WO2016037931A1 - Constructions d'acide nucléique et vecteurs d'expression destinés à la thérapie génique de porphyries aigües et d'autres maladies - Google Patents

Constructions d'acide nucléique et vecteurs d'expression destinés à la thérapie génique de porphyries aigües et d'autres maladies Download PDF

Info

Publication number
WO2016037931A1
WO2016037931A1 PCT/EP2015/070204 EP2015070204W WO2016037931A1 WO 2016037931 A1 WO2016037931 A1 WO 2016037931A1 EP 2015070204 W EP2015070204 W EP 2015070204W WO 2016037931 A1 WO2016037931 A1 WO 2016037931A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid construct
vector
sequence
porphobilinogen deaminase
Prior art date
Application number
PCT/EP2015/070204
Other languages
English (en)
Inventor
Antonio FONTANELLAS ROMÁ
Carmen UNZU EZQUERRO
Original Assignee
Fundación Para La Investigación Médica Aplicada
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fundación Para La Investigación Médica Aplicada filed Critical Fundación Para La Investigación Médica Aplicada
Publication of WO2016037931A1 publication Critical patent/WO2016037931A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01061—Hydroxymethylbilane synthase (2.5.1.61)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/30—Vector systems having a special element relevant for transcription being an enhancer not forming part of the promoter region
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates

