WO2016107958A1 - Vecteur lentiviral à expression auto-limitée - Google Patents

Vecteur lentiviral à expression auto-limitée Download PDF

Info

Publication number
WO2016107958A1
WO2016107958A1 PCT/ES2015/070968 ES2015070968W WO2016107958A1 WO 2016107958 A1 WO2016107958 A1 WO 2016107958A1 ES 2015070968 W ES2015070968 W ES 2015070968W WO 2016107958 A1 WO2016107958 A1 WO 2016107958A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
expression
polynucleotide
promoter
mediator
Prior art date
Application number
PCT/ES2015/070968
Other languages
English (en)
Spanish (es)
Inventor
Arantzazu ALFRANCA GONZÁLEZ
Javier GARCÍA CASTRO
Original Assignee
Instituto De Salud Carlos Iii
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Instituto De Salud Carlos Iii filed Critical Instituto De Salud Carlos Iii
Publication of WO2016107958A1 publication Critical patent/WO2016107958A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors

Definitions

  • the present invention relates to a biscistronic lentiviral vector of self-limited expression, a production system of said lentiviral vector as well as to the uses of said vector in therapy, in particular in osteogenesis.
  • Retroviral vector systems such as lentiviral vector systems, have been proposed as a delivery system / vehicles for transferring a polynucleotide of interest to one or more target sites.
  • the concept of the use of viral vectors for gene therapy is well known in the state of the art (Verma and Somia (1997) Nature 389: 239-242).
  • the use of such systems in gene therapy could entail a number of health risks, so it is crucial to take into account the biosecurity of these types of vectors before using them.
  • the genetic information of the lentivirus has been divided into several parts (3 or 4 depending on the system), so that for its production a vector containing the information concerning the gene of interest is used ⁇ transfer vector ), and accessory plasmids that provide the information necessary for packaging
  • heterologous regulatory elements present in the transfer vector such as the use of tissue-specific promoters or of adjustable activity, have also been used routinely.
  • the present invention provides a new system especially suitable for use in a bicistronic lentiviral vector comprising a polynucleotide of interest directed by a eukaryotic promoter and Cre recombinase directed by a promoter activated by the expression product of the gene of interest, for the purpose of producing an endogenous control of the expression said gene.
  • the vector of the present invention is especially useful for its application in gene therapy, in particular for the production of mesenchymal stem cells (MSCs of the "Mesenchymal stem cells”) modified for bone regeneration.
  • Fig. 1 Design of the lentiviral vectors used in the study and strategy of self-limited expression of the transgene.
  • Fig. 2 Lentiviral vectors used in the study and expected behavior of their expression under osteogenic differentiation conditions.
  • Fig. 3 Morphological changes observed in transduced MSCs. Transduction of MSCs was carried out with pWPI-PL-DLX5 (DLX5), pWPI-PL-DLX5_sCre (DLX5-Cre) and pWPI-PL-GFP (GFP) as a control, and two days later they began to be grown in medium osteogenic differentiation or control. Five days after transduction (three days of osteogenic differentiation) the morphological changes present in the cells in each experimental condition were observed.
  • Fig. 4 Changes in the actin cytoskeleton in transduced MSCs.
  • MSCs transduction was carried out with pWPI-PL-DLX5 (DLX5), pWPI-PL-DLX5_sCre (DLX5-Cre) and pWPI-PL-GFP (GFP) as a control.
  • DLX5 pWPI-PL-DLX5
  • DLX5-Cre pWPI-PL-DLX5_sCre
  • GFP pWPI-PL-GFP
  • Fig. 5 Osteogenic potential in vitro of transduced MSCs.
  • MSCs transduction was performed with pWPI-PL-DLX5 (DLX5), pWPI-PL-DLX5_sCre (DLX5-Cre), pWPI-PL-GFP (GFP) and pWPI-PL-GFP_sCre (GFP-Cre).
  • DLX5 pWPI-PL-DLX5
  • DLX5-Cre pWPI-PL-DLX5_sCre
  • GFP pWPI-PL-GFP
  • pWPI-PL-GFP_sCre pWPI-PL-GFP_sCre
  • Fig. 7 Histological analysis of implants with transduced MSCs. Implants containing MSCs transduced with pWPI-PL-GFP (GFP), control (C) or with BMP-2, pWPI-PL-DLX5_sCre (DLX5-Cre) and pWPI-PL-DLX5 (DLX5), were removed after fourteen days, processed and stained with hematoxylin-eosin (HE). The photos show representative fields of the implants, where positive areas for eosin suggestive of osteoid (arrows) are appreciated.
  • GFP pWPI-PL-GFP
  • C control
  • BMP-2 pWPI-PL-DLX5_sCre
  • DLX5-Cre pWPI-PL-DLX5
  • HE hematoxylin-eosin
  • MSCs mesenchymal stem cells
  • an expression system was required to increase said osteogenic potential through the expression of a gene that encodes an intracellular primary mediator involved in osteogenic cell differentiation that in turn produced an endogenous control of the expression of said gene that will contribute to improve the biosecurity of the process.
  • This vector is characterized by having a polynucleotide sequence comprising: a. a polynucleotide of interest encoding the DLX5 protein and a first eukaryotic promoter, in particular the EF-1 a promoter, which controls the expression of said polynucleotide, and
  • a polynucleotide encoding the CRE recombinase protein and a second eukaryotic promoter in which the second promoter controls the expression of the Cre recombinase protein and in which the second eukaryotic promoter is activated by a product derived from the expression of the DLX5 protein , in particular by the Osterix protein, with which an endogenous control of the expression of said protein is produced.
  • Said vector was used to transduce MSCs. Likewise, additional MSCs to those already transduced with said vector were transduced with a vector that only expressed DLX5 protein and not CRE for use as a positive control.
