WO2016105503A1 - Therapeutic, diagnostic and prognostic methods for cancer of the bladder - Google Patents

Therapeutic, diagnostic and prognostic methods for cancer of the bladder Download PDF

Info

Publication number
WO2016105503A1
WO2016105503A1 PCT/US2015/000237 US2015000237W WO2016105503A1 WO 2016105503 A1 WO2016105503 A1 WO 2016105503A1 US 2015000237 W US2015000237 W US 2015000237W WO 2016105503 A1 WO2016105503 A1 WO 2016105503A1
Authority
WO
WIPO (PCT)
Prior art keywords
patient
cancer
fgfr3
antagonist
egfr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/000237
Other languages
English (en)
French (fr)
Inventor
Younjeong CHOI
Omar Kabbarah
Doris KIM
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Genentech Inc
Original Assignee
F Hoffmann La Roche AG
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201580075170.9A priority Critical patent/CN107223163A/zh
Priority to MX2017008421A priority patent/MX394474B/es
Priority to HK18104105.4A priority patent/HK1244847A1/zh
Priority to RU2017125053A priority patent/RU2739942C2/ru
Priority to BR112017012553-6A priority patent/BR112017012553B1/pt
Priority to AU2015371312A priority patent/AU2015371312B2/en
Priority to EP15831090.4A priority patent/EP3237638B1/en
Priority to MYPI2017000931A priority patent/MY188938A/en
Priority to SG11201704852SA priority patent/SG11201704852SA/en
Priority to JP2017533956A priority patent/JP6900314B2/ja
Priority to CA2969830A priority patent/CA2969830A1/en
Priority to EP19212435.2A priority patent/EP3699290A1/en
Application filed by F Hoffmann La Roche AG, Genentech Inc filed Critical F Hoffmann La Roche AG
Priority to KR1020177017321A priority patent/KR20170095893A/ko
Publication of WO2016105503A1 publication Critical patent/WO2016105503A1/en
Priority to IL252796A priority patent/IL252796B/en
Priority to US15/628,775 priority patent/US20170306418A1/en
Anticipated expiration legal-status Critical
Priority to US17/743,230 priority patent/US20220267864A1/en
Priority to US18/157,597 priority patent/US20230220491A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3038Kidney, bladder
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57557Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701Details
    • G01N2333/4748Details p53
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/71Assays involving receptors, cell surface antigens or cell surface determinants for growth factors; for growth regulators
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention is directed to methods for treating, diagnosing, and providing prognoses for cancer, e.g., bladder cancer.
  • Cancer remains one of the most deadly threats to human health. In the United States, cancer affects nearly 1.3 million new patients each year, and is the second leading cause of death after heart disease, accounting for approximately 1 in 4 deaths. Solid tumors are responsible for most of those deaths. Malignant tumors metastasize and grow rapidly in an uncontrolled manner, making timely detection and treatment extremely difficult.
  • Bladder cancer is the fifth-most common malignancy worldwide, with close to 400,000 newly diagnosed cases and approximately 150,000 associated deaths reported per year. Approximately 75- 80% of bladder cancer patients present with non-muscle-invasive bladder cancer (NMIBC) at the time of initial diagnosis. Although confined to the lamina intestinal and typically not life-threatening, approximately 50-80% of NMIBCs recur, often requiring costly clinical intervention. NMIBCs can progress in about 20- 30% of instances to the more serious muscle-invasive bladder cancer (MIBC). MIBCs (T2 and T3) constitute only ⁇ 10-15% of new cases, but they confer a higher risk for developing metastatic bladder cancer (pT4). Metastatic bladder cancer is associated with a dismal 5-year survival likelihood and represents a major unmet medical need with few effective therapies to date.
  • MIBC muscle-invasive bladder cancer
  • the present invention is directed to methods for treating, diagnosing, and providing prognoses for cancer, e.g., bladder cancer.
  • the invention features a method of treating a patient suffering from a bladder cancer, the method comprising administering to the patient a therapeutically effective amount of an anticancer therapy, wherein the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient has been determined to be increased relative to a reference level of the at least one gene.
  • the invention features a method for diagnosing a bladder cancer in a patient, the method comprising the steps of: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient having a bladder cancer.
  • the method further comprises (c) informing the patient that they have a bladder cancer.
  • the method further comprises (d) selecting an anti-cancer therapy for treatment of said patient when an increase in the level of expression of the at least one gene in the patient sample relative to the reference level is detected. In some embodiments, the method further comprises (e) administering a therapeutically effective amount of an anti-cancer therapy to the patient.
  • the invention features a method for the prognosis of a patient suffering from bladder cancer, the method comprising: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; (b) comparing the expression level of the at least one gene to a reference level of the at least one gene; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is increased relative to the reference level.
  • the prognosis is a prognosis of survival.
  • the method is carried out prior to administering an anti-cancer therapy to the patient.
  • the method further comprises (d) identifying the patient as likely to benefit from administration of an anti-cancer therapy when the patient is determined to have a poor prognosis of survival.
  • the method further ⁇ comprises (e) administering a therapeutically effective amount of an anti-cancer therapy to the patient, if the patient is determined to have a poor prognosis of survival.
  • the survival is disease-free survival or overall survival.
  • the invention features a method of determining whether a patient having a bladder cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the method further comprises (c) administering a therapeutically effective amount of an anti-cancer therapy to the patient.
  • the invention features a method of optimizing therapeutic efficacy of an anticancer therapy for a patient having a bladder cancer, the method comprising: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the method further comprises (c) administering a therapeutically effective amount of an anti-cancer therapy to the patient.
  • the invention features a method of treating a patient suffering from a bladder cancer, the method comprising administering to the patient a therapeutically effective amount of an anti- cancer therapy other than Bacillus Calmette-Guerin (BCG) vaccine, wherein the expression level of TP53 in a sample obtained from the patient has been determined to be increased relative to a reference level of TP53.
  • BCG Bacillus Calmette-Guerin
  • the anti-cancer therapy comprises an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist.
  • the anti- cancer therapy comprises an FGFR3 antagonist and an EGFR antagonist.
  • the FGFR3 antagonist, EGFR antagonist, or TP53 antagonist is an antibody or a functional fragment thereof.
  • the FGFR3 antagonist is an anti-FGFR3 antibody, or a functional fragment thereof.
  • the EGFR antagonist is an anti-EGFR antibody, or a functional fragment thereof.
  • the TP53 antagonist is an anti-TP53 antibody, or a functional fragment thereof.
  • the FGFR3 antagonist, TP53 antagonist, or EGFR antagonist is a small molecule antagonist. In some embodiments, the FGFR3 antagonist or EGFR antagonist is a tyrosine kinase inhibitor. In some embodiments, the EGFR antagonist is erlotinib (TARCEVATM). In some embodiments, the anti-cancer therapy further comprises (i) an agent selected from the group consisting of an anti-neoplastic agent, a chemotherapeutic agent, a growth-inhibitory agent, and a cytotoxic agent, (ii) radiotherapy, or (iii) a combination thereof.
  • the expression level of the at least one gene in the sample obtained from the patient is determined by measuring mRNA. In some embodiments, the expression level of the at least one gene in the sample obtained from the patient is determined by a polymerase chain reaction (PCR) assay. In some embodiments, the PCR assay is a quantitative PCR assay.
  • PCR polymerase chain reaction
  • the expression level of the at least one gene in the sample obtained from the patient is determined by measuring protein. In some embodiments, the expression level of the at least one gene in the sample obtained from the patient is determined by an immunohistochemical (IHC) method.
  • IHC immunohistochemical
  • the sample obtained from the patient is a tumor sample.
  • the tumor sample is a formalin-fixed paraffin-embedded (FFPE) tumor sample.
  • the method further comprises determining the expression level of at least two of the genes. In some embodiments, the method further comprises determining the expression level of all three of the genes.
  • the expression level of FGFR3 has been determined to be increased at least 2-fold relative to a reference level. In some embodiments, the expression level of FGFR3 has been determined to be increased at least 4-fold relative to a reference level.
  • the expression level of EGFR has been determined to be increased at least 4-fold relative to a reference level. In some embodiments, the expression level of EGFR has been determined to be increased at least 8-fold relative to a reference level.
  • the method further comprises
  • the bladder cancer is non-muscle- invasive bladder cancer, muscle-invasive bladder cancer, or metastatic bladder cancer.
  • the non-muscle-invasive bladder cancer is a recurrent non-muscle-invasive bladder cancer.
  • FIGURE 1 is a table showing information regarding the patients and clinicopathologic features of the bladder cancer tumor specimens which were analyzed in the Examples section (e.g., Examples 1 -6).
  • FIGURES 2A and 2B are graphs showing principle components analysis (PCA) on expression of 18,000 genes from Sjodahl et al. Clin. Cancer Res. 18(12): 3377-3386, 2012 ( Figure 2A) and using only 82 genes that overlap with the custom bladder cancer Fluidigm gene expression panel described in the Examples section (see, e.g., Table 1 ) ( Figure 2B). Both analyses show a similar distribution of samples belonging to the bladder cancer subtypes described by Sjodahl et al. (supra).
  • FIGURES 2C and 2D are graphs showing that cross-validation with a centroid-based classifier results in similar classification accuracy of the bladder cancer subtypes of Sjodahl et al. (supra) based on 1 ,000 genes ( Figure 2C) and based on 82 genes that overlap with the custom bladder cancer Fluidigm gene expression panel ( Figure 2D).
  • the data presented in Figures 2A-2D show that the custom bladder cancer Fluidigm gene expression panel can accurately classify bladder cancer into molecularly-defined subtypes.
  • the line markers are for clarity and do not indicate data points.
  • FIGURES 3A and 3B are graphs showing that Fluidigm assay performance was not affected by
  • RNA input amount as shown for FGFR3 ( Figure 3A) and for PIK3CA ( Figure 3B) with decreasing input amounts of universal RNA (uRNA) controls.
  • FIGURES 3C and 3D are graphs showing that run-to-run data reproducibility of the custom bladder cancer Fluidigm gene expression panel was high for clinical tissues.
  • Figure 3C (HP-52719) and Figure 3D (HP-50331 ) show two representative formalin-fixed paraffin-embedded (FFPE)-derived RNA samples that each show R 2 values of >0.98 between runs from different days.
  • FFPE formalin-fixed paraffin-embedded
  • FIGURE 3E is a graph showing high chip-to-chip data reproducibility of the custom bladder cancer Fluidigm gene expression panel.
  • FIGURE 4A is a heatmap of transcriptionally-defined tissue clusters from Fluidigm analysis (Tissues) and groups of co-regulated genes (Genes). The Green, Yellow, and Red tissue groups contained the majority of samples.
  • FIGURE 4B is a graph showing that the Green, Yellow, and Red tissue clusters (see, e.g., Figure 4A) are associated with distinct disease-free survival (DFS) probabilities.
  • FIGURE 4F is a graph showing the treatment frequency distribution for the three groups.
  • Treatments included Bacillus Calmette-Guerin (BCG) vaccine, chemotherapy, radiation, or combinations thereof.
  • BCG Bacillus Calmette-Guerin
  • FIGURE 5A is a heatmap showing that expression analysis by the custom bladder cancer Fluidigm gene expression panel described in Example 2 identified 3 main subsets of tissues represented by the Green, Yellow, and Red groups, and 2 minor subtypes represented by the Blue and Purple groups.
  • FIGURE 5B is a heatmap showing that expression analysis by the custom bladder cancer Fluidigm gene expression panel as described in Example 2 identified 4 major gene expression clusters associated with different biologies. Arrows point to representative genes for each cluster, including TP53 and FGFR3 (pink cluster I); epithelial-to-mesenchymal transition (EMT) genes like ZEB1/2 and phosphoinositide 3-kinase (PI3K) genes such as PIK3CA and PIK3R1 (light blue cluster II); other PI3K genes such as PTEN and AKT1 (magenta cluster III); and fibroblast growth factor (FGF) ligands and receptors (light brown cluster IV).
  • EMT epithelial-to-mesenchymal transition
  • PI3K phosphoinositide 3-kinase
  • FIGURE 5C is a graph showing that the tissue subtypes described in Figure 5A were associated with distinct disease-free survival (DFS) likelihoods.
  • the line markers are for clarity and do not indicate data points.
  • FIGURES 6A-6D are representative hematoxylin & eosin (H&E)-stained sections showing histological features of (Figure 6A) non-muscle invasive bladder cancer; ( Figure 6B) muscle-invasive bladder cancer; (Figure 6C) lymphoid infiltration-positive tissue; and ( Figure 6D) bladder tumor with micropapillary histology. Scale bar indicates 100 ⁇ .
  • FIGURE 7A is a color map showing FGFR3 mutation status, FGFR3 immunohistochemistry (IHC), and histopathology calls for specimens in the Green, Red, and Yellow groups.
  • IHC immunohistochemistry
  • FIGURE 7B is a graph showing that FGFR3 transcript levels were higher in mutant (MT) compared to wild-type (WT) samples (P ⁇ 0.0001 ) as determined by Fluidigm gene expression analysis.
  • FIGURE 7C is a graph showing that FGFR3 mutant samples expressed higher levels of the protein than wild-type tissues, as measured by IHC (P ⁇ 0.0001 ).
  • FIGURE 7D is a graph showing that the FGFR3 mutation rate was significantly higher in the Green group compared to both the Red and invasive/metastatic Yellow groups (P ⁇ 0.0001 for both comparisons).
  • FIGURE 7E is a graph showing that samples in the Green group expressed significantly higher FGFR3 transcript levels than samples in the Red and Yellow groups (P ⁇ 0.0001 for both comparisons).
  • FIGURE 7G is a series of pie charts showing FGFR3 expression in non-invasive, invasive, and bladder cancer metastases. High protein levels of FGFR3 (IHC 2+/3+) were observed in 66%, 32%, and 33% of cases, respectively.
  • FIGURE 8 is a graph showing that INGENUITY® software (Qiagen, Redwood City, CA) analysis identified the p53, PI3K-AKT, EMT, and ERBB and FGFR3 pathways as differentially-expressed between the non-invasive rapidly-recurring Green group and the less-aggressive Red group.
  • the 45/96 genes that were significantly differentially-expressed between the Green and Red groups (P ⁇ 0.05, with multiple testing correct) were used as inputs for the analysis.
  • FIGURE 9A is a color map of next generation sequencing (NGS) results and mutation status as determined by Fluidigm analysis (MutMap; see Schleifman et al. PloS One 9: e90761 , 2014) in samples from the Green, Yellow, and Red groups. Validated mutations were those identified by both NGS and MutMap.
  • NGS next generation sequencing
  • FIGURE 9B is a schematic diagram (lollipop plot) of the TP53 gene showing the TP53 mutations identified by NGS in samples for the Green, Red, and Yellow groups. Colored boxes denote tissue group assignment. Boxes with similar numbers point to mutations co-detected in the same samples. Most mutations cluster in the DNA-binding domain and are non-overlapping.
  • FIGURE 9D is a graph showing that expression levels of TP53 were higher in the Green group compared to both Red and Yellow groups, as determined by Fluidigm gene expression analysis
  • FIGURE 9E is a graph showing that expression levels of the TP53 transcriptional target p21 were significantly higher in the Green compared to both the Red and Yellow groups (P ⁇ 0.0001 for both comparisons), as determined by Fluidigm gene expression analysis.
  • FIGURE 10 is a color map of Fluidigm analysis of ERBB pathway ligands and receptor expression in a subset of bladder cancer specimens, and overlapping mutation and copy number alterations in key pathways in the same samples.
  • Expression analysis of ERBB receptors and ligand, mutational analysis, and copy number analyses were carried out on custom Fluidigm panels (Schleifman et al. PloS One 9: e90761 , 2014).
  • For Fluidigm mutation analysis dark grey bar, mutant; medium grey bar; no call due to technical reasons; white bar, not applicable; light grey bar, wild-type.
  • DNA copy number analysis dark grey bar, DNA copy number gain; medium grey bar, no call due to technical reasons; light grey bar, no DNA copy number change; white bar, not applicable.
  • FIGURE 1 1 G is a graph showing that treatment of bladder cancer cell lines with the EGFR inhibitor erlotinib (TARCEVATM) identified three sensitive cell lines that exhibit >25% growth inhibition (Gl) (UMUC5, UMUC10, and UMUC17), and four resistant cell lines that display ⁇ 25% Gl in response to treatment (RT1 12, UMUC3, SW780, and BFTC905).
  • TARCEVATM EGFR inhibitor erlotinib
  • TARCEVATM erlotinib
  • FIGURE 12A is a Venn diagram showing genes comprising the custom bladder cancer Fluidigm gene expression panel described in Example 1 (e.g., Table 1 ) illustrating overlapping and unique genes belonging to three main pathway groups based on INGENUITY® analysis: (1 ) FGFR, RTK, MAPK, and PI3K pathways; (2) development and epithelial-to-mesenchymal transition (EMT) axes; and (3) TP53, genome stability, and cell cycle regulation networks. The numbers correspond to the number of unique genes in each portion of the Venn diagram.
  • FIGURE 12B is a graph showing the results of unsupervised hierarchical clustering of samples from a large public dataset and corresponding tumor grade, stage, and molecular class, as defined by Sjodahl et al., supra.
  • FIGURE 12C is a series of graphs showing cross-validated misclassification error curves for tumors from the Sjodahl et al. (supra) dataset based on decreasing numbers of lllumina probes compared to probes corresponding to the custom bladder cancer Fluidigm gene expression panel.
  • Each graph shows the amount of classification error made while attempting to predict tumor grade, TNM stage, or molecular class using a nearest shrunken centroid classifier with a subset of the total genes. The number of genes is shown along the top x-axis with the corresponding "shrinkage factor" shown on the bottom x- axis.
  • FIGURE 12D is a series of graphs showing unsupervised hierarchical clustering of samples from four public datasets based on the signals from probes corresponding to genes of the custom bladder cancer Fluidigm gene expression panel and corresponding published basal/luminal status (Damrauer et al. Proc. Natl. Acad. Sci. USA 1 1 1 :31 10-31 15, 2014).
  • FIGURE 13A is a series of graphs showing the linear performance of six representative assays and their raw CT values with respect to increasing input amounts of universal RNA (uRNA) controls.
  • FIGURE 13B is a series of graphs showing run-to-run data reproducibility for archival FFPE tissues, as seen for two representative FFPE-derived RNA samples run on different days.
  • FIGURE 14A is a heatmap showing the results of unsupervised clustering of genes and samples from public data sets, as well as NMIBCs, MIBCs, and metastases (METs) from the bladder cancer FFPE tissue cohort described in Example 1 and Figure 1.
  • White blocks represent genes that are not found in the respective data sets.
  • FIGURE 14B is a graph showing basal profile (red bars) and luminal profile (blue bars) for bladder cancer panel genes calculated from the Damrauer et al. (supra) discovery samples. Mean- centering and unit variance normalization was applied to the log-transformed expression values, and mean log normalized expression levels were calculated independently for basal and luminal sample groups to form the final profiles.
  • FIGURE 14C is a diagram showing methodology used for computing basal/luminal signatures from public data and then applying these signatures to bladder panel data to measure basal/luminal similarity of samples.
  • FIGURE 15A shows the results of unsupervised hierarchical clustering (average-linkage, 1 - Pearson correlation distance metric) of 204 FFPE samples (see Example 1 and Figure 1 ) based on bladder cancer panel gene expression and corresponding B/L scores, histology, and mutational status of cancer-relevant genes. See Example 6 for additional details.
  • FIGURES 15B-15E are graphs showing statistical analysis of the B/L scores (Figure 15B), distribution of NMIBCs, MIBCs, and METs (Figure 15C), prevalence of FGFR3 mutations ( Figure 15D), and FGFR3 IHC scores ( Figure 15E) in samples from the transcriptionally-defined luminal and basal clusters in Figure 15A.
  • FIGURE 15F shows INGENUITY® pathway activation scores based on the expression of genes that were significantly differentially expressed between luminal and basal samples in Figure 15A.
  • FIGURE 16B is a table showing the B/L score of primary tumors ("pri"), matched metastases
  • FIGURES 17A and 17B are diagrams depicting the results of INGENUITY® analysis showing predictive activation of the estrogen receptor in luminal compared to basal samples based on genes significantly differentially expressed between the two groups in FFPE tissues.
