WO2016070769A1 - Protéine de fusion recombinante pour le blocage simultané des voies de signalisation b7/cd28 et il6/il6r/gp130 - Google Patents

Protéine de fusion recombinante pour le blocage simultané des voies de signalisation b7/cd28 et il6/il6r/gp130 Download PDF

Info

Publication number
WO2016070769A1
WO2016070769A1 PCT/CN2015/093581 CN2015093581W WO2016070769A1 WO 2016070769 A1 WO2016070769 A1 WO 2016070769A1 CN 2015093581 W CN2015093581 W CN 2015093581W WO 2016070769 A1 WO2016070769 A1 WO 2016070769A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion protein
amino acid
bifunctional fusion
seq
acid sequence
Prior art date
Application number
PCT/CN2015/093581
Other languages
English (en)
Chinese (zh)
Inventor
杨亚平
刘家望
宋楠萌
陈国强
张磊
张笑岩
邱红娟
车美英
Original Assignee
北京韩美药品有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 北京韩美药品有限公司 filed Critical 北京韩美药品有限公司
Priority to CN201580059624.3A priority Critical patent/CN107074976B/zh
Publication of WO2016070769A1 publication Critical patent/WO2016070769A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention relates to a recombinant fusion protein which simultaneously blocks the B7/CD28 and IL6/IL6R/GP130 signaling pathways, in particular, the present invention relates to a bifunctional fusion protein comprising a CTLA4 molecule extracellular domain, a linker peptide and an anti-IL6 monoclonal antibody, A gene encoding the bifunctional fusion protein, a vector containing the gene, a host cell containing the vector, and a pharmaceutical composition containing the bifunctional fusion protein.
  • Rheumatoid arthritis is a chronic, progressive, systemic autoimmune disease characterized by joint synovitis, with a prevalence of 0.5% to 1% in the global population.
  • the early symptoms are swelling, pain, and difficulty in movement of the joints.
  • the joints will be severely deformed or even disabling, and may involve other tissues and organs, causing diseases such as interstitial lung disease, pleurisy, pericarditis, and rheumatoid vasculitis. Therefore, timely and effective treatment is of great significance in preventing the progression of the disease, alleviating symptoms and improving the quality of life of patients.
  • RA treatments mainly use non-steroidal anti-inflammatory drugs, glucocorticoids and drugs that relieve the disease.
  • TNF ⁇ antagonists that inhibit TNF ⁇ activity
  • Rituximab a monoclonal antibody against B cells
  • inhibition Abatacept of T cell activity, monoclonal antibody tocilizumab which inhibits IL-6 signaling pathway, Anakinra which neutralizes IL-1 activity, etc. (Vierboom M, Breedveld E, Hart BA. Expert opinion on drug discovery. 2012, 7(4): 315-325).
  • Biologics are more effective than traditional RA treatments, have shorter treatment cycles, and have fewer side effects.
  • Cytotoxic T lymphocyte-associated antigen 4 also known as CD152, is a leukocyte differentiation antigen.
  • the ligands of CTLA4 and CD28 are B7 molecules, and CTLA4 binds to B7 molecule to induce T cell non-reactivity and participate in the negative regulation of immune response.
  • Abatacept (trade name OrenciaTM, Bristol-Myers Squibb ) , which was marketed in 2005 for the treatment of rheumatoid arthritis, is a monofunctional fusion protein consisting of two extracellular regions of CTLA4 , ECD) binds to the Fc segment of human IgG1 and inhibits T cell proliferation and activation by competitively blocking the binding of B7 to CD28 (Genovese MC, Becker JC, Schiff M, et al. N. Engl. J .Med., 2005, 353: 1114-1123).
  • IL6 is a cytokine secreted by lymphocytes, macrophages, and fibroblasts involved in various biological functions. It activates the signaling pathway by forming a complex with IL6R and GP130. Studies have shown that the levels of IL6 and IL6R in synovial fluid of RA patients are associated with synovitis symptoms and joint damage. Therefore, blocking the IL6 signaling pathway is a new approach to the treatment of RA.
  • the first anti-IL6 monoclonal antibody, Tocilizumab was developed by Roche for use in patients with TNF antagonists or moderate to severe active rheumatoid arthritis. Clinical application results show that Tocilizumab can effectively control the RA process and shows good tolerance (Tadamitsu K, Int. Immu., 2010, 22(5): 347-352).
  • treatment with co-administration may increase the clinical benefit of certain chronic inflammations such as rheumatoid arthritis.
  • Combination administration requires sequential injection of two or more antibodies, or the same dosage form of the antibody.
  • sequential injection of antibodies reduces the patient's treatment adherence and increases pain.
  • due to differences in the physicochemical properties of different antibodies it is difficult or almost impossible to make different antibodies into the same dosage form.
  • the present invention provides a therapeutic drug for RA which combines two mechanisms of action of inhibiting the B7/CD28 signaling pathway and inhibiting the IL6/IL6R/GP130 signaling pathway.
  • a first aspect of the invention relates to a bifunctional fusion protein comprising a fragment that blocks the B7/CD28 signaling pathway and a fragment that blocks the IL6/IL6R/GP130 signaling pathway.
  • the bifunctional fusion protein further comprises a linker peptide.
  • a fragment that blocks the B7/CD28 signaling pathway is linked to the N-terminus of a fragment that blocks the IL6/IL6R/GP130 signaling pathway via a linker peptide.
  • the fragment that blocks the B7/CD28 signaling pathway is the extracellular region of the CTLA4 molecule.
  • the fragment that blocks the IL6/IL6R/GP130 signaling pathway is a protein or domain that inhibits activation of the IL6/IL6R/GP130 signaling pathway.
  • the protein or domain of the bifunctional fusion protein that inhibits activation of the IL6/IL6R/GP130 signaling pathway is a natural or synthetic amino acid sequence having a blocking effect on the IL6/IL6R/GP130 signaling pathway.
  • the protein or domain of the bifunctional fusion protein that inhibits activation of the IL6/IL6R/GP130 signaling pathway is a monoclonal or polyclonal antibody or functional fragment thereof, chimeric antibody, humanized antibody, fully human Antibodies, single chain antibodies, bispecific antibodies.
  • the monoclonal antibody that inhibits activation of the IL6/IL6R/GP130 signaling pathway of the bifunctional fusion protein is an anti-IL6 monoclonal antibody, an anti-IL6R monoclonal antibody, an anti-GP130 monoclonal antibody, an anti-IL6-IL6R complex Monoclonal antibody, monoclonal antibody against IL6-GP130 complex, monoclonal antibody against IL6R-GP130 complex, monoclonal antibody against IL6-IL6R-GP130 complex, or functional fragment thereof, chimeric antibody, human Antibody, fully human antibody, bispecific antibody.
  • the monoclonal antibody is an IgG, IgA, IgD, IgE, IgM antibody or a hybrid thereof.