  • the transient expression of Dlx5 in MSCs is sufficient to induce morphological changes and redistribution of the actin cytoskeleton similar to those that occur in vitro during bone differentiation with specific culture medium, and different from those obtained with sustained factor expression. In all cases the appearance of calcium deposits in the culture is observed, although to a lesser extent in the case of pWPI-PL-DLX5_sCre.
  • MSCs modified with the control vector and pWPI-PL-DLX5_sCre form bone tissue in subcutaneous implants with the same efficiency as control MSCs in the presence of osteogenic factor BMP-2.
  • the vector pWPI-PL-DLX5_sCre induces in MSCs an expression of Dlx5 at physiological levels and transiently, so that it potentially increases the security of the system.
  • the pWPI-PL-DLX5_sCre vector constitutes an especially useful tool for the treatment of pathologies that present with bone defects.
  • the design of said vector constitutes an ideal starting tool for the design of new strategies in the treatment of all types of pathologies, in particular for those that present with potentially treatable defects with intracellular mediators preferably involved in cell differentiation.
  • the vector pWPI-PL-DLX5_sCre constitutes a daunting starting point to achieve new regulation systems that allow eliminating the provirus of the genome of the target cell once the desired response has been started, and doing so in an endogenously regulated way. from a mechanism triggered by the expression of the transgene in question.
  • a first aspect of the invention relates to a polynucleotide sequence comprising: a. a polynucleotide of interest encoding an intracellular primary mediator and a first eukaryotic promoter, wherein the first eukaryotic promoter controls the expression of said polynucleotide of interest, and
  • promoter as it refers to the first promoter, is well known in the art and is used in the normal sense of the subject, for example, as an RNA polymerase binding site.
  • the term encompasses nucleic acid regions in the range of size and complexity from minimal promoters to promoters that include 5 'elements and enhancers.
  • the first promoter is typically selected from promoters that are functional in mammalian cells, although functional promoters can be used in other eukaryotic cells.
  • the promoter typically derives from promoter sequences of eukaryotic genes. For example, it may be a genome-derived promoter of a cell in which expression will occur or they may be ubiquitously functioning promoters (such as ⁇ -actin, -actin or tubulin promoters) or, alternatively, specific way of tissue.
  • the level of expression of one or more nucleotide sequences under the control of the promoter can be modulated by manipulating the promoter region.
  • different domains in a promoter region may have different gene regulatory activities.
  • the roles of these different regions are typically evaluated using vector constructs that have different promoter variants with specific modified regions.
  • the CRE recombinase protein has the following consensus amino acid and nucleotide sequences:
  • nucleotide sequences encoding the functional CRE recombinase protein would also be encompassed by the present invention.
  • sequences amino acids of the functional CRE recombinase protein are also encompassed by the present invention.
  • other amino acid sequences are understood to be those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • “functional Cre” means the enzyme capable of carrying out DNA recombination processes by recognizing specific sequences in the DNA called LoxP sites.
  • the polynucleotide sequence is an expression cassette suitable for use in a viral vector, preferably in a lentiviral vector.
  • expression cassette means the set of coding and regulatory sequences intended for the expression of one or more transgenes.
  • a second aspect of the invention relates to a vector, preferably to a viral vector comprising the polynucleotide sequence of the first aspect of the invention or the aforementioned expression cassette.
  • vector means a tool that allows or facilitates the transfer of an entity from one environment to another.
  • some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment) to be transferred to a cell host.
  • entities such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment) to be transferred to a cell host
  • examples of vectors used in recombinant DNA techniques include, but are not limited to, plasmids, chromosomes, artificial chromosomes or viruses or any modification of any of these vectors.
  • vector includes expression vectors and / or transformation vectors.
  • expression vector means a construct capable of expression in vivo or in vitro / ex vivo.
  • transformation vector means a construct capable of transferring from one species to another.
  • lentiviral vector a viral vector capable of transducing a target cell independently of cell division.
  • Lentiviral vectors are part of a larger group of vectors called retroviral vectors.
  • the polynucleotide of the present invention can be delivered to a target site by a viral or non-viral vector.
  • the viral vector is a recombinant lentiviral vector, preferably a recombinant self-limiting bicistronic lentiviral vector, wherein preferably, said lentiviral vector comprises a post-transcriptional regulatory element.
  • the lentiviral vector of the present invention has a minimal viral genome.
  • minimal viral genome means that the lentiviral vector has been manipulated to remove non-essential elements and to retain essential elements to provide the functionality necessary to infect and deliver a nucleotide sequence of interest to a target host cell.
  • Lentiviruses belong to the retrovirus family, but they can infect both dividing and non-dividing cells (Lewis et al. (1992) EMBO J. 3053-3058).
  • a retrovirus initially binds to a specific cell surface receptor.
  • the retroviral RNA genome is then copied to DNA by the virally encoded reverse transcriptase carried within the original virus. This DNA is transported to the host cell nucleus, where it is subsequently integrated into the host genome.
  • the lentivirus is typically referred to as provirus.
