of CD25 + Foxp3 + cells among CD4 + cells by flow cytometry.
  • IL-10 expression was increased in Breg cells of this cell group by MSC injection, and IL-10 expression was increased in the group injected with Grim19 overexpressing MSC compared to the MSC injection group.
  • IL-10 expression was increased in the group injected with Grim19 overexpressing MSC compared to the MSC injection group.
  • Grim19 overexpressing MSCs also showed an increased Treg cell population.
  • mice C57BL / 6 (H-2kb) mice were used to prepare mouse models inducing inflammatory bowel disease, and the induction of inflammatory bowel disease was induced by water containing 3% dextran sulfate sodium (DSS) in mice. Was taken for 1 week.
  • DSS dextran sulfate sodium
  • 3 ⁇ 10 5 cell numbers of MSCs and MSCs overexpressing Grim19 were injected intravenously into each mouse and analyzed at 10 days.
  • WT normal mouse
  • the production time schedule of mice induced with inflammatory bowel disease is shown in FIG. 14, and the analysis results are shown in FIGS.
  • the assay measured the DAI level of inflammatory bowel disease for each mouse group, and the length of the intestine was measured after separating the intestines from each mouse.
  • the group injected with MSC overexpressed with Grim19 compared to the group injected with MSC showed more significant improvement in the degree of disease of inflammatory bowel disease. It was confirmed to recover close to normal.
  • the present inventors have found that when the Grim19 overexpressed MSC is used, immune diseases such as inflammatory growth disease, lupus, and arthritis can be more effectively treated than the MSC alone or Grim19 alone.
  • the present invention was carried out with the support of the following national R & D program.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Developmental Biology & Embryology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 유효성분으로 포함하는, 면역질환의 예방 또는 치료용 세포치료제 조성물에 관한 것으로, 본 발명에 따른 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 염증성 사이토카인 및 염증 유발인자의 발현과 생성을 억제할 수 있고, 병인조건 하에서 미분화 T 세포와 공조 배양할 경우, T 세포의 세포 독성 Th17 및 Th1 세포로의 분화를 억제하며, 염증 반응을 제어하는 특성을 갖는 면역조절 T 세포(Treg)의 분화 및 활성을 증진시키고, 나아가 병변부위로 신속하고 정확하게 이동할 수 있는 능력이 있으므로, 본 발명의 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 각종 면역반응의 조절 이상으로 유발되는면역질환을 예방 또는 치료할 수 있는 세포치료제 조성물의 유효성분으로 사용할 수 있다.

