WO2016036195A1 - 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법 - Google Patents

식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법 Download PDF

Info

Publication number
WO2016036195A1
WO2016036195A1 PCT/KR2015/009357 KR2015009357W WO2016036195A1 WO 2016036195 A1 WO2016036195 A1 WO 2016036195A1 KR 2015009357 W KR2015009357 W KR 2015009357W WO 2016036195 A1 WO2016036195 A1 WO 2016036195A1
Authority
WO
WIPO (PCT)
Prior art keywords
canp
gene
cipk1
plant
resistance
Prior art date
Application number
PCT/KR2015/009357
Other languages
English (en)
French (fr)
Inventor
김경남
조주혁
Original Assignee
세종대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150123824A external-priority patent/KR101752324B1/ko
Application filed by 세종대학교 산학협력단 filed Critical 세종대학교 산학협력단
Publication of WO2016036195A1 publication Critical patent/WO2016036195A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Definitions

  • the present invention provides an expression vector comprising a gene that enhances photosynthetic efficiency of a plant and induces plant resistance to dry and salt stress without dwarfism, the transformed plant transformed thereby, and the photosynthetic efficiency of the plant using the gene.
  • a method of inducing plant resistance to enhanced and dry and salt stress is provided.
  • Soil problems are serious due to the excessive use of fertilizer to increase crop production worldwide. This induces salinization of cropland, and damage to crop damage is increasing. In addition, damage to cropland is increasing by 500,000 hectares per year due to sea level rise, which is a salt damage. Therefore, the development of crops resistant to salting has recently been proposed as the most effective strategy for crop production in soils damaged by salting.
  • Droughts also have a major impact on crop production. According to the Palmer Drought Severity Index (PDSI), crops have been affected by droughts around the world, increasing by 15-25% since 1960. Corn is down 11.98% and crop production is expected to decrease by more than 50% by 2050.
  • PDSI Palmer Drought Severity Index
  • CBL-CIPK calcium signaling network first discovered in Arabidopsis plants, is known to play an important role in various abiotic environmental stress reactions such as drought, high salinity, and low temperature.
  • CBL and 26 CIPK genes There are 10 CBL and 26 CIPK genes in Arabidopsis.
  • genes that are very similar to Arabidopsis CBL and CIPK families are found in almost all plants, including major crops such as rice, wheat, soybeans, and corn. . Therefore, CBL-CIPK-related hazard information obtained from Arabidopsis, a model plant, can be similarly applied to other crops.
  • the calcium sensor CBL forms a complex in the cytoplasm, plasma membrane, or vacuole membrane with the serine / threonine protein kinase CIPK. It is unknown how the CBL-CIPK complex formed outside the nucleus modulates the expression of stress genes through signaling mechanisms through the nucleus.
  • the present invention provides an expression vector comprising a gene for enhancing photosynthetic efficiency of plants and resistance to drying and salt stress without dwarfism, thereby transformed plants and methods for producing the same, and seeds of the transformed plants And a method for producing the same, a plant cell derived from the transgenic plant, a method for enhancing photosynthetic efficiency of the plant using the gene and a method for inducing plant resistance to drying and salt stress.
  • the present inventors have continued to study the Arabidopsis CBL1 / CBL9-CIPK1 calcium signaling pathway, which is known to play an important role in plant reactions to environmental disasters such as drought and salt damage. Since it is not known how the CBL1 / CBL9-CIPK1 complex formed in the plasma membrane of cells modulates the expression of stress genes by signaling into the nucleus, the present inventors have identified proteins that interact with CIPK1 by the yeast two-hydrid screening method. As a result, the genes involved in drought and salt reaction were identified, named CIPK1-Associating Nuclear Protein (CANP), and the mechanism of action was identified.