  • FIGURE 18 is a Pearson correlation matrix using next generation sequencing (NGS)
  • AMPLISEQTM data comparing the allele frequency at all variant sites with at least 100x read coverage and frequency > 10% (on average, 120 sites were compared between any two samples).
  • the present invention provides therapeutic, diagnostic, and prognostic methods and
  • compositions for cancer for example, bladder cancer.
  • the invention is based on the discovery that determination of expression levels (e.g., a changed expression level relative to a reference sample) of at least one of the genes set forth in Table 1 , including FGFR3, TP53, and/or EGFR, is useful for treating a patient suffering from a cancer, for diagnosing a patient suffering from a cancer, for determining a prognosis of a patient suffering from a cancer, for determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, and/or for optimizing therapeutic efficacy of an anticancer therapy for a patient having a cancer.
  • an anti-cancer therapy can then be selected for the patient and, further, an anti-cancer therapy can optionally be administered to the patient.
  • expression level generally refers to the amount of a polynucleotide (e.g., a messenger RNA (mRNA)) or an amino acid product or protein in a biological sample.
  • mRNA messenger RNA
  • “Expression” generally refers to the process by which gene- encoded information is converted into the structures present and operating in the cell. Therefore, according to the invention, “expression” of a gene may refer to transcription into a polynucleotide (e.g., an mRNA), translation into a polypeptide (e.g., a protein), or even post-translational modification of the polypeptide.
  • Fragments of the transcribed polynucleotide, the translated polypeptide, or the post- translationally modified polypeptide shall also be regarded as expressed whether they originate from a transcript generated by alternative splicing or a degraded transcript, or from a post-translational processing of the protein, e.g., by proteolysis.
  • "Expressed genes” include those that are transcribed into a polynucleotide as mRNA and then translated into a protein, and also those that are transcribed into RNA but not translated into a protein (e.g., transfer and ribosomal RNAs).
  • biomarker and “biomarker” are used interchangeably herein to refer to a DNA, RNA, protein, carbohydrate, or glycolipid-based molecular marker, the expression or presence of which in a subject's or patient's sample can be detected by standard methods (or methods disclosed herein) and is useful, for example, for diagnosing a bladder cancer in a patient, for prognosis of a patient suffering from bladder cancer, determining whether a patient having a bladder cancer is likely to respond to treatment with an anti-cancer therapy, optimizing therapeutic efficacy of an anti-cancer patient having a bladder cancer, and/or in therapeutic methods that involve determining the expression level of such a marker.
  • biomarkers include, but are not limited to, the genes set forth in Table 1.
  • the gene may be one or more of FGFR3, TP53, and EGFR. In some embodiments, the gene is FGFR3. In some embodiments, the gene is TP53. In some embodiments, the gene is EGFR. In other words,
  • the gene(s) may be selected from DUSB3, FRS2, TSC1, ERBB3, CDKN1A, CCND1, TP63, MMP2, ZEB2, PIK3CB, PIK3R1, MDM2, SNAI2, AXL, ZEB1, BCL2B, TSC2, RB1, FGFR32, PIK3IP1, MTOR, PIK3CA, PTEN, AKT1, BCL2A, FRS3, ERBB2, FGFR31, FGF1, SNAI1, FGFR34, FGF9, or FGF2. Expression of such a biomarker may be determined to be higher or lower in a sample obtained from a patient than a reference level.
  • Individuals having an expression level that is greater than or less than the reference expression level of at least one gene can be identified as subjects/patients who are suffering from a bladder cancer, as patients who have a particular prognosis (e.g., a favorable or poor prognosis), or as one who is likely to respond to treatment with an anti-cancer therapy.
  • a prognosis e.g., a favorable or poor prognosis
  • the term "reference level" herein refers to a predetermined value.
  • the reference level is predetermined and set to meet the requirements in terms of, for example, specificity and/or sensitivity. These requirements can vary, e.g., from regulatory body to regulatory body. It may be, for example, that assay sensitivity or specificity, respectively, has to be set to certain limits, e.g., 80%, 90%, 95% or 99%. These requirements may also be defined in terms of positive or negative predictive values. Nonetheless, based on the teaching given in the present invention it will always be possible to arrive at the reference level meeting those requirements. In one embodiment, the reference level is determined in healthy individuals.
  • the reference level in one embodiment has been predetermined in the disease entity to which the patient belongs (e.g., a cancer type, such as bladder cancer, or a subtype of a bladder cancer).
  • the reference level can be set to any percentile between the 20 th and 95 th percentile (e.g., the 20 th , 25 th , 30 th , 35 th , 40 th , 45 th , 50 th , 55 th , 60 lh , 65 lh , 70 th , 75 lh , 80 th , 85 th , 90 th , or 95 th percentile) of the overall distribution of the values in a disease entity investigated.
  • the 20 th and 95 th percentile e.g., the 20 th , 25 th , 30 th , 35 th , 40 th , 45 th , 50 th , 55 th , 60 lh , 65 lh , 70 th , 75 l
  • the reference level is set to the 25 th percentile of the overall distribution of the values in a disease entity investigated. In other particular embodiments, the reference level is set to the 50 th percentile of the overall distribution of the values in a disease entity investigated. In other embodiments, the reference level can be set to, for example, the median, tertiles, quartiles, or quintiles as determined from the overall distribution of the values in a disease entity investigated or in a given population. In other embodiments, the reference level can be set to, for example, the mean, as determined from the overall distribution of the values in a disease entity investigated or in a given population.
  • the term "increase” or “above” refers to a level at the reference level or to an overall increase of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, 2- fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15-fold, or greater, in the level of a marker (e.g., FGFR3, TP53, or EGFR) detected by the methods described herein, as compared to the level from a reference sample.
  • a marker e.g., FGFR3, TP53, or EGFR
  • the term “decrease” or “below” herein refers to a level below the reference level or to an overall reduction of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater, in the level of a marker (e.g., FGFR3, TP53, or EGFR) detected by the methods described herein, as compared to the level from a reference sample.
  • a marker e.g., FGFR3, TP53, or EGFR
  • the term "at a reference level” refers to a level of a marker (e.g., FGFR3, TP53, and/or EGFR) that is the same as the level, detected by the methods described herein, from a reference sample.
  • a marker e.g., FGFR3, TP53, and/or EGFR
  • diagnosis is used herein to refer to the identification or classification of a molecular or pathological state, disease or condition (e.g., cancer, including bladder cancer).
  • diagnosis may refer to identification of a particular type of cancer.
  • Diagnosis may also refer to the classification of a particular subtype of cancer, e.g., by histopathological criteria, or by molecular features (e.g., a subtype characterized by expression of one or a combination of biomarkers (e.g., particular genes or proteins encoded by said genes)).
  • a subtype of cancer may be a non-muscle-invasive bladder cancer (NMIBC; TO, T1 ), a muscle-invasive bladder cancer (MIBC; T2, T3) or a metastatic bladder cancer.
  • NMIBC non-muscle-invasive bladder cancer
  • MIBC muscle-invasive bladder cancer
  • a “response" of a patient or a patient's “responsiveness” to treatment or therapy refers to the clinical or therapeutic benefit imparted to a patient at risk for or having a cancer (e.g., a bladder cancer) from or as a result of the treatment.
  • an anti-cancer therapy e.g., an anti-cancer therapy comprising an FGFR3 antagonist, a TP53 antagonist, and/or a EGFR antagonist
  • Such benefit may include cellular or biological responses, a complete response, a partial response, a stable disease (without progression or relapse), or a response with a later relapse of the patient from or as a result of the treatment with the antagonist.
  • a response may be reflected by decreased suffering from bladder cancer, such as a diminished and/or halted tumor growth, reduction of the size of a tumor, and/or amelioration of one or more symptoms of bladder cancer, for example, blood in urine (hematuria), changes in urination, other urinary symptoms, back pain, or pelvic pain.
  • the response may be reflected by decreased or diminished indices of the metastatic conversion of the cancer or indices of the cancer, e.g., the prevention of the formation of metastases or a reduction of number or size of metastases.
  • a response can be reduced tumor size, disease-free survival, progression-free survival, or overall survival in a patient diagnosed as expressing increased or decreased levels of one or more of the biomarkers set forth in Table 1 (e.g., FGFR3, TP53, and EGFR) relative to a reference level.
  • the biomarkers set forth in Table 1 e.g., FGFR3, TP53, and EGFR
  • sample and “biological sample” are used interchangeably to refer to any biological sample obtained from an individual including body fluids, body tissue (e.g., tumor tissue), cells, or other sources.
  • Body fluids are, for example, lymph, sera, whole fresh blood, peripheral blood mononuclear cells, frozen whole blood, plasma (including fresh or frozen), urine, saliva, semen, synovial fluid and spinal fluid.
  • Samples also include breast tissue, renal tissue, colonic tissue, brain tissue, muscle tissue, synovial tissue, skin, hair follicle, bone marrow, and tumor tissue. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art.
  • tumor sample herein is a sample derived from, or comprising tumor cells from, a patient's tumor.
  • tumor samples herein include, but are not limited to, tumor biopsies, circulating tumor cells, circulating plasma proteins, ascitic fluid, primary cell cultures or cell lines derived from tumors or exhibiting tumor-like properties, as well as preserved tumor samples, such as formalin-fixed, paraffin- embedded tumor samples or frozen tumor samples.
  • an "antagonist” (interchangeably termed “inhibitor”) of a polypeptide of interest is an agent that interferes with activation or function of the polypeptide of interest, e.g., partially or fully blocks, inhibits, or neutralizes a biological activity mediated by a polypeptide of interest.
  • an antagonist of polypeptide X refers to any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity mediated by polypeptide X.
  • Examples of inhibitors include antibodies; ligand antibodies; small molecule antagonists; antisense and inhibitory RNA (e.g., shRNA) molecules.
  • the inhibitor is an antibody or small molecule which binds to the polypeptide of interest.
  • an inhibitor has a binding affinity (dissociation constant) to the polypeptide of interest of about 1 ,000 nM or less. In another embodiment, an inhibitor has a binding affinity to the polypeptide of interest of about 100 nM or less. In another embodiment, an inhibitor has a binding affinity to the polypeptide of interest of about 50 nM or less. In a particular embodiment, an inhibitor is covalently bound to the polypeptide of interest. In a particular embodiment, an inhibitor inhibits signaling of the polypeptide of interest with a half maximal inhibitory concentration (IC50) of 1 ,000 nM or less. In another embodiment, an inhibitor inhibits signaling of the polypeptide of interest with an IC50 of 500 nM or less.
  • IC50 half maximal inhibitory concentration
  • an inhibitor inhibits signaling of the polypeptide of interest with an IC50 of 50 nM or less.
  • the antagonist reduces or inhibits, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more, the expression level or biological activity of the polypeptide of interest.
  • the polypeptide of interest is FGFR3 or a ligand of FGFR3.
  • the polypeptide of interest is EGFR or a ligand of FGFR3.
  • the polypeptide of interest is TP53.
  • polypeptide refers to any native polypeptide (e.g., protein) of interest from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise indicated.
  • the term encompasses "full-length,” unprocessed polypeptide as well as any form of the polypeptide that results from processing in the cell.
  • the term also encompasses naturally occurring variants of the polypeptide, e.g., splice variants or allelic variants.
  • the polypeptide is FGFR3.
  • the polypeptide is TP53.
  • the polypeptide is EGFR.
  • Polynucleotide or “nucleic acid,” as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and RNA.
  • the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after synthesis, such as by conjugation with a label.
  • Other types of modifications include, for example, "caps,” substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radio
  • any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid or semi-solid supports.
  • the 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms.
  • Other hydroxyls may also be derivatized to standard protecting groups.
  • Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
  • One or more phosphodiester linkages may be replaced by alternative linking groups.
  • linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(0)S("thioate”), P(S)S ("dithioate”), "(0)NR2 ("amidate”), P(0)R, P(0)OR', CO or CH2 ("formacetal"), in which each R or R' is independently H or substituted or unsubstituted alkyl (1 -20 C) optionally containing an ether (-0-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
  • small molecule refers to any molecule with a molecular weight of about 2000 daltons or less, preferably of about 500 daltons or less.
  • antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
  • anti-polypeptide of interest antibody and "an antibody that binds to" a polypeptide of interest refer to an antibody that is capable of binding a polypeptide of interest with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting a polypeptide of interest.
  • the extent of binding of an anti-polypeptide of interest antibody to an unrelated, non- polypeptide of interest protein is less than about 10% of the binding of the antibody to a polypeptide of interest as measured, e.g., by a radioimmunoassay (RIA).
  • RIA radioimmunoassay
  • an antibody that binds to a polypeptide of interest has a dissociation constant (Kd) of ⁇ 1 ⁇ , ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g., 10 "8 M or less, e.g., from 10 "8 M to 10 "13 M, e.g., from 10 "9 M to 10 "13 M).
  • an anti-polypeptide of interest antibody binds to an epitope of a polypeptide of interest that is conserved among polypeptides of interest from different species.
  • the polypeptide of interest is FGFR3.
  • the polypeptide of interest is EGFR.
  • the polypeptide of interest is TP53.
  • blocking antibody or an “antagonist antibody” is one which inhibits or reduces biological activity of the antigen it binds.
  • Preferred blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen.
  • Bind refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity” refers to intrinsic binding affinity which reflects a 1 :1 interaction between members of a binding pair (e.g., antibody and antigen).
  • the affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein.
  • antibody fragment refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds.
  • a “functional fragment” is an antibody fragment that maintains a function of the full-length antibody. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.
  • chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
  • full length antibody “intact antibody,” and “whole antibody” are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region.
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts.
  • each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies.
  • a "human antibody” is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
  • a “humanized” antibody refers to a chimeric antibody comprising amino acid residues from non- human hypervariable regions (HVRs) and amino acid residues from human framework regions (FRs).
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., complementarity determining regions (CDRs)) correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody.
  • a humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody.
  • a "humanized form" of an antibody, e.g., a non-human antibody refers to an antibody that has undergone humanization.
  • an “immunoconjugate” is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent.
  • fibroblast growth factor receptor 3 and "FGFR3" as used herein, refers to any native FGFR3 from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise indicated.
  • the term encompasses "full-length,” unprocessed FGFR3 as well as any form of FGFR3 that results from processing in the cell.
  • the term also refers to any native FGFR3 from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise indicated.
  • the term encompasses "full-length,” unprocessed FGFR3 as well as any form of FGFR3 that results from processing in the cell.
  • the term also
  • FGFR3 encompasses naturally occurring variants of the FGFR3, e.g., splice variants or allelic variants.
  • An exemplary wild-type sequence of human FGFR3 polypeptide comprises the amino acid sequence from UniProt database of P22607-1 or P22607-2.
  • FGFR3 antagonist and "FGFR3 inhibitor” refers to any FGFR3 antagonist that is currently known in the art or that will be identified in the future, and includes any chemical entity that, upon administration to a patient, results in inhibition of a biological activity associated with activation of FGFR3 in the patient, including any of the downstream biological effects otherwise resulting from the binding to FGFR3 of its natural ligand.
  • FGFR3 antagonists include any agent that can block FGFR3 activation or any of the downstream biological effects of FGFR3 activation that are relevant to treating cancer in a patient.
  • Such an antagonist can act by binding directly to the intracellular domain of the receptor and inhibiting its kinase activity.
  • such an antagonist can act by occupying the ligand binding site or a portion thereof of the FGFR3 receptor, thereby making the receptor inaccessible to its natural ligand so that its normal biological activity is prevented or reduced.
  • such an antagonist can act by modulating the dimerization of FGFR3 polypeptides, or interaction of FGFR3 polypeptide with other proteins, or enhance ubiquitination and endocytotic degradation of FGFR3.
  • FGFR3 antagonists include but are not limited to small molecule inhibitors, antibodies or antibody fragments, antisense constructs, small inhibitory RNAs (i.e., RNA interference by dsRNA; RNAi), and ribozymes.
  • the FGFR3 antagonist is a small molecule or an antibody that binds specifically to human FGFR3.
  • Exemplary FGFR3 antagonist antibodies are described, for example, in U.S. Patent No. 8,410,250, which is incorporated herein by reference in its entirety.
  • U.S. Patent No. 8,410,250 describes the FGFR3 antagonist antibody clones 184.6, 84.6.1 , and 184.6.1 N54S (these clones are also referred to as "R3 Mab").
  • EGFR epidermal growth factor receptor
  • ErbB1 ErbB1
  • HER1 EGFR kinase
  • EGFR or ERBB1 refers to the gene encoding the EGFR protein product.
  • the amino acid sequence of an exemplary human EGFR protein may be found, for example, under UniProt Accession Number P00533.
  • EGFR antagonist and "EGFR inhibitor” refers to any EGFR antagonist that is currently known in the art or that will be identified in the future, and includes any chemical entity that, upon administration to a patient, results in inhibition of a biological activity associated with activation of the EGF receptor in the patient, including any of the downstream biological effects otherwise resulting from the binding to EGFR of its natural ligand.
  • EGFR antagonists include any agent that can block EGFR activation or any of the downstream biological effects of EGFR activation that are relevant to treating cancer in a patient.
  • Such an antagonist can act by binding directly to the intracellular domain of the receptor and inhibiting its kinase activity.
  • such an antagonist can act by occupying the ligand binding site or a portion thereof of the EGF receptor, thereby making the receptor inaccessible to its natural ligand so that its normal biological activity is prevented or reduced.
  • such an antagonist can act by modulating the dimerization of EGFR polypeptides, or interaction of EGFR polypeptide with other proteins, or enhance ubiquitination and endocytotic degradation of EGFR.
  • EGFR antagonists include but are not limited to small molecule inhibitors, antibodies or antibody fragments, antisense constructs, small inhibitory RNAs (i.e., RNA interference by dsRNA; RNAi), and ribozymes.
  • the EGFR antagonist is a small molecule or an antibody that binds specifically to human EGFR.
  • Exemplary EGFR antagonists suitable for use in the invention include, for example, small molecule EGFR antagonists including quinazoline EGFR kinase inhibitors, pyrido-pyrimidine EGFR kinase inhibitors, pyrimido-pyrimidine EGFR kinase inhibitors, pyrrolo-pyrimidine EGFR kinase inhibitors, pyrazolo-pyrimidine EGFR kinase inhibitors, phenylamino-pyrimidine EGFR kinase inhibitors, oxindole EGFR kinase inhibitors, indolocarbazole EGFR kinase inhibitors, phthalazine EGFR kinase inhibitors, isoflavone EGFR kinase inhibitors, quinalone EGFR kinase inhibitors, and tyrphostin EGFR kinase inhibitors, such as those described in the following patent publications, and all pharmaceutical