  • the monoclonal antibody is an IgG.
  • the functional fragment is a single domain antibody, a single chain antibody, a single chain variable fragment (scFv), a Fab fragment or a F(ab')2 fragment.
  • the monoclonal antibody that inhibits activation of the IL6/IL6R/GP130 signaling pathway of the bifunctional fusion protein is an anti-IL6 monoclonal antibody.
  • the joining sequence of the bifunctional fusion protein is the CTLA4 molecule extracellular domain, a linker peptide, and an anti-IL6 monoclonal antibody heavy chain.
  • the amino acid sequence of the extracellular region of the CTLA4 molecule is as shown in SEQ ID NO: 1 or is an amino acid of the sequence represented by SEQ ID NO: 1 substituted, deleted, or added with one or more amino acids.
  • a sequence such as 2, 3, 4, 5, 10, 15, 20, 30, 50 amino acid residues, or an amino acid sequence having at least 70% identity and equivalent function to the sequence set forth in SEQ ID NO: Such as at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3% , 99.4%, 99.5%, 99.6% identity.
  • the amino acid sequence of the heavy chain of the anti-IL6 monoclonal antibody is set forth in SEQ ID NO: 2, or the sequence set forth in SEQ ID NO: 2 is replaced, deleted or added with one or more amino acid residues.
  • An equivalent amino acid sequence such as 2, 3, 4, 5, 10, 15, 20, 30, 50 amino acid residues, or at least 70% identical to the sequence of SEQ ID NO: 2 and having equivalent functions Amino acid sequence, such as at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2 %, 99.3%, 99.4%, 99.5%, 99.6% identity.
  • the amino acid sequence of the light chain of the anti-IL6 monoclonal antibody is set forth in SEQ ID NO: 3, or the sequence set forth in SEQ ID NO: 3 is replaced, deleted or added with one or more amino acid residues.
  • An equivalent amino acid sequence such as 2, 3, 4, 5, 10, 15, 20, 30, 50 amino acid residues, or at least 70% identical to the sequence of SEQ ID NO: 3 and having equivalent functions Amino acid sequence, such as at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6% identity.
  • the amino acid sequence of the linker peptide is from 1 to 50 amino acids in length, for example, the amino acid sequence of the linker peptide is 10, 15, 20, 21, 22, 23, 24, 25 or 30 amino acids in length, In another embodiment, the linker peptide has an amino acid sequence of 25 amino acids in length, and in a further embodiment, the amino acid sequence of the linker peptide is set forth in SEQ ID NO: 5.
  • amino acid sequence of the heavy chain of the CTLA4 molecule extracellular domain-linker peptide-anti-IL6 monoclonal antibody is set forth in SEQ ID NO: 6, or the sequence shown in SEQ ID NO: 6 is replaced or deleted.
  • amino acid sequence formed by one or more amino acid residues, such as 2, 3, 4, 5, 10, 15, 20, 30, 50 amino acid residues, or having the sequence of SEQ ID NO: 6
  • a second aspect of the invention relates to a gene encoding a bifunctional fusion protein as described above.
  • nucleotide sequence encoding the gene is set forth in SEQ ID NOs: 7 and 8.
  • a third aspect of the invention relates to a recombinant vector operably linked to a gene encoding as described above.
  • the vector is a eukaryotic expression vector, and in certain embodiments, the vector is a vector X0GC engineered to have two expression cassettes.
  • a fourth aspect of the invention relates to a host cell comprising a recombinant vector as described above.
  • a fifth aspect of the invention relates to a method of producing a bifunctional fusion protein as described above, the method comprising:
  • the eukaryotic expression vector is X0GC, and in one embodiment, the host cell is HEK293-T or CHO cells.
  • a sixth aspect of the invention relates to a pharmaceutical composition wherein the active ingredient is a bifunctional fusion protein as described above.
  • a seventh aspect of the invention relates to the use of a bifunctional fusion protein as described above or a pharmaceutical composition as described above for the preparation of a medicament for preventing or treating an immune disease, a rejection reaction and a cardiovascular disease.
  • the bifunctional fusion protein or pharmaceutical composition is for use in the preparation of a medicament for the prevention or treatment of rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune cerebrospinal Inflammation, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis , gout, rejection of organ transplants, asthma Or atherosclerosis.
  • the bifunctional fusion protein or pharmaceutical composition is used to prepare a medicament for preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis Suppurative arthritis.
  • An eighth aspect of the invention relates to a bifunctional fusion protein as described above or a pharmaceutical composition as described above for use in the prevention or treatment of an immune disease, a rejection reaction, and a cardiovascular disease.
  • the bifunctional fusion protein or pharmaceutical composition is for use in preventing or treating a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, gout Rejection of organ transplants, asthma or atherosclerosis.
  • a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythemat
  • the bifunctional fusion protein or pharmaceutical composition is for use in preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, suppuration Arthritis.
  • a ninth aspect of the invention relates to a method for preventing or treating an immune disease, a rejection reaction, and a cardiovascular and cerebrovascular disease, comprising administering to a subject a therapeutically effective amount of a bifunctional fusion protein as described above or as described above Pharmaceutical composition.
  • the method is for preventing or treating a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic Vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, gout, rejection of organ transplantation, asthma Or atherosclerosis.
  • a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic Vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thro
  • the method is for preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, septic arthritis.
  • An eleventh aspect of the invention relates to a kit comprising a bifunctional fusion protein as described above, a coding gene as described above, a vector as described above or a host cell as described above.
  • the experimental results of the present invention indicate that the bifunctional fusion protein can simultaneously block the B7/CD28 signaling pathway and inhibit the IL6/IL6R/GP130 signaling pathway, and the animal model can effectively inhibit the development of joint inflammation, and can achieve the ratio of the fusion protein.