Description

면역질환 치료 효능을 갖는 GRIM19이 과발현된 중간엽줄기세포 및 이의 용도
본 발명은 면역질환 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포 및 이의 용도에 관한 것이다.
전 세계적으로 면역과민반응으로 인한 질환이 증가하고 있지만, 이러한 질환들의 발생에 대한 근본적인 원인 규명이 충분히 이루어지지 않은 상태이다. 현재 과도한 면역반응에 의한 질환의 치료방법으로는 면역억제제를 단독 또는 병용 투여함으로써 상기 질환에 의해 야기되는 각종 증상을 완화 내지 감소시키는 것이다.
면역억제제란 항원의 작용에 대하여 숙주가 항체를 만드는 능력(체액성 면역반응) 또는 세포성 면역반응을 일으키는 능력을 저하시키거나 차단하기 위해 사용되는 다양한 물질들을 말한다. 이러한 면역억제제는 장기이식분야 뿐만 아니라 루푸스, 류마티스 관절염 등과 같은 자가면역질환과, 아토피, 알러지 등의 피부과민 반응에도 유용하게 사용될 수 있다. 우수한 면역억제제는 면역반응의 불균형을 조절할 수 있어야 하고, 인체에 대한 안전성이 확보되어야 하며, 장기간 치료시에 질환의 재발 발생 빈도가 낮아야 한다.
현재 사용되고 있는 면역억제제로는 사이클로스포린 A와 FK506 등이 있는데, 이들은 복잡한 화학구조를 가진 천연물 유래의 화합물로서 원료 수급의 측면에서 고비용이 드는 문제점이 있어 비경제적이고, 장기투여로 인해 각종 부작용이 야기될 수 있다는 위험성을 내포하고 있다. 따라서 낮은 독성 및 면역관용 유도와 함께 경제적인 생산이 가능한 새로운 면역억제제의 개발이 절실히 요구되고 있는 실정이다.
한편, 각종 병원체에 대한 생체 방어 시스템으로 면역계에서 중심적 역할을 담당하는 세포군의 하나로 T 세포가 있다. T 세포는 인체의 흉선에서 생성되며 일련의 분화 과정을 거치면서 고유의 특성을 지닌 T 세포로 분화하게 되는데, 분화를 완료한 T 세포는 그 기능에 따라 크게 1형 보조 세포(Th1)와 2형 보조 세포(Th2)로 구분된다. 이 중에서 Th1 세포의 주된 기능은 세포 매개성 면역에 관여하고, Th2 세포는 체액성 면역에 관여하며, 면역계에서 이러한 두 세포 집단은 서로 과 활성화되지 않도록 서로 견제를 통해 면역계의 균형을 유지하고 있다.
따라서 면역질환의 대부분은 이러한 두 가지 면역 세포간의 불균형에 기인하는 것으로 볼 수 있는데, 예를 들어 Th1 세포의 활성이 비정상적으로 증가하는 경우 자가면역질환이 발생할 수 있고, Th2 세포의 활성이 비정상적으로 증가하는 경우 과민반응에 의한 면역질환이 발생하는 것으로 알려져 있다.
한편, Th1 세포의 분화에 대한 최근 연구 결과에 따르면, Th1 세포의 활성을 조절할 수 있는 새로운 그룹인 면역조절 T 세포(Treg)의 존재가 알려지면서 이를 이용한 면역질환의 치료에 대한 연구가 대두되고 있는데, Treg 세포는 비정상적으로 활성화된 면역세포의 기능을 억제하여 염증 반응을 제어하는 특성이 있어, Treg 세포의 활성을 증가시키는 작용을 통해 면역질환을 치료하고자 하는 연구들이 많이 진행되고 있다.
또한, Treg 세포 이외에 T 세포의 분화 과정에서 만들어지는 또 다른 그룹으로 Th17 세포가 있는데, Th17 세포는 미분화 T세포의 분화 과정에서 Treg 세포의 분화와 유사한 과정을 거치며 형성되는 것으로 알려져 있다. 즉, Treg 세포와 Th17 세포의 분화는 공통적으로 TGF-β의 존재 하에서 이루어지지만, Treg 세포의 경우 IL-6을 필요로 하지 않는 반면, Th17 세포의 경우에는 TGF-β와 함께 IL-6가 존재하는 상황에서 분화를 한다. 또한, 분화된 Th17 세포는 IL-17을 분비하는 것을 특징으로 한다.
Th17 세포는 Treg 세포와는 달리 면역질환에서 보이는 염증반응의 최전방에서 관여하여 염증 반응의 신호를 최대화시켜 질병의 진행을 가속화시키는 것이 밝혀지고 있다. 그러므로 자가면역질환 중 Treg 세포에 의해 제어되지 않는 자가면역질환의 경우, Th17 세포 활성의 억제를 표적으로 한 자가면역질환의 치료제 개발이 크게 부각되고 있다.
현재 사용되고 있는 면역질환치료제로는 T 세포에서의 신호변환 경로를 차단하는 면역 억제제가 가장 많이 사용되고 있는데, 이러한 면역억제제들은 독성, 감염, 임파종, 당뇨병, 진전(tremor), 두통, 설사, 고혈압, 오심, 신기능 장애 등의 부작용이 발생하는 문제점이 있다.
또한, T 세포의 활성화를 억제하는 방법을 통해 면역질환을 치료하는 방법 이외에도 면역 세포로부터 분비되는 사이토카인의 양을 조절하는 치료법 및 면역 세포로부터 분비되는 사이토카인을 표적으로 하는 항체를 이용한 치료법이 개발 중에 있다(한국 공개특허 제2014-0032925호). 그러나 이러한 방법은 실제적으로 임상실험을 거쳐 환자들에게 적용하기까지 많은 시간이 소요되어야 하고, 항체를 이용하는 방법은 항체 제작 과정에서 너무 많은 비용이 든다는 문제점이 있다.
따라서 부작용이 없고 저렴하면서도 치료 효과가 우수한 새로운 면역질환 치료제 및 치료방법의 개발이 시급하다.
이에 본 발명자들은 Grim19이 도입되어 세포 내에서 Grim19이 과발현된 중간엽줄기세포가 각종 면역 관련 질환의 치료를 위한 세포치료제로서 유용하게 사용할 수 있음을 확인하고 본 발명을 완성하였다.
따라서 본 발명의 목적은 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 유효성분으로 포함하는, 면역질환의 예방 또는 치료용 세포치료제 조성물을 제공하는 것이다.
또한 본 발명의 다른 목적은 시험관 내에서 Grim19 유전자를 함유한 재조합 벡터로 중간엽줄기세포를 형질전환하는 단계를 포함하는, 면역질환의 예방 및 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포의 제조방법을 제공하는 것이다.
또한 본 발명의 다른 목적은 미분화 T 세포를 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포와 함께 공조 배양하는 단계를 포함하는, 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 촉진시키는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 유효성분으로 포함하는, 면역질환의 예방 또는 치료용 세포치료제 조성물을 제공한다.
본 발명의 일실시예에 있어서, 상기 Grim19 유전자는 서열번호 1의 염기서열로 이루어진 것일 수 있다.
본 발명의 일실시예에 있어서, Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 염증유발인자 및 염증성 사이토카인의 생성이 억제되고, Th1 및 Th17 세포의 분화 및 활성이 감소되며, 조절 T 세포(Regulatory T cell: Treg)의 분화 및 활성은 증진될 수 있다.
본 발명의 일실시예에 있어서, Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 세포이동 인자인 CCR3, CCR4, CCR7 및 CCR9의 발현이 증가되어 있어 병변부위로의 이동할 수 있는 능력이 있다.
본 발명의 일실시예에 있어서, 상기 면역질환은 류마티스 관절염 (Rheumatoid Arthritis), 천식 (Asthma), 피부염 (Dermititis), 건선 (Psoriasis), 낭섬유증 (Cystic Fibrosis), 고형장기 이식 후기 및 만성 거부증 (Post transplantation late and chronic solid organ rejection), 다발성 경화증 (Multiple Sclerosis), 전신성 홍반성 루푸스(systemic lupus erythematosus), 쇼그렌 증후군(Sjogren syndrome), 하시모토 갑상선(Hashimoto thyroiditis), 다발성근염(polymyositis), 경피증(scleroderma), 아디슨병(Addison disease), 백반증(vitiligo), 악성빈혈(pernicious anemia), 사구체신염(glomerulonephritis) 및 폐섬유증(pulmonary fibrosis), 염증성장질환 (Inflammatory Bowel Dieseses), 자가면역성 당뇨 (Autoimmune Diabetes), 당뇨 망막증 (Diabetic retinopathy), 비염 (Rhinitis), 혀혈-재관류 손상 (Ischemia-reperfusion injury), 혈관성형술후 재협착 (Post-angioplasty restenosis), 만성 폐색성 심장 질환 (Chronic obstructive pulmonary diseases; COPD), 그레이브병 (Graves disease), 위장관 알러지 (Gastrointestinal allergies), 결막염 (Conjunctivitis), 죽상경화증 (Atherosclerosis), 관상동맥질환 (Coronary artery disease), 협심증 (Angina), 암 전이, 소동맥 질환, 이식편대숙주질환(graft-versus-host disease) 및 미토콘드리아 관련 증후군으로 이루어진 군으로부터 선택되는 것일 수 있다.
또한, 본 발명은 시험관 내에서 Grim19 유전자를 함유한 재조합 벡터로 중간엽줄기세포를 형질전환하는 단계를 포함하는, 면역질환의 예방 및 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포의 제조방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 Grim19 유전자는 서열번호 1의 염기서열로 이루어진 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 Grim19이 과발현된 중간엽줄기세포는 염증유발인자 및 염증성 사이토카인의 생성이 억제되고, Th1 및 Th17 세포의 분화 및 활성이 감소되며, 조절 T 세포(Regulatory T cell: Treg)의 분화 및 활성은 증진되는 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 Grim19이 과발현된 중간엽줄기세포는 세포이동 인자인 CCR3, CCR4, CCR7 및 CCR9의 발현이 증가되어 있어 병변부위로의 이동 능력이 있는 것일 수 있다.
또한, 본 발명은 미분화 T 세포를 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포와 함께 공조 배양하는 단계를 포함하는, 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 촉진시키는 방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 공조 배양은 미분화 T 세포와 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 1:1/5~1:1/50의 세포수 비로 혼합하여 37℃의 온도에서 24~72 시간동안 배양하는 것일 수 있다.
본 발명에 따른 Grim19이 과발현되도록 형질전환된 중간엽줄기세포는 염증성 사이토카인 및 염증 유발인자의 발현과 생성을 효과적으로 억제할 수 있고, T 세포의 세포 독성 Th17 및 Th1 세포로의 분화를 억제하는 효과가 있으며, 비정상적으로 활성화된 면역세포의 기능을 억제하고 염증 반응을 제어하는 특성을 갖는 면역조절 T 세포(Treg)의 분화 및 활성을 증진시키는 효과가 우수한 특징이 있다. 나아가 Grim19이 과발현된 중간엽줄기세포는 병변부위로 용이하게 이동할 수 있는 능력이 우수하다. 따라서 Grim19이 과발현된 중간엽줄기세포는 각종 면역반응의 조절 이상으로 유발되는 자가면역질환, 염증성질환 및 이식거부질환과 같은 면역질환을 예방 또는 치료할 수 있는 세포치료제로 사용할 수 있는 효과가 있다.
도 1은 본 발명의 일실시예에서 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 Grim19 이 도입되지 않은 중간엽줄기세포를 대상으로 세포 내에서 Grim19 단백질의 과발현 정도를 웨스턴 블럿을 통해 확인한 결과를 나타낸 것이다.
도 2는 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 대조군 중간엽줄기세포(Grim19 유전자가 도입되지 않은 세포)를 대상으로 세포 내에서 IL-1 beta, IL-6, VEGF, HMGB-1, IL-10, TGF-beta의 발현 정도를 분석한 결과를 나타낸 것이다.
도 3a는 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 대조군 중간엽줄기세포(Grim19 유전자가 도입되지 않은 세포)를 대상으로 세포이동 인자인 CCR3, CCR4, CCR7, CCR9의 발현 정도를 측정한 결과를 나타낸 것이다.
도 3b는 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 대조군 중간엽줄기세포(Grim19 유전자가 도입되지 않은 세포)를 대상으로 세포이동 분석을 수행한 결과를 형광현미경으로 관찰한 사진을 나타낸 것이다.
도 4는 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 대조군 중간엽줄기세포(Grim19 유전자가 도입되지 않은 세포)를 대상으로 지방세포, 골세포, 연골세포로의 분화용 배지를 이용하여 세포를 배양한 후, 지방세포, 골세포, 연골세포로의 분화 여부를 각 지표인자에 대한 항체를 이용하여 염색한 결과를 나타낸 것이다.