Definitions

  • the invention relates to vectors for gene therapy in general, and particularly for gene therapy of acute porphyrias, and nucleic acid constructs for their construction.
  • Porphyrias are a group of diseases caused by decreased activities of different enzymes in the heme biosynthetic pathway. They are classified in hepatic or erytropoietic depending on the primary site of overproduction of the porphyrin precursor or porphyrin. The porphyrias are also classified on clinical basis into acute porphyrias characterized by neuropsychiatric symptoms or cutaneous porphyrias suffering from photosensitivity to sunlight.
  • the four acute porphyrias are all considered to be hepatic, and they all share possible precipitation of acute attacks.
  • Ubiquitous delta-aminolevulinic acid synthase enzyme regulates hepatic heme biosynthesis in a heme-dependent manner by the intracellular free heme pool. Heme down-regulates transcription of ALASl, blocks mitochondrial import of the enzyme, and mediate a destabilization of the enzyme. This control mechanism is of main importance to the pathophysiology of the acute hepatic porphyrias.
  • endocrine i.e. reproductive hormones
  • environmental factors i.e. certain therapeutic drugs, alcohol, the snuff smoke
  • caloric restriction or intercurrent infections activate hepatic heme biosynthesis through induction of the ALASl .
  • the deficient PBGD catalytic step becomes overloaded by its substrate and causes acute intermittent attacks.
  • These attacks might be a life-threatening medical emergency with neurovisceral symptomatology: abdominal pain, tachycardia, peripheral motor neuropathy, constipation, nausea, vomiting, mental changes, hypertension, sensory neuropathy and convulsion.
  • Severe and recurrent porphyria attacks can be cured only by allogeneic liver transplantation. Nevertheless, transplantation suffers from limited availability of donors; requires life-long immunosuppression and is associated with mortality and morbility and high rate of hepatic artery thrombosis.
  • liver gene therapy mediated by recombinant viral vectors might become a clinical alternative in the near future.
  • Johansson et al. (Mol. Genet. Metab. 2004; 82: 20-26) developed cationic lipid- based vectors in which a plasmid carrying the PBGD cDNA was complexed with liposomes, polyethyleneimine or polyethyleneiminegalactose.
  • these synthetic vectors or naked DNA administered intravenously or directly into the portal vein of a mouse model of acute intermittent porphyria resulted in very low transfection efficiency that subsequently had no therapeutic effect.
  • Johansson et al. disclose that adenoviral- mediated expression of PBGD restores the metabolic defect in a mouse model of acute intermittent porphyria.
  • the vector was a first generation El and E3 deleted adenovirus encoding mouse housekeeping PBGD isoform under the control of CMV promoter.
  • the intravenous administration of this vector resulted in a high but short-term (7 days) PBGD over-expression.
  • Gene therapy requires vectors enabling long-term expression of the PBGD and ensuring sufficiently high levels of the transgene in hepatocytes.
  • WO2010036118 discloses codon optimized nucleotide sequences coding for human porphobilinogen deaminase (cohPBGD). It also disclosed recombinant adeno- associated virus (AAV) vectors comprising cohPBGD sequence. Therapeutic dose effect was demonstrated in AIP murine model. The treatment with AAV2/8-hPBGD or rAAV2/5 -cohPBGD vectors protected male and female mice against phenobarbital- induced acute porphyric attacks. In both vector embodiments transgene expression was driven by chimeric promoter EalAAT constituted by a 1 -antitrypsin gene promoter linked to the enhancer regions of the albumin gene. Unzu C. et al. (Mol.
  • Ther. 201 1; 19(2): 243-250 provide preclinical data on AIP murine model showing a sustained enzymatic correction by rAAV-mediated liver gene therapy that protects against induced motor neuropathy.
  • Three different vectors were tested: AAV2/8-hPBGD, rAAV2/5-hPBGD, and rAAV2/5-cohPBGD.
  • Paneda A. et al. Hum. Gene Ther.
  • liver transduction efficiency was about 8-10 times lower than in mice injected with the same dose.
  • ERE estrogen response elements
  • transgene expression could be induced and maintained during the full period of exposure to estrogens by inserting some ADRES elements (ALAS1 Drug-Responsive Enhancing Sequence) in phase with the promoter (Figure 3).
  • ADRES elements ALAS1 Drug-Responsive Enhancing Sequence
  • expression of the transgene was also induced in response to other porphyrinogenic stimuli, such as phenobarbital, fasting, and cardiotrophin (see Example 3). Inducibility of expression was further improved when 2 or 3 ADRES elements were inserted; 2 tandem ADRES elements inserted in phase with the promoter produced optimum results (Example 2).
  • ADRES elements joined to the promoter driving the expression of therapeutic transgene (PBGD) of both an AAV vector and a high capacity adenoviral vector, allows reducing doses of viral vector which must be administered to maintain the same efficiency and protection against acute attack. This was evidenced in the context of AAV and high-capacity adenoviral vectors (Examples 5 and 6).
  • ADRES elements can be used as an inducible system that can be adapted in gene transfer vectors for gene therapy of acute porphyrias and other diseases.
  • ADRES elements had been previously described and used in a method for testing chemical compounds as inducers of heme and/or P450 synthesis [EP1490493B1], no test or information was provided regarding main factors triggering acute attacks in porphyria, such as estrogens and fasting. On the other hand, these elements had never used in the context of an expression vector for gene therapy, and in particular in the context of expression vectors for gene therapy of acute porphyrias.
  • the invention relates to a method for enhancing the expression of the therapeutic transgene of a recombinant gene therapy expression vector, that comprises inserting the nucleotide sequence of an ALAS1 Drug-Responsive Enhancing Sequence (ADRES) in the nucleic acid construct of the expression vector, wherein the ADRES is operably linked to the promoter that controls the expression of the therapeutic transgene.
  • the expression vector can be a viral vector or a non-viral vector.
  • the vector is a viral or non- viral vector for gene therapy of acute porphyrias, preferably of acute intermittent porphyria.
  • the invention also relates to and covers the use of an ALAS 1 Drug- Responsive Enhancing Sequence (ADRES) in the construction and preparation of a viral or non- viral expression vector for gene therapy, particularly for gene therapy of acute porphyrias, preferably of acute intermittent porphyria.
  • the viral or non-viral vector comprises a nucleotide sequence encoding a protein with porphobilinogen deaminase activity.
  • the invention relates to a nucleic acid construct of a gene therapy viral vector (hereinafter also referred as "first nucleic acid construct of the invention", that comprises
  • the present invention relates to a viral particle that comprises a nucleic acid construct of a gene therapy viral vector of the invention (first nucleic acid construct of the invention). That is to say, a viral particle that comprises the nucleic acid construct of a viral vector in which it has been inserted a nucleotide sequence carrying the sequence encoding the therapeutic polypeptide and, operably linked to it, the ADRES (at least one copy) and the promoter nucleotide sequence.
  • the invention relates to a nucleic acid construct (hereinafter also referred as "second nucleic acid construct of the invention"), that comprises
  • ADRES Drug-Responsive Enhancing Sequence
  • the invention relates to a product of the invention for use in medicine (as a medicament).
  • product of the invention refers to and indistinctively covers any of:
  • nucleic acid construct of the invention a) the first nucleic acid construct of the invention (nucleic acid construct of invention's viral vector),
  • This use in medicine includes the treatment and/or prevention of a condition caused by a deficiency in porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase; in particular of acute porphyrias, such as acute intermittent porphyria, variegate porphyria or hereditary coproporphyria.
  • the invention further relates to a pharmaceutical composition or medicinal product comprising a product of the invention as described above, per se and for the proposed uses in medicine and therapeutic methods that are described below.
  • FIG. 1 Expression of Luciferase transgene in response to phenobarbital injection after hydrodynamics transfection of different DNA plasmids carrying Luciferase coding sequence operably linked to EalbPal AT chimeric promoter. Plasmids distinguished from one another in the number and disposition of ADRES elements which are linked to the promoter: pLuc, control plasmid without ADRES elements; pADRES, with an ADRES in phase with the promoter; p2ADRES, with 2 ADRES tandem copies in phase with the promoter; p3ADRES, with 3 copies in phase with the promoter; p2iADRES, with 2 copies in phase inverted with the promoter; and p2+iADRES, with 3 tandem copies, an inverted ADRES sequence positioned following two ADRES sequences in phase with the promoter. Luciferase expression is expressed as fold change relative to bio luminescence values measured in the control group that received the pLuc plasmid.
  • FIG. 1 Luciferase expression in male BALB/c mice after hydrodynamic transfection with plasmid p2ADRES.
  • Luciferase expression was monitored daily by luminescence and expressed as photons/second/cm 2 /sr.
  • FIG. 2B Luciferase expression in male BALB/c mice after hydrodynamic transfection with plasmid p2ADRES. Transfected animals were exposed to a porphyrinogenic stimulus selected from ketamine administration (Anesthetic, 90 mg/kg/day), 24 h fasting (Fasting), 17a-ethinyl-estradiol injection (Estrogen, 1 ⁇ g/two time a day), and cardiotrophin injection (Cardiotrophin, 10 ⁇ g/kg/day). Luciferase expression was measured at baseline [black bars] and 2 days after continuous exposure to the porphyrinogenic stimulus [white bars]. **: p ⁇ 0.01; p ⁇ 0.001 [ Wilcoxon matched pairs test] .
  • FIG. 4 Therapeutic effect of the treatment with AAV vectors expressing PBGD in female mice with acute intermittent porphyria (AIP) that were intraperitoneally treated with increasing doses of phenobarbital for imitating porphyria attacks. A group of AIP animals remained untreated (Vector -).
  • AIP acute intermittent porphyria
  • Urinary porphobilinogen PBG excretion measured at day 35 after administration of AAV vector, just after phenobarbital challenge, and expressed as ⁇ g of PBG per mg of creatinine ⁇ g/mg creat.).
  • nucleic acid sequence and “nucleotide sequence” may be used interchangeably to refer to any molecule composed of or comprising monomeric nucleotides.
  • a nucleic acid may be an oligonucleotide or a polynucleotide.
  • a nucleotide sequence may be a DNA or R A.
  • a nucleotide sequence may be chemically modified or artificial.
  • Nucleotide sequences include peptide nucleic acids (PNA), morpholinos and locked nucleic acids (LNA), as well as glycol nucleic acids (GNA) and threose nucleic acid (TNA). Each of these sequences is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule.
  • phosphorothioate nucleotides may be used.
  • Other deoxynucleotide analogs include methylphosphonates, phosphoramidates, phosphorodithioates, N3'P5'-phosphoramidates and oligoribonucleotide phosphorothioates and their 2'-0-allyl analogs and 2'-0- methylribonucleotide methylphosphonates which may be used in a nucleotide of the invention.
  • expression vector refers to nucleotide sequences that are capable of effecting expression of a gene (transgene) in host cells or host organisms compatible with such sequences. Together with the transgene, expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements able to respond to a precise inductive signal (endogenous or chimeric transcription factors) or specific for certain cells, organs or tissues.
  • nucleic acid construct refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology.
  • a nucleic acid construct is a nucleic acid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids, which are combined and juxtaposed in a manner, which would not otherwise exist in nature.
  • a nucleic acid construct usually is a "vector”, i.e. a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.
  • ALAS1 Drug-Responsive Enhancing Sequence (ADRES) ALAS1 Drug-Responsive Enhancing Sequence
  • ALS1 and "delta-aminolevulinate synthase 1" indistinctively refer to the enzyme which catalyzes the condensation of glycine with succinyl-CoA to form delta-aminolevulinic acid.
  • This mitochondrial enzyme is the first and rate-limiting enzyme in the mammalian heme biosynthetic pathway.
  • tissue-specific isozymes a housekeeping enzyme encoded by the ALAS1 gene and an erythroid tissue- specific enzyme encoded by a separate ALAS2 gene.
  • the level of the mature encoded protein is regulated by heme: high levels of heme down-regulate transcription of ALAS1, block mitochondrial import of the enzyme, and mediate a destabilization of the mature enzyme in the mitochondria; while low heme levels up-regulate it.
  • ADRES Drug-Responsive Enhancing Sequence
  • the ADRES comprises at least a DR-4 nuclear receptor binding site.
  • DR nuclear receptor binding sites are characterized by hexamer half sites arranged as direct repeats with a 4 or 5 nucleotides separation between both half-sites [6+4+6 or 6+5+6 structure].
  • the half-site has the canonical sequence AG(T/G)TCA.
  • a "DR-4 nuclear receptor binding site” is characterized by hexamer half sites arranged as direct repeats with a 4 nucleotide separation between half-sites; a "DR-5 nuclear receptor binding site” has two direct repeats with 5 nucleotides separation between the hexamer repeats.
  • the ADRES comprises a DR-4 nuclear receptor binding site and a DR-5 nuclear receptor binding site.
  • DR nuclear receptor binding site comprises as well functional equivalents of the canonical sequence i.e. half-site sequence variants which are still able to function as binding sites for nuclear receptors such as e.g. CAR (constitutive androstane receptor)/RXR (retinoid X receptor) heterodimers.
  • this ADRES further comprises a NF-1 binding site.