  • Additional non-limiting examples of small molecule EGFR antagonists include any of the EGFR kinase inhibitors described in Traxler, Exp. Opin. Ther. Patents 8(12):1599-1625 (1998).
  • small molecule EGFR antagonists that can be used according to the present invention include [6,7-bis(2-methoxyethoxy)-4-quinazolin-4-yl]-(3-ethynylphenyl) amine (also known as OSI-774, erlotinib, or TARCEVATM (erlotinib HCI); OSI Pharmaceuticals/Genentech/Roche) (U.S. Pat. No. 5,747,498; International Patent Publication No. WO 01/34574, and Moyer et al. Cancer Res. 57:4838-4848 (1997)); CI-1033 (formerly known as PD183805; Pfizer) (Sherwood et al., Proc. Am.
  • a particularly preferred small molecule EGFR kinase inhibitor that can be used according to the present invention is [6,7-bis(2-methoxyethoxy)-4-quinazolin-4- yl]-(3-ethynylphenyl) amine (i.e., erlotinib), its hydrochloride salt (i.e., erlotinib HCI, TARCEVATM), or other salt forms (e.g., erlotinib mesylate).
  • Exemplary EGFR antagonist antibodies include those described in Modjtahedi, et al., Br. J. Cancer 67:247-253 (1993); Teramoto et al., Cancer 77:639-645 (1996); Goldstein et al., Clin. Cancer Res. 1 :1311 -1318 (1995); Huang, et al., Cancer Res. 15:59(8) :1935-40 (1999); and Yang et al., Cancer Res. 59:1236-1243 (1999).
  • the EGFR antagonist antibody can be the monoclonal antibody Mab E7.6.3 (Yang et al. Cancer Res. 59:1236-43 (1999)), or Mab C225 (ATCC Accession No.
  • Suitable monoclonal EGFR antagonist antibodies include, but are not limited to, IMC-C225 (also known as cetuximab or ERBITUXTM; Imclone Systems), ABX-EGF (Abgenix), EMD 72000 (Merck KgaA, Darmstadt), RH3 (York Medical Bioscience Inc.), and MDX-447 (Medarex/ Merck KgaA).
  • TP53 cellular tumor antigen p53
  • p53 cellular tumor antigen p53
  • p53 p53
  • TP53 refers to a potent tumor suppressor protein encoding a 393 amino acid phosphoprotein.
  • TP53 is negatively regulated or mutated in many cancers. Absence or inactivation of TP53 may contribute to cancer.
  • a "wild type" TP53 is TP53 found in normal (i.e., non-cancerous cells) or TP53 that does not have a mutation correlated to a cancer.
  • TP53 status of a sample may be assessed as for example described in U.S. Pat. No. 6,090,566 issued to Vogelstein et al., or using standard techniques such as described herein or known in the art.
  • a TP53 molecule may include, without limitation, polypeptides containing sequences substantially identical to that set forth in for example UniProt Accession No. P04637 and nucleic acid molecules encoded by those sequences.
  • a "tyrosine kinase inhibitor” is an antagonist molecule which inhibits to some extent tyrosine kinase activity of a tyrosine kinase such as an EGFR receptor or an FGFR3 receptor.
  • BCG Bath Calmette-Guerin
  • Mycobacterium bovis Bacillus Calmette-Guerin
  • the vaccine may help the body's immune system make antibodies to destroy the TB bacteria. It also may help the immune system kill cancer cells, and is used, for example, as a treatment in bladder cancer.
  • cancer and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Included in this definition are benign and malignant cancers.
  • head stage cancer or “early stage tumor” is meant a cancer that is not invasive or metastatic or is classified as a Stage 0, 1, or II cancer.
  • cancer examples include, but are not limited to, carcinoma, lymphoma, blastoma (including medulloblastoma and retinoblastoma), sarcoma (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinoma, and islet cell cancer), mesothelioma, schwannoma (including acoustic neuroma), meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies.
  • carcinoma including lymphoma, blastoma (including medulloblastoma and retinoblastoma)
  • sarcoma including liposarcoma and synovial cell sarcoma
  • neuroendocrine tumors including carcinoid tumors, gastrinoma, and islet cell cancer
  • mesothelioma including schwannoma (including a
  • cancers include bladder cancer, squamous cell cancer (e.g., epithelial squamous cell cancer), lung cancer including small-cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, hepatoma, breast cancer (including metastatic breast cancer), colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, testicular cancer, esophageal cancer, tumors of the biliary tract, as well as head and neck cancer and multiple myeloma.
  • SCLC small-cell lung cancer
  • NSCLC non-small
  • pre-cancerous refers to a condition or a growth that typically precedes or develops into a cancer.
  • a "pre-cancerous" growth will have cells that are characterized by abnormal cell cycle regulation, proliferation, or differentiation, which can be determined by markers of cell cycle regulation, cellular proliferation, or differentiation.
  • Tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • cancer refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • cancer refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • Metastasis is meant the spread of cancer from its primary site to other places in the body. Cancer cells can break away from a primary tumor, penetrate into lymphatic and blood vessels, circulate through the bloodstream, and grow in a distant focus (metastasize) in normal tissues elsewhere in the body. Metastasis can be local or distant. Metastasis is a sequential process, contingent on tumor cells breaking off from the primary tumor, traveling through the bloodstream, and stopping at a distant site. At the new site, the cells establish a blood supply and can grow to form a life-threatening mass. Both stimulatory and inhibitory molecular pathways within the tumor cell regulate this behavior, and interactions between the tumor cell and host cells in the distant site are also significant.
  • non-metastatic is meant a cancer that is benign or that remains at the primary site and has not penetrated into the lymphatic or blood vessel system or to tissues other than the primary site.
  • a non-metastatic cancer is any cancer that is a Stage 0, I, or II cancer, and occasionally a Stage III cancer.
  • anti-cancer therapy refers to a therapy useful in treating cancer.
  • anticancer therapeutic agents include, but are not limited to, antagonists, chemotherapeutic agents, growth inhibitory agents, cytotoxic agents, agents used in radiation therapy, anti-angiogenesis agents, apoptotic agents, anti-tubulin agents, and other agents to treat cancer, anti-CD20 antibodies, platelet derived growth factor inhibitors (e.g., GLEEVECTM (Imatinib Mesylate)), a COX-2 inhibitor (e.g., celecoxib), interferons, cytokines, antagonists (e.g., neutralizing antibodies) that bind to one or more of the following targets ErbB2, ErbB3, ErbB4, PDGFR-beta, BlyS, APRIL, BCMA or VEGF receptor(s), TRAILApo2, and other bioactive and organic chemical agents, etc.
  • an antagonist is an FGFR3 antagonist, a TP53 antagonist, or an antagonist tolery agents,
  • radiation therapy is meant the use of directed gamma rays or beta rays to induce sufficient damage to a cell so as to limit its ability to function normally or to destroy the cell altogether. It will be appreciated that there will be many ways known in the art to determine the dosage and duration of treatment. Typical treatments are given as a one-time administration and typical dosages range from 10 to 200 units (Grays) per day.
  • treatment refers to clinical intervention in an attempt to alter the natural course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • an anti-cancer therapy e.g., an anti-cancer therapy including an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist
  • an anti-cancer therapy is used to delay development of a disease or disorder.
  • an “effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
  • a “therapeutically effective amount” of a substance/molecule of the invention, agonist or antagonist may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule, agonist or antagonist to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the substance/molecule, agonist or antagonist are outweighed by the therapeutically beneficial effects.
  • the term "therapeutically effective amount” refers to an amount of an antibody, polypeptide or antagonist of this invention effective to "treat" a disease or disorder in a mammal (e.g., a patient).
  • the therapeutically effective amount of the drug can reduce the number of cancer cells; reduce the tumor size or weight; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer.
  • the drug can prevent growth and/or kill existing cancer cells, it can be cytostatic and/or cytotoxic.
  • the therapeutically effective amount is a growth inhibitory amount.
  • efficacy in vivo can, for example, be measured by assessing the duration of survival, time to disease progression (TTP), duration of disease free survival (DFS), duration of progression free survival (PFS), the response rates (RR), duration of response, and/or quality of life.
  • TTP time to disease progression
  • DFS duration of disease free survival
  • PFS duration of progression free survival
  • RR response rates
  • survival refers to the patient remaining alive, and includes overall survival as well as disease free survival.
  • all survival refers to the patient remaining alive for a defined period of time, such as 1 year, 5 years, etc. from the time of diagnosis or treatment.
  • progression-free survival in the context of the present invention refers to the length of time during and after treatment during which, according to the assessment of the treating physician or investigator, a patient's disease does not become worse, i.e., does not progress.
  • a patient's progression-free survival is improved or enhanced if the patient experiences a longer length of time during which the disease does not progress as compared to the average or mean progression free survival time of a control group of similarly situated patients.
  • DFS disease-free survival
  • extending survival is meant increasing survival, for example, overall or disease-free survival, in a treated patient relative to an untreated patient (i.e., relative to a patient not treated with an anti-cancer therapy (e.g., an anti-cancer therapy including a FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist), or relative to a patient who does not express FGFR3, TP53, and/or EGFR at a designated reference level.
  • an anti-cancer therapy e.g., an anti-cancer therapy including a FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist
  • cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes (e.g., At 211 , I 131 , 25 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 and radioactive isotopes of Lu), chemotherapeutic agents, e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents, enzymes and fragments thereof such as nucleolytic enzymes, antibiotics, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof, and the various antit
  • chemotherapeutic agent is a chemical compound useful in the treatment of cancer.
  • examples of chemotherapeutic agents include alkylating agents such as thiotepa and CYTOXAN®
  • alkyl sulfonates such as busulfan, improsulfan and piposulfan
  • aziridines such as benzodopa, carboquone, meturedopa, and uredopa
  • ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine
  • acetogenins especially bullatacin and bullatacinone
  • delta-9-tetrahydrocannabinol (dronabinol, MARINOL®)
  • beta-lapachone lapachol
  • colchicines betulinic acid
  • dynemicin including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubi
  • elfornithine elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan;
  • lonidainine lonidainine
  • maytansinoids such as maytansine and ansamitocins
  • mitoguazone mitoxantrone
  • mopidanmol mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofiran;
  • TAXOL® paclitaxel Bristol-Myers Squibb Oncology, Princeton, N.J.
  • chemotherapeutic agents include the cytotoxic agents useful as antibody drug conjugates, such as maytansinoids (DM1 , for example) and the auristatins MMAE and MMAF, for example.
  • “Chemotherapeutic agents” also include “anti-hormonal agents” that act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer, and are often in the form of systemic, or whole-body treatment. They may be hormones themselves.
  • Examples include anti- estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX® tamoxifen), EVISTA® raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY1 17018, onapristone, and FARESTON® toremifene; anti-progesterones; estrogen receptor down-regulators (ERDs); agents that function to suppress or shut down the ovaries, for example, leutinizing hormone-releasing hormone (LHRH) agonists such as LUPRON® and ELIGARD® leuprolide acetate, goserelin acetate, buserelin acetate and tripterelin; other anti-androgens such as flutamide, nilutamide and bicalutamide; and aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal
  • a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits growth and/or proliferation of a cell (e.g., a bladder cancer cell) either in vitro or in vivo.
  • the growth inhibitory agent may be one which significantly reduces the percentage of cells in S phase.
  • growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce G1 arrest and M-phase arrest.
  • Classical M-phase blockers include the vincas (vincristine and vinblastine), taxanes, and topoisomerase II inhibitors such as the anthracycline antibiotic doxorubicin ((8S-cis)-10-[(3-amino-2,3,6-trideoxy-a-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,1 1 - trihydroxy-8-(hydroxyacetyl)-1 -methoxy-5,12-naphthacenedione), epirubicin, daunorubicin, etoposide, and bleomycin.
  • vincas vincristine and vinblastine
  • topoisomerase II inhibitors such as the anthracycline antibiotic doxorubicin ((8S-cis)-10-[(3-amino-2,3,6-trideoxy-a-L-lyxo-hexapyranosyl)oxy]-7
  • DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5- fluorouracil, and ara-C. Further information can be found in "The Molecular Basis of Cancer,"
  • Taxanes are anticancer drugs both derived from the yew tree.
  • Docetaxel (TAXOTERE®, Rhone- Poulenc Rorer), derived from the European yew, is a semisynthetic analogue of paclitaxel (TAXOL®, Bristol-Myers Squibb). Paclitaxel and docetaxel promote the assembly of microtubules from tubulin dimers and stabilize microtubules by preventing depolymerization, which results in the inhibition of mitosis in cells.
  • the terms "patient” or “subject” are used interchangeably and refer to any single animal, more preferably a mammal (including such non-human animals as, for example, dogs, cats, horses, rabbits, zoo animals, cows, pigs, sheep, and non-human primates) for which treatment is desired. Most preferably, the patient herein is a human.
  • administering is meant a method of giving a dosage of a compound (e.g., an antagonist) or a pharmaceutical composition (e.g., a pharmaceutical composition including an antagonist) to a subject (e.g., a patient).
  • Administering can be by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
  • Parenteral infusions include, for example, intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • Dosing can be by any suitable route, e.g., by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
  • Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
  • an effective amount refers to an amount of a medicament that is effective for treating a disorder, for example, for treating a cancer.
  • pharmaceutical formulation refers to a sterile preparation that is in such form as to permit the biological activity of the medicament to be effective, and which contains no additional components that are unacceptably toxic to a subject to which the formulation would be administered.
  • a "sterile" formulation is aseptic or free from all living microorganisms and their spores.
  • a "package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products or medicaments, that contain information about the indications, usage, dosage, administration, contraindications, other therapeutic products to be combined with the packaged product, and/or warnings concerning the use of such therapeutic products or medicaments, etc.
  • a “kit” is any manufacture (e.g., a package or container) comprising at least one reagent, e.g., a medicament for treatment of a cancer (e.g., a bladder cancer), or a probe for specifically detecting a biomarker gene or protein of the invention.
  • the manufacture is preferably promoted, distributed, or sold as a unit for performing the methods of the present invention.
  • label when used herein refers to a compound or composition that is conjugated or fused directly or indirectly to a reagent such as a nucleic acid probe or an antibody and facilitates detection of the reagent to which it is conjugated or fused.
  • the label may itself be detectable (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
  • the term is intended to encompass direct labeling of a probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • the present invention provides methods for treating a patient suffering from cancer.
  • cancer embraces a collection of proliferative disorders, including but not limited to pre-cancerous growths, benign tumors, and malignant tumors.
  • Benign tumors remain localized at the site of origin and do not have the capacity to infiltrate, invade, or metastasize to distant sites.
  • Malignant tumors will invade and damage other tissues around them. They can also gain the ability to break off from the original site and spread to other parts of the body (metastasize), usually through the bloodstream or through the lymphatic system where the lymph nodes are located.
  • Primary tumors are classified by the type of tissue from which they arise; metastatic tumors are classified by the tissue type from which the cancer cells are derived.
  • cancer cells Over time, the cells of a malignant tumor become more abnormal and appear less like normal cells. This change in the appearance of cancer cells is called the tumor grade, and cancer cells are described as being well-differentiated (low grade), moderately-differentiated, poorly-differentiated, or undifferentiated (high grade). Well-differentiated cells are quite normal appearing and resemble the normal cells from which they originated. Undifferentiated cells are cells that have become so abnormal that it is no longer possible to determine the origin of the cells. In particular embodiments, invention provides methods of treating bladder cancer.
  • Cancer staging systems describe how far the cancer has spread anatomically and attempt to put patients with similar prognosis and treatment in the same staging group.
  • Several tests may be performed to help stage cancer including biopsy and certain imaging tests such as a chest x-ray, mammogram, bone scan, CT scan, and MRI scan. Blood tests and a clinical evaluation are also used to evaluate a patient's overall health and detect whether the cancer has spread to certain organs.
  • TNM classification system To stage cancer, the American Joint Committee on Cancer first places the cancer, particularly solid tumors, in a letter category using the TNM classification system. Cancers are designated the letter T (tumor size), N (palpable nodes), and/or M (metastases). T1 , T2, T3, and T4 describe the increasing size of the primary lesion; NO, N1 , N2, N3 indicates progressively advancing node involvement; and M0 and M1 reflect the absence or presence of distant metastases.
  • stage 0 is referred to as "in situ” or “Tis,” such as ductal carcinoma in situ or lobular carcinoma in situ for breast cancers.
  • stage I cancers are small localized cancers that are usually curable, while stage IV usually represents inoperable or metastatic cancer.
  • Stage II and III cancers are usually locally advanced and/or exhibit involvement of local lymph nodes.
  • the higher stage numbers indicate more extensive disease, including greater tumor size and/or spread of the cancer to nearby lymph nodes and/or organs adjacent to the primary tumor.
  • These stages are defined precisely, but the definition is different for each kind of cancer and is known to the skilled artisan.
  • cancer registries such as the NCI's Surveillance, Epidemiology, and End Results Program (SEER), use summary staging. This system is used for all types of cancer. It groups cancer cases into five main categories:
  • Distant is cancer that has spread from the primary site to distant organs or distant lymph nodes.
  • the tumor can be a solid tumor or a non-solid or soft tissue tumor
  • soft tissue tumors include leukemia (e.g., chronic myelogenous leukemia, acute myelogenous leukemia, adult acute lymphoblastic leukemia, acute myelogenous leukemia, mature B-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, polymphocytic leukemia, or hairy cell leukemia) or lymphoma (e.g., non- Hodgkin's lymphoma, cutaneous T-cell lymphoma, or Hodgkin's disease).
  • a solid tumor includes any cancer of body tissues other than blood, bone marrow, or the lymphatic system.
  • Solid tumors can be further divided into those of epithelial cell origin and those of non-epithelial cell origin.
  • epithelial cell solid tumors include tumors of the bladder, gastrointestinal tract, colon, breast, prostate, lung, kidney, liver, pancreas, ovary, head and neck, oral cavity, stomach, duodenum, small intestine, large intestine, anus, gall bladder, labium, nasopharynx, skin, uterus, male genital organ, urinary organs, and skin.
  • Solid tumors of non-epithelial origin include sarcomas, brain tumors, and bone tumors. Other examples of tumors are described in the Definitions section.
  • the methods of the invention include administering to the patient a therapeutically effective amount of an anti-cancer therapy, wherein the expression level at least one of the biomarkers of the invention (for example, a biomarker listed in Table 1 ) in a sample obtained from the patient has been determined to be changed relative to a reference level of the biomarker of the invention.
  • the invention provides a method of treating a cancer (e.g., bladder cancer) that involves administering to the patient a therapeutically effective amount of an anti-cancer therapy, wherein the expression level of at least one gene listed in Table 1 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89,