  • the provirus is stable on the host chromosome during cell division and is transcribed as other cellular genes. The provirus encodes the proteins and other factors required to replicate.
  • Each retroviral genome including lentiviruses, comprises genes called gag, pol and env, which encode virion proteins and enzymes. These genes are flanked at both ends by regions called long terminal repeats (LTR). LTRs are responsible for the integration and transcription of the province. They also serve as enhancer / promoter sequences. In other words, LTRs can control the expression of viral genes. Lentiviral RNA encapsidation occurs because of a psi sequence located at the 5 'end of the viral genome.
  • LTR long terminal repeats
  • LTRs are identical sequences that can be divided into three elements, which are called U3, R and U5.
  • U3 derives from the unique sequence of the 3 'end of the RNA.
  • R derives from a repeated sequence at both ends of the RNA and
  • U5 derives from the unique sequence of the 5 'end of the RNA.
  • the sizes of the three elements can vary considerably between different retroviruses.
  • gag, pol and env gag codes for the internal structural protein of the virus.
  • the Gag protein is proteolytically processed to mature MA (matrix), CA (capsid) and NC (nucleocapsid) proteins.
  • the pol gene encodes reverse transcriptase (RT), which contains DNA polymerase, associated RNase H and integrase (IN), that mediate genome replication.
  • RT reverse transcriptase
  • the env gene encodes the surface glycoprotein (SU) and the transmembrane (TM) protein of the virion, which form a complex that interacts specifically with cellular receptor proteins. This interaction ultimately leads to infection by fusion of the viral membrane with the cell membrane.
  • Lentiviruses may contain "additional" genes that encode proteins other than gag, pol and env.
  • additional genes include, in HIV, one or more of vif, vpr, vpx, vpu, tat, rev and nef.
  • EIAV has (among others) the additional S2 gene.
  • tat acts as a transcriptional activator of viral LTR. It binds to a secondary structure of stable hairpin RNA designated as TAR. Rev regulates and coordinates the expression of viral genes through response elements to rev (RRE).
  • RRE response elements to rev
  • Ttm an EIAV protein, Ttm, has been identified that is encoded by the first exon of tat cut and spliced with the env coding sequence at the start of the transmembrane protein.
  • the lentivirus group can be divided into “primate lentivirus” and "non-primate lentivirus".
  • primate lentiviruses include human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV).
  • the non-primate lentiviral group includes the prototype of "slow virus” visna / maedi virus (VMV), as well as related caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV) and immunodeficiency virus feline (IVF) and bovine immunodeficiency virus (BIV).
  • the lentiviral vectors of the invention will include primate lentiviral vectors such as HIV vectors (eg, HIV-1 and HIV-2 vectors) and SIV vectors, and non-primate lentiviral vectors.
  • the lentiviral vectors of the present invention are recombinant lentiviral vectors.
  • the term "recombinant lentiviral vector” refers to a vector with sufficient genetic information to allow the packaging of an RNA genome, in the presence of packaging components, in a viral particle. capable of infecting and transducing a target cell. Infection and transduction of a target cell include reverse transcription and integration into the genome of the target cell.
  • the RLV carries non-viral coding sequences that are to be delivered by the vector to the target cell.
  • the viral vector is a bicistronic lentiviral vector of recombinant self-limiting expression capable of transducing a target cell and integrating into the genomic DNA of said cell giving rise to a provirus, comprising: a The set of nucleotide sequences that encode proteins and other required factors involved in post-transcriptional regulation, as well as in the packaging of the virus, where said sequences are selected from the list consisting of: RRE: (Rev Response Element); cPPT: (central Polypurine Track) and WPRE: (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) and optionally the Psi protein,
  • a cistron comprising a polynucleotide of interest encoding an intracellular primary mediator, preferably involved in cell differentiation, and a first eukaryotic promoter, in which the first eukaryotic promoter controls the expression of said polynucleotide of interest,
  • a second cistron comprising a polynucleotide encoding the Cre recombinase protein and a second eukaryotic promoter, in which the second promoter controls the expression of the Cre recombinase protein and in which the second eukaryotic promoter is activated by an expression product of the polynucleotide of interest of step a) thereby producing an endogenous control of the expression of said gene, and
  • intracellular primary mediator is understood as the one directly encoded by the polynucleotide of interest
  • expression product is meant an intracellular secondary mediator, preferably involved in cell differentiation, where by intracellular secondary mediator, preferably involved in cell differentiation, a mediator synthesized by a target cell is understood as a consequence of the process set in motion by the expression of the primary mediator and where by second promoter a specific promoter of response to the intracellular secondary mediator is understood.
  • RRE has the following consensus nucleotide sequence:
  • nucleotide sequences corresponding to a functional RRE would also be encompassed by the present invention.
  • other nucleotide sequences are those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • functional RRE means a response element to the Rev protein, which participates in the export of viral RNA from the nucleus to the cytoplasm of the host cell.
  • cPPT has the following consensus nucleotide sequence:
  • nucleotide sequences corresponding to a functional cPPT would also be encompassed by the present invention.
  • other nucleotide sequences are those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • "functional cPPT" means a sequence responsible for the importation of the viral genome into the host cell nucleus.
  • WPRE has the following nucleotide consensus sequence: 5TCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTT ACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCA TTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAG GCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCA CCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCTCCCTATTGCCACGGCGGAACTCA TCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGGGCTCGGCTGTTGGGCACTGACAATTCCGT GGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTC TGCGGGACGTCCTTCTGCTACG
  • nucleotide sequences corresponding to a functional WPRE would also be encompassed by the present invention.
  • other nucleotide sequences are those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • functional WPRE is understood as a sequence that facilitates the maturation of RNA, increasing the expression of the transgene in the target cell.
  • Psi Sequence needed to package the viral RNA into the virus capsid
  • Psi has the following consensus nucleotide sequence: 5'TG AGTACG CCAAAAATTTTG ACTAG CG G AG G CTAG AAGG AG AG 3 '
  • nucleotide sequences corresponding to the Psi protein would also be encompassed by the present invention.
  • other nucleotide sequences are those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • Primary and secondary mediators useful in the present invention, but which in no case limit the present invention, are:
  • TAZ for osteogenic differentiation: Smads, beta catenin, C / EBP beta, DLX5, RUNX2, ATF4, Fra1, NFAT, Osterix (osteopontin promoters, alkaline phosphatase, osteocalcin, collagen I, Satb2);
  • self-limited expression vector means one that contains elements that allow removal of the provirus from the genome of the target cell in an endogenously regulated manner, by the action of a secondary mediator synthesized by the target cell in response to the expression of the polynucleotide of interest.
  • intracellular mediators involved in osteogenic differentiation are understood as intracellular molecules that participate sequentially in the set of successive biological phenomena that mediate the transformation of MSCs into osteocytes.
  • mediators are: Smads, DLX5, RUNX2, Osterix, ATF4, Fra1, NFAT.
  • the primary and secondary intracellular mediators involved in differentiation are intracellular mediators involved in osteogenic differentiation, where preferably said mediators are respectively DLX5 and Osterix.
  • DLX5 has the following consensus amino acid and nucleotide sequences:
  • nucleotide sequences encoding the functional DLX5 protein would also be encompassed by the present invention.
  • other amino acid sequences of the functional DLX5 protein are also encompassed by the present invention.
  • other nucleotide sequences are those sequences capable of encoding a functional amino acid sequence, in particular for those sequences functional that present a degree of identity with the above mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • functional DLX5 protein is understood as the transcription factor involved in embryonic limb development as well as osteoblastic differentiation, by activating promoters of factors such as alkaline phosphatase and Osterix.
  • Osterix has the following consensus amino acid and nucleotide sequences: - Nucleotide Section: AF477981
  • nucleotide sequences encoding the functional Osterix protein would also be encompassed by the present invention.
  • amino acid sequences of the functional Osterix protein are also encompassed by the present invention.
  • nucleotide sequences are understood as those sequences capable of coding for a functional amino acid sequence, in particular for those functional sequences that have a degree of identity with the above-mentioned consensus sequence greater than 85%, preferably greater than 90, 95, 96, 97, 98 or 99%.
  • functional Osterix protein is understood as the osteoblast-specific transcription factor, which activates the transcription of genes such as Sabt2 and Col1 a1 during osteogenic differentiation.
  • the primary mediator is Dlx5 protein
  • the expression product is Osterix
  • the second promoter is the Satb2 promoter
  • the first promoter is optionally the EF-1 a promoter.
  • the nucleotide sequence of the Satb2 promoter is indicated below:
  • nucleotide sequence of the EF-1a promoter is indicated below: 5 ' GTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACGTCCCCGAGAAGTTGGGGGGA
  • a third aspect of the invention relates to a system for producing a viral vector, preferably lentiviral, to produce a vector particle derived from a virus, preferably from a lentivirus, said system comprising a nucleic acid sequence or a set of sequences. of nucleic acid encoding the components of the vector including the nucleic acid sequences as defined in any of the preceding aspects. It is noted that the sequences defined in sections a) and b) of the first aspect of the present invention can be found in this system in a single nucleotide sequence or in two nucleotide sequences (each sequence comprising each of the two cistrons).
  • said system comprises three DNA constructs encoding (i) the components of the vector including the nucleic acid sequences as defined in any of the preceding aspects (transfer vector) (ii) Gag and Pol and Rev and (iii) Env or (ii) Gag and Pol, (iii) Rev and ( ⁇ V) Env.
  • viral vector production system is generally used to indicate a kit of parts or parts that can be used in combination with other components necessary for the production of viral particles in host cells.
  • the lentiviral vector genome may lack one or more of the genes necessary for viral replication. This may be combined in a kit with an additional complementary nucleotide sequence or sequences, for example in one or more producing plasmids. By co-transfecting the genome together with the producing plasmid or plasmids, the necessary components for the production of infectious viral particles should be provided.