  • a single functional unit can achieve a more therapeutic effect in the treatment of RA. It is known to those skilled in the art that the combined use or fusion of several different mechanisms of action may result in different effects such as antagonism, irrelevance, accumulation or synergy, and the mutual use of two or more drugs in combination or fusion. The role can only be determined through specific experimental research and a lot of labor.
  • the bifunctional fusion protein of the present invention provides a superior drug candidate for excellent therapeutic effects in RA patients.
  • the bifunctional fusion protein of the invention simultaneously acts on two different targets for treating RA, and reduces the probability of failure or poor effect of single target treatment, and has important economic and social benefits.
  • the present invention can reduce the production cost, reduce the volume and frequency of clinical administration, improve subject compliance, and have a huge prevention and treatment of immune diseases. Application prospects.
  • Figure 1 is a schematic view showing the structure of a recombinant bifunctional fusion protein of the present invention.
  • FIG. 1 Electrophoretic detection of recombinant bifunctional fusion proteins of the present invention.
  • Lane 1 is a non-reduced anti-IL6 monoclonal antibody
  • lane 2 is a reduced anti-IL6 monoclonal antibody
  • lane 3 is a non-reduced CTLA4-anti-IL6 mAb
  • lane 4 is a reduced CTLA4-anti-IL6 mAb.
  • Figure 3 Binding of recombinant bifunctional fusion protein to human IL6 and mouse IL6 in the present invention.
  • Figure 4 The pharmacokinetic profile and pharmacokinetic parameters of the recombinant bifunctional fusion protein in the present invention.
  • Fig. 5 is a graph showing changes in the joint inflammation index of CIA-induced mice after treatment with the recombinant bifunctional fusion protein of the present invention.
  • FIG. 1 is a schematic diagram showing the structure of a recombinant bifunctional fusion protein of the present invention.
  • Functional fragments that block the B7/CD28 signaling pathway are operably linked to functional segments that block the IL6/IL6R/GP130 signaling pathway, retaining their respective spatial structures and exerting their respective physiological activities.
  • the functional fragment blocking the B7/CD28 signaling pathway and the functional fragment blocking the IL6/IL6R/GP130 signaling pathway may be directly fused together without affecting their respective functions, or may be in the two functional fragments Addition of other sequences, such as a linker peptide, or facilitating the promotion of the two functional fragments to their respective activities, or to induce other biological effects, such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity Other sequences that act, or are beneficial for enhancing the pharmacokinetic properties of the fusion protein.
  • the functional fragment that blocks the B7/CD28 signaling pathway is a CTLA4 molecule or a functional fragment thereof.
  • the functional fragment that blocks the IL6/IL6R/GP130 signaling pathway is an anti-IL6 single gram Long antibody.
  • the functional fragment that blocks the IL6/IL6R/GP130 signaling pathway is an antibody against an IL6R antibody, an anti-IL6-IL6R complex, an anti-GP130 antibody, an antibody against an IL6-GP130 complex, An antibody against the IL6-IL6R-GP130 complex or a functional fragment thereof.
  • the functional fragment that blocks the B7/CD28 signaling pathway is the extracellular region of the CTLA4 molecule.
  • CTLA4 molecular extracellular region refers to the extracellular region of cytotoxic Tlymphocyte-associated antigen 4 (CTLA4).
  • CCD extracellular region
  • SEQ ID NO: 1 is amino acid sequence 37-161 of the human CTLA4 protein (Genbank Accession No. NM_005214.4).
  • the amino acid sequence thereof can correspondingly reduce or increase one or more amino acid residues along the amino acid sequence of positions 37-161 of the human CTLA4 protein.
  • One or more amino acid residues in the amino acid sequence may also be substituted with conservative amino acids. Substitution of conservative amino acids is well known in the art.
  • the functional fragment that blocks the IL6/IL6R/GP130 signaling pathway is an IgG antibody (anti-IL-6 monoclonal antibody) that targets IL-6.
  • the IgG is a chimeric, humanized or fully human IgG.
  • the modifications may be chemical modifications, such as acylation, alkylation, PEGylation products, so long as these modifications retain the ability to target IL-6.
  • the functional equivalent refers to other polypeptide fragments that are capable of effecting the ability of the immunoglobulin to target IL-6 binding.
  • the functional fragment refers to a protein fragment that retains the ability to target IL-6, such as a single domain antibody, a single chain antibody, a single chain variable fragment (scFv), a Fab fragment, or F ( Ab') 2 fragment.
  • the variant refers to a polypeptide derived from a parent protein by one or more alterations at one or more (several) positions, ie, substitutions, insertions, and/or deletions.
  • the heavy chain of the anti-IL6 monoclonal antibody has the amino acid sequence set forth in SEQ ID NO: 2 and the light chain is set forth in SEQ ID NO: 3.
  • the amino acid sequence of the anti-IL6 antibody is also not unique and may be selected from monoclonal antibodies having neutralizing IL6 activity. One or more amino acid residues in the amino acid sequence may also be substituted with conservative amino acids.
  • the linker is from 1 to 50 amino acids in length, such as from 5 to 45 amino acids, from 10 to 35 amino acids, from 20 to 30 amino acids, and in certain embodiments, the length of the linker Is 25 amino acids, in certain embodiments, the sequence of the ligation fragment is set forth in SEQ ID NO:5.
  • the ligation fragment used in the present invention is not particularly limited as long as it functions as two components of the gap fusion protein, so that each component can correctly form each of its components. From the spatial structure, retain its biological activity, cell expression level and thermal stability.
  • the amino acid sequence of the bifunctional fusion protein of the invention is as shown in SEQ ID NOs: 3 and 6, or the sequence shown in SEQ ID NO: 3 and 6 is substituted, deleted or added with one or more amino acids.
  • the 3 and 6 sequences have an amino acid sequence of at least 70% identity and equivalent function.
  • the amino acid sequence of the bifunctional fusion protein of the invention has at least 80%, 85% of the sequence as shown in SEQ ID NOS: 3 and 6. 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7% or 99.8% identity and equivalent functional amino acids sequence.