  • Table 1 e.
  • the invention provides a method of treating a cancer
  • the expression level of at least one gene listed in Table 4 e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, or 48 genes listed in Table 4) has been determined to be changed relative to a reference level of the at least one gene.
  • the change is an increase. In other embodiments, the change is a decrease.
  • the methods of the invention include administering to the patient a therapeutically effective amount of an anti-cancer therapy, wherein the expression level of at least one of the following genes: FGFR3, TP53, and/or EGFR in a sample obtained from the patient has been determined to be increased relative to a reference level of the at least one gene.
  • the expression level of biomarkers of the invention e.g., a gene listed in Table 1 , for example, FGFR3, TP53, and/or EGFR
  • the bladder cancer is NMIBC.
  • the bladder cancer is MIBC. In yet other embodiments, the bladder cancer is metastatic bladder cancer.
  • the patient may optionally have an advanced, refractory, recurrent, and/or chemotherapy-resistant form of the cancer.
  • a patient may have a recurrent bladder cancer, for example, a recurrent NMIBC.
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be changed at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2- fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of biomarker.
  • a biomarker of the invention e.g., a gene listed in Table 1 , for example, FGFR3, TP53, and/or EGFR
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10- fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of biomarker.
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be decreased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3- fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of biomarker.
  • the expression level of at least one (e.g., 1 , 2, or 3) of the following:
  • FGFR3, TP53, and/or EGFR in a sample obtained from the patient may be increased at .least 10%, 20%, 30%, 40%, 50%, 60%», 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of the at least one gene.
  • the expression level of FGFR3 may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12- fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of FGFR3.
  • the expression level of TP53 may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15- fold, 16-fold, or more relative to a reference level of TP53.
  • the expression level of EGFR may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of EGFR.
  • the reference level may be set to any percentile between, for example, the 20 th percentile and the 99 th percentile (e.g., the 20 th , 25 th , 30 th , 35 th , 40 th , 45 th , 50 th , 55 th , 60 th , 65 th , 70 th , 75 th , 80 th , 85 th , 90 th , 95 th , or 99 th percentile) of the overall distribution of the expression level of a biomarker (for example, FGFR3, TP53, or EGFR) in a given cancer type (e.g., bladder cancer).
  • a biomarker for example, FGFR3, TP53, or EGFR
  • the reference level may be set to the 25 th percentile of the overall distribution of the values in a bladder cancer. In other particular embodiments, the reference level may be set to the 50 th percentile of the overall distribution of the values in a bladder cancer. In other embodiments, the reference level may be the median of the overall distribution of the values in a bladder cancer.
  • the methods of the invention include administering to the patient an anticancer therapy that includes one or more (e.g., 1 , 2, or 3) of the following: an FGFR3 antagonist, a TP53, and/or an EGFR antagonist.
  • the methods of the invention include administering an anti-cancer therapy comprising an FGFR3 antagonist, a TP53 antagonist, or an EGFR antagonist.
  • the method may involve administering an anti-cancer therapy comprising an FGFR3 antagonist and an EGFR antagonist.
  • the method may involve
  • an anti-cancer therapy comprising an FGFR3 antagonist, a TP53 antagonist, and an EGFR antagonist.
  • the FGFR3 antagonist may be an FGFR3 antagonist antibody or a small molecule FGFR3 antagonist.
  • Exemplary FGFR3 antagonist antibodies such as 84.6, 184.6.1 , and 184.6.1 N54S, are described, for example, in U.S. Patent No. 8,410,250, which is incorporated herein by reference in its entirety.
  • the small molecule FGFR3 antagonist is a tyrosine kinase inhibitor.
  • the TP53 antagonist may be a TP53 antagonist antibody or a small molecule TP53 antagonist.
  • the EGFR antagonist may be an EGFR antagonist antibody or a small molecule EGFR antagonist.
  • the small molecule FGFR3 antagonist is a tyrosine kinase inhibitor.
  • the small molecule FGFR3 antagonist is erlotinib (TARCEVATM).
  • Exemplary EGFR antagonists that can be used in the methods of the invention include, for example, small molecule EGFR antagonists including quinazoline EGFR kinase inhibitors, pyrido- pyrimidine EGFR kinase inhibitors, pyrimido-pyrimidine EGFR kinase inhibitors, pyrrolo-pyrimidine EGFR kinase inhibitors, pyrazolo-pyrimidine EGFR kinase inhibitors, phenylamino-pyrimidine EGFR kinase inhibitors, oxindole EGFR kinase inhibitors, indolocarbazole EGFR kinase inhibitors, phthalazine EGFR kinase inhibitors, isoflavone EGFR kinase inhibitors, quinalone EGFR kinase inhibitors, and tyrphostin EGFR kinase inhibitors, such as those described in the following patent
  • small molecule EGFR antagonists that can be used in the methods of the invention include [6,7-bis(2-methoxyethoxy)-4-quinazolin-4-yl]-(3-ethynylphenyl) amine (also known as OSI-774, erlotinib, or TARCEVATM (erlotinib HCI); OSI
  • Exemplary EGFR antagonist antibodies that can be used in the methods of the invention include those described in Modjtahedi, et al., Br. J. Cancer 67:247-253 (1993); Teramoto et al., Cancer 77:639- 645 (1996); Goldstein et al., Clin. Cancer Res. 1 :131 1 -1318 (1995); Huang, et al., Cancer Res.
  • the EGFR antagonist antibody can be the monoclonal antibody Mab E7.6.3 (Yang et al., Cancer Res. 59:1236-43 (1999)), or Mab C225 (ATCC Accession No. HB-8508), or an antibody or antibody fragment having the binding specificity thereof.
  • Suitable monoclonal EGFR antagonist antibodies include, but are not limited to, IMC-C225 (also known as cetuximab or ERBITUXTM; Imclone Systems), ABX-EGF (Abgenix), EMD 72000 (Merck KgaA, Darmstadt), RH3 (York Medical Bioscience Inc.), and MDX-447 (Medarex/ Merck KgaA).
  • the cancer expresses FGFR3, amplified FGFR3, translocated FGFR3, and/or mutated FGFR3. In certain embodiments, the cancer expresses activated FGFR3. In certain embodiments, the cancer expresses translocated FGFR3 (e.g., a t(4;14) translocation). In certain embodiments, the cancer expresses constitutive FGFR3. In some embodiments, the constitutive FGFR3 comprises a mutation in the tyrosine kinase domain and/or the juxtamembrane domain and/or a ligand- binding domain. In certain embodiments, the cancer expresses ligand-independent FGFR3. In some embodiments, the cancer expresses ligand-dependent FGFR3.
  • the cancer expresses FGFR3 comprising a mutation corresponding to FGFR3-lllb S248C . In some embodiments, the cancer expresses FGFR3-lllb S2 8C and/or FGFR3-lllc S248C . In some embodiments, the cancer expresses FGFR3 comprising a mutation corresponding to FGFR3-lllb K652E . In some embodiments, the cancer expresses FGFR3-lllb K652E and/or FGFR3-lllc K650E .
  • FGFR3 comprising a mutation corresponding to FGFR3-lllb S249C .
  • the cancer expresses FGFR3-lllb S249C and/or FGFR3-lllc S249C .
  • the cancer expresses FGFR3 comprising a mutation corresponding to FGFR3- lllb G372C In some embodiments, the cancer expresses FGFR3-lllb G372C and/or FGFR3-lllc G370C
  • the cancer expresses FGFR3 comprising a mutation corresponding to FGFR3- lllb Y375C . In some embodiments, the cancer expresses FGFR3-lllb Y375C and/or FGFR3-lllc Y373C .
  • the cancer expresses (a) FGFR3-lllb K652E and (b) one or more of FGFR3- lllb R248C , FGFR3-lllb Y375C , FGFR3 -lllb S249C , and FGFR3lllb G372C
  • the cancer expresses (a) FGFR3-lllb R248C and (b) one or more of FGFR3- lllb K652E , FGFR3-lllb Y375C , FGFR3-lllb S249C , and FGFR3-lllb G372C .
  • the cancer expresses (a) FGFR3-lllb G372C and (b) one or more of FGFR3- lllb K652E , FGFR3-lllb Y375C , FGFR3-lllb S 49C , and FGFR3-lllb R248C .
  • the cancer expresses FGFR3-lllb R248C , FGFR3-lllb K652E , FGFR3-lllb Y375C ,
  • the cancer expresses increased levels of phospho-FGFR3, phospho- FRS2 and/or phospho-MAPK relative to a control sample (e.g., a sample of normal tissue) or level.
  • a control sample e.g., a sample of normal tissue
  • composition comprising an anti-cancer therapy for example, an anti-cancer therapy comprising an antagonist (e.g., an FGFR3 antagonist, a TP53 antagonist, and/or a EGFR antagonist) will be formulated, dosed, and administered in a fashion consistent with good medical practice.
  • an antagonist e.g., an FGFR3 antagonist, a TP53 antagonist, and/or a EGFR antagonist
  • Factors for consideration in this context include the particular type of cancer being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the cancer, the site of delivery of the agent, possible side-effects, the type of antagonist, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
  • the effective amount of the antagonist to be administered will be governed by such considerations.
  • the therapeutic agents of the invention are administered to a human patient, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes.
  • An ex vivo strategy can also be used for therapeutic applications. Ex vivo strategies involve transfecting or transducing cells obtained from the subject with a polynucleotide encoding an antagonist. The transfected or transduced cells are then returned to the subject.
  • the cells can be any of a wide range of types including, without limitation, hemopoietic cells (e.g., bone marrow cells, macrophages, monocytes, dendritic cells, T cells, or B cells), fibroblasts, epithelial cells, endothelial cells, keratinocytes, or muscle cells.
  • hemopoietic cells e.g., bone marrow cells, macrophages, monocytes, dendritic cells, T cells, or B cells
  • fibroblasts e.g., fibroblasts, epithelial cells, endothelial cells, keratinocytes, or muscle cells.
  • the anti-cancer therapy includes an antagonist antibody (e.g., an FGFR3 antagonist antibody, a TP53 antagonist antibody, or an EGFR antagonist antibody)
  • the antibody is administered by any suitable means, including parenteral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal, and, if desired for local immunosuppressive treatment, intralesional administration.
  • Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • the antibody is suitably administered by pulse infusion, particularly with declining doses of the antibody.
  • the dosing is given by injections, most preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
  • the antagonist compound is administered locally, for example, by direct injections, when the disorder or location of the tumor permits, and the injections can be repeated periodically.
  • the antagonist can also be delivered systemically to the subject or directly to the tumor cells, e.g., to a tumor or a tumor bed following surgical excision of the tumor, in order to prevent or reduce local recurrence or metastasis.
  • An anti-cancer therapy may be combined in a pharmaceutical combination formulation, or dosing regimen as combination therapy, with at least one additional compound having anti-cancer properties.
  • the at least one additional compound of the pharmaceutical combination formulation or dosing regimen preferably has complementary activities to the antagonist composition such that they do not adversely affect each other.
  • the anti-cancer therapy may include a chemotherapeutic agent, a cytotoxic agent, a cytokine, a growth inhibitory agent, an anti-hormonal agent, and combinations thereof.
  • a pharmaceutical composition containing an antagonist e.g., an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist
  • an antagonist e.g., an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist
  • Combination therapy is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner.
  • the therapeutic agent can be administered by the same route or by different routes.
  • an antagonist antibody in the combination may be administered by intravenous injection while a chemotherapeutic agent in the combination may be administered orally.
  • both of the therapeutic agents may be administered orally, or both therapeutic agents may be administered by intravenous injection, depending on the specific therapeutic agents.
  • the sequence in which the therapeutic agents are administered also varies depending on the specific agents.
  • each therapeutic agent is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
  • a typical daily dosage might range from about 1 Mg/kg to about 100 mg/kg or more, depending on the factors mentioned above.
  • the treatment is sustained until the cancer is treated, as measured by the methods described above.
  • other dosage regimens may be useful.
  • Preparation and dosing schedules for constituents of an anti-cancer therapy for example, an anti-cancer therapy comprising one or more antagonists (e.g., FGFR3 antagonists, TP53 antagonists, and/or EGFR antagonists), chemotherapeutic agents, etc. may be used according to manufacturer's instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in "Chemotherapy Service,” Ed., M.C. Perry, Williams & Wilkins, Baltimore, Md (1992).
  • the combination therapy may provide "synergy” and prove “synergistic”, that is, the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately.
  • a synergistic effect may be attained when the active ingredients are:
  • each active ingredient is administered sequentially, i.e., serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together.
  • the present invention includes administration by gene therapy.
  • administration of nucleic acids encoding the antagonist is encompassed by the expression "administering an effective amount of an anti-cancer therapy.” See, for example, WO 1996/07321 concerning the use of gene therapy to generate intracellular antibodies.
  • Such a method may be useful, for example, to target intracellular proteins such as TP53.
  • nucleic acid (optionally contained in a vector) into the patient's cells
  • in vivo and ex vivo the nucleic acid is injected directly into the patient, usually at the site where the antagonist is required.
  • ex vivo treatment the patient's cells are removed, the nucleic acid is introduced into these isolated cells and the modified cells are administered to the patient either directly or, for example, encapsulated within porous membranes which are implanted into the patient (see, e.g., U.S. Patent Nos. 4,892,538 and 5,283,187).
  • techniques available for introducing nucleic acids into viable cells The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro or in vivo in the cells of the intended host.
  • a commonly used vector for ex vivo delivery of the gene is a retrovirus.
  • the currently preferred in vivo nucleic acid transfer techniques include transfection with viral vectors (such as adenovirus, Herpes simplex I virus, or adeno-associated virus) and lipid-based systems (useful lipids for lipid-mediated transfer of the gene are DOTMA, DOPE and DC-Choi, for example).
  • viral vectors such as adenovirus, Herpes simplex I virus, or adeno-associated virus
  • lipid-based systems useful lipids for lipid-mediated transfer of the gene are DOTMA, DOPE and DC-Choi, for example.
  • an agent specific for the target cells such as an antibody specific for a cell-surface membrane protein on the target cell, a ligand for a receptor - on the target cell, etc.
  • proteins that bind to a cell-surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g., capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins that undergo internalization in cycling, and proteins that target intracellular localization and enhance intracellular half- life.
  • the technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262:4429-4432 (1987); and Wagner et al., PNAS USA 87:3410-3414 (1990).
  • Gene-marking and gene-therapy protocols are described, for example, in Anderson et al., Science 256:808-813 (1992) and WO 1993/25673.
  • the present invention provides methods for diagnosing a patient suffering from a cancer, for determining a prognosis of a patient suffering from cancer, for determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, and for optimizing therapeutic efficacy of an anti-cancer therapy for a patient having a cancer.
  • the methods are useful, inter alia, for diagnosing subtypes of cancer, for predicting treatment outcomes, and for increasing the likelihood that
  • the methods include determining an expression level at least one of the biomarkers of the invention (for example, a biomarker listed in Table 1 ) in a sample obtained from the patient and comparing the expression level to a reference level of the biomarker of the invention.
  • the methods include determining an expression level of at least one of the following genes: FGFR3, TP53, and/or EGFR in a sample obtained from the patient and comparing the expression level to a reference level of the at least one gene.
  • biomarkers of the invention e.g., FGFR3, TP53, and/or EGFR
  • the cancer is bladder cancer.
  • the bladder cancer is NMIBC. In other embodiments, the bladder cancer is MIBC. In yet other embodiments, the bladder cancer is metastatic bladder cancer.
  • the patient may optionally have an advanced, refractory, recurrent, and/or chemotherapy-resistant form of the cancer. For example, in some embodiments, a patient may have a recurrent bladder cancer, for example, a recurrent NMIBC.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of at least one of the genes listed in Table 1 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93,
  • Table 1 e.
  • the change may be an increase. In other embodiments, the change may be a decrease.
  • the cancer is bladder cancer.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of at least one (e.g., 1 , 2, or 3) of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient having a cancer.
  • the cancer is bladder cancer.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of FGFR3 ' ⁇ n a sample obtained from the patient; and (b) comparing the expression level of FGFR3 ⁇ o a reference level of FGFR3, wherein an increase in the expression level of FGFR3 in the patient sample relative to the reference level identifies a patient having a cancer.
  • the cancer is bladder cancer.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of TP53 in a sample obtained from the patient; and (b) comparing the expression level of TP53 ⁇ o a reference level of TP53, wherein an increase in the expression level of TP53 in the patient sample relative to the reference level identifies a patient having a cancer.
  • the cancer is bladder cancer.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of EGFR in a sample obtained from the patient; and (b) comparing the expression level of EGFR to a reference level of EGFR, wherein an increase in the expression level of EGFR in the patient sample relative to the reference level identifies a patient having a cancer.
  • the cancer is bladder cancer.
  • the invention provides a method for diagnosing a cancer in a patient, the method comprising the steps of: (a) determining the expression level of at least one of the genes listed in Table 4 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, or 48 genes listed in Table 4) in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein a change in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient having a cancer.
  • the change may be an increase.
  • the change may be a decrease.
  • the cancer is bladder cancer.
  • the method may further include (c) informing the patient that they have a cancer. In any of the preceding methods, the method may further include (d) selecting an anti-cancer therapy for treatment of the patient, when an increase in the level of expression of the at least one gene in the patient sample relative to the sample is detected. In any of the preceding embodiments, the method may further include administering a therapeutically effective amount of an anti-cancer therapy to the patient, for example, as described in Section III of the Detailed Description of the Invention.
  • the inventions provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 1 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94,
  • the invention provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; (b) comparing the expression level of the at least one gene to a reference level of the at least one gene; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is increased relative to the reference level.
  • the invention provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of FGFR3 in a sample obtained from the patient; (b) comparing the expression level of FGFR3 to a reference level of FGFR3; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is increased relative to the reference level.
  • the cancer is bladder cancer.
  • the invention provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of TP53 r a sample obtained from the patient; (b) comparing the expression level of TP53 ⁇ o a reference level of TP53; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is increased relative to the reference level.
  • the cancer is bladder cancer.
  • the invention provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of EGFR in a sample obtained from the patient; (b) comparing the expression level of EGFR to a reference level of EGFR; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is increased relative to the reference level.
  • the cancer is bladder cancer.
  • the inventions provides a method for the prognosis of a patient suffering from cancer, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 4 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, or 48 genes listed in Table 4) in a sample obtained from the patient; (b) comparing the expression level of the at least one gene to a reference level of the at least one gene; and (c) determining a prognosis for the patient, wherein a poor prognosis is indicated by an expression level of the at least one gene in the patient sample that is changed relative to the reference level.