  • the complementary nucleotide sequence or sequences may be stably present in a packaging cell line that is included in the kit.
  • a fourth aspect of the invention relates to a process for preparing a viral vector particle, preferably lentiviral, which comprises introducing the set of nucleic acid sequences as defined in any one of the preceding aspects, in particular in the production system of a viral vector of the invention, in a host cell, and obtaining a viral vector particle.
  • a recombinant lentiviral vector particle thus produced is capable of transducing a recipient cell with a gene of interest. Once inside the cell, the RNA genome of the vector particle is reverse transcribed into DNA and integrated into the DNA of the recipient cell.
  • the present invention also provides a packaging cell line comprising the set of nucleic acid sequences as defined in any one of the preceding aspects, in particular in the production system of a viral vector of the invention.
  • the packaging cell line can be transduced with a viral vector system comprising the genome or transfected with a plasmid carrying a DNA construct capable of encoding the RNA genome.
  • the present invention may also provide a lentiviral vector particle produced by said cell.
  • the term "packaging cell” refers to a cell that contains those elements necessary for the production of an infectious recombinant virus that the RNA genome lacks.
  • the HEK 293T cell line could be used, a line that expresses the SV40 large T antigen and is competent to replicate viruses that carry the SV40 origin of replication.
  • packing signal referred to interchangeably as “packing sequence” or “psi”
  • packet sequence is used with reference to the non-coding sequence of cis action required for encapsidation of retroviral RNA strands during viral particle formation.
  • this sequence has been mapped into loci that extend 5 'from the major splice donor site (SD) to at least the gag start codon.
  • Packaging cell lines suitable for use with the vector constructs described above can be easily prepared (see examples of the invention), and used to create producer cell lines for the production of lentiviral vector particles.
  • Packaging cell lines can be useful to provide the gene products necessary to encapsidate and provide a membrane protein for the production of high-title vector particles.
  • the packaging cell can be an in vitro cultured cell such as a tissue culture cell line. Suitable cell lines include, but are not limited to, mammalian cells such as cell lines derived from murine fibroblast or human cell lines.
  • the packaging cell line is a human cell line such as, for example: HEK293, 293-T, TE671, HT1080.
  • the packaging cell can be a cell derived from the individual to treat such as a monocyte, macrophage, blood cell or fibroblast.
  • the cell can be isolated from the individual and the ex vivo packaging and vector components administered followed by the re-administration of the autologous packaging cells.
  • the packaging and vector components can be administered to the packaging cell in vivo. Methods for introducing lentiviral and vector packaging components into an individual's cells are known in the art.
  • a fifth aspect of the invention relates to a viral or lentiviral vector particle produced by the viral system described above (see third aspect of the invention) or produced by the process of the fourth aspect of the invention.
  • a sixth aspect of the invention relates to a receptor cell transduced with the viral or lentiviral vector particle of the fourth aspect of the invention or with the polynucleotide, the expression cassette or the vector as defined in any of the aspects first or second of the invention, where said cell is optionally a mesenchymal stem cell (MSC).
  • MSC mesenchymal stem cell
  • Said mesenchymal stem cell can be used for autologous or allogeneic treatments.
  • a mesenchymal stem cell is understood as a multipotent adult cell, with fibroblastoid morphology, originating from the mesodermal germ layer, capable of differentiating in vitro or in vivo to various cell types, including among other osteocytes, chondrocytes, and adipocytes. These types of cells have a characteristic profile of membrane molecules in humans: CD73 + .CD90 +, CD105 +, CD166 +, CD45-, CD34-, CD19-, CD14-, HLA DR.
  • transduced cells also refer to a cell that has been transduced with a vector system as defined in any of the preceding aspects.
  • Transduction with the vector system of the present invention may confer or increase the capacity of the cell, for example it may confer on the cell an osteogenic capacity or a greater osteogenic capacity.
  • the cell can be transduced in vivo, in vitro or ex vivo.
  • the cell can be removed from the subject and easily transduced for reimplantation in the subject (ex vivo transduction).
  • the cell can be transduced by gene transfer in vivo, using the vector system of the present invention according to standard techniques.
  • the cell is part of a cell line that is stable in culture (namely, that it can survive numerous steps and can be multiplied in vitro), it can then be transduced in vitro by standard techniques, for example, by exposing the cell to supernatants virals that comprise vectors that express the genes of interest.
  • the transduced cell is a mesenchymal stem cell, preferably a human MSC of any origin.
  • a seventh aspect of the present invention relates to the cell of the sixth aspect of the invention, or to a vector, a viral or lentiviral vector particle, a polynucleotide or an expression cassette as defined in any of the aspects. precedents, for use in therapy.
  • a further aspect of the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the cell of the sixth aspect of the invention, or a vector, a viral or lentiviral vector particle, a polynucleotide or an expression cassette as defined. in any of the preceding aspects.