  • identity has the meaning commonly known in the art, and those skilled in the art are also familiar with the rules and criteria for determining identity between different sequences. Sequences defined by the present invention with varying degrees of identity must also have the extracellular domain of the CTLA4 molecule or neutralize the activity of IL-17. Methods and means for screening variant sequences using the above activities are well known to those skilled in the art. Such variant sequences can be readily obtained by those skilled in the art in light of the teachings of the present disclosure.
  • bifunctional fusion protein is "comprising"
  • any other function independent of its function can be added to the bifunctional fusion protein sequence. sequence.
  • those skilled in the art may perform different sequences or different combinations of structures according to the needs, and add one or more additional amino acid residues at the two ends or the junction of the fusion protein.
  • the bifunctional fusion protein is defined by a closed expression, these conditions will not be truly covered.
  • the invention provides a coding gene comprising a nucleotide sequence encoding a bifunctional fusion protein of the invention.
  • one or more codons in the coding gene sequence can be replaced equidistantly, such as one or several codons, such as 1, 2, 3, without altering the encoded amino acid. , 4, 5, 6, 8, 9, 10, 15, 20, 30, 40, 50 codons. Codon usage tables are well known in the art.
  • nucleotide sequence encoding the fusion protein of the invention and the signal peptide sequence required for secretion expression is set forth in SEQ ID NO:4.
  • the invention provides a recombinant vector comprising a coding gene operably linked to a bifunctional fusion protein of the invention.
  • the recombinant vector is a recombinant expression vector, which may be a prokaryotic expression vector or a eukaryotic expression vector, but is preferably a eukaryotic expression vector, more preferably a recombinant expression vector for eukaryotic expression in mammals.
  • operably linked refers to a manner in which the coding gene is placed in a suitable position in the vector such that the coding gene is correctly and smoothly replicated, transcribed or expressed.
  • the invention provides a host cell transformed or transfected with a recombinant vector as described above, the host cell comprising a mammalian cell, a bacterial cell, a yeast cell, an insect cell, and a plant cell.
  • the host cell comprises CHO cells, HEK293 cells, NSO cells, and SP 2/0 cells.
  • the present invention provides a method of producing a bifunctional fusion protein of the present invention, wherein the method comprises: (1) cloning the coding gene of the above aspect into a eukaryotic expression vector and transfecting it into a host cell Expression; and (2) purification of the bifunctional fusion protein.
  • the purity of the purified bifunctional fusion protein is greater than 50%, more preferably greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9%.
  • the invention provides a pharmaceutical composition comprising a bifunctional fusion protein of the invention and a pharmaceutically acceptable carrier.
  • the bifunctional fusion protein may be the sole active ingredient of the pharmaceutical composition, or may be one of the active ingredients of the pharmaceutical composition, and other active ingredients are other therapeutic agents that can be used in combination with the bifunctional fusion protein.
  • the pharmaceutical compositions of the invention comprise a single administered dosage form, a topically administered dosage form, and a systemically administered dosage form.
  • the present invention provides the use of the bifunctional fusion protein or a pharmaceutical composition comprising the bifunctional fusion protein for the preparation of a medicament for preventing or treating an immune disease, a rejection reaction, and a cardiovascular disease.
  • the bifunctional fusion protein or pharmaceutical composition is for use in the preparation of a medicament for the prevention or treatment of rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune cerebrospinal Inflammation, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis , gout, rejection of organ transplants, asthma or atherosclerosis.
  • the bifunctional fusion protein or pharmaceutical composition is used to prepare a medicament for preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis Suppurative arthritis.
  • the present invention provides the bifunctional fusion protein or a pharmaceutical composition comprising the bifunctional fusion protein for use in preventing or treating an immune disease, a rejection reaction, and a cardiovascular disease.
  • the bifunctional fusion protein or pharmaceutical composition is for use in preventing or treating a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, gram Ron's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, gout, Rejection of organ transplants, asthma or atherosclerosis.
  • a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, gram Ron's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus
  • the bifunctional fusion protein or pharmaceutical composition is for use in preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, suppurative arthritis.
  • the present invention provides a method of preventing or treating an immune disease, a rejection, and a cardiovascular or cerebrovascular disease, comprising administering a therapeutically effective amount of the above aspect to a patient suffering from the disease or a population prone to the disease.
  • the step of the bifunctional fusion protein or a pharmaceutical composition comprising the bifunctional fusion protein comprising the bifunctional fusion protein.
  • the method is for preventing or treating a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic Vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, gout, rejection of organ transplantation, asthma Or atherosclerosis.
  • a disease such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crohn's disease, systemic Vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thro
  • the method is for preventing or treating a disease: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, septic arthritis.
  • the term "therapeutically effective amount” refers to a dose which, when administered, can exert a pharmacological effect in a subject.
  • the “therapeutically effective amount” can be easily determined by a person skilled in the art according to the condition of the patient such as age, body weight, disease state, and the like.
  • the conditions in which the bifunctional fusion protein of the present invention can prevent, treat or ameliorate are not limited.
  • any condition that can achieve prophylactic, therapeutic or ameliorating benefits by simultaneously blocking the B7/CD28 and IL-6/IL-6R/GP130 signaling pathways is included within the scope of the present invention.
  • the bifunctional fusion protein provided by the present invention is capable of binding to B7 and IL6.