  • NF-1 binding site refers to a DNA element which serves as binding site for members of the nuclear factor- 1 family of transcription factors, and said term encompasses functional equivalents thereof i.e. sequence variants which are still able to function as binding sites for members of the nuclear factor 1 (NF1) family of transcription factors.
  • the ADRES is an ADRES of human origin.
  • the nucleic acid construct comprises more than 1 ADRES copy; for example 1, 2, or 3 ADRES copies, which can be linked in phase with the promoter, or inverted.
  • it comprises the sequence SEQ.ID.NO.2 which contains 2 ADRES copies, linked in phase with the promoter sequence.
  • promoter or “transcription regulatory sequence” refer to a nucleotide sequence that functions to control the transcription of one or more coding sequences, which is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter, including e.g. attenuators, enhancers, and silencers.
  • a “constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions.
  • An “inducible” promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer.
  • a “tissue specific” promoter is only active in specific types of tissues or cells. That is to say a tissue specific promoter, in the context of this invention, is one which is more active in one or several (for example two, three or four) particular tissues than in other tissues (i.e. the promoter is capable of driving a higher expression of the coding sequence to which it is operably linked in the tissue(s) for which it is specific as compared to any others).
  • gene the down-stream of a "tissue specific" promoter is one which is active to a much higher degree in the tissue(s) for which the promoter is specific than in any other tissue(s). In this case, there may be little or substantially no activity of the promoter in any tissue other than the one(s) for which it is specific.
  • the nucleotide sequence encoding the therapeutic polypeptide or transgene is operably linked to the promoter.
  • operably linked refers to a linkage of polynucleotide (or polypeptide) elements in a functional relationship.
  • a nucleic acid is "operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
  • a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence.
  • Operably linked means that the DNA sequences being linked are typically contiguous; where it is necessary to join two protein encoding regions, they are contiguous and in reading frame.
  • promoters are known in the art [Sambrook and Russell (Molecular Cloning: a Laboratory Manual; Third Edition; 2001 Cold Spring Harbor Laboratory Press); and Green and Sambrook (Molecular Cloning: a Laboratory Manual; Fourth Edition; 2012 Cold Spring Harbor Laboratory Press)]. Constitutive promoters that drive a broad expression in many cell types, such as the CMV promoter may be used. However, promoters that are inducible, tissue-specific, cell-type-specific, or cell cycle- specific may be preferred.
  • the nucleotide sequence encoding the therapeutic polypeptide or transgene is operably linked to a liver-specific promoter.
  • a liver specific promoter is a promoter which is more active in liver as compared to its activity in any other tissue of the body.
  • the activity of a liver specific promoter will be considerably greater in the liver than in other tissues.
  • such a promoter may be at least 2, at least 3, at least 4, at least 5 or at least 10 times more active (for example as determined by its ability to drive the expression in a given tissue in comparison to its ability to drive the expression in other cells or tissues).
  • a liver specific promoter allows an active expression in the liver of the gene linked to it and prevents its expression in other cells or tissues.
  • Suitable liver-specific promoters include, without limitation, an l-anti-trypsin (AAT) promoter, a thyroid hormone-binding globulin promoter, an alpha fetoprotein promoter, an alcohol dehydrogenase promoter, an IGF-II promoter, the factor VIII (FVIII) promoter, a HBV basic core promoter (BCP) and PreS2 promoter, an albumin promoter, a thyroxin-binding globulin (TBG) promoter, an Hepatic Control Region (HCR)-ApoCII hybrid promoter, an HCR-hAAT hybrid promoter, an AAT promoter combined with the albumin gene enhancer (Ealb) element (EalbPalAT), an apolipoprotein E promoter, a low density lipoprotein promoter, a pyruvate kinase promoter, a phosphenol pyruvate carboxykinase promoter, a lecithin-chol
  • the liver-specific promoter is a hybrid promoter comprising a liver-specific enhancer and a liver-specific promoter, such as a Hepatic Control Region (HCR)-ApoCII hybrid promoter, an HCR-hAAT hybrid promoter, an EalbPalAT hybrid promoter [AAT promoter combined with the albumin gene enhancer (Ealb) element].
  • HCR Hepatic Control Region
  • HCR-hAAT hybrid promoter HCR-hAAT hybrid promoter
  • EalbPalAT hybrid promoter EalbPalAT hybrid promoter [AAT promoter combined with the albumin gene enhancer (Ealb) element].
  • the promoter sequence is SEQ.ID.NO.7, corresponding to an EalbPalAT hybrid promoter.
  • 1, 2, or 3 copies of an ADRES are operably linked to a liver-specific promoter; in a preferred embodiment the sequence containing the ADRES copy/ies which is linked to the liver-specific promoter is SEQ.ID.NO. l .
  • operably linked when used to define the arrangement of the ADRES and the promoter, is used to define an arrangement wherein the ADRES is located before the promoter, i.e. the promoter is located between the ADRES and the sequence of the therapeutic gene. Moreover, operably linked also implies that the ADRES is in phase with the promoter.
  • the term “in phase” refers to the fact that the orientation of the ADRES in the first or second nucleic acid constructs of the invention with respect to the therapeutic gene is the same as it occurs in the ALASl gene from wherein it derives.
  • the region comprising nucleotides -20 918 pb to -20 745 bp of the 5 '-flanking region of the ALASl gene is located with respect to the therapeutic gene in the same orientation as it appears in the ALASl gene with respect to the ALASl coding sequence.
  • 1, 2, or 3 copies of an ADRES are operably linked to an EalbPalAT promoter.
  • the first and/or second nucleic acid construct of the invention comprises sequence SEQ.ID.NO.8, which incorporates 2 ADRES copies linked in phase with the EalbPalAT promoter.
  • polypeptide is a continuous and unbranched chain of amino acid monomers linked by peptide (amide) bonds, whatever the length of the chain (the term embraces peptides and oligopeptides).
  • This polypeptide can be any natural polypeptide or protein; a fragment of a natural polypeptide or protein; a recombinant fusion or chimeric protein; a recombinant variant of a natural polypeptide or protein; and in general any recombinant polypeptide that directly or indirectly produces a therapeutic effect once the polypeptide has been translated and expressed into the host.
  • Fusion proteins or chimeric proteins are proteins created through the joining of two or more genes that originally coded for separate proteins. Translation of this fusion gene results in polypeptides with functional properties derived from each of the original proteins.
  • Recombinant fusion proteins are created artificially by recombinant technology for use in biological research or in therapy. "Chimeric” or “chimera” usually designate hybrid proteins made of polypeptides having different functions or physico-chemical patterns. Chimeric mutant proteins can occur naturally (i.e. when a complex mutation, such as a chromosomal translocation, tandem duplication, or retro-transposition creates a novel coding sequence containing parts of the coding sequences from two different genes. Chimeric proteins can also be generated by recombinant technology.
  • a “therapeutic polypeptide” is herein understood as any polypeptide which is capable of preventing, eliminating, or reducing the symptoms of a disease.
  • the therapeutic polypeptide can be for example an enzyme, a polypeptidic hormone, a cytokine, a growth factor, a blood factor, an immunoglobulin or an antibody, a receptor protein, a signaling protein or transcription factor, or a structural protein.
  • the therapeutic polypeptide is useful for the treatment of diseases affecting or having their origin in the liver.
  • the nucleotide sequence encodes as therapeutic polypeptide a protein with porphobilinogen deaminase activity (EC 2.5.1.61), coproporphyrinogen oxidase activity (EC 1.3.3.3), or protoporphyrinogen oxidase activity (EC 1.3.3.4); in a preferred embodiment, it encodes a protein with porphobilinogen deaminase activity.
  • Porphobilinogen deaminase (PBGD) also termed hydroxymethylbilane synthase
  • HMBS heme biosynthetic pathway
  • uroporphyrinogen-III synthase EC 4.2.1.75
  • Porphobilinogen deaminase and uroporphyrinogen-III synthase work consecutively and cooperatively, producing the side-chain asymmetry of the physiological porphyrins.
  • nucleotide sequence that encodes the therapeutic polypeptide can correspond to a erythroid or alternatively to a ubiquitous non-erythroid porphobilinogen deaminase; preferably corresponds to a non- erythroid porphobilinogen deaminase.
  • the nucleotide sequence encodes as therapeutic polypeptide a PBGD of human origin.
  • the nucleotide sequence may thus encode any naturally occurring amino acid sequence of any allelic form of a human PBGD.
  • the nucleotide sequence encodes as therapeutic polypeptide a human PBGD protein whose amino acids sequence is SEQ.ID.NO.4, or SEQ.ID.NO.6.
  • the nucleotide sequence encoding the porphobilinogen deaminase has an improved codon usage bias for the human cell as compared to naturally occurring nucleotide sequence coding for the deaminase.
  • the nucleotide sequence encoding the porphobilinogen deaminase has a codon adaptation index (CAI) of at least 0.8, 0.85, 0.90, 0.92, 0.94, 0.95, 0.96 or 0.97.
  • CAI codon adaptation index
  • At least 320, 330, 340, 345, 350, 355, 356, 357, 358, 359, 360, or 361 of all codons of the nucleotide sequence coding for the non-erythroid porphobilinogen deaminase are identical to the codons (in corresponding positions) of sequence SEQ ID NO: 3.
  • At least 305, 310, 315, 320, 325, 330, 335, 340, 341, 342, 343, or 344 of the codons of the nucleotide sequence coding for the erythroid porphobilinogen deaminase are identical to the codons (in corresponding positions) of sequence SEQ ID NO: 5.
  • sequences SEQ.ID.NO.3 and SEQ.ID.NO.5 refer to the codons in the frame beginning with nucleotide 1 of SEQ.ID.NO.3 and SEQ.ID.NO.5, i.e. not the frame beginning with nucleotide 2 or 3 of SEQ.ID.NO.3 and SEQ.ID.NO.5. That is to say, the first codon of SEQ.ID.NO.3 and SEQ.ID.NO.5 is indicated by nucleotide numbers 1 to 3.
  • the nucleotide sequence encodes as therapeutic polypeptide a protein with porphobilinogen deaminase activity that has at least 95, 96, 97, 98 or 99% nucleotide sequence identity over its entire length with SEQ.ID.NO.3 or SEQ.ID.NO.5, as determined by a Needleman and Wunsch global alignment algorithm. More preferably the nucleotide sequence codes for the amino acid sequences SEQ.ID.NO.4 or SEQ.ID.NO.6.
  • nucleotide sequence encoding human PBGD is SEQ.ID.NO.3, or SEQ.ID.NO.5.
  • Coproporphyrinogen oxidase is the sixth enzyme of the heme biosynthetic pathway, and catalyzes the stepwise aerobic oxidative decarboxylation of propionate groups of rings A and B of coproporphyrinogen-III to yield the vinyl groups of protoporphyrinogen-IX.
  • COX is a soluble enzyme found in the intermembrane space of mitochondria. Defects in the gene that code for this enzyme (gene name CPOX) are a cause of hereditary coproporphyria (HCP).
  • nucleotide sequence encodes as therapeutic polypeptide a coproporphyrinogen oxidase of human origin.
  • Protoporphyrinogen oxidase is an enzyme located on the inner mitochondrial membrane that catalyzes the 6-electron oxidation of protoporphyrinogen- IX to form protoporphyrin-IX. Defects in the gene that code for this enzyme (gene name PPOX) are a cause of variegate porphyria (VP).
  • Information on human PPO is available at Uniprot with Accesion number: P50336 (http://www.uniprot.org/uniprot/P50336; Last modified April 16, 2014; version 132).
  • Information on the PPOX gene encoding this enzyme is available at Entrez with accession number Gene ID: 5498 (http://www.ncbi.nlm.nih.gov/gene/5498; updated on 4- May-2014).
  • the nucleotide sequence encodes as therapeutic polypeptide a protoporphyrinogen oxidase of human origin.
  • the enzyme with porphobilinogen deaminase activity, coproporphyrinogen oxidase activity or protoporphyrinogen oxidase activity can also be originated from any other species, and particularly from mammals.
  • nucleotide sequences that encode engineered functional equivalent variants of these enzymes having one more amino acid substitutions, deletions and/or insertions compared to a naturally occurring human amino acid sequence, and that substantially preserve the biological activity of porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase.
  • Porphobilinogen deaminase activity may be determined by an assay as is described for example by Wright and Lim (Biochem. J. 1983; 213: 85-88).
  • Coproporphyrinogen oxidase activity may be determined by an assay as is described for example by Taketani S. et al. (Biochimica et Biophysica Acta. 1994; 1183, 547-549).
  • Protoporphyrinogen oxidase activity may be determined by an assay as is described for example by Deybach JC et al. (Hum Genet. 1981; 58:425-428).
  • Additional elements can be inserted into the first and/or second nucleic acid construct of the invention upstream or downstream to the sequence encoding the therapeutic polypeptide and operably linked to it.
  • upstream of the coding sequence it can be inserted a Kozak consensus sequence around the initiation codon of the encoding nucleotide sequence; it can be inserted downstream of the coding sequence one or more stop codons; a 3' untranslated repeat (3' UTR); and a polyadenylation signal.
  • the woodchuck hepatitis virus post-transcriptional regulatory element can also be inserted; WPRE is a DNA sequence that, when transcribed creates a tertiary structure enhancing transgene expression in a variety of viral vectors.
  • polyadenylation signal relates to a nucleic acid sequence that mediates the attachment of a polyadenine stretch to the 3 ' terminus of the mRNA.
  • Suitable polyadenylation signals include the SV40 early polyadenylation signal, the SV40 late polyadenylation signal, the HSV thymidine kinase polyadenylation signal, the protamine gene polyadenylation signal, the adenovirus 5 Elb polyadenylation signal, the bovine growth hormone polydenylation signal, the human variant growth hormone polyadenylation signal, human PBGD polyadenylation signal and the like.