  • compositions described in the preceding aspect may be for human or animal use in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier or excipient.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical field and are described, for example, in "Remington's Pharmaceutical Sciences", Mack Publishing Co. (AR Gennaro edit. 1985).
  • the choice of pharmaceutical carrier, excipient or diluent can be made with respect to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as, or in addition to, carrier, excipient and diluent any suitable binder, lubricant, suspending agent, coating agent or solubilizing agent.
  • Preservatives, stabilizers, dyes and even flavoring agents can be provided in the pharmaceutical composition.
  • preservatives include sodium benzoate, sorbic acid and esters of phydroxybenzoic acid.
  • Antioxidants and suspending agents can also be used.
  • the pharmaceutical composition of the present invention can be formulated to be delivered using a minipump or mucosa, for example, as a nasal spray or inhalation spray or ingestible solution, or parenterally in which the composition is formulated in injectable form for delivery, for example, intravenously, intramuscularly or subcutaneously.
  • the formulation can be designed to be supplied by both routes.
  • the pharmaceutical composition When the pharmaceutical composition is to be delivered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit through the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acidic pH and resistant to the detergent effects of bile.
  • compositions may be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or powder for sprinkling, by using a dermal patch, orally in the form of tablets containing excipients such as starch or lactose or chalk, or in capsules or ovules alone or mixed with excipients, or in the form of elixirs, solutions or suspensions containing flavoring or coloring agents, or may be injected parenterally, by intravenous, intramuscular or subcutaneous example.
  • excipients such as starch or lactose or chalk
  • capsules or ovules alone or mixed with excipients
  • elixirs solutions or suspensions containing flavoring or coloring agents
  • compositions may be better used in the form of a sterile aqueous solution that may contain other substances, for example, sufficient salts or monosaccharides to make isotonic dissolution with blood.
  • compositions can be administered in the form of tablets or troches that can be formulated in a conventional manner.
  • compositions (or component parts thereof) of the present invention can be administered orally.
  • the compositions (or component parts thereof) of the present invention can be administered by direct injection.
  • the compositions (or component parts thereof) of the present invention can be administered topically.
  • the compositions (or component parts thereof) of the present invention can be administered by inhalation.
  • compositions (or component parts thereof) of the present invention may also be administered by one or more of the parenteral, mucous, intramuscular, intravenous, subcutaneous, intraocular or transdermal means of administration, and are formulated to such administration.
  • the pharmaceutical composition of the present invention can be administered according to a regimen of 1 to 10 times a day, such as once or twice a day.
  • the specific dose level and dosage frequency for any particular patient can be varied and will depend on a variety of factors that include the activity of the specific compound employed, the metabolic stability and the period of action of that compound, age, body weight, general health, sex, diet, mode and timing of administration, excretion rate, combination of drugs, severity of the particular condition and the host undergoing the therapy.
  • the pharmaceutical composition of the present invention can be administered by one or more of the following routes: oral administration, injection (such as direct injection), topical, inhalation, parenteral administration, mucosal administration, intramuscular administration, intravenous administration, administration subcutaneous, intraocular administration or transdermal administration.
  • compositions comprising an effective amount of the vector can be used in the treatment of disorders.
  • disorders for ease of reference, part of this list of disorders is now provided: macrophage inhibitor and / or T lymphocyte inhibitor activity and, therefore, anti-inflammatory activity; anti-immune activity, namely, inhibitory effects against a cellular and / or humoral immune response, including a response not associated with inflammation; diseases associated with viruses and / or other intracellular pathogens; inhibition of the ability of macrophages and T lymphocytes to adhere to the extracellular matrix and fibronectin components, as well as positively regulated ias receptor expression in T lymphocytes; inhibition of an unwanted immune reaction and inflammation, including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory
  • cancer-related disorders include, but are not limited to: solid tumors; blood-borne tumors such as leukemia; tumor metastases; benign tumors, for example, hemangiomas, acoustic neuromas, neurofibromas, tracomas and pyogenic granulomas; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolenticular fibroplasia, rubeosis; Osler-Webber syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophilic arthropathy; angiofibroma; wound granulation; coronary collateral circulation; cerebral collateral circulation; arteriovenous malformations; ischemic limb angiogenesis; neovascular glaucoma; retrolenticular fibrop
  • the pharmaceutical composition of the invention is applied in osteogenesis or in bone regeneration.