  • CIPK1-Associating Nuclear Protein CIPK1-Associating Nuclear Protein
  • CANP normally forms a complex with CIPK1 in the cytoplasm, but when calcium signal is generated due to drought or salt damage, CBL1 / CBL9 protein that recognizes it interacts with CIPK1 and in this process CANP is separated from CIPK1. It goes into the nucleus. CANP enters the nucleus and interacts with AREB / ABF, a bZIP transcription factor, to increase the promoter activity of stress genes with ABRE cis-acting elements to increase dry and flame resistance. In addition, the overexpression of the gene was confirmed to show an increase in photosynthetic efficiency of the plant without dwarfism.
  • the present invention provides an expression vector comprising a gene CANP (CIPK1-Associating Nuclear Protein) which induces plant photosynthetic efficiency and induces plant resistance to drying and salt stress without dwarfism, and thereby transformed plants, And it provides a method for inducing photosynthesis efficiency of plants and resistance to drying and salt stress using the gene.
  • CANP CIPK1-Associating Nuclear Protein
  • the present invention provides a recombinant vector for producing a transformed plant comprising the gene CIPK1-Associating Nuclear Protein (CANP) which enhances photosynthetic efficiency of a plant without dwarfism and induces plant resistance to drying and salt stress.
  • CIPK1-Associating Nuclear Protein CIPK1-Associating Nuclear Protein
  • the present invention encodes the amino acid sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 or comprises a conserved sequence (RED_N_Superfamily and RED_C_Superfamily) at the N- and C-terminal, respectively, consisting of 540 to 600 amino acids
  • a recombinant vector for producing a transformed plant comprising a CIPK1-Associating Nuclear Protein (CANP) gene encoding an amino acid sequence, which enhances photosynthetic efficiency and enhances resistance to dry and salt stress.
  • CIPK1-Associating Nuclear Protein CIPK1-Associating Nuclear Protein
  • CANP CIPK1-Associating Nuclear Protein
  • the CIPK1-Associating Nuclear Protein (CANP) gene encodes the amino acid sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 or is a conserved sequence that appears in most plants RED_N_Superfamily and RED_C_Superfamily It is a gene encoding the amino acid sequence consisting of 540 to 600 amino acids contained in the N terminal and C terminal, respectively.
  • amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 13 are each Arabidopsis (SEQ ID NO: 1, NCBI No. NP_180214), Rice (SEQ ID NO: 2, NCBI No. EEC67667), Corn (SEQ ID NO: 3, NCBI No. NP_001105988 ), Beans (SEQ ID NO: 4, NCBI No. XP_003533803), potato (SEQ ID NO: 5, NCBI No. XP_006344564), crude (SEQ ID NO: 6, NCBI No. XP_004978650), tomato (SEQ ID NO: 7, NCBI No. (SEQ ID NO: 7, NCBI No.
  • XP_004242897 cucumber (SEQ ID NO: 8, NCBI No. XP_004136540), grape (SEQ ID NO: 9, NCBI No. XP_002274576), strawberry (SEQ ID NO: 10, NCBI No. XP_004287674), orange (SEQ ID NO: 11, NCBI No. KDO73769), peach (SEQ ID NO: 12, NCBI No. XP_007204321), and cacao (SEQ ID NO: 13, NCBI No. XP_007012533).
  • the Arabidopsis CANP gene has been reported to have a high homology with the human RED or murine MuRED gene (E. Assier et al., Gene 230 (1999) 145-154).
  • the Arabidopsis CANP gene is a protein with no known function, and has a "RED-like protein N-terminal region" and a "RED-like protein C-terminal region” with high homology with the RED gene. Turned out.
  • the positions of the “RED-like protein N-terminal region” are from 5 to 214 of the amino acid sequence of SEQ ID NO. 1, and the positions of the “RED-like protein C-terminal region” are from 461 to 585 of the amino acid sequence of SEQ ID NO. Exists at once.
  • RED-like protein N-terminal region and RED-like protein C-terminal region are conserved sequences that are evolutionarily conserved in most plants in most plants, It was found to be included in the N terminus and C terminus of the CIPK1-Associating Nuclear Protein (CANP) gene referred to in the present invention.