도 5a는 관절염이 유발된 마우스군을 대상으로 Grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포와 대조군 중간엽줄기세포(Grim19 유전자가 도입되지 않은 세포)를 각각 복강 내 투여한 다음, 관절염의 증상을 측정한 결과를 나타낸 것이며, 5b는 혈청 내 염증 항체인 IgG의 생성 변화를 측정한 결과이며, 5c 및 5d는 Treg/Th17 세포수를 분석한 결과를 나타낸 것이다.
도 6a 및 6b는 마우스 유래 T 세포를 대상으로 Grim19 이 과발현되는 중간엽줄기세포와 공조배양 후, 마우스 유래 T 세포에서 Foxp3+Treg 세포수와 인터페론 감마의 생성량을 분석한 결과를 나타낸 것이다.
도 7a 및 7b는 인간 유래 T 세포를 대상으로 Grim19 이 과발현되는 중간엽줄기세포와 공조배양 후, 마우스 유래 T 세포에서 Foxp3+Treg 세포수와 인터페론 감마의 생성량을 분석한 결과를 나타낸 것이다.
도 8a는 Grim19이 과발현된 중간엽줄기세포, stat3 억제제(STA21)가 처리된 중간엽줄기세포 및 아무것도 처리하지 않은 대조군 중간엽줄기세포를 대상으로 세포이동인자들의 발현 정도를 분석한 결과를 나타낸 것이고, 8b는 관절염 동물모델을 대상으로 이들 세포를 복강내 주입하여 관절염 개선 정도를 분석한 결과를 나타낸 것이다.
도 9는 본 발명의 일실시예에서 Grim19 유전자가 도입된 재조합 벡터인 pMX-IRES-GFP-hGrim19의 벡터제조 과정 및 벡터지도를 나타낸 것이다.
도 10은 본 발명의 일실시예에 따라서 루프스가 유발된 마우스 모델에서 줄기세포 주입 시기에 대한 과정을 나타낸 것이다.
도 11a는 본 발명의 일실시예에서 루프스가 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 마우스 혈청 내 IgG의 양을 ELISA를 이용하여 분석한 결과를 나타낸 것이다.
도 11b는 본 발명의 일실시예에서 루프스가 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 비장내 면역세포군인 Th2, Th1, Th17 세포군의 수를 유세포 분석기를 통해 분석한 결과를 나타낸 것이다.
도 12a는 본 발명의 일실시예에서 루프스가 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 Tfh 세포의 활성도를 분석한 결과를 나타낸 것이다.
도 12b는 본 발명의 일실시예에서 루프스가 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 Germinal center B 세포 및 플라즈마 세포(plasma cell)의 활성도를 분석한 결과를 나타낸 것이다.
도 13은 루프스가 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 면역조절 T 세포 및 면역조절 B 세포의 세포수 및 활성도를 분석한 결과를 나타낸 것이다.
도 14는 본 발명의 일실시예에 따라서 염증성 장질환이 유발된 마우스 모델에서 줄기세포 주입 및 실험과정을 나타낸 것이다.
도 15a 및 도 15b는 염증성 장질환이 유발된 마우스에 대해 Grim19 유전자가 도입된 MSC 주입에 따른 염증성 장질환의 질환증상 개선도(도 15a) 및 장 길이 개선정도(도 15b)를 분석한 결과를 나타낸 것이다.
본 발명은 면역질환을 보다 효과적으로 치료할 수 있는 세포치료제를 개발하기 위해 연구하던 중, Grim19이 과발현되도록 제조한 중간엽줄기세포가 면역질환 치료효과가 우수하다는 것을 확인함으로써, Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물을 제공함에 그 특징이 있다.
본 발명에서 주목한 상기 Grim19(gene associated with retinoid-IFN-induced mortality 19)은 세포의 죽음과 관련된 유전자로 밝혀졌고, 최근에는 yeast-2-hybrid 스크리닝을 통해 STAT3와 상호작용을 하는 파트너로 알려진 바 있다(Zhang J, Yang J, Roy SK, Tininini S, Hu J, Bromberg JF. The cell death regulator Grim-19 is an inhibitor of signal transducer and activator of transcription 3. Proc Natl Acad Sci USA. 2003;100:9342-9347). 초기 STAT3 관련 인자들이 거론되었을 때, PIAS3 및 SOCS3(suppressor of cytokine signaling 3)는 STAT3의 억제 피드백으로 거론된 바 있고, SOCS 단백질은 JAKs을 억제하여 리간드에 의해 유도되는 반응을 억제하는 활성이 있으며, PIAS 단백질은 STAT3의 인산화를 억제하는 활성이 있는 것으로 알려져 있다(Starr R, Hilton DJ. Negative regulation of the JAK/STAT pathway. Bioessays 1999;21:4752). 또한 Grim19는STAT3에 의해 유도되는 전사를 억제하는 역할을 하는 것으로 알려져 있는데 흥미롭게도 Grim19은 SOCS3 및 PIAS3와는 달리 타이로신(tyrosin)과 세린(serine) 잔기의 인산화를 억제하거나 DNA 결합을 방해하지 않는다(Chung CD, Liao J, Liu B, Rao X, Jay P, Berta P. Specific inhibition of Stat3 signal transduction by PIAS3. Science. 1997;278:1803-1805). 반면, Grim19는 STAT3의 트랜스 활성 도메인(trans activation domain:TAD)에 결합하여 STAT3에 관련된 전사를 억제할 때 STAT3가 인산화되어 핵으로 전위되는 것을 억제하는 작용을 한다고 알려져 있다(Dhananjaya V. Kalvakolanu. The Grims: a new interface between cell death regulation and interferon/retinoid induced growth suppression. Cytokine & Growth Factor Reviews. 2004;15:169-194).
한편, STAT(Signal transducers and activators of transcription)는 신호전달 및 전사조절 단백질로서, 사이토카인, 호르몬, 성장인자 등의 세포외 자극에 의해 활성화되어 타이로신 잔기가 인산화되고, SH2 도메인의 상호작용으로 이량체(dimer)가 형성되어 핵 안으로 들어가 특정 프로모터에 결합하게 된다. 이런 STAT 단백질의 신호체계는 탈인산화 작용 및 단백질 분해에 의해 억제될 수 있다.
특히, 최근에는 다양한 암종에서 STAT1, STAT3 및 STAT5의 활성화된 형태가 발견되고 있는데, STAT3는 백혈병과 같은 혈액암 뿐만 아니라, 유방암, 두부경부암, 흑색종, 난소암, 폐암, 췌장암, 전립선암과 같은 다양한 고형암에서 활성화되어 있어 중요한 항암 타겟이 되고 있다(Hua Yu and Richard Jove, Nature Reviews Cancer., 2004, 4, 97-105).
또한, STAT3의 활성은 세포사멸을 억제하고, 신생혈관(angiogenesis)을 유도하며, 면역회피를 유도하는 것으로 알려진 바 있다((Wang T. et al., Nature Medicine., 2004, 10, 48). 따라서 STAT3 활성 억제는 복합적인 항암 기작으로 종양을 제어할 수 있는 효과가 있고, STAT3 단백질은 종양뿐만 아니라 다양한 세포내 기능에도 관여하므로 이의 저해제 발굴은 면역억제제로의 개발도 가능하다.
일반적으로 면역계는 정상상태에서는 자가항원에 대한 특이적 면역반응을 제어하고 있으며, 외부항원에 대한 면역반응도 억제하고 있는 경우가 있는데, 예컨대 임산부의 태아에 대한 반응 및 만성감염상태에 있는 미생물에 대한 면역반응을 들 수 있다. 이러한 현상들은 항원 특이적 면역관용이 유도될 수 있는 기전으로 클론 제거(clonal deletion), 클론 무반응(anergy) 및 면역조절 T 세포(Treg)에 의한 능동적 통제에 의해 유도되는 것으로 알려져 있다. 이식항원에 대한 면역관용이 우연히 획득된 일부 환자나 실험적으로 면역관용을 유도한 동물모델을 조사해 보면 위의 세 가지 기전 모두 이식면역관용에 관여한다는 사실이 확인되고 있고, 특히 최근에는 면역조절 T 림프구가 이식면역반응 뿐만 아니라 자가면역, 종양면역, 감염면역반응 등 생체의 거의 모든 면역반응을 통제하는데 관여하는 중요한 세포로 주목받고 있다.
또한 최근 그 존재가 밝혀진 면역조절 T 세포, 즉, 면역조절 T 림프구(Treg)는 크게 자연성(natural) Treg 와 적응성(adaptive) Treg 세포로 나눌 수 있으며, 자연성 Treg인 CD4+ CD25+ T 세포는 이 세포가 흉선에서 새로이 만들어질 때부터 면역억제기능을 부여받게 되며, 정상개체의 말초 CD4+ T 림프구 중 5~10%의 빈도로 존재한다. 아직까지 이 세포의 면역억제 기전은 정확히 파악되지 못하고 있지만, Foxp3라는 유전자의 발현 제어 인자가 이 세포의 분화와 활성에 중요한 역할을 수행한다는 사실이 최근에 밝혀졌다. 또한, 말초 자연성 T 세포는 특정 환경하에서 자가 또는 외부항원의 자극을 받으면 면역억제효과를 나타내는 세포로 분화될 수 있는데, 이를 적응성(adaptive) 또는 유도성(inducible) Treg로 부르며, IL-10을 분비하는 Tr1, TGF-β를 분비하는 Th3 및 CD8 Ts등이 여기에 해당한다.
또한, 앞서 종래기술에도 기술한 바와 같이, T 세포는 Treg 세포 이외에 분화 과정을 통해 Th17 세포로도 분화되는데, Th17 세포는 Treg 세포와 공통적으로 TGF-β의 존재 하에서 이루어지지만 Treg 세포의 경우 IL-6을 필요로 하지 않는 반면, Th17 세포의 경우에는 TGF-β와 함께 IL-6가 존재하는 상황에서 분화하고, IL-17을 분비하는 것을 특징으로 한다.
또한, Th17 세포는 염증 반응의 신호를 최대화시켜 질병의 진행을 가속화시키는 세포독성을 가지는 특성이 있다. 따라서 Th17 세포로의 분화 또는 활성의 억제는 면역질환을 치료할 수 있는 방법 중 하나이다.
이러한 점에서 본 발명자들은 T 세포에서 병적 세포인 Th17 세포로의 분화를 억제하면서 동시에 Treg 세포는 분화와 증식을 촉진함을 통해 보다 효과적으로 면역질환을 치료할 수 있는 방법으로서, grim19이 도입된 중간엽줄기세포를 사용할 수 있음을 확인하였다.
본 발명의 일실시예에 따르면, grim19 유전자를 함유하는 재조합 벡터로 형질전환된 중간엽줄기세포의 경우, 세포 내에서 염증성 인자(IL-1 beta, IL-6, VEGF, HMGB-1)들의 발현이 감소되고 있는 반면 항염증 관련 인자(IL-10, TGF-beta)들의 발현은 증가되는 것으로 나타났고 미분화 t세포와 함께 공조배양할 경우, Th17세포로의 분화는 억제되면서 treg 세포로의 분화는 활성화되어 Treg/Th17 세포비가 현저하게 증가하는 것으로 나타났다.
또한 본 발명에 따른 grim19이 도입되어 과발현된 중간엽줄기세포는 줄기세포로서의 기능을 여전히 유지하고 있는 것으로 나타났으며, 특히 세포이동에 관여하는 인자들의 발현이 현저하게 증가되어 있어 병변부위로 효율적으로 이동할 수 있음을 알 수 있었다.
줄기세포를 이용한 세포치료제의 경우, 우수한 치료효과와 더불어 병변부위로 신속하고 정확하게 이동할 수 있는 능력이 있어야 하는데 보통 줄기세포의 경우 병변부위로의 이동력이 약해 엄청나게 많은 양의 세포를 투여해야 하는 문제점이 있으며, 줄기세포의 고유의 기능을 상실하게 되어 치료제로서의 역할을 발휘하지 못하는 문제점이 있었다.
이러한 점에서 본원발명에서 제조한 Grim19이 과발현되는 중간엽줄기세포는 세포분화능력이 유지되고 있음을 확인함에 따라 줄기세포 고유의 능력을 지니고 있으며 나아가 세포이동 능력도 우수하여 적은양의 세포투여로도 효과적으로 목적 부위로 이동 및 치료효과를 발휘할 수 있는 특징이 있다.
본 발명에서 사용되는 용어 "중간엽줄기세포"는 골수(bone marrow), 혈액, 진피 및 골막에서 분리되는 줄기세포로서, 다양한 세포 예컨대 지방세포, 연골세포 및 뼈세포 등으로 분화할 수 있는 전능성(pluripotent) 또는 다능성(multipotent) 세포를 의미한다. 상기 중간엽줄기세포는 동물, 바람직하게는 포유동물, 보다 바람직하게는 인간의 중간엽줄기세포일 수 있다.
또한 중간엽줄기세포는 골수 등에 매우 적은 양으로 존재하지만, 이를 분리 및 배양하는 과정은 당업계에 잘 알려져 있으며, 예컨대, 미국특허 제5,486,359호에 개시되어 있으며, 상기 특허 문헌은 본 명세서에 참조로서 삽입된다. 또한, 상기 간엽줄기세포는 공지된 방법에 따라 골수의 조혈모세포로부터 부착 특성에 의해 분리한 후 분화능력을 잃지 않은 상태에서 증식시켜 얻을 수 있다.