  • the construction of the vectors corresponding to Dlx5 (gene of interest) and GFP (negative control) has been carried out in several phases: a. First, the IRES + GFP cassette of the pWPI plasmid (purchased from Addgene, according to catalog and instructions contained in www.addgene.org/) was removed, and a sequence with new restriction sites (BamHI and Mlul) was inserted instead. ), thus generating the vector pWPI-PL, in order to be able to clone the Dlx5 and GFP cDNAs, followed by the Satb2 promoter and the Cre cDNA. b.
  • the Dlx5 cDNA obtained by PCR amplification, was introduced into the Pmel site of the construction thus generated. In this way the plasmid pWPI-PL-DLX5 was obtained.
  • the GFP fluorescent protein cDNA was introduced into the construction site mentioned in section a), thus obtaining the negative control pWPI-PL-GFP. d.
  • plasmids pWPI-PL-DLX5 and pWPI-PL-GFP a fragment of the Satb2 promoter was introduced into the Mlul site of both plasmids, amplified by PCR from mouse genomic DNA to which 5 ' ends were added MluI and 3 'XhoI, followed Cre cDNA obtained by PCR starting from plasmid previously generated in the laboratory (pHRSIN-Cre), which sites were added 5' XhoI and 3 'MluI.
  • the plasmids pWPI-PL-DLX5-SCre and pWPI-PL-GFP-SCre were obtained, respectively.
  • Restriction enzymes (Pmel, Mlul, BamHI, Xhol) were purchased from New England Biolabs, and the oligonucleotides used in the PCRs and for the generation of plasmid pWPI-PL are:
  • pWPI-PL-GFP pWPI-PL-GFP-SCre
  • pWPI-PL-DLX5 pWPI-PL-DLX5- SCre
  • Viral particles were produced by standard techniques of transfection with calcium phosphate from HEK-293T cells (used as packaging cells), of each of these vectors together with the auxiliary plasmids psPAX and VSVg (Addgene). After 48h, the supernatants of these cells, which contain the viral particles, were collected and ultracentrifuged at 4 ° C (2h at 26,000 rpm).
  • Cells transduced with the different lentiviral vectors were fixed in 4% paraformaldehyde and subsequently stained with Texas Red-X phalloidin (Invitrogen) according to the manufacturer's instructions, and DAPI (Invitrogen) dilution 1: 500 for 5min. The cells so marked were visualized in a SP5 confocal microscope.
  • the formation of ceramic implants was carried out according to the protocol described by the research group. Briefly, the MSCs transduced with the different vectors (approx. 10 6 cells) were placed in 50ml tubes with 0.1 g of biphasic ceramic granules (MBCP, Biomatlante) and were cultured in these conditions for 16h. Then 100 ⁇ of complete DMEM was added together with thrombin (SIGMA) dissolved in 0.22mM CaCI 2 , and fibrinogen, incubating for two hours under standard cell culture conditions. The mixture was inoculated subcutaneously in immunodeficient NOD / SCID mice anesthetized with ketamine / xylazine.
  • SIGMA thrombin
  • the implants were removed for study by imaging techniques (microCT) and histological analysis. Implants that combine BMP-2 with cells transduced with the GFP control vector were also included, in order to adequately assess the osteogenic capacity of the modified MSCs against the factor.
  • the mineral density of the samples was quantified using the GEHC microview program (http://microview.sourceforge.net).
  • the ceramic implants were fixed in formalin and subsequently decalcified by treatment with Osteosoft (Merck Mlllipore) for 48 hours, being subsequently processed for inclusion in paraffin. In all cases a standard staining with hematoxylin-eosin was performed. In some cases, in addition, immunohistochemistry was carried out with a human anti-vimentin antibody (Abcam).
  • Example 1 Generation of lentiviral vectors. Lentiviral vectors that code for Dlx5 and for GFP (control virus) were constructed. A self-inactivating lentiviral vector was used as the basis, which has the deleted U3 enhancer / promoter sequence located in the 3 ' LTR. To direct the expression of the transgene, the eukaryotic promoter of EF-1a was used, which allows to obtain expression levels similar to the endogenous ones, as well as avoiding in vivo methylation of the promoter, frequent in viral promoters.
  • a dual vector was generated which, in addition to Dlx5 (or GFP) expressed under the control of the EF-1a promoter, codes for Cre recombinase directed by the minimum fragment of the Sabt2 promoter containing the elements of response to Osterix.
  • the starting vector contains a LoxP (Cre target) sequence in the 3 ' U3 region.
  • this modified U3 3 ' region is copied to both sides of the provirus DNA, which is thus flanked by LoxP sequences.
  • Dlx5 is synthesized and sets in motion the osteogenic differentiation mechanism.
  • osteogenic differentiation is accompanied by characteristic changes in the actin cytoskeleton of MSCs.
  • perinuclear actin beams are made that "frame" the cell body, polygonally shaped, showing abundant stress fibers and an increase in actin polymerization.
  • an analysis of the actin cytoskeleton of MSCs transduced with the various viruses was carried out by staining with faloidin marked with Texas Red (fig. 4).
  • the cells transduced with pWPI-PL-DLX5_sCre showed changes in their cytoskeleton identical to those described for the osteogenic differentiation process in basal conditions.
  • the MSCs transduced with pWPI-PL-DLX5 also showed an increase in the degree of polymerization of actin, which in this case was placed in large beams parallel to the longitudinal axis of the cells, of fibroblastoid appearance.
  • Example 3 Study of the osteogenic capacity of MSCs transduced in vivo
  • the in vivo osteogenic potential of the cells transduced with the various lentiviral vectors was studied. Given their high dependence on the microenvironment, the potential for differentiation of MSCs may vary when analyzed in vivo, so that trials with subcutaneous ceramic implants in mice were essential to properly assess the validity of the system.
  • Human MSCs transduced with pWPI-PL-GFP, pWPI-PL-DLX5_sCre or pWPI-PL-DLX5 were included 1-2 days after infection in ceramic implants that were subcutaneously placed on the flank of immunodeficient NOD / SCID mice.
  • the BMP-2 factor was included as a positive differentiation control.
  • BMD bone density