  • Studies in mice that have been treated with CIA-induced arthritis have shown that the bifunctional fusion proteins provided by the present invention significantly ameliorate the progression of the disease.
  • Shows the dual function fusion of the present invention The structural constitutive form of the protein retains the same biological activity as the native protein, and also shows that the bifunctional fusion protein of the present invention has potential application value in immunomodulation, particularly immunosuppression.
  • the present invention has the following beneficial effects:
  • Item 1 A fusion protein comprising a fragment that blocks the B7/CD28 signaling pathway and a fragment that blocks the IL6/IL6R/GP130 signaling pathway.
  • Item 2 The bifunctional fusion protein according to Item 1, which further comprises a linker peptide.
  • Item 3 The bifunctional fusion protein according to Item 1 or 2, wherein the fragment blocking the B7/CD28 signaling pathway is linked to the N-terminus of the fragment blocking the IL6/IL6R/GP130 signaling pathway via a linker peptide.
  • the bifunctional fusion protein according to any one of items 1 to 3, wherein the fragment blocking the B7/CD28 signaling pathway is the extracellular region of the CTLA4 molecule.
  • Item 6 The bifunctional fusion protein according to Item 5, characterized in that the protein or domain of the bifunctional fusion protein which inhibits activation of the IL6/IL6R/GP130 signaling pathway is a natural or synthetic IL6/IL6R/GP130 signal. Amino acid sequence of pathway blockade.
  • Item 7 The bifunctional fusion protein according to Item 6, characterized in that the protein or domain of the bifunctional fusion protein which inhibits activation of the IL6/IL6R/GP130 signaling pathway is a monoclonal antibody or a polyclonal antibody or a functional fragment thereof.
  • Item 8 The bifunctional fusion protein according to Item 7, characterized in that the monoclonal antibody which inhibits activation of the IL6/IL6R/GP130 signaling pathway by the bifunctional fusion protein is an anti-IL6 monoclonal antibody, an anti-IL6R monoclonal antibody, and an anti-GP130 Monoclonal antibody, monoclonal antibody against IL6-IL6R complex, monoclonal antibody against IL6-GP130 complex, monoclonal antibody against IL6R-GP130 complex, monoclonal antibody against IL6-IL6R-GP130 complex.
  • the monoclonal antibody which inhibits activation of the IL6/IL6R/GP130 signaling pathway by the bifunctional fusion protein is an anti-IL6 monoclonal antibody, an anti-IL6R monoclonal antibody, and an anti-GP130 Monoclonal antibody, monoclonal antibody against IL6-IL6R complex, monoclonal antibody against IL6-GP130 complex, monoclonal antibody
  • Item 9 The bifunctional fusion protein according to Item 6, which is characterized by inhibition of a bifunctional fusion protein
  • the monoclonal antibody activated by the IL6/IL6R/GP130 signaling pathway is an anti-IL6 monoclonal antibody.
  • bifunctional fusion protein according to any one of items 1-9, wherein the bifunctional fusion protein is linked in the extracellular region of the CTLA4 molecule, a linker peptide and an anti-IL6 monoclonal antibody heavy chain.
  • the bifunctional fusion protein according to any one of items 1 to 10, characterized in that the amino acid sequence of the extracellular region of the CTLA4 molecule is as shown in SEQ ID NO: 1 or the sequence shown in SEQ ID NO: 1 is replaced.
  • the bifunctional fusion protein according to any one of items 1 to 11, wherein the amino acid sequence of the heavy chain of the anti-IL6 monoclonal antibody is as shown in SEQ ID NO: 2 or as shown in SEQ ID NO: 2.
  • the sequence is substituted, deleted, or added with one or more amino acids to form an equivalent amino acid sequence or an amino acid sequence having at least 70% identity and equivalent function to the sequence of SEQ ID NO: 2.
  • the bifunctional fusion protein according to any one of items 1 to 12, characterized in that the amino acid sequence of the light chain of the anti-IL6 monoclonal antibody is shown in SEQ ID NO: 3 or as shown in SEQ ID NO: An amino acid sequence having the same function formed by substitution, deletion, addition of one or more amino acids, or an amino acid sequence having at least 70% identity and equivalent function to the sequence of SEQ ID NO: 3.
  • the bifunctional fusion protein according to any one of items 2 to 13, wherein the amino acid sequence of the linker peptide is from 1 to 50 amino acids in length, preferably, the amino acid sequence of the linker peptide is 25 amino acids in length. More preferably, the amino acid sequence of the linker peptide is as shown in SEQ ID NO: 5.
  • the bifunctional fusion protein according to any one of items 1 to 14, wherein the amino acid sequence of the bifunctional fusion protein is as shown in SEQ ID NO: 6, or the sequence shown in SEQ ID NO: An equivalent amino acid sequence formed by substitution, deletion or addition of one or more amino acid residues, or an amino acid sequence having at least 70% identity and equivalent function to the sequence of SEQ ID NO: 6.
  • Item 16 A coding gene encoding the bifunctional fusion protein of Items 1-15.
  • Item 17 The gene encoding according to Item 16, characterized in that the nucleotide sequence encoding the gene is set forth in SEQ ID NOS: 7 and 8.
  • Item 18 A recombinant vector operably linked to the coding gene of Item 17.
  • Item 19 A host cell transformed or transfected with the recombinant vector of Item 18.
  • Item 20 A method of producing the bifunctional fusion protein of any one of items 1 to 15, the method comprising:
  • the eukaryotic expression vector is X0GC, preferably the host cell is HEK293-T and CHO.
  • Item 21 A pharmaceutical composition, wherein the active ingredient is the bifunctional fusion protein of any one of items 1 to 15.
  • Item 22 The bifunctional fusion protein of any one of items 1 to 15, or the pharmaceutical composition according to Item 21, in the preparation of a medicament for preventing or treating an immune disease, a rejection reaction, and a cardiovascular disease use.
  • Item 23 The use according to Item 22, characterized in that it is used for the preparation of a medicament for preventing or treating diseases such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, Gout, rejection of organ transplants, asthma or atherosclerosis.
  • diseases such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lup
  • Item 24 The use according to Item 22, which is characterized in that it is used for the preparation of a medicament for preventing or treating diseases: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, Septic arthritis.
  • the bifunctional fusion protein according to any one of items 1 to 15, or the pharmaceutical composition according to item 21, which is for use in the prevention or treatment of an immune disease, a rejection reaction, and a cardiovascular disease.