또한 중간엽줄기세포를 얻는 과정을 설명하면 다음과 같다. 인간 또는 마우스를 포함하는 포유동물, 바람직하게는, 인간의 중간엽줄기세포 소스, 예컨대, 혈액 또는 골수로부터 중간엽줄기세포를 분리한다. 상기 골수는 경골, 대퇴골, 척수 또는 장골로부터 추출할 수 있다. 이어, 골수로부터 세포를 얻고, 이들 세포를 적합한 배지에서 배양한다. 배양과정에서 부유 세포를 제거하고 배양 플레이트에 부착된 세포들을 계대 배양하여, 최종적으로 구축된(established) 중간엽줄기세포를 수득한다. 상기 과정에서 이용되는 배지로는, 줄기세포의 배양에 이용되는 일반적인 어떠한 배지도 이용할 수 있다. 바람직하게는, 혈청(예컨대, 우태아 혈청, 말 혈청 및 인간 혈청)이 함유된 배지이다. 본 발명에서 이용될 수 있는 배지는, 예를 들어, RPMI 시리즈, Eagles's MEM , α-MEM, Iscove's MEM, 199 배지, CMRL 1066, RPMI 1640, F12, F10, DMEM, DMEM과 F12의 혼합물, Way-mo, h's MB752/1, McCoy's 5A 및 MCDB 시리즈을 포함하나, 이에 한정되는 것은 아니다. 상기 배지에는, 다른 성분, 예를 들어, 항생제 또는 항진균제(예컨대, 페니실린, 스트렙토마이신) 및 글루타민 등이 포함될 수 있다. 배지 및 배양에 대한 일반적인 설명은 한국 등록특허 제10-1446328호에 기재되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다.
본 발명에서 제조한 면역질환 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포는 상기 중간엽줄기세포에 Grim19 유전자를 함유하는 재조합 벡터로 형질전환시켜 제조할 수 있다.
상기 Grim19이 과발현되는 중간엽줄기세포를 제조하기 위해 Grim19 단백질을 코딩하는 폴리뉴클레오티드를 적절한 발현 벡터에 삽입하고, 재조합 벡터를 중간엽줄기세포로 형질전환하여 Grim19이 과발현되는 중간엽줄기세포를 제조할 수 있다.
본 발명에서 상기 재조합 벡터는 프로모터 및 이와 작동가능하게 연결된 Grim19를 암호화하는 폴리뉴클레오티드를 포함하는 벡터일 수 있으며, 이에 제한되지는 않으나, 당업계에 공지된 플라스미드, 파지, 코스미드, 바이러스벡터 또는 기타 매개체를 의미한다. 또한 본 발명에서 상기 Grim19를 암호화하는 폴리뉴클레오티드는 자연에서 분리되거나 인위적으로 합성 변형된 것일 수 있는데, Grim19 단백질을 암호화하는 염기서열은 하나 이상의 핵산 염기가 치환, 결실 또는 삽입에 의해 변형될 수 있으며, 이러한 변형에 의해 발현된 단백질은 이의 생물학적 작용성에 유의한 변화를 포함하지 않아야 한다. 상기한 변형은 이종의 상동성 유전자로의 변형을 포함한다.
따라서 Grim19 단백질을 암호화하는 폴리뉴클레오티드는 바람직하게는 서열번호 1의 염기서열로 표시되는 것을 특징으로 하되, 이에 한정되지 않고 상기의 폴리뉴클레오티드, 즉, 핵산 서열과 70% 이상, 바람직하게는 80% 이상, 보다 바람직하게는 90% 이상의 상동성을 갖는 염기 서열로 표시되는 것을 특징으로 한다.
본 발명에 따른 상기 발현벡터는 당업계에 공지된 방법을 사용하여 세포에 도입할 수 있다. 예를 들어 이에 한정되지는 않으나, 일시적 형질감염(transient transfection), 미세주사, 형질도입(transduction), 세포융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질감염(liposome-mediated transfection), DEAE 덱스트란-매개된 형질감염(DEAE Dextran- mediated transfection), 폴리브렌-매개된 형질감염(polybrene-mediated transfection), 전기침공법(electropora tion), 유전자 총(gene gun) 및 세포 내로 핵산을 유입시키기 위한 다른 공지의 방법에 의해 세포 내로 도입할 수 있다(Wu et al., J. Bio. Chem., 267:963-967, 1992; Wu and Wu, J. Bio. Chem., 263:14621-14624, 1988).
상기 기술된 본 발명에 따른 Grim19이 과발현된 중간엽줄기세포는 T 세포에서 병적 세포인 Th17 세포로의 분화를 억제하면서 동시에 Treg 세포는 분화와 증식을 촉진할 수 있는 특징이 있으며 이러한 중간엽줄기세포는 면역질환을 치료하기 위한 세포치료제로서 유용하게 활용될 수 있다.
또한 본 발명은 미분화 T 세포를 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포와 함께 공조 배양하는 단계를 포함하는, 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 증폭 및 촉진시키는 방법을 제공할 수 있다.
본 발명에서 상기 활성이란 생체 내에서 조절 T 세포(Regulatory T cell: Treg), 즉, 자연성(natural) Treg와 적응성(adaptive) Treg 세포를 모두 포함하는 Treg 세포가 가지는 모든 기작이 촉진 또는 증진되는 것을 말하며, 생체 내의 면역반응이 정상 상태를 유지하도록 면역조절작용, 예컨대 면역억제반응이 촉진 또는 증진되는 것을 말한다.
또한, 상기 증폭(expansion)이란 미분화 T 세포가 조절 T 세포로 분화 및 증식되는 것을 말하는 것으로서, '분화(differentiation)'는 세포가 분열 증식하여 성장하는 동안에 서로 구조나 기능이 특수화하는 현상, 즉 생물의 세포, 조직 등이 각각에게 주어진 일을 수행하기 위하여 형태나 기능이 변해가는 것을 말하며, '증식(proliferation)' 은 세포가 분열되어 동질의 것이 불어나는 것으로서 보통 다세포생물의 체내에서 세포수가 증가되어 가는 것을 말한다.
본 발명에서 상기 면역질환은 포유류 면역계의 구성성분들이 포유류의 병리상태를 야기하거나, 매개하거나 또는 기타 공헌하는 질환을 의미한다. 또한, 면역 반응의 자극 또는 중단이 그 질병의 진행에 보상적인 효과를 갖는 질환을 모두 포함할 수 있는데, 본 발명에서는 과민성 면역반응으로 인해 야기되는 질환들을 포함할 수 있다. 이러한 면역질환의 예로는 이에 제한되지는 않으나, 자가면역질환; 염증성질환; 및 세포, 조직 또는 기관의 이식거부(transplantation rejection)질환 등을 모두 포함할 수 있다.
바람직하게 상기 본 발명의 면역질환은 이에 제한되지는 않으나, 류마티스 관절염 (Rheumatoid Arthritis), 천식 (Asthma), 피부염 (Dermititis), 건선 (Psoriasis), 낭섬유증 (Cystic Fibrosis), 고형장기 이식 후기 및 만성 거부증 (Post transplantation late and chronic solid organ rejection), 다발성 경화증 (Multiple Sclerosis), 전신성 홍반성 루푸스(systemic lupus erythematosus), 쇼그렌 증후군(Sjogren syndrome), 하시모토 갑상선(Hashimoto thyroiditis), 다발성근염(polymyositis), 경피증(scleroderma), 아디슨병(Addison disease), 백반증(vitiligo), 악성빈혈(pernicious anemia), 사구체신염(glomerulonephritis) 및 폐섬유증(pulmonary fibrosis), 염증성장질환 (Inflammatory Bowel Dieseses), 자가면역성 당뇨 (Autoimmune Diabetes), 당뇨 망막증 (Diabetic retinopathy), 비염 (Rhinitis), 혀혈-재관류 손상 (Ischemia-reperfusion injury), 혈관성형술후 재협착 (Post-angioplasty restenosis), 만성 폐색성 심장 질환 (Chronic obstructive pulmonary diseases; COPD), 그레이브병 (Graves disease), 위장관 알러지 (Gastrointestinal allergies), 결막염 (Conjunctivitis), 죽상경화증 (Atherosclerosis), 관상동맥질환 (Coronary artery disease), 협심증 (Angina), 암 전이, 소동맥 질환, 이식편대숙주질환(graft-versus-host disease) 및 미토콘드리아 관련 증후군을 포함할 수 있다.
한편, 모든 정상 개체에 있어서 가장 중요한 특성 중의 하나는 자기(self)를 구성하고 있는 항원물질에 대해서는 해롭게 반응하지 않는 반면, 비자기(non-self) 항원들에 대해서는 이를 인식하고 반응하여 제거할 수 있는 능력을 가지고 있다. 이처럼 자기항원에 대한 생체의 무반응을 면역학적 무반응성(immunologic unresponsiveness) 또는 관용(tolerance)이라고 한다.
그러나 이러한 자기관용을 유도하거나 계속 유지하는데 있어서 문제가 생기게 되면 자기항원에 대하여 면역반응이 일어나게 되고, 이로 인하여 자신의 조직을 공격하는 현상이 발생하는데 이러한 과정에 의해 발생되는 질환을 자가면역질환이라고 한다.
또한, 염증성 질환이란 염증유발인자 또는 방사선조사 등 유해한 자극으로 인해 인체 면역체계를 과도하게 항진시켜 대식세포와 같은 면역세포에서 분비되는 TNF-α(tumor necrosis factor-α), IL-1(interleukin-1), IL-6, 프로스타글란딘(prostagladin), 루코트리엔(luecotriene) 또는 산화질소(nitric oxide, NO)와 같은 염증유발물질(염증성 사이토카인)에 의해 유발되는 질환을 말한다.
한편, 성공적인 장기 이식을 위해서는 이식할 세포 및 장기에 대한 수혜자의 면역 거부반응을 극복해야 한다. 이식면역거부반응의 주요 매개체는 T 세포로서, 이식편(graft)에 발현되어져 있는 주조직적합성분자(major histocompatibility complex, MHC)를 T 세포 수용체(T cell receptor)가 인지함으로써 면역반응이 유도되어 이식거부반응이 발생되게 된다. 따라서 이러한 이식면역거부반응을 감소시키기 위해 면역억제제들이 사용되고 있는데 이러한 면역억제제들의 공통된 목적은 이식편에 대한 T 세포-매개 면역반응을 억제하는 것이며, 최근에는 조절 T 세포를 이용하여 면역반응을 억제함으로써 이식거부질환을 치료하려는 방법이 시도되고 있다.
그러므로 본 발명에 따른 Grim19이 과발현되는 중간엽줄기세포를 함유하는 조성물은 면역질환을 예방 또는 치료할 수 있는 약학적 조성물, 바람직하게는 세포치료용 조성물로 사용될 수 있다.
상기 치료란, 달리 언급되지 않는 한, 상기 용어가 적용되는 질환 또는 질병, 또는 상기 질환 또는 질병의 하나 이상의 증상을 역전시키거나, 완화시키거나, 그 진행을 억제하거나, 또는 예방하는 것을 의미하며, 포유동물에 있어서 면역질환의 치료 또는 치료요법은 하기의 하나 이상을 포함할 수 있다:
(1) 면역질환의 성장을 저해함, 즉, 그 발달을 저지시킴,
(2) 면역질환의 확산을 예방함, 즉, 전이를 예방함,
(3) 면역질환을 경감시킴.
(4) 면역질환의 재발을 예방함, 및
(5) 면역질환의 증상을 완화함(palliating)
본 발명에 따른 면역질환의 예방 또는 치료용 조성물은 약학적으로 유효한 양의 Grim19이 과발현된 중간엽줄기세포를 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함할 수 있다. 상기에서 약학적으로 유효한 양이란 면역질환의 증상을 예방, 개선 및 치료하기에 충분한 양을 말한다.
또한, 상기에서 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 상기 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
또한, 본 발명의 조성물은 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 사용하여 제형화될 수 있다. 제형은 분말, 과립, 정제, 에멀젼, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 멸균 주사용액, 멸균 분말의 형태일 수 있다.
또한, 본 발명에 따른 면역질환의 예방 또는 치료용 조성물은 경구, 경피, 피하, 정맥 또는 근육을 포함한 여러 경로를 통해 투여될 수 있으며, 활성 성분의 투여량은 투여 경로, 환자의 연령, 성별, 체중 및 환자의 중증도 등의 여러 인자에 따라 적절히 선택될 수 있고, 본 발명에 따른 면역질환의 예방 또는 치료용 조성물은 면역질환의 증상을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병행하여 투여할 수 있으며 바람직하게는 비경구로 투여할 수 있다. 비경구로 투여되는 경우 본 발명의 약제학적 조성물은 정맥내 주입, 피하 주입, 근육 주입 및 복강 주입 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 수용자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 투여량은 바람직하게는 1일 당 1 × 103 - 1 × 1012 세포/kg 이다.
또한, 본 발명은 시험관 내에서 Grim19 유전자를 함유한 재조합 벡터로 중간엽줄기세포를 형질전환하는 단계를 포함하는, 면역질환의 예방 및 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포의 제조방법을 제공할 수 있으며, 또한, 미분화 T 세포를 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포와 함께 공조 배양하는 단계를 포함하는, 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 촉진시키는 방법을 제공할 수 있다.
본 발명에 따른 상기 시험관(in vitro)내에서 미분화 T 세포의 Th17 세포로의 분화를 감소 또는 억제하는 방법, 및 조절 T 세포를 활성화시키는 방법의 바람직한 방법은, 상기 T 세포를 배양하는 배지에 Grim19이 과발현된 중간엽줄기세포를 첨가하여 함께 배양할 수 있으며, 상기 공조 배양은 미분화 T 세포와 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 1:1/5~1:1/50 의 세포수 비로 혼합하여 37℃의 온도에서 24 ~72 시간동안 배양하는 것이 바람직하다.