  • the change may be an increase. In other embodiments, the change may be a decrease.
  • the cancer is bladder cancer
  • the prognosis may be a prognosis of survival.
  • the method is carried out prior to administering an anti-cancer therapy to the patient.
  • the method is carried out during administering an anti-cancer therapy to the patient.
  • the method is carried out after administering an anti-cancer therapy to the patient.
  • the method may further include identifying the patient as likely to benefit from administration of an anti-cancer therapy when the patient is determined to have a poor prognosis of survival.
  • the method may further include identifying the patient as less likely to benefit from administration of an anti-cancer therapy when the patient is determined to have a poor prognosis of survival.
  • the method may further include administering a therapeutically effective amount of an anti-cancer therapy to the patient, if the patient is determined to have a poor prognosis of survival, as described, for example, in Section III of the Detailed Description of the Invention.
  • the survival may be disease free survival, progression free survival, or overall survival.
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 1 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77,.78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of at least one of the following genes: FGFR3, TP53, and EGFR, in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the cancer is bladder cancer.
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of FGFR3 n a sample obtained from the patient; and (b) comparing the expression level of FGFR3 ⁇ o a reference level of FGFR3, wherein an increase in the expression level of FGFR3 in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the cancer is bladder cancer.
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of TP53 in a sample obtained from the patient; and (b) comparing the expression level of TP53 ⁇ o a reference level of TP53, wherein an increase in the expression level of TP53 in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the cancer is bladder cancer.
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of EGFR in a sample obtained from the patient; and (b) comparing the expression level of EGFR Xo a reference level of EGFR, wherein an increase in the expression level of EGFR in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the cancer is bladder cancer.
  • the invention provides a method of determining whether a patient having a cancer is likely to respond to treatment with an anti-cancer therapy, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 4 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, or 48 genes listed in Table 4) in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein a change in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the change may be an increase. In other embodiments, the change may be a decrease. In some
  • the invention provides a method of optimizing therapeutic efficacy of an anticancer therapy for a patient having a cancer, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 1 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 ,
  • Table 1
  • the invention provides a method of optimizing therapeutic efficacy of an anti-cancer therapy for a patient having a cancer, the method comprising: (a) determining the expression level of at least one (e.g., 1 , 2, or 3) of the following genes: FGFR3, TP53, and EGFR in a sample obtained from the patient; and (b) comparing the expression level of the at least one gene to a reference level of the at least one gene, wherein an increase in the expression level of the at least one gene in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anti-cancer therapy.
  • the change may be an increase. In other embodiments, the change may be a decrease.
  • the cancer is bladder cancer.
  • the invention provides a method of optimizing therapeutic efficacy of an anticancer therapy for a patient having a cancer, the method comprising: (a) determining the expression level of FGFR3 in a sample obtained from the patient; and (b) comparing the expression level of FGFR3 to a reference level of FGFR3, wherein an increase in the expression level of FGFR3 in the patient sample relative to the reference level identifies a patient who is likely to respond to treatment comprising an anticancer therapy.
  • the change may be an increase. In other embodiments, the change may be a decrease.
  • the cancer is bladder cancer.
  • the invention provides a method of optimizing therapeutic efficacy of an anticancer therapy for a patient having a cancer, the method comprising: (a) determining the expression level of at least one of the genes listed in Table 4 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17,
  • the change may be an increase. In other embodiments, the change may be a decrease. In some embodiments, the cancer is bladder cancer.
  • the method may further comprise further comprising
  • the invention provides a method of treating a patient suffering from a bladder cancer, the method comprising administering to the patient a therapeutically effective amount of an anticancer therapy other than Bacillus Calmette-Guerin (BCG) vaccine, wherein the expression level of TP53 in a sample obtained from the patient has been determined to be increased relative to a reference level of TP53.
  • BCG Bacillus Calmette-Guerin
  • the method may further include administering a therapeutically effective amount of an anti-cancer therapy to the patient, as described, for example, in Section III of the Detailed Description of the Invention.
  • the expression level of a biomarker of the invention may be determined by measuring messenger RNA (mRNA), as described, for example below or by methods known in the art.
  • mRNA messenger RNA
  • the expression level of a biomarker of the invention in a sample obtained from the patient is determined by a polymerase chain reaction (PCR) assay.
  • the PCR assay is a quantitative PCR assay.
  • the quantitative PCR assay is a TAQMAN® assay.
  • the assay is performed using a Fluidigm assay.
  • the expression level of a biomarker of the invention may be determined by measuring protein, as described, for example below or by methods known in the art.
  • the expression level of a biomarker of the invention in a sample obtained from the patient is determined by an immunohistochemical method.
  • FGFR3 overexpression may be analyzed by IHC. Paraffin-embedded tissue sections from a tumor biopsy may be subjected to the IHC assay and accorded a FGFR3 protein staining intensity criteria as follows:
  • Score 0 no staining is observed or membrane staining is observed in less than 10% of tumor cells.
  • Score 1+ a faint/barely perceptible membrane staining is detected in more than 10% of the tumor cells. The cells are only stained in part of their membrane.
  • Score 2+ a weak to moderate complete membrane staining is observed in more than 10% of the tumor cells.
  • Score 3+ a moderate to strong complete membrane staining is observed in more than 10% of the tumor cells.
  • those tumors with 0 or 1 + scores for FGFR3 overexpression assessment may be characterized as not overexpressing FGFR3, whereas those tumors with 2+ or 3+ scores may be characterized as overexpressing FGFR3.
  • tumors overexpressing FGFR3 may be rated by immunohistochemical scores corresponding to the number of copies of FGFR3 molecules expressed per cell, and can been determined biochemically.
  • the sample obtained from the patient is a tumor sample.
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be changed at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9- fold, 10-fold, 1 1 -fold, 12-fold, 3-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of biomarker.
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15- fold, 16-fold, or more relative to a reference level of biomarker.
  • the expression level of a biomarker of the invention in a sample obtained from the patient may be decreased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9- fold, 10-fold, 1 1 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of biomarker.
  • the expression level of at least one (e.g., 1 , 2, or 3) of the following: FGFR3, TP53, and/or EGFR in a sample obtained from the patient may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of the at least one gene.
  • the expression level of FGFR3 may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 1 1 -fold, 12- fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of FGFR3.
  • the expression level of TP53 may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
  • the expression level of EGFR may be increased at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11 -fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, or more relative to a reference level of EGFR.
  • the reference level may be set to any percentile between, for example, the 20 th percentile and the 99 lh percentile (e.g., the 20 th , 25 th , 30 th , 35 th , 40 th , 45 th , 50 th , 55 th , 60 th , 65 th , 70 th , 75 th , 80 th , 85 th , 90 th , 95 th , or 99 th percentile) of the overall distribution of the expression level of a biomarker (for example, FGFR3, TP53, or EGFR) in a given cancer type (e.g., bladder cancer).
  • a biomarker for example, FGFR3, TP53, or EGFR
  • the reference level may be set to the 25 th percentile of the overall distribution of the values in a bladder cancer. In other particular embodiments, the reference level may be set to the 50 th percentile of the overall distribution of the values in a bladder cancer. In other embodiments, the reference level may be the median of the overall distribution of the values in a bladder cancer.
  • a patient could provide a sample (e.g., a tumor biopsy or a blood sample) for diagnosis of a particular cancer, or subtype of cancer.
  • a sample e.g., a tumor biopsy or a blood sample
  • the diagnosis could be for bladder cancer.
  • the diagnosis could be for a subtype of bladder cancer, for example, NMIBC, MIBC, or metastatic bladder cancer.
  • a patient could provide a sample (e.g., a tumor biopsy or a blood sample) before treatment with an anti-cancer therapy and the sample could be examined by way of various in vitro assays to determine whether the patient's cells would be sensitive to an anti-cancer therapy, for example, an anti-cancer therapy including an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist.
  • a sample e.g., a tumor biopsy or a blood sample
  • an anti-cancer therapy including an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist.
  • an anti-cancer therapy including an antagonist (e.g., an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist), even when a patient is not predicted to be particularly sensitive to VEGF antagonists, based on data from diagnostic tests or from other criteria, particularly if all or most of the other obvious treatment options have failed, or if some synergy is anticipated when given with another treatment.
  • an antagonist e.g., an FGFR3 antagonist, a TP53 antagonist, and/or an EGFR antagonist
  • the sample may be taken from a patient who is suspected of having, or is diagnosed as having a cancer (e.g., bladder cancer), and hence is likely in need of treatment, or from a normal individual who is not suspected of having any disorder.
  • patient samples such as those containing cells, or proteins or nucleic acids produced by these cells, may be used in the methods of the present invention.
  • the level of a biomarker can be determined by assessing the amount (e.g., the absolute amount or concentration) of the markers in a sample, preferably a tissue sample (e.g., a tumor tissue sample, such as a biopsy).
  • the level of a biomarker can be assessed in bodily fluids or excretions containing detectable levels of biomarkers.
  • Bodily fluids or secretions useful as samples in the present invention include, e.g., blood, urine, saliva, stool, pleural fluid, lymphatic fluid, sputum, ascites, prostatic fluid, cerebrospinal fluid (CSF), or any other bodily secretion or derivative thereof.
  • the word blood is meant to include whole blood, plasma, serum, or any derivative of blood.
  • Assessment of a biomarker in such bodily fluids or excretions can sometimes be preferred in circumstances where an invasive sampling method is inappropriate or inconvenient.
  • the sample to be tested herein is preferably blood, synovial tissue, or synovial fluid, most preferably blood.
  • the sample may be frozen, fresh, fixed (e.g., formalin-fixed), centrifuged, and/or embedded (e.g., paraffin-embedded), etc.
  • the cell sample can, of course, be subjected to a variety of well-known post- collection preparative and storage techniques (e.g., nucleic acid and/or protein extraction, fixation, storage, freezing, ultrafiltration, concentration, evaporation, centrifugation, etc.) prior to assessing the amount of the marker in the sample.
  • biopsies may also be subjected to post-collection preparative and storage techniques, e.g., fixation.
  • any of the preceding methods further can, optionally, include selection of an anticancer therapy for administration to the patient and further include, optionally, administration of an anticancer therapy to the patient.
  • tissue or cell samples from mammals can be conveniently assayed for, e.g., mRNAs or DNAs from a genetic biomarker of interest using Northern, dot-blot, or polymerase chain reaction (PCR) analysis, array hybridization, RNase protection assay, or using DNA SNP chip microarrays, which are commercially available, including DNA microarray snapshots.
  • PCR polymerase chain reaction
  • a method for detecting mRNA from a genetic biomarker of interest in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced; and detecting the presence of the amplified cDNA.
  • such methods can include one or more steps that allow one to determine the levels of mRNA in a biological sample (e.g., by simultaneously examining the levels a comparative control mRNA sequence of a "housekeeping" gene such as an actin family member).
  • the sequence of the amplified cDNA can be determined.
  • Exemplary methods for detecting the expression level of FGFR3 are provided, for example, in U.S. Patent Application Publication No. 2014/0030259 and in U.S. Patent No. 8,410,250, both of which are incorporated herein by reference in their entirety.
  • expression of the genes set forth in Table 1 can be performed by RT- PCR technology.
  • Probes used for PCR may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator, or enzyme.
  • a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator, or enzyme.
  • Such probes and primers can be used to detect the presence of expressed genes set forth in Table 1 in a sample.
  • a great many different primers and probes may be prepared based on the sequences provided in herein and used effectively to amplify, clone and/or determine the presence and/or levels of expressed genes set forth in Table 1 and/or Table 4.
  • the RT-PCR may be quantitative RT-PCR.
  • quantitative RT-PCR may be performed in a microfluidic device, for example
  • Other methods include protocols that examine or detect mRNAs from at least one of the genes set forth in Table 1 (e.g., FGFR3, TP53, and EGFR mRNAs), in a tissue or cell sample by microarray technologies.
  • mRNAs from at least one of the genes set forth in Table 1 (e.g., FGFR3, TP53, and EGFR mRNAs), in a tissue or cell sample by microarray technologies.
  • test and control mRNA samples from test and control tissue samples are reverse transcribed and labeled to generate cDNA probes.
  • the probes are then hybridized to an array of nucleic acids immobilized on a solid support.
  • the array is configured such that the sequence and position of each member of the array is known. For example, a selection of genes that have potential to be expressed in certain disease states may be arrayed on a solid support.
  • Hybridization of a labeled probe with a particular array member indicates that the sample from which the probe was derived expresses that gene.
  • Differential gene expression analysis of disease tissue can provide valuable information.
  • Microarray technology utilizes nucleic acid hybridization techniques and computing technology to evaluate the mRNA expression profile of thousands of genes within a single experiment (see, e.g., WO 2001/75166). See, for example, U.S. Patent 5,700,637, U.S. Patent 5,445,934, and U.S. Patent 5,807,522, Lockart, Nature Biotechnology, 14:1675-1680 (1996); and Cheung et al., Nature Genetics 21 (Suppl):15-19 (1999) for a discussion of array fabrication.
  • DNA profiling and detection method utilizing microarrays described in EP 1753878 may be employed. This method rapidly identifies and distinguishes between different DNA sequences utilizing short tandem repeat (STR) analysis and DNA microarrays.
  • STR short tandem repeat
  • a labeled STR target sequence is hybridized to a DNA microarray carrying complementary probes. These probes vary in length to cover the range of possible STRs.
  • the labeled single-stranded regions of the DNA hybrids are selectively removed from the microarray surface utilizing a post-hybridization enzymatic digestion. The number of repeats in the unknown target is deduced based on the pattern of target DNA that remains hybridized to the microarray.
  • microarray processor is the Affymetrix GENECHIP® system, which is commercially available and comprises arrays fabricated by direct synthesis of oligonucleotides on a glass surface.
  • Other systems may be used as known to one skilled in the art.
  • RNA-based genomic analysis such as, for example, RNASeq.
  • protein assays are available including, for example, antibody-based methods as well as mass spectroscopy and other similar means known in the art.
  • antibody-based methods for example, the sample may be contacted with an antibody specific for said biomarker under conditions sufficient for an antibody-biomarker complex to form, and then detecting said complex.
  • Detection of the presence of the protein biomarker may be accomplished in a number of ways, such as by Western blotting (with or without immunoprecipitation), 2-dimensional SDS-PAGE, immunoprecipitation, ⁇ fluorescence activated cell sorting (FACS), flow cytometry, and ELISA procedures for assaying a wide variety of tissues and samples, including plasma or serum.
  • Western blotting with or without immunoprecipitation
  • 2-dimensional SDS-PAGE immunoprecipitation
  • immunoprecipitation ⁇ fluorescence activated cell sorting (FACS), flow cytometry, and ELISA procedures for assaying a wide variety of tissues and samples, including plasma or serum.
  • FACS fluorescence activated cell sorting
  • flow cytometry ELISA procedures for assaying a wide variety of tissues and samples, including plasma or serum.
  • ELISA ELISA
  • Sandwich assays are among the most useful and commonly used assays. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate, and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-antigen complex, a second antibody specific to the antigen, labeled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody- antigen-labeled antibody.
  • any unreacted material is washed away, and the presence of the antigen is determined by observation of a signal produced by the reporter molecule.
  • the results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of biomarker.
  • a simultaneous assay in which both sample and labeled antibody are added simultaneously to the bound antibody.
  • a first antibody having specificity for the biomarker is either covalently or passively bound to a solid surface.
  • the solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene.
  • the solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay.
  • the binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex is washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g., 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g., from room temperature to 40 °C such as between 25 "C and 32 °C inclusive) to allow binding of any subunit present in the antibody. Following the incubation period, the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of the biomarker. The second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to the molecular marker.
  • An alternative method involves immobilizing the target biomarkers in the sample and then exposing the immobilized target to specific antibody which may or may not be labeled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labeling with the antibody. Alternatively, a second labeled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody- second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
  • reporter molecule is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody.
  • the most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e., radioisotopes) and chemiluminescent molecules.
  • an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate.
  • glutaraldehyde or periodate As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan.
  • Commonly used enzymes include horseradish peroxidase, glucose oxidase, beta-galactosidase, and alkaline phosphatase, amongst others.
  • the substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable color change. Examples of suitable enzymes include alkaline phosphatase and peroxidase.
  • fluorogenic substrates which yield a fluorescent product rather than the chromogenic substrates noted above.
  • the enzyme-labeled antibody is added to the first antibody-molecular marker complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen-antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of biomarker which was present in the sample.
  • fluorescent compounds such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity.
  • the fluorochrome-labeled antibody When activated by illumination with light of a particular wavelength, the fluorochrome-labeled antibody adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic color visually detectable with a light microscope.