  • conserved sequences are referred to as RED_N_Superfamily and RED_C_Superfamily, respectively. 16 showing the alignment results of the amino acid sequences of SEQ ID NOS: 1 to 13, it can be seen that the conserved sequences RED_N_Superfamily and RED_C_Superfamily are commonly present in CANP of most major crops.
  • the amino acid sequence encoding the CANP gene is fixed to 540-600 amino acids, although not limited thereto. This indicates that the amino acid sequence encoded by the CANP gene has no large variation in the sequence in addition to the conserved sequences RED_N_Superfamily and RED_C_Superfamily, and the sequence homology is very high. Accordingly, the CANP gene of the present invention may be a gene encoding the amino acid sequence of SEQ ID NOs: 1 to 13 as a specific sequence, as well as similar genes having high sequence homology, that is, RED_N_Superfamily and RED_C_Superfamily, respectively, which are conserved sequences. Included at the terminus and C terminus, genes encoding amino acid sequences consisting of 540 to 600 amino acids are included.
  • RED_N_Superfamily and RED_C_Superfamily as defined herein may include seven and four conserved sequence blocks, respectively, as shown in FIG. 16. These conserved sequence blocks are arbitrarily expressed as the block having the highest conserved region among the sequences belonging to the RED_N_Superfamily or RED_N_Superfamily, and RED_N_Superfamily or RED_N_Superfamily as defined herein is not necessarily limited thereto.
  • the amino acid represented by X n means any amino acid present in the n-th position, and which amino acid is represented by X n separately.
  • SEQ ID NO: 16 KISIEX 6 SKYLGGDVEHTHLVKGLDYALLX 29 KVRSEIX 36 KKP
  • the recombinant vector including the CANP gene is prepared by inserting the gene into a known expression vector used for plant transformation.
  • vector refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host.
  • the vector may be a plasmid, phage particles, or simply a potential genomic insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors.
  • Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. Has a structure comprising a reporter gene, and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.
  • transformation refers to introducing and incorporating a nucleic acid encoding a heterologous gene to be introduced into a host cell of a plant or a vector containing the nucleic acid into the host cell to generate a genetically stable heredity
  • Transformed plant refers to a plant in which the heterologous gene has been introduced and genetically stable integrated to obtain the desired phenotype.
  • a number of techniques are available for transforming a desired gene into plant host cells. These techniques include transformation with non-arm T-DNA using Agrobacterium tumefaciens or Agrobacterium risogenes as transforming agents, calcium phosphate transfection, polybrene transformation, protoplast fusion, electroporation. , Ultrasound methods (eg, sonoporation), liposome transformation, microinjection, raw DNA, plasmid vectors, viral vectors, bioistics (microparticle impact), silicon carbide WHISKERS mediated transformation, aerosol beaming Or PEG transformation as well as other possible methods.
  • Agrobacterium tumefaciens or Agrobacterium risogenes as transforming agents
  • calcium phosphate transfection calcium phosphate transfection
  • polybrene transformation protoplast fusion
  • electroporation electroporation.
  • Ultrasound methods eg, sonoporation
  • liposome transformation microinjection
  • raw DNA plasmid vectors
  • the present invention also provides a composition for producing a transformed plant, wherein the photosynthetic efficiency including the recombinant vector including the CANP gene is enhanced and the resistance to dry and salt stress is enhanced.
  • the composition for producing a transgenic plant may further include a carrier for delivering the recombinant vector to a host cell or a component such as a medium or a buffer required for transformation in addition to the recombinant vector including the CANP gene according to the present invention. .
  • the present invention also improves photosynthetic efficiency of plants without dwarfism, including overexpressing the CANP gene in the host cell by transforming the host cell with the recombinant vector including the CANP gene, and enhances resistance to drying and salt stress. It provides a method for producing a conversion plant.