  • the first nucleic acid construct of the invention constitutes the nucleotide sequence of an expression "viral vector", which includes the genomic sequence of a virus modified in order to accommodate an exogenous sequence of interest [a therapeutic protein or polypeptide] to be introduced into a host cell.
  • Modification of viruses for the design and production of expression viral vectors is common practice in the gene therapy field, and typically involves: (i) removal from the viral genome of most genes coding for viral proteins; in particular, of those that are potentially pathogenic; (ii) maintenance of the cis-acting sequences of the viral genome required for viral replication; in particular, those determining inclusion of the genomes within the viral particles (packaging signal, ⁇ ); (iii) expression of the viral genes required for viral replication within the virus-producing cells (called packaging cells); either from genes encoded by transiently transfected plasmids or expressed in the context of a helper virus simultaneously infecting the packaging cells, or from genes directly contained inside the packaging cells' genome thanks to a previous recombinant engineering of these cells.
  • packaging cells either from genes encoded by transiently transfected plasmids or expressed in the context of a helper virus simultaneously infecting the packaging cells, or from genes directly contained inside the packaging cells' genome thanks to a previous recombinant engineering of these cells
  • the viral vector is modified by insertion into the first nucleic acid construct of a sequence comprising the nucleotide sequence encoding a therapeutic polypeptide of interest, and operably linked to it, the ADRES (at least on copy) and the promoter sequence.
  • the modification usually involves the deletion of a part of the viral genome, for example a part critical for viral replication.
  • a virus can efficiently infect cells but, once the infection has taken place, a system is required to provide the missing proteins for production of new virions, for example by means of a helper virus.
  • the viral vector further comprises an insulator.
  • Insulator elements may contribute to isolating promoter of transgene from viral ITRs, thus avoiding unspecific promoter activity of ITRs interfering with transgene expression.
  • the polyA insulator is located immediately upstream of the ADRES region. Examples of insulator elements include, but are not limited to, an insulator from a beta -globin locus, such as chicken HS4.
  • the viral vector of the invention is derived from a virus selected from the group consisting of parvoviruses (in particular adeno-associated viruses), adenoviruses, alphaviruses, retroviruses (in particular gamma retroviruses, and lentiviruses), herpesviruses, and SV40.
  • the vector is an adeno-associated viral vector (AAV), an adenoviral vector, or a lentiviral vector.
  • AAV and adenoviral vectors are particularly suitable to specifically drive and express the foreign genetic material into the liver.
  • AAV adeno-associated virus
  • AAV serotypes have genomic sequences with a significant homology at the nucleic acid and the amino acid levels, provide an identical set of genetic functions; they produce virions which are essentially physically and functionally equivalent; and replicate and assemble by practically identical mechanisms.
  • the invention may be carried out by using AAV serotypes AAV1, AAV2, AAV3 (including types 3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
  • AAV serotypes AAV1, AAV2, AAV3 including types 3 A and 3B
  • AAV4 AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
  • the genomic sequences of the various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of their terminal repeats, Rep proteins, and capsid subunits are known in the art. Such
  • an AAV vector according to the invention comprises, optionally in combination with one or more features of the various embodiments described above or below, at least one AAV inverted terminal repeat sequence (ITR) flanking the nucleic acid construct at one side.
  • AAV "inverted terminal Repeats (ITR)" or “terminal repeats” are 145 nucleotides' sequences located at 5'- and 3 '-ends of AAV, that contain palindromic sequences and that can fold over to form T- shaped hairpin structures that function as primers during initiation of DNA replication. They are also needed for viral genome integration into host genome; for the rescue from the host genome; and for the encapsidation of viral nucleic acid into mature virions.
  • the ITRs are the only viral elements which are required in cis for the vector genome replication and its packaging into the viral particles.
  • the AAV vector comprises at least two AAV ITRs, one on each side of the nucleic acid construct.
  • the ITRs will typically be at the 5' and 3' ends of the nucleic acid construct, but need not be contiguous thereto.
  • the terminal repeats can be the same or different from each other.
  • both ITRs are from a same AAV serotype, which can be an AAV of any serotype known or later discovered.
  • ITRs are the ITRs of an AAV of a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
  • ITRs of AAV1, AAV2, and AAV4 are preferred, more particularly ITRs from AAV2 (for example SEQ.ID.NO.9 and SEQ.ID.NO.10).
  • the nucleic acid construct of the AAV vector of the invention comprises a single "terminal repeat".
  • terminal repeat includes a viral terminal repeat and/or a partially or completely synthetic nucleotides' sequence that form hairpin structures and function as an inverted terminal repeat, such as the "double-D sequence" as described in United States Patent No. 5,478,745 to Samulski et al.
  • the "AAV terminal repeat” may be from any AAV, including but not limited to serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV 11 and/or AAV 12, or any other AAV now known or later discovered.
  • the AAV terminal repeat need not have a wild-type sequence (e.g., a wild- type sequence may be altered by insertion, deletion, truncation or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, provirus rescue, and the like.
  • the nucleic acid construct includes a non-resolvable terminal repeat, optionally in combination with one or more features of the various embodiments described above or below.
  • non-resolvable terminal repeat refers to a modified ITR such that the resolution by the Rep protein is reduced.
  • a non-resolvable ITR can be an ITR sequence without the terminal resolution site which leads to low or no resolution of the non- resolvable terminal repeat and yields self-complementary AAV vectors.
  • a self- complementary genome comprises a 5' ITR, and a 3' ITR flanking the genome (wild- type ITRs or resolvable ITRs), and a non-resolvable ITR interposed between the 5' and 3' ITRs.
  • Each portion of the genome i.e. between each resolvable ITR and non- resolvable ITR
  • Self-complementary AAV vectors have been previously described in the art (US7465583 and McCarty D.M. Mol. Ther. 2008; 16(10): 1648-1656) and can be adapted as particular embodiments of the present invention.
  • an adenoviral vector includes any adenovirus serotype within any of the classification sub-groups (A-F).
  • an adenoviral vector according to the invention is derived from a sub-group C adenovirus, more preferably from an adenovirus serotype 2 (Ad2) or serotype 5 (Ad5).
  • Adenovirus have been widely used for the design and construction of adenoviral vectors for gene therapy, and a number of possible alternative modifications are well known for those skill in the art (e.g.. first-, second-, third-generation adenoviruses), [see Adenovirus. Methods and Protocols. Chillon M. and Bosch A. (Eds); third Edition; 2014 Springer].
  • the adenoviral vector according to the invention can be, in particular, a first-, second-, or third-generation adenovirus, or any other adenoviral vector system already known or later described.
  • the viral vector of the invention is a "third generation adenovirus", which may also be referred to as “gutless adenovirus”, “helper-dependent adenovirus (HD-Ad)", or “high capacity adenovirus (HC-Ad)".
  • a third generation adenovirus has all viral coding regions removed (gutless); it depends on a helper adenovirus to replicate (helper-dependent); and it can carry and deliver into the host cell up to 36 Kbp inserts of foreign genetic material (high- capacity).
  • a gutless adenovirus keeps the inverted terminal repeats ITRs (5' and 3') and packaging signal ( ⁇ ), which is essential for the final assembly of the viral particle.
  • a high-capacity adenoviral vector according to the invention comprises together with the sequence carrying the nucleotide sequence encoding a therapeutic polypeptide and, operably linked to it, the ADRES (at least one copy) and promoter sequence: a) two ITR copies, one on each side of the nucleic acid construct (5'-ITR, and 3'-ITR), and b) an adenovirus packaging signal ( ⁇ ) located downstream of the 5' -ITR and preceding the nucleic acid construct carrying the ADRES element/s, the promoter and the encoding sequence.
  • the HC-Ad comprises 5 ' ITR, ⁇ packaging signal, and 3 ' ITR of an adenovirus of Ad2 or Ad5 serotype.
  • the nucleic acid construct of the viral vector may further comprise other optional viral and no-viral nucleotide sequences, including among others: stuffer sequences to complete the minimal packageable genome size (e.g. intronic sequences hypoxanthine-guanine phospho ribosyl transferase HPRT), polyA insulators, and post-transcriptional regulatory elements.
  • stuffer sequences to complete the minimal packageable genome size e.g. intronic sequences hypoxanthine-guanine phospho ribosyl transferase HPRT
  • polyA insulators e.g., polyA insulators
  • post-transcriptional regulatory elements e.g., post-transcriptional regulatory elements.
  • Suitable optional nucleotide elements for the viral vector construction are in general well known of a person skilled in recombinant genetic technology, and in particular of a person skilled in genetic engineering of gene therapy viral vectors.
  • the first and/or second nucleic acid construct of the invention herein described can be prepared and obtained by conventional methods known to those skilled in the art: Sambrook and Russell (Molecular cloning: a laboratory Manual; Third Edition; 2001 Cold Spring Harbor Laboratory Press); and Green and Sambrook (Molecular cloning: a laboratory Manual; Fourth Edition; 2012 Cold Spring Harbor Laboratory Press).
  • virion and “viral particle” are used herein interchangeably and relate to an infectious and typically replication-defective virus particle comprising the viral genome packaged within a capsid and, as the case may be, a lipidic envelope surrounding the capsid.
  • the virion of the invention is a "recombinant AAV virion" or "rAAV virion” obtained by packaging of a nucleic acid construct of an AAV vector according to the invention in a protein shell.
  • capsid proteins VP1, VP2, and VP3 Proteins of the viral capsid of an adeno-associated virus (capsid proteins VP1, VP2, and VP3) are generated from a single viral gene (cap gene). Differences among the capsid protein sequence of the various AAV serotypes result in the use of different cell surface receptors for cell entry. In combination with alternative intracellular processings, this gives rise to distinct tissue tropisms for each AAV serotype.
  • a recombinant AAV virion according to the invention may be prepared by encapsidating the nucleic acid construct of an AAV vector derived from a particular AAV serotype on a viral particle formed by natural Cap proteins corresponding to an AAV of the same particular serotype. Nevertheless, several techniques have been developed to modify and improve the structural and functional properties of naturally occurring AAV viral particles (Bunning H et al. J Gene Med 2008; 10: 717-733).
  • the nucleotide construct of the viral vector flanked by ITR(s) of a given AAV serotype can be packaged, for example, into: a) a viral particle constituted of capsid proteins derived from a same or different AAV serotype [e.g. AAV2 ITRs and AAV5 capsid proteins; AAV2 ITRs and AAV8 capsid proteins; etc]; b) a mosaic viral particle constituted of a mixture of capsid proteins from different AAV serotypes or mutants [e.g.
  • AAV2 ITRs with AAVl and AAV5 capsid proteins a chimeric viral particle constituted of capsid proteins that have been modified by domain swapping between different AAV serotypes or variants [e.g. AAV2 ITRs with AAV5 capsid proteins with AAV3 domains]; or d) a targeted viral particle engineered to display selective binding domains, enabling stringent interaction with target cell specific receptors [e.g. AAV4 ITRs with AAV2 capsid proteins genetically modified by insertion of a peptide ligand; or AAV2 capsid proteins non-genetically modified by coupling of a peptide ligand to the capsid surface].
  • AAV4 ITRs with AAV2 capsid proteins genetically modified by insertion of a peptide ligand
  • AAV2 capsid proteins non-genetically modified by coupling of a peptide ligand to the capsid surface.
  • the AAV virion according to the invention may comprise capsid proteins from any AAV serotype.
  • the AAV viral particle comprises capsid proteins from a serotype selected from the group consisting of AAVl, AAV5, AAV8, and AAV9 which are more suitable for delivery to the liver cells (Nathwani et al, 2007, Blood 109: 1414-1421; Kitajima et al, 2006, Atherosclerosis 186:65-73).
  • the virion of the invention is an adenoviral virion, such as an Ad5 virion.
  • Ad5 virion adenoviral virion
  • capsid proteins of Ad virions can also be engineered to modify their tropism and cellular targeting properties.
  • Production of viral particles carrying the nucleic acid construct of the viral vector of the invention can be performed by means of conventional methods and protocols, which are selected having into account the structural features chosen for the instant nucleic acid construct and viral particle of the vector embodiment to be produced.
  • viral particles can be produced in a specific virus-producing cell (packaging cell) which is transfected with the DNA nucleic acid construct of the vector to be packaged, in the presence of a helper virus or other DNA construct/s.
  • the packaging cell, and helper vector or DNA constructs provide together in trans all the missing functions which are required for the complete replication and packaging of the viral vector.
  • Large-scale production of AAV vectors according to the invention can be carried out for example by infection of insect cells with a combination of recombinant baculoviruses (Urabe et al. Hum. Gene Ther. 2002; 13: 1935-1943).