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un vecteur lentiviral bicistronique à expression auto-limitée, un système de production dudit vecteur lentiviral, ainsi que les utilisations dudit vecteur en thérapie, en particulier pour l'ostéogenèse.
PCT/ES2015/070968 2015-01-02 2015-12-30 Vecteur lentiviral à expression auto-limitée WO2016107958A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES201530001A ES2578903B1 (es) 2015-01-02 2015-01-02 Vector lentiviral de expresión autolimitada
ESP201530001 2015-01-02

Publications (1)

Publication Number Publication Date
WO2016107958A1 true WO2016107958A1 (fr) 2016-07-07

Family

ID=56284333

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2015/070968 WO2016107958A1 (fr) 2015-01-02 2015-12-30 Vecteur lentiviral à expression auto-limitée

Country Status (2)

Country Link
ES (1) ES2578903B1 (fr)
WO (1) WO2016107958A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002029065A2 (fr) * 2000-10-06 2002-04-11 Oxford Biomedica (Uk) Limited Systeme de vecteur
WO2002044380A2 (fr) * 2000-11-30 2002-06-06 Board Of Regents, The University Of Texas System Facteur maitre de transcription de formation osseuse: compositions et procedes d'utilisation
WO2012170431A2 (fr) * 2011-06-06 2012-12-13 Bluebird Bio, Inc. Systèmes perfectionnés de commutation génique

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002029065A2 (fr) * 2000-10-06 2002-04-11 Oxford Biomedica (Uk) Limited Systeme de vecteur
WO2002044380A2 (fr) * 2000-11-30 2002-06-06 Board Of Regents, The University Of Texas System Facteur maitre de transcription de formation osseuse: compositions et procedes d'utilisation
WO2012170431A2 (fr) * 2011-06-06 2012-12-13 Bluebird Bio, Inc. Systèmes perfectionnés de commutation génique

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PFEIFER ALEXANDER ET AL.: "Delivery of the Cre recombinase by a self-deleting lentiviral vector: Efficient gene targeting in vitro.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 98, no. 20, 25 September 2001 (2001-09-25), pages 11450 - 11455, ISSN: 0027-8424 *
SILVER DANIEL P ET AL.: "Self-excising retroviral vectors encoding the Cre recombinase overcome Cre-mediated cellular toxicity.", MOLECULAR CELL, vol. 8, no. 1, July 2001 (2001-07-01), pages 233 - 243, XP002182221, ISSN: 1097-2765, DOI: doi:10.1016/S1097-2765(01)00295-7 *

Also Published As

Publication number Publication date
ES2578903A1 (es) 2016-08-02
ES2578903B1 (es) 2017-07-07

Similar Documents

Publication Publication Date Title
US9061031B2 (en) Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy
US7419829B2 (en) Vector system
ES2411981T3 (es) Vector lentivírico
ES2343564T3 (es) Vectores de eiav con codones optimizados.
US20090111106A1 (en) Vector System
JP4992032B2 (ja) レトロウイルスベクター
US20060258006A1 (en) Retroviral vector
JP2007510412A (ja) レトロウイルスベクター及びレンチウイルスベクター
ES2744448T3 (es) Vectores para la expresión transgénica
US8278284B2 (en) Therapeutic agents for diseases associated with apoptotic degeneration in ocular tissue cells that use SIV-PEDF vectors
ES2578903B1 (es) Vector lentiviral de expresión autolimitada
Metharom et al. Development of disabled, replication-defective gene transfer vectors from the Jembrana disease virus, a new infectious agent of cattle
van Heuvel Optimization of retroviral packaging cells for scale-up of vector production
TW202321456A (zh) 反轉錄病毒載體製造用之核酸
AU2014256388A1 (en) Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy
Yasemin van Heuvel Optimization of retroviral packaging cells for scale-up of vector production

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15875295

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15875295

Country of ref document: EP

Kind code of ref document: A1