  • the host cell can be transformed by a conventional method using a recombinant vector including the CANP gene.
  • the host cell according to the present invention is a cell of a plant intended to give increased resistance to drought and salt and improved photosynthetic efficiency, and the type thereof is not limited.
  • the present invention also provides a transformed plant and its seed transformed with a recombinant vector comprising the CANP gene, enhanced photosynthetic efficiency and enhanced resistance to dry and salt stress.
  • plants that want to increase resistance to drought and salt and increase photosynthetic efficiency include Arabidopsis, rice, corn, soybeans, potatoes, crude, tomatoes, cucumbers, grapes, strawberries, and oranges. , Peaches or cacao and the like.
  • heterologous foreign DNA After introduction of heterologous foreign DNA into plant cells, transformation or integration of the heterologous genes in the plant genome is confirmed by various methods, such as analysis of nucleic acids, proteins or metabolites in this regard.
  • PCR analysis is a rapid method of screening transformed cells, tissues, or chutes for the presence of genes involved at an early stage prior to transplantation into soil (Sambrook and Russell's " Molecular Cloning: A Laboratory Manual "). (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001). PCR is performed using oligonucleotide primers specific for the gene of interest or Agrobacterium vector.
  • plant transformation can be confirmed by Southern blot analysis of genomic DNA.
  • whole DNA is extracted from a transformant, digested with appropriate restriction enzymes, fractionated in an agarose gel and nitrocellulose or nylon membranes. Is transferred to.
  • the membrane or “blot” can then be examined, for example with radioactively labeled 32 P target DNA fragments, to confirm the integration of introduced genes in the plant genome according to standard techniques (referred to above). Sambrook and Russell (2001).
  • RNA is isolated from specific tissues of transformants, fractionated in formaldehyde agarose gels, and placed on nylon filters according to standard procedures routinely used in the art. Blot (Sambrook and Russell (2001), previously mentioned). Expression of RNA encoded by the nucleotide sequences of the present invention is then tested by hybridizing the filter to radioactive probes derived from GDC by methods known in the art (see Sambrook and Russell, previously mentioned). 2001).
  • Standard blots using Western blots, ELISAs, lateral flow tests and similar biochemical assays employ antibodies that bind to one or more epitopes present on the herbicide tolerant protein. Can be performed on the transgenic plants to determine the presence of the protein encoded by the herbicide resistance gene.
  • the plant cells After introducing the genetic construct into plant cells, the plant cells can grow and mature plants can be produced upon emergence of differentiated tissue such as shoots and roots. In some embodiments, a plurality of plants can be produced. Methodologies for regenerating plants are known to those skilled in the art and are described, for example, in Plant Cell and Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer Academic Publishers and Plant Cell Culture Protocols (Methods in Molecular Biology 111, 1999 Hall Eds Humana Press).
  • the genetically modified plants described herein can be cultured in fermentation medium or grown in a suitable medium such as soil.
  • growth media suitable for higher plants can include growth vegetation for all plants, which includes all other particulate media (eg vermiculite, pearlite, etc.) or hydroponic cultivation that supports soil, sand, root growth. As well as suitable light, water, and nutritional supplements that optimize growth of higher plants.
  • particulate media eg vermiculite, pearlite, etc.
  • hydroponic cultivation that supports soil, sand, root growth.
  • suitable light, water, and nutritional supplements that optimize growth of higher plants.
  • the transformed plant cells produced by any of the above transformation techniques can be cultured to retain the transformed genotype to regenerate the complete plant having the desired phenotype.
  • This regeneration technique depends on the manipulation of specific plant hormones in tissue culture growth medium, which typically depends on the biocide and / or herbicide markers introduced with the desired nucleotide sequence. Plant regeneration from cultured protoplasts is described by Evans, et al., "Protoplasts Isolation and Culture” in Handbook of Plant Cell Culture , pp. 124-176, Macmillian Publishing Company, New York, 1983; And Binding, Regeneration of Plants, Plant Protoplasts , pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, pollen, embryos or portions thereof. Such regeneration techniques are generally described in Klee et al. (1987) Ann. Rev. of Plant Phys . 38: 467-486.