  • the fluorescent labeled antibody is allowed to bind to the first antibody-molecular marker complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength, the fluorescence observed indicates the presence of the molecular marker of interest.
  • Immunofluorescence and EIA techniques are both very well established in the art. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
  • kits or articles of manufacture are also provided by the invention.
  • Such kits can be used, for example, to diagnose a patient suffering from, or suspected of suffering from, a cancer (e.g., bladder cancer), to provide a prognosis for a patient suffering from a cancer, e.g., bladder cancer, and/or to determine if a patient with a cancer (e.g., bladder cancer) will be effectively responsive to an anti-cancer therapy.
  • kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
  • one of the container means may comprise a probe that is or can be detectably labeled.
  • probe may be an antibody or polynucleotide specific for a protein or message, respectively.
  • the kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, e.g., avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
  • a reporter-means such as a biotin-binding protein, e.g., avidin or streptavidin
  • kit will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • a label may be present on the container to indicate that the composition is used for a specific application, and may also indicate directions for either in vivo or in vitro use, such as those described above.
  • kits of the invention have a number of embodiments.
  • a typical embodiment is a kit comprising a container, a label on said container, and a composition contained within said container, wherein the composition includes a primary antibody that binds to a protein or autoantibody biomarker, and the label on said container indicates that the composition can be used to evaluate the presence of such proteins or antibodies in a sample, and wherein the kit includes instructions for using the antibody for evaluating the presence of biomarker proteins in a particular sample type.
  • the kit can further comprise a set of instructions and materials for preparing a sample and applying antibody to the sample.
  • the kit may include both a primary and secondary antibody, wherein the secondary antibody is conjugated to a label, e.g., an enzymatic label.
  • kits comprising a container, a label on said container, and a composition contained within said container, wherein the composition includes one or more polynucleotides that hybridize to a complement of a biomarker set forth in Table 1 under stringent conditions, and the label on said container indicates that the composition can be used to evaluate the presence of a biomarker set forth in Table 1 in a sample, and wherein the kit includes instructions for using the polynucleotide(s) for evaluating the presence of the biomarker RNA or DNA in a particular sample type.
  • kits include one or more buffers (e.g., block buffer, wash buffer, substrate buffer, eic), other reagents such as substrate (e.g., chromogen) that is chemically altered by an enzymatic label, epitope retrieval solution, control samples (positive and/or negative controls), control slide(s), etc.
  • Kits can also include instructions for interpreting the results obtained using the kit.
  • the kit can comprise, for example: (1 ) a first antibody (e.g., attached to a solid support) that binds to a biomarker protein; and, optionally, (2) a second, different antibody that binds to either the protein or the first antibody and is conjugated to a detectable label.
  • a first antibody e.g., attached to a solid support
  • a second, different antibody that binds to either the protein or the first antibody and is conjugated to a detectable label.
  • the kit can comprise, for example: (1 ) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a biomarker protein or (2) a pair of primers useful for amplifying a biomarker nucleic acid molecule.
  • the kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent.
  • the kit can further comprise components necessary for detecting the detectable label (e.g., an enzyme or a substrate).
  • the kit can also contain a control sample or a series of control samples that can be assayed and compared to the test sample.
  • Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit.
  • kits comprises any of the nucleotide sequences described herein, for example, one or more of SEQ ID NOs:1 -51 ,
  • Therapeutic formulations of the therapeutic agent(s) of the anti-cancer therapies described herein are prepared for storage by mixing the therapeutic agent(s) having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions.
  • anti-cancer therapies including antagonists such as FGFR3 antagonists, TP53 antagonists, and/or EGFR antagonists
  • optional pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids;
  • antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
  • polypeptides include proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins;
  • chelating agents such as EDTA
  • sugars such as sucrose, mannitol, trehalose or sorbitol
  • salt-forming counter-ions such as sodium
  • metal complexes e.g., Zn-protein complexes
  • non-ionic surfactants such as TWEENTM, PLURONICSTM, or polyethylene glycol (PEG).
  • Lyophilized formulations adapted for subcutaneous administration are described, for example, in U.S. Patent No. 6,267,958 (Andya ei al.). Such lyophilized formulations may be reconstituted with a suitable diluent to a high protein concentration and the reconstituted formulation may be administered subcutaneously to the mammal to be treated herein.
  • the formulation herein may also contain more than one active compound (a second medicament as noted above), preferably those with complementary activities that do not adversely affect each other.
  • a second medicament as noted above
  • the type and effective amounts of such medicaments depend, for example, on the amount and type of therapeutic agent(s) present in the formulation, and clinical parameters of the subjects.
  • the preferred such second medicaments are noted above.
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interracial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and
  • nanocapsules or in macroemulsions.
  • Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antagonist, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained- release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and ⁇ ethyl-L- glutamate copolymers of L-glutamic acid and ⁇ ethyl-L- glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.
  • LUPRON DEPOTTM injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate
  • poly-D-(-)-3-hydroxybutyric acid poly-D-(-)-3-hydroxybutyric acid.
  • formulations to be used for in vivo administration must be sterile. This is readily
  • FFPE formalin-fixed paraffin-embedded
  • Hematoxylin & eosin (H&E) stained sections were evaluated by two independent pathologists, and the tumor areas for cases with less than 70% neoplastic cellularity were marked by a pathologist for macro-dissection. Overall, tumor content ranged from 70-90%.
  • RNA and DNA were extracted from macrodissected samples as previously described (Schleifman et al. PLoS One 9(3): e90761 ; Schleifman et al. PLoS One 9(2): e88401 ).
  • Gene expression analysis of 96 unique mRNA transcripts of bladder cancer-relevant genes was performed on patient specimens starting with 100 ng total RNA that was reverse-transcribed to cDNA and pre-amplified in a single reaction using SUPERSCRIPT® lll/PLATINUM® Taq and pre-amplification reaction mix (Invitrogen, Carlsbad, CA).
  • thermocycling conditions were as follows: 1 cycle of 50"C for 15 min, 1 cycle of 70°C for 2 min, 14 cycles of 95 ' C for 15 sec and 1 cycle of 60"C for 4 min.
  • Pre-amplified cDNA was diluted 2-fold and then amplified using TAQMAN® Universal PCR MasterMix (Applied Biosystems, Foster City, CA) on the BIOMARKTM BMK-M-96.96 platform (Fluidigm, South San Francisco, CA) according to the manufacturer's instructions. All samples were assayed in triplicate.
  • Cycle threshold (Ct) values were converted to relative expression using the 2 "ACt method (Livak et al. Methods 25(4): 402-408, 2001 ), where ACt is the mean of the target gene minus the mean of the 96 Ct values calculated for the respective patient specimen.
  • Table 2 shows the nucleotide sequences of custom TAQMAN® probes and oligonucleotides that were used for the indicated genes.
  • FGF1 fibroblast growth factor 1 (acidic) 3665 5q31.3-q33.2 Hs00265254_m1
  • FGF2 fibroblast growth factor 2 (basic) 3676 4q26 Hs00266645_m1
  • FGF7 fibroblast growth factor 7 3685 15q21.2 Hs00940253_m1 fibroblast growth factor 9 (glia-activating 3687 13q11 -q12 Hs00181829_m1
  • FGFR3 C Isoform fibroblast growth factor receptor 3 3690 4p16.3 custom
  • FGFR3 B Isoform fibroblast growth factor receptor 3 3690 4p16.3 custom
  • FGFR4 fibroblast growth factor receptor 4 3691 5q33-qter Hs01 106908_m1 fms-related tyrosine kinase 1 (vascular 3763 13q12 Hs01052961_m1
  • FRS2 fibroblast growth factor receptor substrate 2 16971 12q15 Hs00183614_m1
  • HIF1A basic helix-loop-helix transcription factor
  • MAP2K2 mitogen-activated protein kinase kinase 2 6842 19p13.3 Hs00360961_m1
  • MAPK14 mitogen-activated protein kinase 14 6876 6p21.3-p21.2 Hs00176247_m1
  • HGNC HUGO Gene Nomenclature Committee.
  • ERBB2 TTTGGACCGGAGGCT GAGTGTCAGCCCCAGAATG GTGGGCACAGGCCACACA
  • VPS33B AGAAGAGGTCTGGAG CCTGCACGTGTCCCAACTG GGCACACGTGCTTCTTCTTG
  • AGC (SEQ ID NO: 49) (SEQ ID NO: 50) (SEQ ID NO: 51 )
  • Mutation analyses were carried out on genomic DNA extracted from macrodissected FFPE tissues using the QIAAMP® FFPE kit (Qiagen, Valencia, CA) after deparaffinization with ENVIRENETM (Schleifman et al. PLoS One 9(3): e90761 ). Mutations in PIK3CA, EGFR, KRAS, NRAS, HRAS, FGFR3, MET, BRAF, KIT, AKT1, and FL T3 were detected using mutation-specific qPCR as described previously (Schleifman et al. PLoS One 9(3): e90761 ).
  • NGS Next-generation sequencing
  • ION TORRENTTM next-generation sequencing using the ION AMPLISEQTM Cancer Hotspot Panel v2 (Life Technologies, Carlsbad, CA) according to manufacturer guidelines (see, e.g., Tsongalis et al. Clin. Chem. Lab. Med. 52(5): 707-714, 2014).
  • Table 3 shows a summary of the results of the NGS mutation analysis of the bladder cancer samples (WT, wild-type; MUT, mutant).
  • Table 3 NGS Mutation Analysis of Bladder Cancer Samples
  • Immunohistochemistry was performed on 4-pm thick FFPE tissue section using the Ventana DISCOVERY® XT Autostainer platform (Ventana Medical Systems Inc, Arlington, AZ).
  • the slides underwent pre-treatment using CC1 extended antigen retrieval followed by staining with anti-FGFR3, clone 15C3 (Genentech) primary antibody diluted to 1 pg/mL and incubated for 60 minutes at room temperature.
  • clone 15C3 Genentech
  • an unconjugated rabbit anti-mouse linker antibody Jackson Immunoresearch, West Grove, PA
  • Sections were counter-stained with hematoxylin, dehydrated, cleared and cover-slipped for viewing.
  • Bladder cancer cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA) or from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Braunschweig, Germany). Cell lines were archived at an early passage in the Genentech cell bank and authenticated either by a multiplex short tandem repeat assay or as previously described (O'Brien et al. Clin. Cancer Res. 16(14): 3670-3683, 2010). All cell lines were maintained in RPMI 1640 or DMEM supplemented with 10% fetal bovine serum (Sigma, St. Louis, MO), nonessential amino acids, and 2 mmol/L L-glutamine.
  • ATCC American Type Culture Collection
  • DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
  • Erlotinib (TARCEVATM) is a selective and potent inhibitor of EGFR. Details of its structure, selectivity, and biological properties have been previously described (Stamos et al. J. Biol. Chem.
  • unsupervised hierarchical clustering was performed using Euclidean distance and complete linkage.
  • Nonparametric Mann-Whitney tests see, e.g., Mann and Whitney, Annals of Mathematical Statistics 18(1 ): 50-60, 1947
  • Bonferroni corrections see, e.g., Bonferroni, Pubblicazioni del R Instituto Superiore di Scienze Economiche e Commerciali di Firenze Q: 3-62, 1936 and Miller, Simultaneous Statistical Inference, 2 nd Ed., Springer Verlag, pages 6-8, 1981 ) were applied to further identify differentially expressed genes among the bladder sample clusters.
  • DFS was defined as the time from the date of surgery to the date of recurrence or death.
  • OS was similarly defined as the time from the date of surgery to the date of death. Survival outcomes were censored at the latest observed time point when the patient was known to be recurrence-free (for DFS) or alive (for OS).
  • Kaplan-Meier estimates (see, e.g., Kaplan and Meier, Journal of the American Statistical Association 53(282): 457-481 , 1958) were used to estimate the DFS probability and survival probability over time. The 3-year and 5-year DFS rate and survival rate were also calculated from the Kaplan-Meier DFS/OS curve estimates. For the significance of differential mutation frequency between clusters, Fisher's exact test was performed.
  • Example 2 Development of a custom microfluidics-based bladder cancer gene expression panel and its application in stratifying archival bladder cancer clinical samples
  • the custom bladder cancer Fluidigm panel provides a robust platform for stratifying archival bladder cancer tissues.
  • Analysis of the clinically-annotated set of bladder cancer samples on this panel revealed three transcriptionally-distinct bladder cancer subtypes, including a NMIBC Green group that was associated with poor DFS likelihoods.
  • Example 3 FGFR3 is hyper-mutated and overexpressed in rapidly-recurrent NMIBCs, and high expression in a subset of invasive and metastatic tumors is associated with poor clinical outcomes
  • NMIBCs Fibroblast Growth Factor Receptor 3
  • FGFR3 Fibroblast Growth Factor Receptor 3
  • Example 4 The tumor suppressor TP53 is mutated and overexpressed in rapidly-recurring NMIBCs
  • the custom bladder cancer Fluidigm panel identified a transcriptionally-defined aggressive subset of NMIBCs. Comparative expression analysis showed that 45/96 genes (47%) were significantly differentially expressed between the rapidly recurring NMIBC Green and the more benign Red groups (P ⁇ 0.05, with multiple testing correction).
  • the differentially-expressed genes belonged to the FGFR3 pathway, as described above, and also the tumor suppressor TP53, Avian Erythroblastosis Oncogene B (ERBB), Epithelial-Mesenchymal Transition (EMT), Phosphatidylinositol-3-Kinase and Protein Kinase B (PI3K-AKT) pathways (Figure 8).
  • NGS analysis To further characterize our samples on a mutational level, we conducted NGS analysis (Tsongalis et al. Clin. Chem. Lab. Med. 52(5): 707-714, 2014). As expected, NGS data confirmed the presence of FGFR3 mutations described above and presented in Figure 7A ( Figure 9A, Table 3). Additionally, NGS analysis revealed mutations in several other genes, including TP53, PIK3CA, KRAS, VHL, EGFR, PTEN, and IDH2, among others ( Figure 9A, Table 3). Mutations in TP53 have been reported in invasive and metastatic bladder cancers and to a lesser extent in superficial disease (George et al. J. Clin. Oncol. 25(34): 5352-5358, 2007).
  • TP53 signature has been shown to be associated with resistance to chemotherapy in the invasive bladder cancer setting (Choi et al. Cancer Cell 25(2): 152-165, 2014).
  • Our data suggest that a high frequency of TP53 mutation may contribute to aggressive tumor behavior in patient with NMIBCs, and that this could be due, in part, to a counter-productive effect of BCG treatment in this patient population.
  • Example 5 High EGFR expression is associated with poor clinical outcomes and confers sensitivity to erlotinib in bladder cancer cell lines
  • Example 6 Custom bladder cancer Fluidigm panel accurately classifies bladder cancer samples into basal and luminal subtypes
  • the genes of the panel include components of receptor tyrosine kinase (RTK) pathways such as FGFR, ERBB, MET, PI3K/AKT, and MAPK axes; cell cycle and genome stability genes like TP53; as well as genes involved in the regulation of cell differentiation and development, and epithelial-mesenchymal transition (EMT) (Figure 12A).
  • RTK receptor tyrosine kinase
  • FGFR3 had the highest average expression value in luminal samples than any other gene on our panel, and the average FGFR3 expression level was one of the lowest in basal samples from the public datasets ( Figure 14B).
  • NMIBCs As described above, one of the characteristic features of NMIBCs is that they carry somatic activating mutations in FGFR3 in approximately 60-80% of cases, and a much lower frequency of approximately 15% has been reported in MIBCs and METs.
  • Table 4 Genes differentially expressed between basal and luminal groups value P Value mean gene Std. Dev. mean Dev gene gene gene
  • CDH1 -6.186010 1.00E-04 1.
  • OOE-04 0.308209 0.626927 -0.554378 1.255825
  • CDKN1 A -6.302967 1.00E-04 1.OOE-04 0.379429 0.948515 -0.569761 1.109340
  • TSC1 -4.289175 1. OOE-04 0.0015 0.239069 0.686542 -0.196540 0.688436
  • Pathways that exhibited a significant activation score in luminal tumors included the NF- ⁇ , TP53, ERK/MAP, G1/S cell cycle checkpoint, HGF, and VEGF signaling pathways (Figure 15F).
  • pathways that were significantly activated in the basal group included the PTEN, PI3K/AKT, ceramide, and cell cycle regulation signaling pathways ( Figure 15F).
  • FFPE formalin-fixed paraffin-embedded
  • RNA extracted from FFPE macrodissected using the High Pure FFPE RNA Micro Kit (Roche Diagnostics, Indianapolis, IN) after de-paraffinization with ENVIRENE®, as described previously (O'Brien et al. Clin. Cancer Res. 16:3670-3683, 2010).
  • Gene expression analysis of 96 unique mRNA transcripts of bladder cancer-relevant genes was performed on patient specimens starting with 00 ng total RNA that was reverse-transcribed to cDNA and pre-amplified in a single reaction using Superscript Ill/Platinum Taq and pre-amplification reaction mix (Invitrogen, Carlsbad, CA).
  • thermocycling conditions were as follows: 1 cycle of 50'C for 15 min, 1 cycle of 70 * C for 2 min, 14 cycles of 95'C for 15 sec, and 60'C for 4 min.
  • Pre-amplified cDNA was diluted 2-fold and then amplified using TAQMAN® Universal PCR MasterMix (Applied Biosystems, Foster City, CA) on the BIOMARKTM BMK-M- 96.96 platform (Fluidigm, South San Francisco, CA) according to the manufacturer's instructions. All samples were assayed in triplicate.
  • Cycle threshold (Ct) values were converted to relative expression using the ACt method (O'Brien et al. supra), where ACt was the mean of the target gene minus the geometric mean of reference genes calculated for the respective patient specimen.
  • Cycle threshold (Ct) values were normalized using median polish (Tukey et al. supra). Hierarchical clustering of differentially expressed genes was carried out on normalized data with the average-linkage method using 1 - Pearson correlation as a distance metric and subsequently visualized using R.
  • Mutation analyses were carried out on genomic DNA extracted from macrodissected FFPE tissues using the QIAamp FFPE kit (Qiagen, Valencia, CA) after deparaffinization with ENVIRENE® (Lindgren et al. PLoS One 7:e38863, 2012). Mutations in PIK3CA, EGFR, KRAS, NRAS, HRAS, FGFR3, MET, BRAF, KIT, AKT1, FL T3 were detected using mutation-specific qPCR as described previously (Schliefman et al. PLoS One 9:e88401 , 2014).
  • next generation sequencing was carried out using the ION AMPLISEQTM Cancer Hotspot Panel v2 (Life Technologies, Carlsbad, CA) according to manufacturer guidelines (Tsongalis et al.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2015/000237 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder Ceased WO2016105503A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
CA2969830A CA2969830A1 (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
HK18104105.4A HK1244847A1 (zh) 2014-12-24 2015-12-23 用於膀胱癌症的治疗,诊断和预後方法
RU2017125053A RU2739942C2 (ru) 2014-12-24 2015-12-23 Терапевтические, диагностические и прогностические способы для рака мочевого пузыря
BR112017012553-6A BR112017012553B1 (pt) 2014-12-24 2015-12-23 Método de tratamento de um paciente que sofre de um câncer, método para o diagnóstico de um câncer, método para o prognóstico de um paciente que sofre de câncer, método para determinar se um paciente com um câncer e método para otimizar a eficácia terapêutica de uma terapia anticâncer
AU2015371312A AU2015371312B2 (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
EP15831090.4A EP3237638B1 (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
MYPI2017000931A MY188938A (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
SG11201704852SA SG11201704852SA (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
JP2017533956A JP6900314B2 (ja) 2014-12-24 2015-12-23 膀胱癌の治療、診断、及び予後判定方法
CN201580075170.9A CN107223163A (zh) 2014-12-24 2015-12-23 用于膀胱癌症的治疗,诊断和预后方法
MX2017008421A MX394474B (es) 2014-12-24 2015-12-23 Métodos de pronóstico para cáncer de vejiga sin invasión muscular y antagonistas para usarse en el tratamiento de lo mismo.
EP19212435.2A EP3699290A1 (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic, and prognostic methods for cancer
KR1020177017321A KR20170095893A (ko) 2014-12-24 2015-12-23 방광암에 대한 치료, 진단, 및 예후 방법
IL252796A IL252796B (en) 2014-12-24 2017-06-08 Therapeutic, diagnostic and prognostic methods for cancer of the bladder
US15/628,775 US20170306418A1 (en) 2014-12-24 2017-06-21 Therapeutic, diagnostic, and prognostic methods for cancer
US17/743,230 US20220267864A1 (en) 2014-12-24 2022-05-12 Therapeutic, diagnostic, and prognostic methods for cancer
US18/157,597 US20230220491A1 (en) 2014-12-24 2023-01-20 Therapeutic, diagnostic, and prognostic methods for cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462096741P 2014-12-24 2014-12-24
US62/096,741 2014-12-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/628,775 Continuation US20170306418A1 (en) 2014-12-24 2017-06-21 Therapeutic, diagnostic, and prognostic methods for cancer