  • Item 26 The bifunctional fusion protein or pharmaceutical composition according to Item 25, which is for use in the prevention or treatment of the following diseases: rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmunity Encephalomyelitis, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, kidney Small ball nephritis, gout, rejection of organ transplants, asthma or atherosclerosis.
  • diseases rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmunity Encephalomyelitis, Crohn's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, p
  • the bifunctional fusion protein or pharmaceutical composition according to Item 25, which is for use in the prevention or treatment of the following diseases: osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid Arthritis, septic arthritis.
  • Item 28 A method for preventing or treating an immune disease, a rejection, and a cardiovascular and cerebrovascular disease, comprising administering to a subject a therapeutically effective amount of the bifunctional fusion protein of any one of items 1 to 15 or item 21 Said pharmaceutical composition.
  • Item 29 The method according to Item 28, which is characterized in that it is for preventing or treating diseases such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crowe Enr's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, lupus erythematosus, idiopathic thrombocytopenic purpura, glomerulonephritis, gout, organs Transplant rejection, asthma or atherosclerosis.
  • diseases such as rheumatoid arthritis, psoriasis, type I diabetes, multiple sclerosis, autoimmune encephalomyelitis, Crowe Enr's disease, systemic vasculitis, dermatomyositis, mixed connective tissue disease, ankylosing spondylitis, psoriatic arthritis, l
  • Item 30 The method according to Item 28, characterized in that it is used for preventing or treating diseases such as osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, suppurative joints inflammation.
  • diseases such as osteoarthritis, psoriatic arthritis, gouty arthritis, juvenile rheumatoid arthritis, suppurative joints inflammation.
  • Item 31 A kit comprising the bifunctional fusion protein of any one of clauses 1 to 15, such as item 16 or The gene of claim 17, the recombinant vector of item 18 or the host cell of item 19.
  • the following experimental methods are conventional methods unless otherwise specified, and the experimental materials used can be easily obtained from commercial companies unless otherwise specified.
  • the various antibodies used in the following examples of the invention are all derived from standard antibodies of the commercial route.
  • Example 1 Construction of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein expression vector
  • the extracellular region sequence of human CTLA4 protein is shown in SEQ ID NO: 1 and is the amino acid sequence of amino acid 37-161 of the human CTLA4 protein (Genbank Accession No. NM_005214.4.).
  • the amino acid sequence of the anti-IL6 monoclonal antibody is described in patent WO2010065072, the heavy chain sequence is shown in SEQ ID NO: 2, and the light chain sequence is shown in SEQ ID NO: 3.
  • the signal peptide sequence used to express the fusion protein is shown in SEQ ID NO:4.
  • the linker peptide is (G 4 S) 5 (SEQ ID NO: 5).
  • the amino acid sequence of the CTLA4ECD-linker peptide-anti-IL6 mAb heavy chain is set forth in SEQ ID NO: 6.
  • the nucleotide sequence encoding the signal peptide-CTLA4ECD-linker peptide-anti-IL6 mAb heavy chain was optimized by mammalian cell codon preference as shown in SEQ ID NO: 7.
  • the nucleotide sequence encoding the anti-IL6 mAb light chain is optimized for mammalian cell codon preference and the sequence is set forth in SEQ ID NO: 8.
  • SEQ ID NO: 7 and SEQ ID NO: 8 were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and introduced into pUC57 vector by TA cloning and designated as pUC57-ctla4-anti-il6 mAb hc and pUC57-anti-il6 mAb lc, respectively.
  • the pUC57-ctla4-anti-il6 mAb hc plasmid (Suzhou Jinweizhi Biotechnology Co., Ltd.) was used as a template to amplify the coding sequence of the signal peptide-human CTLA4ECD-linker peptide-anti-IL6 mAb heavy chain by conventional PCR.
  • the HindIII restriction site has the sequence CCCAAGCTTGCCACCATGGGGG (SEQ ID NO: 9).
  • the downstream primer carries the EcoR I restriction site and the sequence is CCGGAATTCTCACTTTCCTGGTGA (SEQ ID NO: 10).
  • the pUC57-anti-il6mAb lc plasmid (Suzhou Jinweizhi Biotechnology Co., Ltd.) was used as a template to amplify the coding sequence of the anti-IL6 mAb light chain by conventional PCR.
  • the upstream primer used had a Hind III restriction site, and the sequence was SEQ ID. NO: 9.
  • the downstream primer carries the EcoR I restriction site and the sequence is CCGGAATTCTCAGCATTCGCCACGATTGAA (SEQ ID NO: 11).
  • the amplified CTLA4-anti-IL6 mAb hc and anti-IL6 mAb lc coding sequences were subjected to electrophoresis on a 1% agarose gel to recover the corresponding fragment.
  • the recovered gene fragment and the company's eukaryotic expression vector X0GC (patent US20100120089) were digested with Hind III and EcoR I to obtain recombinant plasmids X0GC-ctla4-anti-il6mAb hc and X0GC-anti-il6mAb lc, respectively. It was transformed into E.
  • coli DH5 ⁇ and recombinant strains DH5 ⁇ /X0GC-ctla4-anti-il6mAb hc and DH5 ⁇ /X0GC-anti-il6mAb lc were obtained. Positive clones were screened by PCR and DNA sequencing was performed to verify that the recombinant plasmid was constructed correctly.
  • DH5 ⁇ /X0GC-ctla4-anti-il6mAb hc and DH5 ⁇ /X0GC-anti-il6mAb lc were inoculated separately into 1L LB/Amp liquid medium (composed of 1% peptone (BD company), 0.5% yeast extract (BD company) ), 1% NaCl (National Pharmaceutical Group Chemical Reagent Co., Ltd.)), shake culture at 37 ° C, 180 rpm overnight. The next day, the plasmid was extracted using the endotoxin-free plasmid (Qiagen, 12381) for transfection of HEK293-T cells (Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences).
  • Example 2 Expression of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein
  • HEK293-T cells with a good growth state and a confluency of 95% or more were inoculated to a ten-layer cell factory (NUNC) at an inoculation amount of 18 ⁇ 10 7 cells, and DMEM containing 10% fetal bovine serum (purchased from Gibco) was used.
  • the culture medium purchased from Corning
  • the cells were completely adhered to a density of 80% for transient transfection.
  • the X0GC-ctla4-anti-il6 mAb hc and X0GC-anti-il6 mAb lc recombinant plasmids were filtered through a 0.22 ⁇ m filter, and 670 ⁇ g of the filtrate was separately aspirated and mixed, and 66 ml of serum-free DMEM medium was added.
  • An equal volume of serum-free DMEM medium was added to 2660 ⁇ g of transfection reagent PEI (purchased from Sigma), and then mixed with the plasmid filtrate, and allowed to stand for 15 minutes.