  • SF9 cells are co- infected with three baculovirus vectors respectively expressing AAV rep, AAV cap and the AAV vector to be packaged.
  • helper plasmids encoding the rep ORF ⁇ open reading frame
  • ITRs ITRs of a given AAV serotype
  • cap ORF open reading frame
  • AAV vector carrying the nucleic acid construct of the AAV vector
  • AAV helper plasmid that encodes rep and cap open reading frames, but does not carry ITRs sequences
  • a third plasmid providing the adenoviral functions necessary for AAV replication.
  • rep, cap, and adenoviral helper genes can be combined on a single plasmid (Blouin Vet al. J Gene Med. 2004; 6(suppl): S223-S228; Grimm D. et al. Hum. Gene Ther. 2003; 7:839-850).
  • HC-Ad vectors can be carried out by means of mammalian cells that constitutively express and transcomplement the adenoviral El gene, and also Cre recombinase (e.g. 293Cre cells). These cells are transfected with the HC-Ad vector genome and infected with a first- generation adenoviral helper virus (El -deleted) in which the packaging signal is flanked by loxP sequences.
  • adenoviral helper virus El -deleted
  • Cre/loxP-based helper virus systems have been described that can be used for packaging HC-Ad vectors, such as the AdAdLC8cluc, or the optimized self-inactivating AdTetCre helper virus (EP2295591; Gonzalez- Aparicio et al. Gene Therapy 2011; 18: 1025-1033).
  • Adeno-Associated Virus Methods and Protocols. R.O. Snyder and P. Moulllier (Eds). 2011 Humana Press (Springer).
  • Adenovirus Methods and Protocols. M. Chillon and A. Bosch (Eds.); Third Edition. 2014 Humana Press (Springer); (in particular chapter 15).
  • the product of the invention as defined within the Summary of the invention is devised for use in the treatment of a condition caused by a deficiency in porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase; in that case the nucleic acid construct comprises a nucleotide sequence encoding the therapeutic polypeptide or protein with corresponding porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase activity.
  • the invention also relates to the use of a product of the invention that comprises a nucleotide sequence encoding a therapeutic polypeptide with PBGD, COX or PPOX activity, for the preparation of a medicament for the treatment of a condition respectively caused by a deficiency in porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase; and to a method for the treatment of a condition caused by a deficiency in porphobilinogen deaminase, coproporphyrinogen oxidase or protoporphyrinogen oxidase, that comprises the administration of an effective amount of a product of the invention that comprises a nucleic acid sequence encoding a therapeutic polypeptide with corresponding PBGD, COX or PPOX activity to a subject with a corresponding porphobilinogen deaminase, coproporphyrinogen oxidase or protopor
  • the condition caused by a PBGD, COX or PPOX deficiency is an acute porphyria, and, in particular, an acute intermittent porphyria (AIP, Online Mendelian Inheritance in Man catalog accession number OMIN 176000), a variegate porphyria (VP, OMIN 176200) or a hereditary coproporphyria (HCP, OMIN 121300).
  • AIP acute intermittent porphyria
  • VP variegate porphyria
  • HCP hereditary coproporphyria
  • the condition to be treated is caused by a deficiency in porphobilinogen deaminase, and in particular an acute porphyria; more preferably is acute intermittent porphyria, and in particular acute intermittent porphyria in a subject which suffers recurrent attacks of porphyria with or without nervous system dysfunctions.
  • Such treatment may alleviate, ameliorate, or reduce the severity of one or more symptoms of AIP, for example reduces the incidence or severity of an attack.
  • treatment may alleviate, ameliorate, or reduce the severity of dysfunction of the nervous system, abdominal pain or neurovisceral and/or circulatory disturbances.
  • the product of the invention for these therapeutic uses will carry a nucleotide sequence encoding a polypeptide with porphobilinogen deaminase activity.
  • composition or medicament will be typically included in a pharmaceutical composition or medicament, optionally in combination with a pharmaceutical carrier, diluent and/or adjuvant.
  • Such composition or medicinal product comprises the product of the invention in an effective amount, sufficient to provide a desired therapeutic or prophylactic effect, and a pharmaceutically acceptable carrier or excipient.
  • An "effective amount” means a therapeutically effective amount or a prophylactically effective amount.
  • the invention further relates to a pharmaceutical composition or medicinal product comprising a product of the invention, per se and for the above proposed uses in medicine and therapeutic methods.
  • the pharmaceutical composition or medicament preferably comprises a pharmaceutically acceptable carrier. Any suitable pharmaceutically acceptable carrier or excipient can be used in the present compositions (See e.g., Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (Editor) Mack Publishing Company, April 1997). Preferred pharmaceutical forms would be in combination with sterile saline, dextrose solution, or buffered solution, or other pharmaceutically acceptable sterile fluids. Alternatively, a solid carrier may be used such as, for example, microcarrier beads.
  • compositions are typically sterile and stable under the conditions of manufacture and storage.
  • Pharmaceutical compositions may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to accommodate a high drug concentration.
  • the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
  • the product of the invention may be administered in a time or controlled release formulation, for example in a composition which includes a slow release polymer or other carriers that protect the compound against rapid release, including implants and microencapsulated delivery systems.
  • Biodegradable, and biocompatible polymers may for example be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic / polyglycolic copolymers (PLG).
  • a "therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as an elevation of PBGD, PPOX or COX activity.
  • a therapeutically effective amount of the product of the invention, or pharmaceutical composition that comprises it may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the product or pharmaceutical composition to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response.
  • a therapeutically effective amount is also typically one in which any toxic or detrimental effects of the product or pharmaceutical composition are outweighed by the therapeutically beneficial effects.
  • a prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as preventing or inhibiting various conditions, for example a condition associated with a reduction in PBGD, PPOX or COX levels.
  • a prophylactic dose may be used in subjects prior to or at an earlier stage of disease, and a prophylactically effective amount may be more or less than a therapeutically effective amount in some cases.
  • the therapy is administered prior to, concomitantly and/or immediately after the exposure of the patient to a porphyrinogenic factor.
  • porphyrinogenic factor refers to any factor that results in an increased production of heme by the liver.
  • Porphyrinogenic factors include, without limitation, estrogen administration or an increase in estrogens during the hormonal cycle, starvation, and certain drugs and anesthetics, such as barbiturates.
  • a range for the therapeutically or prophylactically effective amounts of the product of the invention, or pharmaceutical composition which comprises it may be from 1 x 10 10 to 2 x 10 13 genome copies (gc) /kg, for example from 1 x 10 10 to 1 x 10 13 gc/kg of AAV vector and from 5 x 10 8 infective units/kg to 1 x 10 12 infective units/kg of HC-Ad vector. It is to be noted that dosage values may vary with the severity of the condition to be alleviated.
  • dosage regimens may be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners.
  • the dosage to be administered may depend to a large extent on the condition and size of the subject being treated as well as the therapeutic formulation, frequency of treatment and the route of administration. Regimens for continuing therapy, including dose, formulation, and frequency may be guided by the initial response and clinical judgment.
  • the parenteral route of injection into the interstitial space of tissue may be preferred, although other parenteral routes may also be considered.
  • Intravenous or intrahepatic administrations can be suitable (Unzu C. et al. Hum. Mol. Genet. 2013; 22(14):2929-2940).
  • a formulation comprising the vector of the invention in an aqueous carrier is injected into tissue in appropriate amounts.
  • the tissue target may be specific, for example the liver tissue, or it may be a combination of several tissues, for example the muscle and liver tissues.
  • Exemplary tissue targets may include liver, skeletal muscle, heart muscle, adipose deposits, kidney, lung, vascular endothelium, epithelial and/or hematopoietic cells.
  • the effective dose range for small animals (mice), following intrahepatic injection may be between 1 x 10 10 and 1 x 10 12 gc / kg for AAV; or between 5 x 10 8 and 1 x 10 11 vp/kg for HC-Ad, and for larger animals (cats) and for human subjects, between 1 x 10 11 and 2 x 10 13 gc / kg for AAV or between 1 x 10 10 and 1 x 10 12 vp / kg for HC-Ad.
  • the amount of product of the invention or of pharmaceutical composition in the compositions of the invention may vary according to factors such as the disease state, age, sex, and weight of the individual, and/or concomitant medication that has been prescribed to the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention may be dictated by the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and by the limitations inherent in the art of compounding such an active compound for the treatment of a condition in individuals.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic, absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for parenteral administration, which includes among others intravenous, intraperitoneal or intramuscular administration.
  • the carrier may be suitable for sublingual or oral administration.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated.
  • Supplementary active compounds can also be incorporated into the pharmaceutical compositions of the invention.
  • Guidance on co-administration of additional therapeutics may for example be found in the Compendium of Pharmaceutical and Specialties (CPS) of the Canadian Pharmacists Association.
  • CPS Compendium of Pharmaceutical and Specialties
  • the word “comprise” and variations of thereof, are not intended to exclude other technical features, additives, components, or steps.
  • the word “comprise” encompasses the case of "consisting of. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention.
  • the following examples are provided by way of illustration, and they are not intended to be limiting of the present invention.
  • the present invention covers all possible combinations of particular and preferred embodiments described herein.
  • a set of different plasmidic vectors was designed and constructed to conduct several comparative hydrodynamic transfection assays.
  • pTRE-EalbPalAT-Luciferase plasmid (henceforth pLuc) was used as starting product to construct other plasmids, and was also included in the assays as a control.
  • the plasmid was derived from a pTRE2 vector (CLONTECH Laboratories, Inc, Germany); the reporter gene luciferase (CDS sequence: 304..429, 487..694, 746..1079, 1128..1448, 1498..1852, 1896..2061 and 2109..2251; GenBank accession number Ml 5077) was cloned downstream of the a- 1 -antitrypsin promoter linked to the enhancer regions of the albumin gene (EalbPal AT) which is a potent chimeric promoter in directing stable gene expression in liver cells [Kramer MG et al. Mol Ther 2003; 7: 375-385].
  • ERE estrogen response elements
  • the nucleotide sequence GGTCACAGTGACC of Estrogen Response Element (ERE) was SEQ.ID.N0.13.
  • Five ERE elements in tandem were obtained from AdEHT2 plasmid (Hernandez-Alcoceba et al. Hum. Gene Ther. 2002.13: 1737-1750) and were cloned into pLuc expression vector at 5 '-end of EalbPalAT promoter.
  • the resulting plasmid was pTRE-5xERE-EalbPalAT-Luc (p5ERE).
  • a panel of plasmids which carried one or several ADRES elements was also constructed.
  • the nucleotide sequence of an ADRES element is provided as SEQ.ID.NO.l, a sequence of 174 bp in length spanning from -20 918 pb to -20 745 bp of the 5 '-flanking region of human ALAS1 gene (GenBank accession no. AC006252). Designed primers
  • sensehuADRES (SEQ.ID.NO. i l) 5 ' -ATCTGCAGAATTGCTCGAGCGCAAAGTCAACACAAGCCTCTCCACCGTGTGTCCAT GTTTATGTGTATGCGCTGTGCCCCGTCATGCCACCTGGACGCAGGGACTCCAGTGACCT CTC-3' ;
  • the resultant fragment was cloned into the above mentioned pLuc vector using the Xhol restriction endonuclease site placed in 5 '-end of EalbPal AT promoter and Xhol sites placed on both ends of the ADRES fragment.
  • pTRE- ADRES-EalbPa 1 AT-Luc carrying 1 ADRES sequence in phase with the promoter
  • pTRE-2xADRES-EalbPal AT-Luc carrying 2 ADRES sequence in phase with the promoter
  • p3ADRES pTRE-3xADRES-EalbPal AT-Luc
  • p2iADRES pTRE-ADRES-iADRES-EalbPal AT-Luc
  • pTRE-2xADRES-iADRES-EalbPal AT-Luc which carried 3 ADRES sequences, an inverted ADRES sequence positioned following 2 ADRES sequences in phase with the promoter.
  • Viral expression vectors construction of AAV vectors (serotype 8, single- stranded).
  • AAV2/8-EalbPalAT-cohPBGD and AAV2/8-2xADRES-EalbPalAT-cohPBGD vectors were produced for evaluation in acute intermittent porphyria murine model.
  • pro-AAV-cohPBGD and pro-AAV-2ADRES were generated by cloning expression cassettes of the vectors in a pro-AAV based cloning vector (courtesy of P. Berraondo: Berraondo P. et al. Mol. Ther. 2005; 12: 68-76).
  • the pro- AAV based vector carries the backbone for the vector, containing mainly the AAV2 5'ITR (SEQ.ID.NO.9); a first appropriate stuffer sequence; the restriction sites for expression cassette insertion; a poly(A) sequence from the rabbit ⁇ -globin gene, added to adjust the size of the AAV genome to the optimal packaging capacity described for single-stranded AAV vectors (Dong et al, Hum. Gene Ther. 1996; 7(17):2101-2112.); and AAV2 3'ITR (SEQ.ID.NO.10).