따라서 본 발명에 따른 Grim19이 과발현된 중간엽줄기세포는 미분화 T 세포를 면역질환 치료를 위한 세포로 활성화 될 수 있도록 하여 Treg 세포를 용이하게 대량생산할 수 있다.
또한, 본 발명은 면역질환이 유발된 개체에 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 투여하는 단계를 포함하는 면역 질환의 예방 또는 치료 방법을 제공한다.
상기 면역질환은 류마티스 관절염, 천식, 피부염, 건선, 낭섬유증, 고형장기 이식 후기 및 만성 거부증, 다발성 경화증, 전신성 홍반성 루푸스, 쇼그렌 증후군, 하시모토 갑상선, 다발성근염, 경피증, 아디슨병, 백반증, 악성빈혈, 사구체신염 및 폐섬유증, 염증성장질환, 자가면역성 당뇨, 당뇨 망막증, 비염, 혀혈-재관류 손상, 혈관성형술후 재협착, 만성 폐색성 심장 질환, 그레이브병, 위장관 알러지, 결막염, 죽상경화증, 관상동맥질환, 협심증, 암 전이, 소동맥 질환, 이식편대숙주질환 및 미토콘드리아 관련 증후군으로 이루어진 군으로부터 선택되는 어느 하나일 수 있으나, 이에 한정하지 아니한다.
이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
<실시예 1>
Grim19이 도입된 중간엽줄기세포의 제조
<1-1> 중간엽줄기세포의 분리
외과적 수술 후에 얻어진 지방 조직을 10% 페니실린-스트렙토마이신을 포하는 PBS로 10회 세척하여 혈액과 이물질을 제거한 후, 조직을 0.2g이 되도록 잘게 절단하였다. 이후 조직을 0.2% 콜라게나아제(Roche, Sandhofer Strasse, Mannheim, Germany) 용액에 넣어서 37℃의 온도 조건으로 100rpm에서 1시간 동안 반응시켰다. 100 ㎛ 메쉬를 이용하여 콜라게나아제에 의해서 분해된 용액층과 분해되지 않은 조각을 분리한 후, 분리된 콜라게나아제 용액에 동량의 PBS를 첨가하였다. 이어, 4℃, 1200 rpm에서 5분간 원심분리하여 상층액인 지질과 지방층을 제거하고, 콜라게나아제 상층액을 제거하였다. 이후 가라앉은 중간엽줄기세포(MSC)로부터 남은 콜라게나아제 용액을 제거하기 위해서 MSCGM [mesenchymal stem cell growth media: MSC 기본 배지 (Cambrex, Walkersville, MD, 미국), 간엽세포 성장 보조물 (Cambrex, Walkersville, MD, 미국), 4 mM L-글루타민 및 페니실린(0.025 unit/500 ㎖)/스트렙토마이신(0.025 mg/500 ㎖)]를 첨가하고 다시 4℃, 1200 rpm에서 5 분간 원심분리 하였다. MSCGM은 우태아혈청을 포함하는 DMEM (Dulbecco's modified Eagle's medium)에 기초한 배지이다. 이어, 상층액을 제거하고 수득한 MSC를 배양 접시에 접종하고 MSCGM로 37℃, 5% CO2 항온기에서 배양하였다. 이후 이틀에 한번 씩 배양액을 교체하면서 배양하여 하기 실시예에서 사용할 중간엽줄기세포를 수득하였다.
<1-2> Grim19 유전자를 포함하는 재조합 벡터로 형질전환된 중간엽줄기세포 제조
중간엽줄기세포로 grim19 유전자를 함유하는 재조합 벡터의 도입을 위해 먼저 Human grim19 viral 벡터를 제조하기 위해 human grim19 유전자 서열을 BamHI 및 XhoI의 제한효소를 이용하여 viral vector로 클로닝 하였고 클로닝 과정 및 상기 방법으로 제조된 PMX-IRES-GFP-hGrim19의 벡터지도를 도 9에 나타내었다.
이후 제조된 Grim19 함유 벡터인 PMX-IRES-GFP-hGrim19을 실시예 <1-1>에서 수득한 중간엽줄기세포 내로 형질도입하였는데, 즉, 60mm dish에 중간엽줄기세포 3×105의 세포수로 깔아주고 다음날 벡터(2㎍)와 transfection reagent(X-Treme GENE HP transfection reagent, Rhoshe, 6㎕)를 반응시킨 후 상기 세포에 처리하여 밤새도록 반응시킨 다음, 다음날에 DMEM으로 배지를 교환하여 상기 제조된 벡터를 중간엽줄기세포 내로 형질도입하였다. 그런 뒤, 2일 후, 중간엽줄기세포 내에서 Grim19이 제대로 과발현 되었는지 확인하기 위해 형질도입된 중간엽줄기세포를 대상으로 세포 용해물을 제조하고 Grim19 항체를 이용하여 웨스턴 블럿을 수행하였다.
그 결과, 도 1에 나타낸 바와 같이, 재조합 벡터가 도입된 중간엽줄기세포에서는 Grim19 단백질이 과발현되고 있는 것을 알 수 있었다.
<실시예 2>
Grim19이 도입된 중간엽줄기세포의 염증인자 조절 능력 분석
실시예 1에서 제조한 Grim19이 도입된 중간엽줄기세포의 염증인자 조절 능력을 분석하기 위해, Grim19이 과발현된 세포와 Grim19이 도입되지 않은 세포를 대상으로 RT-PCR을 이용하여 IL-1 beta, IL-6, VEGF, HMGB-1, IL-10 및 TGF-beta의 세포내 발현 정도를 분석하였다. RT-PCR을 위해 사용한 프라이머는 하기 표에 기재된 프라이머쌍을 이용하였다.
프라이머 서열
유전자명 정방향 프라이머 서열번호 역방향 프라이머 서열번호
IL-1 beta GGA CAA GCT GAG GAA GAT GC 2 TCG TTA TCC CAT GTG TCG AA 3
IL-6 AAT TCG GTA CAT CCT CGA CGG 4 GGT TGT TTT CTG CCA GTG CC 5
VEGF CCA TGA ACT TTC TGC TGT CTT 6 ATC GCA TCA GGG GCA CAC AG 7
HMGB-1 GAT CCC AAT GCA CCC AAG AG 8 TTC GCA ACA TCA CCA ATG A 9
IL-10 CCA AGC CTT GTC TGA GAT GA 10 TGC GGC AGC TGT ACA TTG A 11
TGF-beta TGA GGG TCT TCA GGT TCT CC 12 TGG TTG TAC AGG GCC AGG A 13
분석 결과, 도 2에 나타낸 바와 같이, Grim19이 도입되어 과발현된 중간엽줄기세포에서는 염증인자들인 IL-1b, IL-6, VEGF, HMGB-1의 발현이 wild type의 중간엽줄기세포에 비해 유의미하게 억제되어 있는 것으로 나타났고, 반면, IL-10 및 TGF-beta는 발현이 유의미하게 증가되어 있는 것으로 나타났다.
따라서 이러한 결과를 통해 본 발명자들은 Grim19이 과발현된 중간엽줄기세포가 염증인자들의 발현은 억제하면서 항염증 인자들의 발현은 증가시킬 수 있는 능력, 즉 염증인자 조절능을 가지고 있음을 알 수 있었다.
<실시예 3>
Grim19이 도입된 중간엽줄기세포의 세포이동 능력분석
나아가 본 발명자들은 Grim19이 도입된 중간엽줄기세포를 대상으로 세포 이동능력이 있는지 확인하기 위해 다음과 같은 실험을 수행하였다. 세포체료제를 이용하여 효과적으로 목적 질환을 치료하기 위해서는 질병부위 또는 타겟부위로 세포치료제가 잘 이동되어져야 한다. Grim19이 도입된 중간엽줄기세포의 경우, 목적 부위로의 원활한 이동이 가능한지 확인하기 위하여, 중간엽줄기세포의 이동과 관련된 인자인 CCR3, CCR4, CCR7 및 CCR9의 발현정도를 하기 프라이머쌍을 이용하여RT-PCR로 분석하였다.
또한, Grim19이 과발현된 지방유래 중간엽줄기세포의 세포 이동을 확인하기 위해, 세포이동키트(Chemicon, Temecula, CA)를 사용한 분석도 수행하였다. 즉, 아래 챔버에는 SDF-1(20ng/ml)이 함유된 배지를 넣어두었고, 지방조직 유래 간엽줄기세포를 위의 챔버에 넣어주었다. 이후 위에 넣어준 지방조직 유래 중간엽줄기세포가 아래 챔버로 이동하기 위해 polycarbonate membrane을 통과한 세포를 염색하여 확인하였다. 이때 상기 실험들의 대조군으로는 Grim19이 도입되지 않은 중간엽줄기세포를 이용하였다.
프라이머 서열
유전자명 정방향 프라이머 서열번호 역방향 프라이머 서열번호
CCR3 TTTGTCATCATGGCGGTGTTTTTC 14 GGTTCATGCAGCAGTGGGAGTAG 15
CCR4 GAGAAGAAGAACAAGGCGGTGAAGA 16 GGATTAAGGCAGCAGTGAACAAAAG 17
CCR7 GCCGAGACCACCACCACCTT 18 AGTCATTGCATCTGCTCCCTATCC 19
CCR9 TATACAGCCAAATCAAGGAGGAATC 20 CATGACCACGAAGGGAAGGAAG 21
분석결과, 도 3a에 나타낸 바와 같이, 중간엽줄기세포의 이동에 관여하는 인자들 모두 Grim19이 도입되지 않은 세포에서는 거의 발현이 되지 않거나 매우 소량 발현된 반면, Grim19이 도입된 세포에서는 현저하게 많은 양으로 발현되고 있는 것으로 나타났다. 따라서 이러한 결과를 통해 Grim19이 도입된 중간엽줄기세포는 병소부위로 원활한 이동이 가능할 수 있음을 알 수 있었다. 도 3b의 결과를 통해서도 Grim19 과발현된 MSC가 SDF-1이 함유된 배지로의 이동이 대조군에 비해 월등히 우수함을 확인할 수 있었다.
<실시예 4>
Grim19이 도입된 중간엽줄기세포의 줄기세포 기능 유지 분석
Grim19이 도입된 중간엽줄기세포 자체가 줄기세포의 기능을 유지할 수 있는지 확인하기 위해 Grim19이 도입된 중간엽줄기세포과 Grim19이 도입되지 않은 중간엽줄기세포를 대상으로 세포분화능을 확인하였다. 이를 위해 지방세포, 골세포 및 연골세포로의 분화를 위한 분화유도 배양액 키트(R&D #sc006)을 이용하였는데, 24웰 플레이트에 세포를 각각 1×104의 개수로 분주한 후, 배양액 키트를 첨가하고 4일마다 배지를 교환하여 2주간 세포를 분화시켰다. 이후 지방세포 분화인자 마커인 FABP4 및 골세포 분화인자 마커인 osteocalcin과 연골세포 분화인자인 aggrecan에 대한 항체를 이용하여 DAPI로 염색한 후, 형광현미경을 이용하여 세포분화를 관찰하였다.
분석결과, 도 4에 나타낸 바와 같이, Grim19이 도입되지 않은 중간엽줄기세포와 도입된 중간엽줄기세포 모두 지방세포, 골세포 및 연골세포로 분화되는 것을 확인할 수 있었다. 따라서 Grim19이 도입된 중간엽줄기세포가 줄기세포 자체의 기능을 그대로 유지하고 있음을 알 수 있었다.
<실시예 5>
관절염 치료 효능 분석
<5-1> 관절염 동물모델을 대상으로 관절염 지수 분석
Grim19이 도입된 본 발명의 중간엽줄기세포가 면역질환 중 하나인 관절염을 실제적으로 치료할 수 있는 효과가 있는지 확인하기 위해 다음과 같은 실험을 수행하였다.
먼저, DBA/1J마우스에 type II collagen(CII)과 CFA(adjuvant) 1:1 로 혼합하여 마우스당 100㎍의 CII를 tail base에 50㎕ 용량으로 주사하였다 2주 후, CII와 IFA 1:1로 혼합액을 100㎍/50㎕로 2차로 주입하는 방법으로 관절염 동물을 제작하였다.
관절염 유도마우스 1주일 후 1주일에 1회 총3회 정맥 내 1×106의 복강 내 아무것도 처리되지 않은 중간엽줄기세포 및 Grim19 유전자가 과발현된 중간엽줄기세포를 각각 주입하였으며, 각 군은 5마리씩을 대상으로 진행하였고 관절염 평가를 진행하였다. 첫 번째 접종을 시작점으로 하여 3주 후부터 실험의 내용을 알고 있지 않은 관찰자 세 명이 일주일에 두 번씩 관절 염증의 위중도를 평가하여 33일까지 관찰하였다. 이 때 관절염 평가는 마리당 2차 접종 때 CII/CFA를 투여한 다리를 제외한 나머지 세 다리에서 아래의 척도에 따라 매긴 점수를 합하여 3으로 나눈 평균치를 얻고, 다시 각 동물 모델에서 3명의 관찰자가 얻은 수치를 합산하여 나눈 평균치를 사용하였다. 관절염 평가에 따른 점수와 기준은 다음과 같다.
-평가 기준-
0점: 부종이나 종창이 없다.
1점: 발 또는 발목관절에 국한된 경한 부종과 발적
2점: 발목관절에서 족근골(metatarsal)에 걸친 경한 부종과 발적
3점: 발목관절에서 족근골에 걸친 중등도의 부종과 발적
4점: 발목에서 다리 전체에 걸쳐 부종과 발적이 있는 경우
투여한 후 관절염 평가를 진행하였다.
분석결과, 도 5a에 나타낸 바와 같이, Grim19이 과발현된 중간엽줄기세포를 주입한 마우스 군이 대조군 중간엽줄기세포를 주입한 마우스 군에 비해 관절염이 더욱 의미있게 억제됨을 알 수 있었다.
<5-2> IgG 항체 항체 조절 효과 분석
또한, Grim19이 과발현된 중간엽줄기세포가 항체를 조절할 수 있는 효과가 있는지 알아보기 위하여 하기와 같이 실험하였다.
먼저, IgG항체를 상온에서 2시간 동안 96-웰 마이크로필터 플레이트(well microtitier plate)에 도포한 다음 상기 <5-1>에서 사용한 마우스 군으로부터 수집한 혈청 샘플을 well당 50㎕씩 넣고 실온에서 1시간 반응 시켰다. 반응이 끝나면 0.05% Tween 20(Amresco)이 포함된 TBS(pH 8.0)용액으로 3번씩 세척 후, IgG항체를 1시간 동안 반응시키고, 위의 용액으로 세척한 후 TMB +H2O2 system(KPL, Gaithersburg, MD)으로 발색하였다. 이는 450nm에서 흡광도로 읽었으며, 항체 측정 결과는 흡광도 자체로 표시하였다.
그 결과, 도 5b에 나타낸 바와 같이, 관절염이 유도된 마우스군에 비해 증간엽줄기세포를 주입한 마우스 군들이 IgG 항체 분비가 감소한 것으로 나타났으며, Grim19이 과발현된 간엽줄기세포가 가장 효과적으로 IgG 항체 분비를 억제하는 것으로 나타났다.
<5-3> Th17/IL-17 억제와 Foxp3+Treg 증가 효과 분석