  • reporter or marker genes for selecting transformed cells or tissues or plant parts or plants may be included in the transformation vector or construct.
  • selection markers include dihydrofolate reductases that confer resistance to anti-metabolic agents such as herbicides or antibiotics, for example resistance to methotrexate (Reiss, Plant Physiol. (Life Sci. Adv. 13: 143-149, 1994; Herrera Estrella et al., Nature 303: 209-213, 1983; Meijer et al., Plant Mol. Biol. 16: 807-820, 1991); Neomycin phosphotransferases confer resistance to aminoglycoside neomycin, kanamycin and palomycin (Herrera-Estrella, EMBO J.
  • Mannose-6-phosphate isomerase (WO 94/20627), which allows cells to utilize mannose; Ornithine decarboxylase inhibitor, ornithine decarboxylase confers resistance to 2- (difluoromethyl) -DL-ornithine (DFMO) (McConlogue, 1987, In: Current Communications in Molecular Biology , Cold Spring Harbor Laboratory ed.]); And Aspergillus , which confers resistance to blasticidin S deaminase (documents from terreus): and a [Tamura, Biosci Biotechnol Biochem 59. .. 2336-2338, 1995]).
  • DFMO 2- (difluoromethyl) -DL-ornithine
  • Aspergillus which confers resistance to blasticidin S deaminase (documents from terreus): and a [Tamura, Biosci Biotechnol Biochem 59. .. 2336-2338, 1995]).
  • the present invention also provides an amino acid sequence consisting of 540 to 600 amino acids encoding the amino acid sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 or comprising the conserved sequence RED_N_Superfamily and RED_C_Superfamily at the N- and C-terminals, respectively.
  • a plant cell derived from a transformed plant, transformed with a recombinant vector comprising a CIPK1-Associating Nuclear Protein (CANP) gene encoding, and having enhanced photosynthetic efficiency and enhanced resistance to dry and salt stress.
  • the “transformed plant” includes not only mature plants and parts thereof, ie, leaves, stems, flowers, fruits and the like, but also plant cells constituting the plants or tissues.
  • the present invention also provides a method for producing a seed of a transformed plant having enhanced photosynthetic efficiency and enhanced resistance to dry and salt stress, comprising the following steps:
  • Seeds harvested from the selected transgenic plants may exhibit one or more phenotypes of salt resistance, drying resistance, and photosynthetic efficiency.
  • the CIPK1-Associating Nuclear Protein (CANP) gene has been found to be involved in the CBL1 / CBL9-CIPK1 calcium signaling mechanism, and the transgenic plants expressing this gene can improve photosynthetic efficiency and simultaneously resist dryness without the side effect of dwarfism. And flameproof phenotypes. Therefore, this CANP gene can be usefully used for the development of crops resistant to drought and salt.
  • CCP CIPK1-Associating Nuclear Protein
  • Figure 2 depicts the CANP full length cDNA sequence.
  • FIG. 3 is a diagram confirming that full-length CANP interacts with CIPK1 through a yeast two-hybrid assay.
  • FIG. 4 is a schematic diagram (A) of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA, and these vectors are expressed in onion (B), Arabidopsis (C), and tobacco (D).
  • Focal laser scanning shows the results of a complex of CANP and CIPK1 proteins.
  • FIG. 5 shows a schematic diagram (A) of the pGADT7.CANP and pBridge.CIPK1 / CBL1 (or CBL9) constructs, and an analysis result (B) of the yeast three-hybrid assay.
  • Figure 7 shows a schematic diagram (A) of the canp mutant line in which T-DNA is inserted into the CANP gene, the results of Genomic Southern blot assay (B), and RT-PCR analysis results (C).