  • the expression cassette inserted in pro-AAV- cohPBGD had the following elements: a polyA insulator sequence, liver- specific promoter EalbPalAT (SEQ.ID.NO.7) (Kramer et al, Mol. Ther. 2003; 7(3):375-385; referred as Ealb-PalAT), a codon optimized synthetic sequence encoding human housekeeping PBGD followed with two stop codons (SEQ.ID.NO.3), and the 3'-UTR and polyadenylation sequences of human PBGD (bases 9,550-9,655: GenBank accession no. M95623).
  • the expression cassette inserted in pro-AAV-cohPBGD vector had these same elements plus two tandem repeats of ADRES (SEQ.ID.NO.2) inserted after the polyA insulator at the 5 'end of EalbPalAT promoter.
  • AAV8 vectors carrying wild-type AAV2 ITRs were then produced in 293 T cells.
  • a mixture of plasmids was transfected into 293 T cells using linear polyethylenimine 25 kDa (Polysciences, Warrington, PA) (as described by Durocher Y. et al, Nucleic Acids Res. 2002; 30:E9).
  • the mixture of plasmids contained 20 ⁇ g of corresponding pro-AAV based plasmid and 55 ⁇ g of plasmid pDP8.ape (PlasmidFactory, KG, Bielefeld, Germany).
  • the cells were harvested 48 hours after transfection and virus was released from the cells by three rounds of freeze-thawing. Crude lysates from all batches were centrifuged for 10 min at 4°C, 960 g, filtered (pore size, 0.45 ⁇ ) and later digested with 100 ⁇ g/ml DNase and RNase (both from Roche Diagnostic GmbH, Mannheim, Germany) for 30 min at 37°C. AAVs were purified from the supernatant by ultracentrifugation in Optiprep Density Gradient Medium-Iodixanol (Sigma-Aldrich, St Louis MO), following manufacturer instructions. The purified batches were then concentrated and diafiltrated by passage through Centricon tubes (YM-100; Millipore, Bedford, MA). After concentration, the viral batches were stored at -80 °C.
  • Adenoviral expression vectors construction of plasmids and production of high capacity helper dependent Adenovirus (HC-Ad).
  • HC- Ad5 -EalbPa 1 AT-cohPBGD and HC-Ad5-2xADRES-EalbPalAT-cohPBGD vectors were produced for evaluation in acute intermittent porphyria murine model.
  • plasmids pL-cohPBGD and pL-2ADRES were generated by cloning expression cassettes of the vectors into the shuttle plasmid pLPBLl-Zeo (courtesy of Dr Brendan Lee, Baylor College of Medicine, Houston, TX, USA).
  • the expression cassette inserted in pL-cohPBGD had the following elements: a polyA insulator sequence, a liver-specific promoter EalbPalAT (SEQ.ID.NO.7), a codon optimized synthetic sequence encoding human PBGD followed with two stop codons (SEQ.ID.NO.3), and the human PBGD 3'-UTR and polyadenylation sequence (bases 9,550-9,655: GenBank accession no. M95623).
  • the expression cassette inserted in pL-2ADRES had these same elements plus two tandem repeats of ADRES (SEQ.ID.NO.2) inserted after the polyA insulator at the 5 'end of EalbPalAT promoter.
  • pDelta28E4 carries the backbone for the vector, containing mainly the Ad5 5'ITR and ⁇ packaging signal, a first stuffer sequence, the restriction site for expression cassette insertion, a second stuffer sequence, and Ad5 3'ITR.
  • Total length of pHCA-cohPBGD and pHCA-2ADRES genomes within the plasmids were 33.1 kb and 33.4 kb, respectively.
  • helper virus AdTetCre system was used for the packaging and production of the HC-Ad vectors (Gonzalez-Aparicio M. et al. Gene Ther. 2011; 18(11): 1025-1033).
  • the pHCA-cohPBGD and pHCA-2ADRES plasmids were digested with Pmel to liberate the vector genome, precipitated with ethanol and resuspended in Tris lOmM, at pH 8 and a concentration of 1 mg/mL.
  • HC- Ad vector For rescue of HC- Ad vector (step 0, P0), 293Cre4 cells were seeded in 60mm culture plates (10 6 cells per plate), pretreated for 24 h with tamoxifen (TAM; 0.8 mM) and doxycycline (DOX; 1 mg/ml), and transfected with 15 mg of the corresponding plasmids, using lipofectamine 2000 (Invitrogen). After 6 h, cells were infected with AdTetCre at a multiplicity of infection (MOI) of 1 iu per cell in the presence of DOX and TAM.
  • MOI multiplicity of infection
  • S5 step 50% of lysate from S4 step was used to infect 10x150 mm plates, or 100% of the lysate was used to infect 20 plates.
  • S6 step 100% of lysate from S5 step was used to infect 60x150 mm plates. In all cases, the MOI of AdTetCre was maintained at 1.
  • Viral particles were measured by spectrophotometry at 260 nm after particle lysis by incubation in phosphate-buffered saline (PBS)/0.5% sodium dodecyl sulphate at 37°C for 15 min.
  • PBS phosphate-buffered saline
  • OPA optical particle units
  • Huh7 cells were seeded in 24-well plates at a density of 1 x 10 5 cells per well. The next day, the HC-Ad was diluted 1 :20 in PBS. Then 5, 10 and 20 ⁇ of this dilution were added to 200 ⁇ of DMEM 2% FBS by duplicate and added to the cells. One hour later, 300 ⁇ DMEM 10% were added. After 24 h, cells were washed twice with PBS and 200 ⁇ of PBS/5mM ethylene-diamine-tetra-acetic acid was added. The plates were incubated at 37°C for 30 min and detached cells were transferred into a 1.5-ml tube.
  • a cell lysis was performed by adding 200 ⁇ of 0.8 N NaOH and vortexing for 10 s. Samples were then incubated for 20 min at room temperature.
  • Viral nucleic acids were extracted from cell lysates obtained from the infection assay using the High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland) and were quantified by real-time PCR with the iQ instrument (Bio-Rad, Hercules, CA, USA). To generate the standard curves, serial dilutions of pHCA-coPBGD genomic DNA were prepared, ranging from l x lO 3 to l x lO 7 plasmid copies.
  • a standard program was used for all quantifications: 10 min at 95 °C, 35 cycles of 10 s at 95 °C and 20 s at 60 °C.
  • a melting curve was generated by raising the incubation temperature from 65 °C to 95 °C to confirm amplification specificity.
  • the iu/vp ratio was estimated at 1/100.
  • Example 2 Effects of the incorporation of ADRES elements in the expression vector. Transgene expression depending on the number and disposition of ADRES elements. In vivo hydrodynamic transfer. Plasmids pLuc, pADRES, p2ADRES, p3ADRES, p2iADRES and p2+i ADRES were comparatively tested by hydrodynamic transfer assays in order to assess the effect of the incorporation of a different number and disposition of ADRES elements in the luciferase expression vector.
  • mice Trans fected mice were then treated with increasing doses of phenobarbital (75, 80, 85, and 90 mg/kg body weight) for four consecutive days (phenobarbital challenge).
  • Liver transgene expression levels were determined two hours after the third and fourth phenobarbital doses by bio luminescence measurements performed in anesthetized HD-mice that were intraperitoneally injected with 100 ml of d-luciferin (30 mg/ml of 150 mM NaCl).
  • the grayscale photographs and bio luminescence images from all studies were superimposed, using Living Image software (Xenogen).
  • ADRES elements in the plasmid pLuc affected to transgene expression. Incorporation of ADRES elements resulted in an increased luciferase expression in response to phenobarbital.
  • the inclusion of a third copy in phase with the promoter (p3ADRES) or inverted (p2+iADRES) also enhanced the transgene expression in response to phenobarbital, but to a lesser level than the increased observed for p2ADRES.
  • Example 3 Effects of the incorporation of ADRES elements in an expression vector. Transgene expression in response to porphyrinogenic stimuli. In vivo hydrodynamic transfer.
  • p2ADRES was selected to assess the performance of plasmid vectors modified with ADRES elements in response to different porphyrinogenic stimuli.
  • the liver of 5 male BALB/c mice was transfected with p2 ADRES plasmid [50 ⁇ g DNA plasmid re-suspended in 2 ml of 0.9% NaCl saline] using the hydrodynamic-based procedure as described in Example 1.
  • p2 ADRES plasmid 50 ⁇ g DNA plasmid re-suspended in 2 ml of 0.9% NaCl saline
  • Three animals received a dose of 90 mg of phenobarbital/kg on days 1, 2, 3, 4, 7 and 8. Luciferase expression was daily monitored by luminescence measurement as has been previously described.
  • mice were also hydrodynamically transfected with p2ADRES [50 ⁇ g DNA plasmid re-suspended in 2 ml of 0.9% NaCl saline] and were then exposed to different factors known to induce porphyria attacks in humans: 90 mg of phenobarbital kg/day; 90 mg of ketamine/kg/day; 10 ⁇ g of cardiotrophin/kg/day; 1 ⁇ g 17a-ethinyl-estradiol/two times a day; and 24h fasting. Luciferase expression was monitored by luminescence measurement as has been previously described at baseline and 2 days after continuous exposure to these porphyrinogenic factors.
  • Example 4 Effects of the incorporation of ERE or ADRES elements in an expression vector. Comparison of sustainability of transgene expression. In vivo hydrodynamic transfer.
  • ADRES element is the most suitable enhancer to maintain transgene induction during the entire duration of the acute attack.
  • Example 5 Effects of the incorporation of ADRES elements in an AAV vector carrying PBGD. Therapeutic effect in an experimental acute porphyria model.
  • AAV2/8-EalbPalAT-cohPBGD (as Reference AA V vector) and AAV2/8-2xADRES-EalbPalAT-cohPBGD viral vectors was comparatively tested in a murine model of acute intermittent porphyria (AIP).
  • Murine AIP model Compound heterozygote Tl (C57BL/6-pbgd tml(neo)Uam ) and T2 (C57BL/6-pbgd tm2(neo)Uam ) strains described by Lindberg et al. [Nat. Genet. 1996, 12: 195-199] was used as a disease model for acute intermittent porphyria. These mice exhibit the typical biochemical characteristics of human porphyria, notably, a decreased hepatic PBGD activity and a massively increased urinary excretion of heme precursors in response to treatment with drugs such as phenobarbital.
  • Porphyrins mostly uroporphyrin (URO) and coproporphyria are also elevated in AIP but increased urinary porphyrin is a much less specific feature than increases in porphobilinogen (PBG) and 5 -aminolevulinic acid (ALA) levels.
  • URO uroporphyrin
  • PBG porphobilinogen
  • ALA 5 -aminolevulinic acid
  • mice were injected intravenously, via the tail vein, with a total of 200 of corresponding test substance (test viral vector). Extra groups of wild type and AIP mice were included as non-treated controls.
  • test viral vector test substance
  • mice were intraperitoneally injected with two cycles of increasing doses of phenobarbital (75mg/kg, 80mg/kg, 85mg/kg and 90mg/kg body weight in four consecutive days): first cycle on days 17 to 20 after administration of the test viral vector, second cycle on days 31 to 34.
  • PBGD expression was then determined by measurement of enzymatic activity, determining the conversion of PBG to URO.
  • PBGD activity was expressed in terms of pmol uroporphyrin/mg protein/h using appropriate standards. PBG excretion and PBGD activity were determined as has been described by Unzu et al. (Mol. Ther. 2011; 19(2): 243-250, supplementary information).
  • the Reference AAV vector was tested at treatment doses of 7.7 x 10 9 , and
  • AAV2/8-2xADRES-EalbPalAT-cohPBGD was tested at treatment doses of 7.7 x 10 9 , and 2.3 x 10 10 gc/kg. Results showed that, in this model, an intravenous dose of 5 x 10 10 gc/kg of
  • Reference AA V vector constituted a sub-therapeutic dose, whereas the administration of 2.3 x 10 10 gc/kg of AAV2/8-2xADRES-EalbPalAT-cohPBGD resulted in normal PBGD activity (Fig. 4A) and in a full protection against induced acute attack, as evidenced by normalization of urine PBG excretion (Fig. 4B).
  • liver of AIP mice injected with a dose of 7.7 x 10 9 gc/kg of
  • AAV2/8-2xADRES-EalbPal AT-cohPBGD showed similar PBGD activity than animals injected with a dose 7 times higher of Reference AAV vector (Fig. 4A). Both groups of animals exhibited a partial protection against the acute attack, although it was not as complete as that observed with the dose of 2.3 x 10 10 gc/kg of AAV2/8-2xADRES-EalbPalAT-cohPBGD (Fig. 4B). In conclusion, these results indicate that the inclusion of ADRES elements into the viral vector permits to lower the effective dose, and thus to expand the therapeutic window.
  • Example 6 Effects of the incorporation of ADRES elements in a HC-Ad vector carrying PBGD.
  • HC- Ad5 -EalbPa 1 AT-cohPBGD (as Reference HC-Ad vector) and HC-Ad5-2xADRES-EalbPalAT-cohPBGD viral vectors was comparatively tested in the murine AIP model, as is described in Example 5.
  • phenobarbital challenge (4 days with increasing doses) was started 3 weeks after test vector administration (on day 21). After the last phenobarbital dose (day 24), animals were housed during 24 h in metabolic cages in order to collect 24h-urine samples. Same way, animals were sacrificed 24h after the last phenobarbital dose.
  • DNA genome of HC-Ad viral vectors in the hepatic tissue was determined by real time Q-PCR using specific primers detailed in SEQ.ID.NO.14 and SEQ.ID.NO.15.
  • the endogenous Gapdh gene served as internal reference; specific primers used were mGAPDHfw (SEQ.ID.NO.16: 5 ' -ccaaggtcatccatgacaac-3 ' ), and mGAPDHrv (SEQ.ID.NO.17: 5 ' -tgtcataccaggaaatgagc-3 ' ).
  • liver samples were calculated according to the formula where Ct is the cycle at which the fluorescence rises appreciably above background fluorescence. Data are expressed in arbitrary units and correspond to fold increase compared to non-injected group. Hepatic PBGD expression and urinary PBG excretion were also determined as described above for AAV based test vectors.
  • the Reference HC-Ad vector was tested at a treatment dose of 2.6 x 10 9 iu/kg
  • the iu/viral particle ratio was estimated at 1/100.
  • HC- Ad5 -2xADRES-EalbPa 1 AT-cohPBGD was tested at a treatment dose of 5.0 x 10 8 iu/kg.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne de nouvelles constructions d'acide nucléique particulièrement appropriées pour la construction de vecteurs viraux et non viraux destinés à la thérapie génique, en particulier à la thérapie génique des porphyries aigües. Le vecteur d'expression qui porte les nouvelles constructions d'acide nucléique fournit une expression transgénique qui peut être induite et maintenue pendant toute la période d'exposition aux facteurs porphyrinogéniques responsables des attaques aigües de porphyries, comme les estrogènes, l'inanition ainsi que certains médicaments et anesthésiques. Ces nouveaux vecteurs de thérapie génique procurent une protection totale contre une attaque aigüe induite par le phénobarbital à une dose inférieure à celle décrite antérieurement pour des vecteurs AAV et HC-Ad.
PCT/EP2015/070204 2014-09-11 2015-09-04 Constructions d'acide nucléique et vecteurs d'expression destinés à la thérapie génique de porphyries aigües et d'autres maladies WO2016037931A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP14382337 2014-09-11
EP14382337.5 2014-09-11