  • the mixture containing the plasmid and PEI was added to 1.3 liters of serum-free DMEM medium, mixed well, and slowly added to the cell factory.
  • the cell factory was cultured in a 37 ° C, 5% CO 2 incubator. After 4 hours, 266 ml of Cell Boost 5 (purchased from Thermo Fisher Co., Ltd.) was added, and the mixture was further mixed for 3-4 days, and then centrifuged at 7000 rpm for 20 minutes to collect the supernatant for purification of the target protein.
  • Cell Boost 5 purchased from Thermo Fisher Co., Ltd.
  • Example 3 Purification of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein
  • the harvested cell culture supernatant was centrifuged at 7000 rpm for 20 min to remove the precipitate.
  • the supernatant of the cell fermentation broth was filtered through a 0.45 ⁇ m filter, concentrated by ultrafiltration in a 30K membrane and replaced with 20 mM PB buffer to 150 mM sodium chloride, pH 7.4.
  • the precipitate was removed by filtration through a 0.45 ⁇ m filter before applying column purification. This step was carried out at 4 °C.
  • Purification was carried out at 4 °C using an AKTA explorer 100 protein purification system (GE Healthcare) and an affinity chromatography column rProtein A Sepharose Fast Flow (16 mm I.D., 10 ml, GE Healthcare).
  • the mobile phase A that is, 20 mM PB buffer was added to 150 mM sodium chloride, pH 7.4 solution to equilibrate the column.
  • the pretreated cell fermentation broth supernatant was loaded at a flow rate of 5 ml/min. After loading, rinse with mobile phase A and elute with different buffers.
  • Example 4 Binding of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein to human IL6, mouse IL6
  • the binding ability of the recombinant fusion protein CTLA4-anti-IL6 mAb bifunctional fusion protein to its antigen human IL6 and mouse IL6 was determined by ELISA.
  • the specific implementation process of the method is as follows.
  • the product number 50136-MNAE) the coating concentration was 1 ⁇ g/mL, the coating amount was 100 ⁇ L per well, and the coating was carried out overnight at 4 °C. Wash PBST (Sigma, Cat. No. P-3563) 5 times.
  • AP309P diluted 1:2000 in PBST containing 1% BSA was added, 100 ⁇ L per well was added, and incubation was carried out for 1 hour at 25 °C. Wash PBST 5 times.
  • a colorimetric substrate TMB (BD OptEIA, Cat. No. 555214) was added at 100 ⁇ L/well and developed for 10 minutes at room temperature. Color development was stopped by adding 1 M H2SO4 at 100 ⁇ L/well. The absorbance at 450 nm was read on a microplate reader.
  • the recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein has binding activity to human IL6 and mouse IL6.
  • Example 5 Binding of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein to B7 molecule
  • the specific implementation process of the method is as follows. Subcultured Raji cells (ATCC, Cat. No. CCL-86) were collected by centrifugation at 1000 rpm for 5 minutes. Wash once with PBS (GIBCO, Cat. No. 14190136) containing 2% FBS (GIBCO, Cat. No. 10099141). Raji cells were resuspended in 200 ⁇ L of 2% FBS and 0.5 ⁇ M recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein or isotype control protein (human immunoglobulin, Jiangxi Boya Biopharmaceutical) at 1*106 cells per tube. Co., Ltd., the national drug quasi-word S19993012) in the cold PBS.
  • the results are shown in Table 1.
  • the recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein has high binding affinity to Raji cells highly expressing its ligand B7 molecule, and is similar to the marketed drug Abatacept.
  • mice Female BALB/c mice (8 weeks old, purchased from Beijing Huakang Biotechnology Co., Ltd.) were used as experimental materials. One week after the mice were acclimated to the environment, they were randomized into groups of 18 animals each. Each group was given 33 nmol/kg recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein and administered by three routes of administration: intravenous, subcutaneous or intraperitoneal injection, 10 ml/kg body weight, single administration.
  • Intravenous group at 0 o'clock 5 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 48 hours, 72 hours, 96 hours, 120 hours, 168 hours after administration, blood collection;
  • the group injected and intraperitoneally injected at 0 o'clock, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 48 hours, 72 hours, 96 hours, 120 hours, 168 hours after the administration; Blood was collected twice per mouse.
  • Anticoagulation was not performed, and the blood sample was placed at room temperature for 30 minutes. After coagulation, centrifugation was performed at 3000 rpm for 5 minutes, and the obtained serum sample was frozen and stored at -80 °C.
  • Serum samples were analyzed by ELISA and the concentration of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein was determined.
  • test serum sample diluted with PBST containing 10% mixed mouse serum and 1% BSA was added and incubated at 25 ° C for 1 hour, and the plate was washed with PBST.
  • Horseradish peroxidase-labeled anti-human IgG antibody (Chemicon, Cat. No. AP309P) diluted in PBS containing 5% skim milk powder was added, and the plate was washed with PBST at 25 ° C for 1 hour.
  • color development was carried out using a colorimetric substrate TMB (BD OptEIA, Cat. No. 555214), and color development was carried out for 10 minutes at room temperature. Color development was terminated by the addition of 1 M H 2 SO 4 .
  • the absorbance at 450 nm was read on a microplate reader.
  • Example 7 Efficacy study of recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein in type II collagen induced mouse arthritis (CIA) model
  • mice Male DBA1/J mice (8 weeks old, purchased from Shanghai Slack Laboratory Animals Co., Ltd.) were used as experimental materials. After one week of adaptation to the environment, the mice were divided into two groups, one group as a control and the other group to establish a CIA model. The establishment of the CIA mouse model was first immunized and boosted. The specific implementation process of the CIA model was as follows: primary collagen immunization: 70 ⁇ g of type II bovine collagen (Chondrex, item number 20022) was mixed with Freund's complete adjuvant (Sigma-Aldrich, item number F5881) to form milk. The solution was injected intradermally into the tail of the mouse.
  • primary collagen immunization 70 ⁇ g of type II bovine collagen (Chondrex, item number 20022) was mixed with Freund's complete adjuvant (Sigma-Aldrich, item number F5881) to form milk. The solution was injected intradermally into the tail of the mouse.
  • Dosing begins after grouping.
  • Drug vehicle PBS
  • Etanercept 33 nmol/kg
  • Abatacept 33 nmol/kg
  • anti-IL6 mAb 33 nmol/kg
  • recombinant CTLA4-anti-IL6 mAb bifunctional fusion protein 33 nmol/kg