  • FIG. 8 shows the complementation construct for the CANP gene. Schematic (A) and real-time RT-PCR analysis of the canp / CANP complementation plants with the introduction (B) is shown.
  • Figure 11 shows canp mutants and wild type responsiveness to drought stress.
  • Figure 12 shows a schematic diagram (A) of the plant transformation construct (pBI121 ⁇ GUS.CANP) for the production of Arabidopsis plants overexpressed CANP (A) and selection of the transformants via Real-time RT-PCR (B) .
  • Figure 13 shows the resistance of CANP overexpressing transformants to salt stress.
  • Figure 14 shows the resistance of CANP overexpression to drought stress.
  • 15 is a graph showing the increased photosynthetic efficiency of CANP overexpression compared to wild type.
  • Figure 17 shows the results of comparing the amino acid sequence of the Arabidopsis CANP (AtCANP) and tomato CANP (SlCANP).
  • FIG 18 shows the structure of tomato CANP overexpression vector (pATC940 vector).
  • FIG 19 shows the soil purification of tomato wild type (WT) and tomato CANP overexpressing transformants.
  • FIG. 21 shows the appearance of tomato wild type (WT) and CANP overexpression (SICANP OX-1 and SICANP OX-3) grown in soil for 7 weeks.
  • FIG. 22 is a graph showing increased photosynthetic efficiency of tomato CANP overexpression compared to wild type.
  • CANP CIPK1 -Associating Nuclear Protein (EGP) Genes, and Construction and Phenotypic Assay of Transgenic Arabidopsis Overexpressing Arabidopsis CANP Gene
  • YPD medium bacto yeast extract, bacto peptone, glucose
  • the grown cells were precipitated by centrifugation at 3,000 rpm for 5 minutes, the medium was removed, the remaining medium was washed with 20 ml of distilled water, and resuspended with 1 ml of distilled water. Cells were then transferred to a 1.5 ml tube and centrifuged at 13,200 rpm for 15 seconds to completely remove supernatant. 400 ⁇ l of 100 mM lithium acetate (pH7.5) was added to the remaining cells, and the cells were resuspended and incubated at 30 ° C. for 15 minutes.
  • the transformed yeast cells were streaking on SC-LW plate medium, grown at 30 ° C., and then ⁇ -galactosidase filter-lift assay was performed as follows.
  • First X-gal stock N, N-dimethylformide 5-bromo-4chloro-3-indolyl-
  • Z buffer 60 mM Na 2 HPO 4 H 2 O, 40 mM Na 2 HPO 4 , 10 mM KCl, 1 mM MgSO 4
  • 90 ⁇ l of ⁇ -D-galactosidae (20 mg / ml) is added, 4.86 ⁇ l of ⁇ -mercaptoethanol is mixed, and the solution is poured into a petri dish and placed on a 3MM paper soaked.
  • the cells were transferred to the membrane by placing a nitrocellulose filter (Osmonics Inc., NitroPure, 45 Micron, 82 mm) on the cell plate.
  • a nitrocellulose filter Osmonics Inc., NitroPure, 45 Micron, 82 mm
  • the membrane was placed in liquid nitrogen, the cells were frozen, taken out, and dissolved at room temperature. At this time, the part where the cell is always up. The melted membrane was superimposed on paper soaked in Z-buffer containing X-gal and incubated at 30 ° C. to observe blue color.
  • the coding region of CANP cDNA was amplified with CANP-1 and CANP-2 primers, and the PCR product was cloned into EcoRI and SalIsite of pGAD.GH vector.
  • the pGAD.CANP plasmid was digested with EcoR I and Sal I restriction enzymes, and an insert was inserted into the pGEX.4T-3 vector.
  • Col-0 genomic DNA was used as a template, and PCR was performed using CANP-PF and CANP-PR primers.
  • PCR products of 1,560bp size were digested with HindIII and BamHI and cloned into pBI101.1 vector with GUS gene to prepare pBI101.CANPp plasmid.