Publications (1)

Publication Number Publication Date
WO2016037931A1 true WO2016037931A1 (fr) 2016-03-17

Family

ID=51585061

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/070204 WO2016037931A1 (fr) 2014-09-11 2015-09-04 Constructions d'acide nucléique et vecteurs d'expression destinés à la thérapie génique de porphyries aigües et d'autres maladies

Country Status (1)

Country Link
WO (1) WO2016037931A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018206125A1 (fr) * 2017-05-09 2018-11-15 Fundacion Para La Investigacion Medica Aplicada Protéines dérivées de la porphobilinogène désaminase humaine et polynucléotides et leurs utilisations
WO2020247819A3 (fr) * 2019-06-07 2021-02-25 Agios Pharmaceuticals, Inc. Méthode de traitement à l'aide de modulateurs de l'acide aminolévulinique synthase 2 (alas2)
RU2811791C1 (ru) * 2023-04-16 2024-01-17 федеральное государственное бюджетное учреждение "Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи" Министерства здравоохранения Российской Федерации Экспрессионный вектор на основе аденовируса человека 19 серотипа и способ его применения

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
WO2003085113A1 (fr) * 2002-04-09 2003-10-16 Universität Basel Sequence activatrice du gene d'acide 5-aminolevulinique synthase
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
WO2010036118A1 (fr) 2008-09-29 2010-04-01 Amsterdam Molecular Therapeutics (Amt) B.V. Thérapie génique par la porphobilinogène désaminase
EP2295591A1 (fr) 2008-05-16 2011-03-16 Proyecto de Biomedicina Cima, S.L. Adénovirus auxiliaires auto-inactivants pour la production d'adénovirus de recombinaison de capacité élevée