상기 실험에서 사용한 각 마우스로부터 비장세포를 수득하고, 비장세포 내 Treg 및 Th17 세포의 활성을 FACS로 분석하였다. 즉 이를 위해 각 마우스의 비장세포를 각각 모으고 당업계에서 사용되고 있는 유세포분석을 위한 FACs buffer로 세포들을 세척한 후, 비특이성 결합을 억제하기 위해 blocking을 4℃에서 15분간 반응한 뒤 perm wash buffer로 세척하였다. 이후, Anti Foxp3-FITC와 anti IL-17 PE를 넣고 4℃에서 30분간 반응한 뒤 perm wash buffer로 세척하였다. 염색이 끝난 세포는 FACs buffer로 세척한 후, 유세포분석기(FACs, fluorescent-activated cell sorter)를 이용하여 Grim19 과발현에 따른 Th17 세포 및 Treg 세포의 세포수를 뷴석하였다.
분석 결과, Grim19-MSC가 도입된 관절염 마우스는 Treg의 활성이 증가된 반면, Th17세포의 활성은 억제되어 있는 것으로 나타났고, Treg/Th17의 ratio이 Grim19-MSC의 경우, 다른 대조군에 비해 월등히 우수하여 Treg/Th17세포의 밸런스가 Treg쪽으로 유도되고 있다는 것을 알 수 있었다. 따라서 이러한 결과를 통해 본 발명에서 제조한 Grim19이 도입된 중간엽줄기세포의 경우, 효과적으로 면역질환을 치료할 수 있도록 면역조절능을 갖는 Treg 세포 활성은 현저하게 상승시키는 반면 병인세포인 Th17세포의 활성을 억제시키고 있음을 알 수 있었다(도 5c 및 도 5d 참조).
<실시예 6>
T 세포 조절능력 분석
<6-1> 마우스 CD4+ T 세포와의 공조배양에 따른 T 세포 조절능력 확인
나아가 본 발명자들은 Grim19이 과발현된 중간엽줄기세포가 T 세포의 능력을 조절할 수 있는지 확인하기 위해, Grim19이 과발현된 중간엽줄기세포를 마우스 CD4+ T 세포와 공조배양 한 후, 세포조절능을 갖는 Treg 세포수의 변화를 분석하였다. 구체적으로 이러한 분석을 위해 B6 마우스로부터 적출된 비장을 유리 슬라이드를 이용하여(teasing slide) 비장 조직을 잘게 갈은 후, 적혈구 용혈 용액으로 비장내의 적혈구를 제거하였다, 이후 PBS 완충 용액을 첨가하고 원심 분리하여 비장세포를 수득하였고, 이후 CD4 micro bead를 이용하여 CD4+ T 세포를 분리하였다. 분리된 CD4+ T세포는 본 발명의 Grim19이 과발현되는 중간엽줄기세포와 3일간 공조배양하였고, 공조배양에 따른 CD4+ T세포의 Treg 세포로의 활성여부를 유세포분석기를 사용하여 분석하였으며, 또한 ELISA 방법을 통해 공조배양액 내의 IFN-r의 양을 측정하였다. 이때 상기 공조배양은 분리된 CD4+ T세포(1×106)세포와 중간엽줄기세포(1×105)세포를 24well 플레이트에 깔고 RPMI 배양액 1ml 내에서 3일간 공조배양하였으며, 3일 후 세포를 수집하여 유세포분석을 진행하였고, 배양액을 대상으로 ELISA를 통해 사이토카인의 양을 측정하였다. 유세포기를 이용한 분석은 anti-CD4-percp antibody와 anti-CD25-APC antibody를 세포에 처리하고 4℃에서 30분간 반응시킨 다음, 세포를 permeabilization 한 다음, anti-Foxp3-PE antibody로 각각 반응시키고 유세포 분석기로 분석하였다. Treg의 활성을 분석하기 위해 CD4+CD25+Foxp3 마커를 발현하는 세포를 대상으로 분석하였다.
분석결과, 도 6a 및 6b에 나타낸 바와 같이, foxp3을 발현하고 있는 면역조절능을 갖는 Treg 세포가 공조배양에 의해 유의미하게 증가하는 것으로 나타났으며(1.74에서 4.87로 증가) 반면, 염증성인자인 IFN-r의 생성은 공조배양에 의해 유의미하게 감소되는 것으로 나타났다.
<6-2> 인간 CD4+ T 세포와의 공조배양에 따른 T 세포 조절능력 확인
Grim19이 과발현된 중간엽줄기세포가 인간 T 세포도 조절할 수 있는지 확인하기 위해, <6-1>에서 마우스 CD4+ T세포 대신 인간 CD4+ T세포를 대상으로 하여 동일하게 실험을 수행하였다. 이때 상기 인간 CD4+ T세포는 정상인의 혈액으로부터 ficoll 원심분리하여 말초단핵세포를 분리하였고, human CD4 microbead(Miltenyi biotec) 를 이용하여 CD4+ T cell을 분리하였다.
분석결과, 도 7a 및 도 7b에 나타낸 바와 같이, foxp3을 발현하고 있는 면역조절능을 갖는 Treg 세포가 공조배양에 의해 유의미하게 증가하는 것으로 나타났으며(7.32에서 12.1로 증가) 반면, 염증성인자인 IFN-r 및 IL-17의 생성은 공조배양에 의해 유의미하게 감소되는 것으로 나타났다.
이러한 결과를 통해 본 발명자들은 면역질환을 효과적으로 치료할 수 있는 세포치료제의 제조방법으로서 Grim19이 과발현된 중간엽줄기세포를 T 세포와 공조배양하여 Treg 세포를 증폭 및 활성화 시킬 수 있음을 알 수 있었다.
<실시예 7>
STAT3 억제제가 처리된 중간엽줄기세포와 Grim19이 과발현된 중간엽줄기세포와의 면역질환 치료효능 비교
<7-1> 세포이동실험
본 발명자들은 Grim19이 과발현된 중간엽줄기세포와 STAT3억제제인 STA21 및 AG-490이 각각 처리된 중간엽줄기세포를 대상으로 상기 실시예 3에서 수행한 세포이동 분석 실험을 수행하였는데, 중간엽줄기세포를 60mm dish에 3×105의 세포수로 깔아주고 다음날, STA-21 및 AG-490을 각각 10uM로 자극한 후 3일 동안 배양하고 배양된 세포를 대상으로 분석하였다.
분석결과, 도 8a에 나타낸 바와 같이, STAT3억제제가 처리된 중간엽줄기세포에 비해 본 발명의 Grim19이 과발현된 중간엽줄기세포가 세포이동 인자들의 발현이 월등이 증가된 것으로 나타났다. 따라서 이러한 결과를 통해 stat3 억제제보다 Grim19이 도입된 중간엽줄기세포가 더 효과적으로 병변부위로 이동할 수 있음을 알 수 있었다.
<7-2> 관절염 치료 효능
본 발명자들은 Grim19이 과발현된 중간엽줄기세포와 STAT3 억제제인 STA21 및 AG-490이 각각 처리된 중간엽줄기세포를 대상으로 상기 실시예 <5-1>의 방법과 동일하게 관절염 마우스 동물모델을 대상으로 관절염 지수를 측정하였다.
분석결과, 도 8b에 나타낸 바와 같이, 관절염 지수는 STAT3억제제가 처리된 중간엽줄기세포에 비해 Grim19이 과발현된 중간엽줄기세포가 더 현저하게 감소된 것으로 나타났다. 이러한 결과는 Grim19이 과발현된 중간엽줄기세포가 관절염 치료를 위한 세포치료제로서 더 유용함을 나타내는 것이라고 할 수 있다.
< 실시예 8>
Grim19이 과발현된 중간엽줄기세포를 이용한 루프스 치료 효능 분석
<8-1> IgG 및 면역세포군 분석
본 발명자들은 상기 실시예 <1-2>에서 제조한 Grim19이 과발현된 중간엽줄기세포가 루프스 질환을 효과적으로 치료할 수 있는지 확인하기 위해 다음과 같은 실험을 수행하였다. 루푸스 질환 증상을 나타내는 Roquin마우스(15주령)를 대상으로 Grim19이 과발현된 MSC 주입군과, Grim19이 도입되지 않은 MSC 주입군 및 MSC를 주입하지 않은 루프스 질환 마우스 군을 대상으로 실험을 수행하였고, 세포 주입군은 각 마우스당 3×105 세포수를 2회 주입하였으며, 1주일 간격으로 주입하였고, 주입 완료 후 3일후에 비장세포를 분리하여 면역세포(T/B cell)군을 분석하였다.
상기 분석은 각 마우스로부터 혈청을 분리한 후, IgG의 양을 ELISA로 측정하였으며, 또한 비장세포에서 분리한 면역세포들에 대해 유세포분석기를 이용하여 분석함으로써 Th2 세포군 및 Th1, Th17 세포군의 세포수를 분석하였다.
분석 결과, 도 10은 루프스 질환 마우스 군을 대상으로 Grim19이 과발현된 MSC를 주입하는 타임 스케줄을 나타낸 것이고, 면역세포군에 대한 분석은 도 11a 및 도 11b에 나타내었다.
도 11a에 나타낸 바와 같이, IgG의 양은 다른 군에 비해 Grim19이 과발현된 MSC를 주입한 군에서 낮은 농도로 검출됨을 확인하였다. 따라서, Grim19이 과발현된 세포에 의해 면역과잉 반응이 감소될 수 있음을 알 수 있었고, 도 11b에 나타난 결과를 통해 Th2 세포군은 다른 군에 비해 유의미하게 증가하는 것으로 확인되었으며, 반면, Th1, Th17 세포군은 다른 군에 비해 Grim19이 과발현된 MSC를 주입한 군에서 유의적으로 감소되는 것으로 나타났다.
<8-2> Tfh 세포 활성 분석
일반적으로 루프스가 발병되면 Tfh 세포가 과활성되어 있어 B 세포 및 항체분비가 과도하게 증가되어 있다.
따라서 본 발명자들은 Grim19이 과발현된 MSC가 Tfh 세포의 과도한 활성을 억제시킬 수 있는지 확인하기 위해 Tfh 세포의 활성을 분석하였다. Tfh 세포의 활성을 분석하기 위해, 마우스 비장세포로부터 CD4+PD-1+CXCR5+ 세포의 양을 유세포 분석을 통해 관찰하였고, 또한 Tfh세포(CD4+PD-1+CXCR5+)내 ICOS의 발현은 히스토그램으로 관찰하였다.
또한, Germinal center B 세포 및 플라즈마 세포(plasma cell)의 활성 정도로 분석하였는데, B 세포 분석을 위해, Germinal center B cell은 B220+ 세포 중 GL-1+CD95+ 세포를 분석하였으며, plasma세포는 B220-CD138+ 세포의 양을 유세포분석을 통해 관찰하였다.
분석 결과, 도 12a에 나타낸 바와 같이, Tfh 세포는 MSC 주입에 의해 감소되는 것으로 나타났고, ICOS의 발현도 감소되는 것으로 나타났으나, Grim19이 과발현된 MSC을 주입한 군은 MSC 주입군에 비해 Tfh 세포 및 ICOS의 발현이 더욱 현저하게 감소되는 것으로 나타났다.
또한, Germinal center B 세포 및 플라즈마 세포(plasma cell)의 활성 역시 MSC 주입군에 비해 Grim19이 과발현된 MSC을 주입한 군에서 더욱 현저하게 감소되는 것으로 나타났다(도 12b 참조).
<8-3> 면역조절 T 세포(Treg) 및 B 세포(Breg) 조절 분석
면역조절세포로 알려진 regulatory B cell(Breg, CD1d+CD5+CD19+IL-10+) 및 regulatory T cell (Treg, CD4+CD25+Foxp3+)세포 아형군을 조사하였다. Breg 세포는 CD19세포 중 CD1d+CD5+세포 중에서 IL-10을 발현하는 세포를 분석하였으며, Treg은 CD4+ 세포 가운데 CD25+Foxp3+세포의 양을 유세포분석을 통해 관찰하였다.
분석 결과, MSC 주입에 의해 이러한 세포군의 Breg 세포에서는 IL-10 발현이 증가되는 것으로 나타났고, Grim19 과발현 MSC를 주입한 군에서는 MSC 주입군에 비해 IL-10의 발현이 더욱 증가되는 것으로 나타났다. 또한, Grim19 과발현 MSC는 Treg 세포 집단(poplation)도 증가되어 있는 것으로 나타났다.
따라서 이러한 결과를 통해, Grim19 과발현 MSC가 생체 내에 주입되면 병인 T 및 B 세포는 억제시키는 반면 면역조절 T세포 및 면역조절 B세포는 의미있게 증가되어 질환을 효과적으로 억제시킬 수 있는 것으로 나타났다(도 13 참조).
<실시예 9>
Grim19이 과발현된 중간엽줄기세포를 이용한 염증성 장질환 치료 효능 분석
염증성 장질환이 유발된 마우스 모델을 제조하기 위해 C57BL/6(H-2kb) 마우스를 사용하였으며, 염증성 장질환의 유도는 마우스에 3% 덱스트란 설페이트 소듐(dextran sulfate sodium, DSS)이 함유된 물을 1주일간 섭취하게 하였다. 섭취 후, 5일 또는 8일에 되는 때에 3×105 세포수의 MSC와 Grim19이 과발현된 MSC를 각 마우스에 정맥주사로 주입하였고 10일째에 치사하여 분석을 하였다. 이때 대조군으로는 정상 마우스에 PBS만을 주입한 군(WT)을 사용하였다. 염증성 장질환이 유발된 마우스의 제조 타임 스케줄은 도 14에 나타내었고, 분석결과는 도 15a 및 도 15b에 나타내었다.
분석은 각 마우스 군에 대해 염증성장질환의 DAI 수치를 측정하였고, 각 마우스로부터 장을 분리한 후, 장의 길이를 측정하였다.
분석 결과, 도 15a 및 도 15b에 나타낸 바와 같이, MSC를 주입한 군에 비해 Grim19이 과발현된 MSC를 주입한 군이 더 유의적으로 염증성장질환의 질환 정도가 개선되는 것으로 나타났고, 장 길이도 정상에 가깝게 회복되는 것으로 확인되었다.
따라서 이러한 결과를 통해 본 발명자들은 Grim19이 과발현된 MSC를 사용할 경우, MSC 단독 또는 Grim19을 단독 처리한 것에 비해 더욱 효과적으로 염증성장질환, 루프스, 관절염 등 면역질환을 치료할 수 있음을 알 수 있었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
본 발명은 하기 국가연구개발사업 프로그램의 지원에 의해 수행되었다.
1. 과제고유번호: HI14C3417
2. 부처명: 보건복지부
3. 연구관리전문기관: 한국보건산업진흥원
4. 연구사업명: 보건의료연구개발사업
5. 연구과제명: 염증면역질환에서 Th17 세포군 조절을 통한 면역조절 치료제 개발
6. 기여율: 1/2
7. 주관기관: 가톨릭대학교 산학협력단
8. 연구기간: 2014.12.01 ~ 2019.11.30
1. 과제고유번호: HI14C1549
2. 부처명: 보건복지부
3. 연구관리전문기관: 한국보건산업진흥원
4. 연구사업명: 첨단의료기술개발
5. 연구과제명: STAT3 활성 억제된 중간엽줄기세포를 이용한 골관절염 특이 세포치료제 개발
6. 기여율: 1/2
7. 주관기관: 가톨릭대학교 산학협력단
8. 연구기간: 2014.10.01 ~ 2015.09.30