  • PCR was carried out using CANP-5 and CANP-6 primer sets to prepare pMDDI.CANP plasmids, and a CANP PCR product without stop codon was obtained and digested with Xba I and BamH I restriction enzymes. This was cloned into binary vector pMDDI (Siu et al., 1996) inserted with sGFP (S65T) to create a CANP-GFP construct.
  • PCR was performed using CANP-11 and CANP-6 primers using a CANP cDNA template, and the amplified PCR products were digested with XbaI and BamHI restriction enzymes. This PCR product was inserted into the pMDDI vector to create a CANPC-GFP construct with the N-terminus deleted.
  • pCAM35S.CBL9 and pCAM35S.CIPK1 CBL9 and CIPK1 cDNA were amplified using a template using CBL9-3 / CBL9-4 primer and CIPK1-14 / CIPK1-23 primer set.
  • the amplified PCR products were digested with Xba I and BamH I restriction enzymes and cloned into pCAM35S vector, respectively. 5,700bp of genomic DNA fragment, which combines 2,000bp from start codon and stop codon of CANP gene to 3,700bp of promoter region, was used to obtain the PCR product using CANPP-1 and CANP-17 primer sets.
  • the pCAM1300.CANPG plasmid was constructed as a result of insertion into the pCAM1300 vector, a plant transformation vector.
  • pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA constructs use the CANP-5 / CANP-10 and CIPK1-14 / CIPK1-23 primer sets as templates for the CANP and CIPK1 cDNA. And amplified using. Each of the obtained PCR products was digested with XbaI and BamHI restriction enzymes and cloned into pVYNE-c-myc and pMAS.SCYCE (R) -HA vectors.
  • CANP overexpression PCR products using CANP-5 and CANP-10 primer sets were digested with XbaI and BamHI restriction enzymes and cloned into pBI121 ⁇ GUS vector with CaMV 35S promoter.
  • PGADT7.CANP, pBridge.CIPK1, pBridge.CIPK1 / CBL1 and pBridge.CIPK1 / CBL9 were prepared to perform the yeast three hyrid.
  • pGADT7.CANP and pBridge.CIPK1 were amplified using CANP and CIPK1 cDNA as templates using CANP-12 / CANP-2 primers and CIPK1-15 / CIPK1-2 primer sets.
  • the amplified PCR products were digested with EcoR I and Sal I and cloned into pGADT7 and pBridge vectors, respectively.
  • pBridge.CIPK1 / CBL1 and pBridge.CIPK1 / CBL9 amplify CBL1 and CBL9 cDNAs with templates using CBL1-7 / CBL1-8 primers and CBL9-5 / CBL9-6 primer sets, and each PCR product is NotI. Digested with BglII and cloned into pBridge.CIPK1 plasmid. All constructs used were confirmed by DNA sequencing.
  • CANP-1 5'-TAA GAATTC AATGAAACCTTCAAAATCGC-3 '(SEQ ID NO: 25);
  • CANP-2 5'-GAT GTCGAC TCAATGCTT-GGATCTCTTA-3 '(SEQ ID NO: 26);
  • CANP-5 5'-TAA TCTAGA ATGAAACCTTCAAAATCGCA-3 '(SEQ ID NO: 27);
  • CANP-6 5'-TTT GGATCC ATGCTTGGATCTCTTAGGAG-3 '( SEQ ID NO: 28);
  • CANP-10 5'-TTT GGATCC TCAATGCTT-GGATCTCTTAG-3 '( SEQ ID NO: 29);
  • CANP-12 5 ⁇ -TAA GAATTC ATGAAACCTTCAAAATCGCA-3 ⁇ (SEQ ID NO: 31);
  • CANP-17 5′-TTT TCTAGA TCAATGCTTGG-ATCTCTTAG-3 ′ (SEQ ID NO: 32);
  • CANP-PR 5'-ATA GGATCC TAGATTTCGT-TAATTCGATT-3 '( SEQ ID NO: 35);
  • PMDDI.CANP construct was coated on a tungsten microcarrier (Bio-RAD, Tungsten M-17, 11.1micron) and inserted into onion cells using particle bambardment (Bio-RAD Laboratories).