Abstract

La présente invention concerne une protéine de fusion bifonctionnelle comprenant un domaine extracellulaire d'une molécule CTLA4 et un fragment fonctionnel à activité IL6 neutralisée, un gène codant de la protéine de fusion bifonctionnelle, un support comprenant le gène, une cellule hôte comprenant le support, et une composition pharmaceutique comprenant la protéine de fusion. Le fragment fonctionnel à activité IL6 neutralisée est un anticorps monoclonal contre IL6. Le domaine extracellulaire de la molécule CTLA4 se trouve à une extrémité N d'une chaîne lourde de l'anticorps monoclonal contre IL6, et est connecté en utilisant un peptide de connexion. La protéine de fusion bifonctionnelle dans la présente invention peut simultanément bloquer les voies de signalisation B7/CD28 et IL6/IL6R/GP130, afin de supprimer une réaction inflammatoire.
PCT/CN2015/093581 2014-11-04 2015-11-02 Protéine de fusion recombinante pour le blocage simultané des voies de signalisation b7/cd28 et il6/il6r/gp130 WO2016070769A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201580059624.3A CN107074976B (zh) 2014-11-04 2015-11-02 同时阻断b7/cd28和il6/il6r/gp130信号通路的重组融合蛋白

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201410612999 2014-11-04
CN201410612999.5 2014-11-04

Publications (1)

Publication Number Publication Date
WO2016070769A1 true WO2016070769A1 (fr) 2016-05-12

Family

ID=55908574

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2015/093581 WO2016070769A1 (fr) 2014-11-04 2015-11-02 Protéine de fusion recombinante pour le blocage simultané des voies de signalisation b7/cd28 et il6/il6r/gp130

Country Status (2)

Country Link
CN (1) CN107074976B (fr)
WO (1) WO2016070769A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022212513A1 (fr) * 2021-03-31 2022-10-06 University Of Southern California Compositions et méthodes pour la modulation de trouble inflammatoire et dégénératif

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002069904A2 (fr) * 2001-03-02 2002-09-12 Medimmune, Inc. Prevention ou traitement de maladies inflammatoires ou auto-immunes par administration d'antagonistes de cd2 en combinaison avec d'autres agents prophylactiques ou therapeutiques
WO2013041029A1 (fr) * 2011-09-23 2013-03-28 Igenimed Pharmaceuticals Inc. Nouveaux variants de ctla4 solubles
CN104684582A (zh) * 2012-08-31 2015-06-03 戊瑞治疗有限公司 用结合群落刺激因子1受体(csf1r)的抗体治疗病状的方法

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3793693B2 (ja) * 1998-12-23 2006-07-05 ファイザー インコーポレーテッド Ｃｔｌａ−４に対するヒトモノクローナル抗体
AU2009323002B2 (en) * 2008-11-25 2016-01-28 Vitaeris Inc. Antagonists of IL-6 to raise albumin and/or lower CRP
JP2012527875A (ja) * 2009-05-28 2012-11-12 グラクソ グループ リミテッド 抗原結合タンパク質

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002069904A2 (fr) * 2001-03-02 2002-09-12 Medimmune, Inc. Prevention ou traitement de maladies inflammatoires ou auto-immunes par administration d'antagonistes de cd2 en combinaison avec d'autres agents prophylactiques ou therapeutiques
WO2013041029A1 (fr) * 2011-09-23 2013-03-28 Igenimed Pharmaceuticals Inc. Nouveaux variants de ctla4 solubles
CN104684582A (zh) * 2012-08-31 2015-06-03 戊瑞治疗有限公司 用结合群落刺激因子1受体(csf1r)的抗体治疗病状的方法

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022212513A1 (fr) * 2021-03-31 2022-10-06 University Of Southern California Compositions et méthodes pour la modulation de trouble inflammatoire et dégénératif

Also Published As

Publication number Publication date
CN107074976B (zh) 2020-10-09
CN107074976A (zh) 2017-08-18

Similar Documents

Publication Publication Date Title
JP6152433B2 (ja) 抗ｔｎｆ−抗ｉｌ−１７二重特異性抗体
US10214579B2 (en) Fc fusion proteins comprising novel linkers or arrangements
US5639455A (en) Immunosuppressant
US9556266B2 (en) Methods of treating sickle cell disease with anti-P-selectin antibodies
KR20140018299A (ko) Ｔｎｆ-알파에 대한 단일 도메인 항체를 이용하여 면역 장애를 치료하는 방법
KR102602539B1 (ko) Fc-융합 고친화성 IgE 수용체 알파 사슬
JP2023537422A (ja) Ｉｌ－１１の抗体及びその使用
WO2015113494A1 (fr) Protéine de fusion bifonctionnelle, procédé de préparation s'y rapportant et son utilisation
CN104231086B (zh) 双功能融合蛋白及其制备方法和用途
JPWO2020018503A5 (fr)
WO2016070769A1 (fr) Protéine de fusion recombinante pour le blocage simultané des voies de signalisation b7/cd28 et il6/il6r/gp130
WO2024046301A1 (fr) Protéine de fusion comprenant un polypeptide taci et son utilisation
US20210309735A1 (en) Anti-il-17a antibodies and use thereof
CA3194457A1 (fr) Anticorps caninises contre le recepteur alpha de l'interleukine-31 canine
NZ791361A (en) Engineered anti-il-2 antibodies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15856763

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC, FORM 1205A DATED 26.09.2017

122 Ep: pct application non-entry in european phase

Ref document number: 15856763

Country of ref document: EP

Kind code of ref document: A1