Claims (13)

  1. Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 유효성분으로 포함하는, 면역질환의 예방 또는 치료용 세포치료제 조성물.
  2. 제1항에 있어서,
    상기 Grim19 유전자는 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  3. 제1항에 있어서,
    Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 염증유발인자 및 염증성 사이토카인의 생성이 억제되고, Th1 및 Th17 세포의 분화 및 활성이 감소되며, 조절 T 세포(Regulatory T cell: Treg)의 분화 및 활성은 증진되는 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  4. 제1항에 있어서,
    Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포는 세포이동 인자인 CCR3, CCR4, CCR7 및 CCR9의 발현이 증가되어 있어 병변부위로의 이동 능력이 있는 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  5. 제1항에 있어서,
    상기 면역질환은 류마티스 관절염 (Rheumatoid Arthritis), 천식 (Asthma), 피부염 (Dermititis), 건선 (Psoriasis), 낭섬유증 (Cystic Fibrosis), 고형장기 이식 후기 및 만성 거부증 (Post transplantation late and chronic solid organ rejection), 다발성 경화증 (Multiple Sclerosis), 전신성 홍반성 루푸스(systemic lupus erythematosus), 쇼그렌 증후군(Sjogren syndrome), 하시모토 갑상선(Hashimoto thyroiditis), 다발성근염(polymyositis), 경피증(scleroderma), 아디슨병(Addison disease), 백반증(vitiligo), 악성빈혈(pernicious anemia), 사구체신염(glomerulonephritis) 및 폐섬유증(pulmonary fibrosis), 염증성장질환 (Inflammatory Bowel Dieseses), 자가면역성 당뇨 (Autoimmune Diabetes), 당뇨 망막증 (Diabetic retinopathy), 비염 (Rhinitis), 혀혈-재관류 손상 (Ischemia-reperfusion injury), 혈관성형술후 재협착 (Post-angioplasty restenosis), 만성 폐색성 심장 질환 (Chronic obstructive pulmonary diseases; COPD), 그레이브병 (Graves disease), 위장관 알러지 (Gastrointestinal allergies), 결막염 (Conjunctivitis), 죽상경화증 (Atherosclerosis), 관상동맥질환 (Coronary artery disease), 협심증 (Angina), 암 전이, 소동맥 질환, 이식편대숙주질환(graft-versus-host disease) 및 미토콘드리아 관련 증후군으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 면역질환의 예방 또는 치료용 세포치료제 조성물.
  6. 시험관 내에서 Grim19 유전자를 함유한 재조합 벡터로 중간엽줄기세포를 형질전환하는 단계를 포함하는, 면역질환의 예방 및 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포의 제조 방법.
  7. 제6항에 있어서,
    상기 Grim19 유전자는 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는 방법.
  8. 제6항에 있어서,
    상기 Grim19이 과발현된 중간엽줄기세포는 염증유발인자 및 염증성 사이토카인의 생성이 억제되고, Th1 및 Th17 세포의 분화 및 활성이 감소되며, 조절 T 세포(Regulatory T cell: Treg)의 분화 및 활성은 증진되는 것을 특징으로 하는 방법.
  9. 제6항에 있어서,
    상기 Grim19이 과발현된 중간엽줄기세포는 세포이동 인자인 CCR3, CCR4, CCR7 및 CCR9의 발현이 증가되어 있어 병변부위로의 이동 능력이 있는 것을 특징으로 하는 방법.
  10. 미분화 T 세포를 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포와 함께 공조 배양하는 단계를 포함하는, 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 촉진시키는 방법.
  11. 제10항에 있어서,
    상기 공조 배양은 미분화 T 세포와 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 1:1/5~1:1/50의 세포수 비로 혼합하여 35~37℃의 온도에서 24 ~72 시간동안 배양하는 것을 특징으로 하는 미분화 T 세포의 조절 T 세포(Regulatory T cell: Treg)로의 분화 및 활성을 촉진시키는 방법.
  12. 면역질환이 유발된 개체에 Grim19 유전자를 함유한 재조합 벡터로 형질전환된 중간엽줄기세포를 투여하는 단계를 포함하는 면역 질환의 예방 또는 치료 방법.
  13. 제12항에 있어서,
    상기 면역질환은 류마티스 관절염, 천식, 피부염, 건선, 낭섬유증, 고형장기 이식 후기 및 만성 거부증, 다발성 경화증, 전신성 홍반성 루푸스, 쇼그렌 증후군, 하시모토 갑상선, 다발성근염, 경피증, 아디슨병, 백반증, 악성빈혈, 사구체신염 및 폐섬유증, 염증성장질환, 자가면역성 당뇨, 당뇨 망막증, 비염, 혀혈-재관류 손상, 혈관성형술후 재협착, 만성 폐색성 심장 질환, 그레이브병, 위장관 알러지, 결막염, 죽상경화증, 관상동맥질환, 협심증, 암 전이, 소동맥 질환, 이식편대숙주질환 및 미토콘드리아 관련 증후군으로 이루어진 군으로부터 선택되는 어느 하나인 방법.
PCT/KR2016/000701 2015-01-23 2016-01-22 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도 Ceased WO2016117960A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2015-0011164 2015-01-23
KR20150011164 2015-01-23
KR1020150174165A KR101739659B1 (ko) 2015-01-23 2015-12-08 면역질환 치료 효능을 갖는 Grim19이 과발현된 중간엽줄기세포 및 이의 용도
KR10-2015-0174165 2015-12-08