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
WO2003085113A1 (fr) * 2002-04-09 2003-10-16 Universität Basel Sequence activatrice du gene d'acide 5-aminolevulinique synthase
EP1490493B1 (fr) 2002-04-09 2006-12-06 Universität Basel WTT-Stelle Sequence activatrice du gene d'acide 5-aminolevulinique synthase
EP2295591A1 (fr) 2008-05-16 2011-03-16 Proyecto de Biomedicina Cima, S.L. Adénovirus auxiliaires auto-inactivants pour la production d'adénovirus de recombinaison de capacité élevée
WO2010036118A1 (fr) 2008-09-29 2010-04-01 Amsterdam Molecular Therapeutics (Amt) B.V. Thérapie génique par la porphobilinogène désaminase

Non-Patent Citations (48)

* Cited by examiner, † Cited by third party
Title
"Adeno-Associated Virus: Methods and Protocols", 2011, SPRINGER
"Adenovirus. Methods and Protocols", 2014, SPRINGER
"Adenovirus: Methods and Protocols", 2014, SPRINGER
"Remington: The Science and Practice of Pharmacy", April 1997, MACK PUBLISHING COMPANY
"The High Pure Viral Nucleic Acid", ROCHE APPLIED SCIENCE
"Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology", vol. 737, 2011, SPRINGER
ASTRID PAÑEDA ET AL: "Safety and Liver Transduction Efficacy of rAAV5- cohPBGD in Nonhuman Primates: A Potential Therapy for Acute Intermittent Porphyria", HUMAN GENE THERAPY, vol. 24, no. 12, 1 December 2013 (2013-12-01), US, pages 1007 - 1017, XP055223315, ISSN: 1043-0342, DOI: 10.1089/hum.2013.166 *
BLOUIN V ET AL., J GENE MED., vol. 6, 2004, pages S223 - S228
BURNING H ET AL., J GENE MED, vol. 10, 2008, pages 717 - 733
BURNING H. ET AL.: "Recent developments in adeno-associated virus technology", J. GENE MED., vol. 10, 2008, pages 717 - 733
C. UNZU ET AL: "Helper-dependent adenoviral liver gene therapy protects against induced attacks and corrects protein folding stress in acute intermittent porphyria mice", HUMAN MOLECULAR GENETICS, vol. 22, no. 14, 5 April 2013 (2013-04-05), gb, pages 2929 - 2940, XP055223318, ISSN: 0964-6906, DOI: 10.1093/hmg/ddt148 *
CARMEN UNZU ET AL: "Sustained Enzymatic Correction by rAAV-Mediated Liver Gene Therapy Protects Against Induced Motor Neuropathy in Acute Porphyria Mice", MOLECULAR THERAPY, vol. 19, no. 2, 28 September 2010 (2010-09-28), GB, pages 243 - 250, XP055223309, ISSN: 1525-0016, DOI: 10.1038/mt.2010.210 *
DEYBACH JC ET AL., HUM GENET., vol. 58, 1981, pages 425 - 428
DONG ET AL., HUM. GENE THER, vol. 7, no. 17, 1996, pages 2101 - 2112
DUROCHER Y. ET AL., NUCLEIC ACIDS RES., vol. 30, 2002, pages E9
GONZALEZ-APARICIO ET AL., GENE THERAPY, vol. 18, 2011, pages 1025 - 1033
GONZALEZ-APARICIO M. ET AL., GENE THER., vol. 18, no. 11, 2011, pages 1025 - 1033
GREEN; SAMBROOK: "Molecular cloning: a laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
GRIMM D. ET AL., HUM. GENE THER., vol. 7, 2003, pages 839 - 850
HEILBRONN R.; WEGER S: "Drug Delivery, Handbook of Experimental Pharmacology", vol. 197, 2010, SPRINGER-VERLAG, article "Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics", pages: 143 - 170
HERNANDEZ-ALCOCEBA ET AL., HUM. GENE THER., vol. 13, 2002, pages 1737 - 1750
HERNANDEZ-ALCOCEBA R, CANCER GENE THER., vol. 8, no. 4, 2001, pages 298 - 307
JOHANSSON ET AL., MOL. GENET. METAB., vol. 82, 2004, pages 20 - 26
JOHANSSON ET AL., MOL. THER., vol. 10, no. 2, 2004, pages 337 - 343
KITAJIMA ET AL., ATHEROSCLEROSIS, vol. 186, 2006, pages 65 - 73
KRAMER ET AL., MOL. THER., vol. 7, no. 3, 2003, pages 375 - 385
KRAMER MG ET AL., MOL THER, vol. 7, 2003, pages 375 - 385
LINDBERG ET AL., NAT. GENET., vol. 12, 1996, pages 195 - 199
M. GIACCA: "Gene Therapy", 2010, SPRINGER-VERLAG
MCCARTY D.M., MOL. THER., vol. 16, no. 10, 2008, pages 1648 - 1656
NATHWANI ET AL., BLOOD, vol. 109, 2007, pages 1414 - 1421
NUCLEIC ACIDS RESEARCH, vol. J4, 2006, pages D104 - D107
OKA K ET AL., CIRCULATION, vol. 103, 2001, pages 1274 - 1281
P. BERRAONDO; BERRAONDO P ET AL., MOL. THER., vol. 12, 2005, pages 68 - 76
PALMER; ENGEL, MOL. THER., vol. 8, 2003, pages 846 - 852
PANEDA A. ET AL., HUM. GENE THER., vol. 24, 2013, pages 1007 - 1017
PANEDA PANEDA ASTRID ET AL: "Toxicology and Liver Transduction Efficacy Evaluation of a Recombinant Adeno-Associated Viral Vector in Non Human Primates as a Potential Treatment for Acute Intermittent Porphyria", MOLECULAR THERAPY, vol. 20, no. Suppl. 1, May 2012 (2012-05-01), & 15TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-GENE-AND-CELL-THERAPY (ASGCT); PHILADELPHIA, PA, USA; MAY 16 -19, 2012, pages S225 - S226, ISSN: 1525-0016(print) *
PARKS RJ ET AL., PROC. NATL. ACAD. SCI. USA, 1996, pages 13565 - 13570
SAMBROOK; RUSSELL: "Molecular Cloning: a Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
TAKETANI S. ET AL., BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1183, 1994, pages 547 - 549
UNZU C. ET AL., HUM MOL GENET., vol. 22, 2013, pages 2929 - 2940
UNZU C. ET AL., HUM. MOL. GENET., vol. 22, no. 14, 2013, pages 2929 - 2940
UNZU C. ET AL., MOL. THER., vol. 19, no. 2, 2011, pages 243 - 250
UNZU ET AL., J HEPATOL., vol. 52, 2010, pages 417 - 424
UNZU ET AL., MOL. THER., vol. 19, no. 2, 2011, pages 243 - 250
URABE ET AL., HUM. GENE THER., vol. 13, 2002, pages 1935 - 1943
WRIGHT; LIM, BIOCHEM. J., vol. 213, 1983, pages 85 - 88
YASUDA M. ET AL., MOL. THER., vol. 18, 2010, pages 17 - 22

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018206125A1 (fr) * 2017-05-09 2018-11-15 Fundacion Para La Investigacion Medica Aplicada Protéines dérivées de la porphobilinogène désaminase humaine et polynucléotides et leurs utilisations
US11390854B2 (en) 2017-05-09 2022-07-19 Fundacion Para La Investigacion Medica Aplicada Human porphobilinogen deaminase derived proteins and polynucleotides and uses thereof
WO2020247819A3 (fr) * 2019-06-07 2021-02-25 Agios Pharmaceuticals, Inc. Méthode de traitement à l'aide de modulateurs de l'acide aminolévulinique synthase 2 (alas2)
CN114174288A (zh) * 2019-06-07 2022-03-11 安吉奥斯医药品有限公司 用氨基乙酰丙酸合酶2(alas2)调节剂治疗的方法
RU2811791C1 (ru) * 2023-04-16 2024-01-17 федеральное государственное бюджетное учреждение "Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи" Министерства здравоохранения Российской Федерации Экспрессионный вектор на основе аденовируса человека 19 серотипа и способ его применения

Similar Documents

Publication Publication Date Title
JP7349931B2 (ja) 高ビリルビン血症の処置
EP2352823B1 (fr) Thérapie génique par la porphobilinogène désaminase
CA2939950C (fr) Compositions utiles dans le traitement du deficit en ornithine transcarbamylase (otc)
RU2745567C2 (ru) Конструкции нуклеиновой кислоты и векторы для генотерапии для применения для лечения болезни вильсона и других состояний
KR20170121745A (ko) 선택적 스플라이싱의 앱타머 매개 조절에 의한 유전자 발현의 조절
JP7433360B2 (ja) Ｐａｈ遺伝子移入のためのアデノ随伴ウイルス組成物及びそれらの使用方法
US11891616B2 (en) Transgene cassettes designed to express a human MECP2 gene
KR20220155981A (ko) 미성숙 종결 코돈-매개 장애를 치료하기 위한 방법 및 조성물
JP2022522196A (ja) ラミノパシーを処置するための組成物および方法
US20210403947A1 (en) Miniaturized dystrophins and uses thereof
JP2018501791A (ja) 改変ｇ６ｐｃをコードするアデノ随伴ウイルスベクターおよびその使用
US20240091383A1 (en) Synergistic effect of smn1 and mir-23a in treating spinal muscular atrophy
KR20240025507A (ko) 미성숙 종결 코돈-매개 장애를 치료하기 위한 방법 및 조성물
JP2021512871A (ja) Ｐａｈ遺伝子機能を回復させるためのアデノ随伴ウイルス組成物及びそれらの使用方法
WO2016037931A1 (fr) Constructions d'acide nucléique et vecteurs d'expression destinés à la thérapie génique de porphyries aigües et d'autres maladies
JP5728389B2 (ja) アラニン−グリオキシル酸アミノトランスフェラーゼ治療薬
CN115605266A (zh) Dysferlin双载体的基因疗法
OA21365A (en) Synergistic effect of SMN1 and MIR-23A in treating spinal muscular atrophy.
WO2024103118A1 (fr) Systèmes d'édition de gènes et leurs utilisations
CA3140507A1 (fr) Therapie genique par l'insuline
CN117377771A (zh) 载体系统
CN117003833A (zh) 肝脏特异性的腺相关病毒血清型及应用
EA046419B1 (ru) Миниатюризированные дистрофины и их применения

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15759773

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15759773

Country of ref document: EP

Kind code of ref document: A1