Publications (1)

Publication Number Publication Date
WO2016105503A1 true WO2016105503A1 (en) 2016-06-30

Family

ID=55275150

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/000237 Ceased WO2016105503A1 (en) 2014-12-24 2015-12-23 Therapeutic, diagnostic and prognostic methods for cancer of the bladder

Country Status (14)

Country Link
US (3) US20170306418A1 (enExample)
EP (2) EP3237638B1 (enExample)
JP (2) JP6900314B2 (enExample)
KR (1) KR20170095893A (enExample)
CN (1) CN107223163A (enExample)
AU (1) AU2015371312B2 (enExample)
CA (1) CA2969830A1 (enExample)
HK (1) HK1244847A1 (enExample)
IL (1) IL252796B (enExample)
MX (1) MX394474B (enExample)
MY (1) MY188938A (enExample)
RU (1) RU2739942C2 (enExample)
SG (1) SG11201704852SA (enExample)
WO (1) WO2016105503A1 (enExample)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3229800A2 (en) * 2014-12-11 2017-10-18 Bayer Pharma Aktiengesellschaft Use of pan fgfr inhibitors and method of identifying patients with cancer eligible for treatment with a pan fgfr inhibitor
US9845287B2 (en) 2012-11-01 2017-12-19 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
CN108676884A (zh) * 2018-06-04 2018-10-19 海口市人民医院(中南大学湘雅医学院附属海口医院) 一种用于预测膀胱癌的肿瘤标志物
US10208024B2 (en) 2015-10-23 2019-02-19 Array Biopharma Inc. 2-aryl- and 2-heteroaryl-substituted 2-pyridazin-3(2H)-one compounds as inhibitors of FGFR tyrosine kinases
US10227380B2 (en) 2012-02-15 2019-03-12 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
WO2019055622A1 (en) * 2017-09-14 2019-03-21 Siemens Healthcare Diagnostics Inc. ADHESIVE POLYMER CONTAINING MEMBRANES FOR IN VITRO DIAGNOSTIC DEVICES
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
US10308699B2 (en) 2011-10-18 2019-06-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10471120B2 (en) 2014-09-24 2019-11-12 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
WO2020208260A1 (en) * 2019-04-12 2020-10-15 Stratifyer Molecular Pathology Gmbh Method of classifying a sample based on determination of fgfr
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof
WO2021138391A1 (en) 2019-12-30 2021-07-08 Tyra Biosciences, Inc. Indazole compounds
WO2021138392A1 (en) 2019-12-30 2021-07-08 Tyra Biosciences, Inc. Aminopyrimidine compounds
GB2597332A (en) * 2020-07-20 2022-01-26 Institute Of Cancer Res Prognostic and treatment response predictive method
WO2022147246A1 (en) 2020-12-30 2022-07-07 Tyra Biosciences, Inc. Indazole compounds as kinase inhibitors
WO2022182972A1 (en) 2021-02-26 2022-09-01 Tyra Biosciences, Inc. Aminopyrimidine compounds and methods of their use
RU2793510C1 (ru) * 2022-07-25 2023-04-04 федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии" Министерства здравоохранения Российской Федерации Способ прогнозирования рецидива немышечно-инвазивного рака мочевого пузыря
WO2024006897A1 (en) 2022-06-29 2024-01-04 Tyra Biosciences, Inc. Indazole compounds
WO2024006883A1 (en) 2022-06-29 2024-01-04 Tyra Biosciences, Inc. Polymorphic compounds and uses thereof
WO2024138112A1 (en) 2022-12-22 2024-06-27 Tyra Biosciences, Inc. Indazole compounds
US12180207B2 (en) 2018-12-19 2024-12-31 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as inhibitors of FGFR tyrosine kinases
WO2025129014A1 (en) 2023-12-15 2025-06-19 Tyra Biosciences, Inc. Indazole compounds for the treatment of cancer
US12351571B2 (en) 2018-12-19 2025-07-08 Array Biopharma Inc. Substituted quinoxaline compounds as inhibitors of FGFR tyrosine kinases
WO2025222097A1 (en) 2024-04-19 2025-10-23 Tyra Biosciences, Inc. Indazole-based protac degraders and their anticancer activity
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
WO2026035809A1 (en) 2024-08-06 2026-02-12 Tyra Biosciences, Inc. Indazole compounds for the treatment of cancer

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180165599A1 (en) * 2016-12-12 2018-06-14 Business Objects Software Ltd. Predictive model integration
CN110115758B (zh) * 2018-02-05 2021-05-11 中山大学 Pik3ip1蛋白在调节t细胞反应和制备抗肿瘤药物中的应用
CN112955747A (zh) * 2018-09-19 2021-06-11 豪夫迈·罗氏有限公司 膀胱癌的治疗和诊断方法
CN111289748A (zh) * 2018-12-08 2020-06-16 惠州市中大惠亚医院 ErbB3蛋白在制备膀胱癌无创诊断产品中的应用
CN110055331B (zh) * 2019-05-10 2023-05-02 人和未来生物科技(长沙)有限公司 一种用于膀胱癌辅助诊断或筛查的试剂盒及其应用
JPWO2021010326A1 (enExample) * 2019-07-12 2021-01-21
CN111269983A (zh) * 2020-02-21 2020-06-12 深圳市众循精准医学研究院 一种膀胱癌基因扩增的fish检测方法、探针及试剂盒
EP4121565A4 (en) * 2020-03-18 2024-12-11 The Regents of University of California RISK STRATIFICATION OF MENINGIOMA PATIENTS
CN111679076A (zh) * 2020-06-15 2020-09-18 吉林医药学院 一种用于检测cyclinD1和BCL-2抗体的检测试剂盒
US20230178177A1 (en) * 2020-06-30 2023-06-08 Northwestern University A single patient classifier for t1 high grade bladder cancer
WO2022174234A2 (en) * 2021-02-10 2022-08-18 Foundation Medicine, Inc. Biomarkers for cancer treatment
JP2023023327A (ja) * 2021-08-05 2023-02-16 国立大学法人大阪大学 腫瘍のサブタイプ決定方法及びその応用、並びにサブタイプ決定のための方法
IT202200001817A1 (it) 2022-02-02 2023-08-02 Aizoon S R L Procedimento per la prognosi di una malattia in seguito ad un trattamento terapeutico, relativo sistema e prodotto informatico
IT202200005861A1 (it) 2022-03-24 2023-09-24 Aizoon S R L Procedimento per stimare una variabile di interesse associata ad una data malattia in funzione di una pluralità di diversi dati omici, relativo dispositivo e prodotto informatico
CN115343474B (zh) * 2022-06-27 2024-12-27 陕西佰美基因股份有限公司 Ckap4蛋白的应用、产品、表达干扰试剂及预后模型构建方法
AU2023208071A1 (en) 2022-07-25 2024-02-08 Aizoon S.r.l. Method for providing a clinical decision support, corresponding system for providing a clinical decision support, and computer program product

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014135655A1 (en) * 2013-03-06 2014-09-12 Institut Curie Compositions and methods for treating muscle-invasive bladder cancer