Publications (1)

Publication Number Publication Date
WO2016117960A1 true WO2016117960A1 (ko) 2016-07-28

Family

ID=56417413

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/000701 Ceased WO2016117960A1 (ko) 2015-01-23 2016-01-22 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2016117960A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200246392A1 (en) * 2017-08-16 2020-08-06 Sungkwang Medical Foundation Composition for treatment of thyroid associated ophthalmopathy, comprising mesenchymal stem cell
CN112111520A (zh) * 2020-09-22 2020-12-22 重庆医科大学附属儿童医院 Grim-19基因过表达的腺相关病毒表达载体及其在抑制肝纤维化病理进程中的应用
CN113645983A (zh) * 2018-10-17 2021-11-12 基础科学研究院 诱导Treg细胞的酵母衍生多糖的结构和功能特征

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060182712A1 (en) * 2004-06-21 2006-08-17 The Cleveland Clinic Foundation CCR ligands for stem cell homing
KR20100074386A (ko) * 2008-12-24 2010-07-02 한 쎌 주식회사 인간 간성장인자를 발현하는 중간엽 줄기세포, 그의 제조방법 및 이를 이용한 간 질환 치료제
KR20110092237A (ko) * 2010-02-08 2011-08-17 가톨릭대학교 산학협력단 Grim19을 유효성분으로 함유하는 면역질환의 예방 또는 치료용 조성물
WO2012099441A2 (ko) * 2011-01-21 2012-07-26 인제대학교산학협력단 트립토판 대사효소 유전자를 발현하는 줄기세포를 함유하는 면역 반응 억제용 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060182712A1 (en) * 2004-06-21 2006-08-17 The Cleveland Clinic Foundation CCR ligands for stem cell homing
KR20100074386A (ko) * 2008-12-24 2010-07-02 한 쎌 주식회사 인간 간성장인자를 발현하는 중간엽 줄기세포, 그의 제조방법 및 이를 이용한 간 질환 치료제
KR20110092237A (ko) * 2010-02-08 2011-08-17 가톨릭대학교 산학협력단 Grim19을 유효성분으로 함유하는 면역질환의 예방 또는 치료용 조성물
WO2012099441A2 (ko) * 2011-01-21 2012-07-26 인제대학교산학협력단 트립토판 대사효소 유전자를 발현하는 줄기세포를 함유하는 면역 반응 억제용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SOHNI, A. ET AL.: "Mesenchymal Stem Cells Migration Homing and Tracking", STEM CELLS INTERNATIONAL, vol. 2013, no. 130763, 2013, pages 1 - 8 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200246392A1 (en) * 2017-08-16 2020-08-06 Sungkwang Medical Foundation Composition for treatment of thyroid associated ophthalmopathy, comprising mesenchymal stem cell
US11524036B2 (en) * 2017-08-16 2022-12-13 Sungkwang Medical Foundation Method for treating thyroid associated ophthalmopathy
CN113645983A (zh) * 2018-10-17 2021-11-12 基础科学研究院 诱导Treg细胞的酵母衍生多糖的结构和功能特征
US12161662B2 (en) 2018-10-17 2024-12-10 Institute For Basic Science Structural and functional characteristics of yeast-derived polysaccharide inducing Treg cell
CN112111520A (zh) * 2020-09-22 2020-12-22 重庆医科大学附属儿童医院 Grim-19基因过表达的腺相关病毒表达载体及其在抑制肝纤维化病理进程中的应用

Similar Documents

Publication Publication Date Title
WO2016209021A1 (ko) 자연살해세포의 증식 방법 및 자연살해세포 증식용 조성물
WO2020197318A1 (ko) Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도
WO2020101361A1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
KR101705412B1 (ko) Stat3 억제제가 처리된 간엽줄기세포를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2018097540A9 (ko) 무혈청면역세포배양용 배지첨가키트, 상기 키트를 이용한 면역세포배양방법, 상기 키트 또는 배양방법에 의해 얻어진 무혈청면역세포배양액 및 상기 배양액을 포함하는 화장료조성물
Gur-Wahnon et al. Contact-dependent induction of regulatory antigen-presenting cells by human mesenchymal stem cells is mediated via STAT3 signaling
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
KR101656104B1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
KR101215670B1 (ko) Grim19을 유효성분으로 함유하는 면역질환의 예방 또는 치료용 조성물
WO2017135800A1 (ko) Trail 및 cd를 발현하는 중간엽줄기세포 및 이의 용도
WO2019117633A1 (ko) 아토피성 피부염, 탈모, 상처 또는 피부 주름의 개선용 화장료 조성물 및 약학 조성물
WO2019182392A1 (ko) 자연살해세포의 제조방법
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2017135795A1 (ko) 간세포성장인자를 발현하는 중간엽줄기세포 및 이의 용도
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2015167243A1 (ko) 면역질환 치료효과를 갖는 신규한 화합물 및 이의 용도
WO2012099441A2 (ko) 트립토판 대사효소 유전자를 발현하는 줄기세포를 함유하는 면역 반응 억제용 조성물
WO2019103436A9 (ko) Nk 세포 배양용 조성물 및 이를 이용하여 nk 세포를 배양하는 방법
WO2023128733A1 (ko) 감마-델타 t 세포의 증식 배양 방법
WO2015023147A1 (ko) mTOR/STAT3 신호억제제 처리된 면역조절능을 갖는 간엽 줄기세포 및 이를 포함하는 면역질환의 예방 또는 치료용 세포치료제 조성물
WO2015023165A1 (ko) 염증조절복합체 및 stat3 신호분자 차단을 통한 면역조절능 최적화된 안정화 중간엽줄기세포
WO2021177599A1 (en) METHOD FOR PRODUCING MEMORY-LIKE NK CELLS WITH ABILITY TO EXPRESS HIGHER LEVELS OF NCRS, CYTOTOXICITY, AND IFN-γ THAN NK CELLS IN HUMAN PERIPHERAL BLOOD
WO2016027990A1 (ko) Dusp5를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16740432

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16740432

Country of ref document: EP

Kind code of ref document: A1