Family Cites Families (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US4018653A (en) 1971-10-29 1977-04-19 U.S. Packaging Corporation Instrument for the detection of Neisseria gonorrhoeae without culture
US4016043A (en) 1975-09-04 1977-04-05 Akzona Incorporated Enzymatic immunological method for the determination of antigens and antibodies
US4424279A (en) 1982-08-12 1984-01-03 Quidel Rapid plunger immunoassay method and apparatus
US4892538A (en) 1987-11-17 1990-01-09 Brown University Research Foundation In vivo delivery of neurotransmitters by implanted, encapsulated cells
US5283187A (en) 1987-11-17 1994-02-01 Brown University Research Foundation Cell culture-containing tubular capsule produced by co-extrusion
US5700637A (en) 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
US5527676A (en) 1989-03-29 1996-06-18 The Johns Hopkins University Detection of loss of the wild-type P53 gene and kits therefor
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
AU658646B2 (en) 1991-05-10 1995-04-27 Rhone-Poulenc Rorer International (Holdings) Inc. Bis mono-and bicyclic aryl and heteroaryl compounds which inhibit EGF and/or PDGF receptor tyrosine kinase
NZ243082A (en) 1991-06-28 1995-02-24 Ici Plc 4-anilino-quinazoline derivatives; pharmaceutical compositions, preparatory processes, and use thereof
AU661533B2 (en) 1992-01-20 1995-07-27 Astrazeneca Ab Quinazoline derivatives
CA2134773A1 (en) 1992-06-04 1993-12-09 Robert J. Debs Methods and compositions for in vivo gene therapy
EP0672035A1 (en) 1993-10-01 1995-09-20 Novartis AG Pyrimidineamine derivatives and processes for the preparation thereof
US5656643A (en) 1993-11-08 1997-08-12 Rhone-Poulenc Rorer Pharmaceuticals Inc. Bis mono-and bicyclic aryl and heteroaryl compounds which inhibit EGF and/or PDGF receptor tyrosine kinase
IL112249A (en) 1994-01-25 2001-11-25 Warner Lambert Co Pharmaceutical compositions containing di and tricyclic pyrimidine derivatives for inhibiting tyrosine kinases of the epidermal growth factor receptor family and some new such compounds
IL112248A0 (en) 1994-01-25 1995-03-30 Warner Lambert Co Tricyclic heteroaromatic compounds and pharmaceutical compositions containing them
AU2096895A (en) 1994-03-07 1995-09-25 Sugen, Incorporated Receptor tyrosine kinase inhibitors for inhibiting cell proliferative disorders and compositions thereof
EP0682027B1 (de) 1994-05-03 1997-10-15 Novartis AG Pyrrolopyrimidinderivate mit antiproliferativer Wirkung
US5807522A (en) 1994-06-17 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US5910486A (en) 1994-09-06 1999-06-08 Uab Research Foundation Methods for modulating protein function in cells using, intracellular antibody homologues
DE69522717T2 (de) 1995-03-30 2002-02-14 Pfizer Inc., New York Chinazolinderivate
AU711592B2 (en) 1995-04-03 1999-10-14 Novartis Ag Pyrazole derivatives and processes for the preparation thereof
GB9508538D0 (en) 1995-04-27 1995-06-14 Zeneca Ltd Quinazoline derivatives
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
US5650415A (en) 1995-06-07 1997-07-22 Sugen, Inc. Quinoline compounds
ATE212993T1 (de) 1995-07-06 2002-02-15 Novartis Erfind Verwalt Gmbh Pyrolopyrimidine und verfahren zu ihrer herstellung
DK9500262U4 (da) 1995-07-07 1996-10-07 Bonus Energy As Bundramme til vindmøllehus samt vindmølle omfattende samme
US6267958B1 (en) 1995-07-27 2001-07-31 Genentech, Inc. Protein formulation
AR004010A1 (es) 1995-10-11 1998-09-30 Glaxo Group Ltd Compuestos heterociclicos
GB9523675D0 (en) 1995-11-20 1996-01-24 Celltech Therapeutics Ltd Chemical compounds
US6140317A (en) 1996-01-23 2000-10-31 Novartis Ag Pyrrolopyrimidines and processes for their preparation
JP3406763B2 (ja) 1996-01-30 2003-05-12 東レ・ダウコーニング・シリコーン株式会社 シリコーンゴム組成物
GB9603097D0 (en) 1996-02-14 1996-04-10 Zeneca Ltd Quinazoline compounds
GB9603095D0 (en) 1996-02-14 1996-04-10 Zeneca Ltd Quinazoline derivatives
DE19608588A1 (de) 1996-03-06 1997-09-11 Thomae Gmbh Dr K Pyrimido [5,4-d]pyrimidine, diese Verbindungen enthaltende Arzneimittel, deren Verwendung und Verfahren zu ihrer Herstellung
DE19629652A1 (de) 1996-03-06 1998-01-29 Thomae Gmbh Dr K 4-Amino-pyrimidin-Derivate, diese Verbindungen enthaltende Arzneimittel, deren Verwendung und Verfahren zu ihrer Herstellung
AU716383B2 (en) 1996-03-15 2000-02-24 Novartis Ag Novel N-7-heterocyclyl pyrrolo(2,3-d)pyrimidines and the use thereof
HU228446B1 (en) 1996-04-12 2013-03-28 Warner Lambert Co Kinazoline derivatives as irreversible inhibitors of protein-kinase, pharmaceutical compositions containing these compounds and use thereof
GB9607729D0 (en) 1996-04-13 1996-06-19 Zeneca Ltd Quinazoline derivatives
DE69734513T2 (de) 1996-06-24 2006-07-27 Pfizer Inc. Phenylamino-substituierte tricyclische derivate zur behandlung hyperproliferativer krankheiten
ES2191187T3 (es) 1996-07-13 2003-09-01 Glaxo Group Ltd Compuestos heteroaromaticos biciclicos como inhibidores de la proteina tirosin-quinasa.
HRP970371A2 (en) 1996-07-13 1998-08-31 Kathryn Jane Smith Heterocyclic compounds
JP4386967B2 (ja) 1996-07-13 2009-12-16 グラクソ、グループ、リミテッド プロテインチロシンキナーゼ阻害剤としての縮合複素環式化合物
DE69738468T2 (de) 1996-08-23 2009-01-08 Novartis Ag Substituierte pyrrolopyrimidine und verfahren zu ihrer herstellung
WO1998014449A1 (en) 1996-10-02 1998-04-09 Novartis Ag Fused pyrazole derivatives and processes for their preparation
ID18494A (id) 1996-10-02 1998-04-16 Novartis Ag Turunan pirazola leburan dan proses pembuatannya
WO1998014450A1 (en) 1996-10-02 1998-04-09 Novartis Ag Pyrimidine derivatives and processes for the preparation thereof
EP0837063A1 (en) 1996-10-17 1998-04-22 Pfizer Inc. 4-Aminoquinazoline derivatives
GB9621757D0 (en) 1996-10-18 1996-12-11 Ciba Geigy Ag Phenyl-substituted bicyclic heterocyclyl derivatives and their use
DE69839338T2 (de) 1997-02-05 2008-07-10 Warner-Lambert Company Llc Pyrido (2,3-d) pyrimidine und 4-amino-pyrimidine als inhibitoren der zellulären proliferation
WO1999007701A1 (en) 1997-08-05 1999-02-18 Sugen, Inc. Tricyclic quinoxaline derivatives as protein tyrosine kinase inhibitors
GB9800569D0 (en) 1998-01-12 1998-03-11 Glaxo Group Ltd Heterocyclic compounds
GB9800575D0 (en) 1998-01-12 1998-03-11 Glaxo Group Ltd Heterocyclic compounds
UA74803C2 (uk) 1999-11-11 2006-02-15 Осі Фармасьютікалз, Інк. Стійкий поліморф гідрохлориду n-(3-етинілфеніл)-6,7-біс(2-метоксіетокси)-4-хіназолінаміну, спосіб його одержання (варіанти) та фармацевтичне застосування
US6291496B1 (en) * 1999-12-27 2001-09-18 Andrew J. Dannenberg Treating cancers associated with overexpression of class I family of receptor tyrosine kinases
JP2003529774A (ja) 2000-03-31 2003-10-07 ジェネンテック・インコーポレーテッド 遺伝子発現を検出し定量するための構成物及び方法
US6500633B1 (en) * 2000-04-26 2002-12-31 Atairgin Technologies, Inc. Method of detecting carcinomas
JP4731793B2 (ja) 2000-12-28 2011-07-27 アルセア テクノロジーズ インコーポレイテッド 抗体全体またはそのフラグメントの結晶、ならびにこの結晶を作製および使用するための方法
US20060008823A1 (en) 2004-05-12 2006-01-12 Kemp Jennifer T DNA profiling and SNP detection utilizing microarrays
ES2564127T5 (es) * 2004-06-04 2020-03-26 Genentech Inc Mutaciones en EGFR
EP3702371B1 (en) 2009-03-25 2022-11-02 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US20130059303A1 (en) * 2011-09-06 2013-03-07 Francois Radvanyi Cdkn2a as a prognostic marker in bladder cancer
WO2014018841A1 (en) 2012-07-27 2014-01-30 Genentech, Inc. Methods of treating fgfr3 related conditions
US20150293105A1 (en) * 2012-10-26 2015-10-15 The University Of Queensland Methods for classifying tumors and uses therefor
NZ630213A (en) * 2013-03-14 2017-05-26 Abraxis Bioscience Llc Methods of treating bladder cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014135655A1 (en) * 2013-03-06 2014-09-12 Institut Curie Compositions and methods for treating muscle-invasive bladder cancer

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHAKRAVARTI A ET AL: "Expression of the epidermal growth factor receptor and Her-2 are predictors of favorable outcome and reduced complete response rates, respectively, in patients with muscle-invading bladder cancers treated by concurrent radiation and cisplatin-based chemotherapy: A report from the Radiation Therapy O", INTERNATIONAL JOURNAL OF RADIATION: ONCOLOGY BIOLOGY PHYSICS, PERGAMON PRESS, USA, vol. 62, no. 2, 1 June 2005 (2005-06-01), pages 309 - 317, XP025262773, ISSN: 0360-3016, [retrieved on 20050601], DOI: 10.1016/J.IJROBP.2004.09.047 *
GAKIS GEORGIOS ET AL: "Current status of molecular markers for prognostication and outcome in invasive bladder cancer", BJU INTERNATIONAL, vol. 110, no. 2, July 2012 (2012-07-01), pages 233 - 237, XP002756577 *
GUST KILIAN M ET AL: "Fibroblast Growth Factor Receptor 3 Is a Rational Therapeutic Target in Bladder Cancer", MOLECULAR CANCER THERAPEUTICS, vol. 12, no. 7, July 2013 (2013-07-01), pages 1245 - 1254, XP002756576 *
KIM WUN-JAE ET AL: "A four-gene signature predicts disease progression in muscle invasive bladder cancer.", MOLECULAR MEDICINE (CAMBRIDGE, MASS.) 2011 MAY-JUN, vol. 17, no. 5-6, May 2011 (2011-05-01), pages 478 - 485, XP002756573, ISSN: 1528-3658 *
LIANG CHENG ET AL: "Bladder cancer: translating molecular genetic insights into clinical practice", HUMAN PATHOLOGY, SAUNDERS, PHILADELPHIA, PA, US, vol. 42, no. 4, 8 July 2010 (2010-07-08), pages 455 - 481, XP028367813, ISSN: 0046-8177, [retrieved on 20100811], DOI: 10.1016/J.HUMPATH.2010.07.007 *
MAZZOLA CLARISSE R ET AL: "Dovitinib: rationale, preclinical and early clinical data in urothelial carcinoma of the bladder", EXPERT OPINION ON INVESTIGATIONAL DRUGS, vol. 23, no. 11, November 2014 (2014-11-01), pages 1553 - 1562, XP002756575 *
MOOSO BENJAMIN A ET AL: "The role of EGFR family inhibitors in muscle invasive bladder cancer: a review of clinical data and molecular evidence.", THE JOURNAL OF UROLOGY JAN 2015, vol. 193, no. 1, 23 August 2014 (2014-08-23), pages 19 - 29, XP029113056, ISSN: 1527-3792 *
PARK JINSUNG ET AL: "Do molecular biomarkers have prognostic value in primary T1G3 bladder cancer treated with bacillus Calmette-Guerin intravesical therapy?", UROLOGIC ONCOLOGY AUG 2013, vol. 31, no. 6, August 2013 (2013-08-01), pages 849 - 856, XP002756572, ISSN: 1873-2496 *
SHINOHARA ASANO ET AL: "Association of TP53 and MDM2 polymorphisms with survival in bladder cancer patients treated with chemoradiotherapy", CANCER SCIENCE, vol. 100, no. 12, December 2009 (2009-12-01), pages 2376 - 2382, XP002756574, ISSN: 1347-9032 *

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US12522669B2 (en) 2010-11-30 2026-01-13 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US10308699B2 (en) 2011-10-18 2019-06-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10227380B2 (en) 2012-02-15 2019-03-12 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US10669230B2 (en) 2012-11-01 2020-06-02 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9845287B2 (en) 2012-11-01 2017-12-19 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof
US10471120B2 (en) 2014-09-24 2019-11-12 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
EP3229800A2 (en) * 2014-12-11 2017-10-18 Bayer Pharma Aktiengesellschaft Use of pan fgfr inhibitors and method of identifying patients with cancer eligible for treatment with a pan fgfr inhibitor
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10208024B2 (en) 2015-10-23 2019-02-19 Array Biopharma Inc. 2-aryl- and 2-heteroaryl-substituted 2-pyridazin-3(2H)-one compounds as inhibitors of FGFR tyrosine kinases
US11255810B2 (en) 2017-09-14 2022-02-22 Siemens Healthcare Diagnostics Inc. Adhesive-polymer containing membranes for in vitro diagnostic devices
WO2019055622A1 (en) * 2017-09-14 2019-03-21 Siemens Healthcare Diagnostics Inc. ADHESIVE POLYMER CONTAINING MEMBRANES FOR IN VITRO DIAGNOSTIC DEVICES
CN108676884A (zh) * 2018-06-04 2018-10-19 海口市人民医院(中南大学湘雅医学院附属海口医院) 一种用于预测膀胱癌的肿瘤标志物
US12180207B2 (en) 2018-12-19 2024-12-31 Array Biopharma Inc. Substituted pyrazolo[1,5-a]pyridine compounds as inhibitors of FGFR tyrosine kinases
US12351571B2 (en) 2018-12-19 2025-07-08 Array Biopharma Inc. Substituted quinoxaline compounds as inhibitors of FGFR tyrosine kinases
WO2020208260A1 (en) * 2019-04-12 2020-10-15 Stratifyer Molecular Pathology Gmbh Method of classifying a sample based on determination of fgfr
US20220145403A1 (en) * 2019-04-12 2022-05-12 Stratifyer Molecular Pathology Gmbh Method of classifying a sample based on determination of fgfr
WO2021138392A1 (en) 2019-12-30 2021-07-08 Tyra Biosciences, Inc. Aminopyrimidine compounds
WO2021138391A1 (en) 2019-12-30 2021-07-08 Tyra Biosciences, Inc. Indazole compounds
WO2022018086A1 (en) * 2020-07-20 2022-01-27 The Institute Of Cancer Research: Royal Cancer Hospital Prognostic and treatment response predictive method
GB2597332A (en) * 2020-07-20 2022-01-26 Institute Of Cancer Res Prognostic and treatment response predictive method
WO2022147246A1 (en) 2020-12-30 2022-07-07 Tyra Biosciences, Inc. Indazole compounds as kinase inhibitors
WO2022182972A1 (en) 2021-02-26 2022-09-01 Tyra Biosciences, Inc. Aminopyrimidine compounds and methods of their use
WO2024006897A1 (en) 2022-06-29 2024-01-04 Tyra Biosciences, Inc. Indazole compounds
WO2024006883A1 (en) 2022-06-29 2024-01-04 Tyra Biosciences, Inc. Polymorphic compounds and uses thereof
RU2793510C1 (ru) * 2022-07-25 2023-04-04 федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии" Министерства здравоохранения Российской Федерации Способ прогнозирования рецидива немышечно-инвазивного рака мочевого пузыря
WO2024138112A1 (en) 2022-12-22 2024-06-27 Tyra Biosciences, Inc. Indazole compounds
WO2025129014A1 (en) 2023-12-15 2025-06-19 Tyra Biosciences, Inc. Indazole compounds for the treatment of cancer
WO2025222097A1 (en) 2024-04-19 2025-10-23 Tyra Biosciences, Inc. Indazole-based protac degraders and their anticancer activity
WO2026035809A1 (en) 2024-08-06 2026-02-12 Tyra Biosciences, Inc. Indazole compounds for the treatment of cancer

Also Published As

Publication number Publication date
BR112017012553A2 (pt) 2018-07-31
AU2015371312A1 (en) 2017-06-29
EP3237638B1 (en) 2020-01-15
EP3699290A1 (en) 2020-08-26
RU2017125053A (ru) 2019-01-24
MX394474B (es) 2025-03-24
MX2017008421A (es) 2018-03-23
CN107223163A (zh) 2017-09-29
US20230220491A1 (en) 2023-07-13
US20220267864A1 (en) 2022-08-25
AU2015371312B2 (en) 2022-01-27
KR20170095893A (ko) 2017-08-23
IL252796A0 (en) 2017-08-31
RU2017125053A3 (enExample) 2019-07-17
JP2018508469A (ja) 2018-03-29
IL252796B (en) 2022-04-01
SG11201704852SA (en) 2017-07-28
HK1244847A1 (zh) 2018-08-17
EP3237638A1 (en) 2017-11-01
JP6900314B2 (ja) 2021-07-07
JP2021169451A (ja) 2021-10-28
CA2969830A1 (en) 2016-06-30
MY188938A (en) 2022-01-13
US20170306418A1 (en) 2017-10-26
RU2739942C2 (ru) 2020-12-30

Similar Documents

Publication Publication Date Title
US20230220491A1 (en) Therapeutic, diagnostic, and prognostic methods for cancer
EP2949764B1 (en) Methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by cancer patients
EP3611506B1 (en) Predicting response to alvocidib by mitochondrial profiling
US20210338684A1 (en) Diagnostic and therapeutic methods for cancer
US20200392585A1 (en) Context dependent diagnostics test for guiding cancer treatment
SG178360A1 (en) Biological markers for monitoring patient response to vegf antagonists
AU2017249229A1 (en) Diagnostic and therapeutic methods for cancer
CN101910416A (zh) 在癌症患者中诊断性使用的方法和组合物
Rao et al. Excision repair cross-complementing group-1 (ERCC1) induction kinetics and polymorphism are markers of inferior outcome in patients with colorectal cancer treated with oxaliplatin
BR112017012553B1 (pt) Método de tratamento de um paciente que sofre de um câncer, método para o diagnóstico de um câncer, método para o prognóstico de um paciente que sofre de câncer, método para determinar se um paciente com um câncer e método para otimizar a eficácia terapêutica de uma terapia anticâncer
JP2010535523A (ja) Egfrインヒビター処理のための予測マーカー
AU2014213541B2 (en) Methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by cancer patients
HK40022688A (en) Predicting response to alvocidib by mitochondrial profiling

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15831090

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2969830

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 252796

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 11201704852S

Country of ref document: SG

REEP Request for entry into the european phase

Ref document number: 2015831090

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017533956

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/008421

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 20177017321

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2015371312

Country of ref document: AU

Date of ref document: 20151223

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017125053

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017012553

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112017012553

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170613