  • plasmids were prepared at a concentration of 5 ⁇ g. And 3 mg of tungsten was resuspended by adding 1 ml of 100% ethanol and centrifuged at 10,000 rpm for 10 seconds. The supernatant was removed, washed twice with 1 ml of sterile water and then centrifuged to remove the supernatant and 30 ⁇ l of sterile water was added. 5 ⁇ g of CANP plasmid was added to tungsten and vortexed.
  • DNA was coated on tungsten by vortexing for 3 minutes while adding 50 ⁇ l of 2.5M CaCl 2 and 20 ⁇ l of 0.1m spermidine. Thereafter, the supernatant was removed by centrifugation at 10,000 rpm for 10 seconds, followed by washing with the addition of 250 ⁇ l of 100% ethanol, followed by centrifugation to remove the supernatant, and 60 ⁇ l of ethanol. After inserting the macrocarrier into the macrocarrier holder, the plasmid-coated tungsten was released by tapping and released, followed by dropping by 10 ⁇ l. The epidermal layer of onion was separated and prepared on MS medium. 1,100 psi rupture disk (Bio-RAD Laboratories) was used to bambard incubation at 23 °C for 16-24 hours.
  • 1,100 psi rupture disk Bio-RAD Laboratories
  • DAPI staining of the particle bambardment samples DAPI was made up to 5,000 fold stock at 10 mg / ml in DMSO. DAPI was diluted to 1 / 5,000 in running buffer (1X PBS buffer, 5 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.01% Tween-80) and soaked tissue in this buffer and incubated for 5 minutes. Thereafter, the buffer was removed and incubated with a buffer without DAPI three times for 5 minutes to wash the remaining DAPI.
  • running buffer (1X PBS buffer, 5 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.01% Tween-80
  • the leaves were obtained from 4 week-old Arabidopsis plants without peduncles, and cut into 0.5-1 mm thick. Cut the leaves immediately with Enzyme solution (20 mM MES, pH 5.7, containing 1.5% (w / v) cellulase R10, 0.4% (w / v) macerozyme R10, 0.4 M mannitol, 20 mM KCl, 10 mM CaCl 2 , 1 mM It was placed in a Petri dish containing ⁇ -mercaptoethanol and 0.1% BSA), wrapped in foil, and incubated with a desiccator for 30 minutes in vacuum, followed by 3 hours at room temperature.
  • Enzyme solution 20 mM MES, pH 5.7, containing 1.5% (w / v) cellulase R10, 0.4% (w / v) macerozyme R10, 0.4 M mannitol, 20 mM KCl, 10 mM CaCl 2 , 1
  • W5 solution 154 mM NaCl, 2 mM MES containing 125 mM CaCl 2 and 5 mM KCl, pH 5.7
  • the solution was filtered using nylon mesh to harvest protoplast. The supernatant was removed by centrifuging the solution at 200 g for 2 minutes, followed by MMG solution (0.4 M mannitol and 15 mM MgCl 2 Protoplast was resuspended to 1 ⁇ 10 6 / ml using 4 mM MES (pH 5.7)).
  • the cells were harvested to a concentration of 0.3, resuspended in infiltration buffer, infiltrated on the back of the leaves of tobacco (N.benthamiana and SR1), and observed 5 days later using a confocal laser scanning microscope (Leica TCS SP5, Microsystems). .
  • 1 ⁇ g of the construct was mixed with 50 ⁇ l of Agrobacterium tumefaciens (GV3101) competent cell and heat shock treated in a 37 ° C. water bath for 5 minutes and then 1 ml LB medium was added. After incubation at 28 ° C. for 3 hours, the cells were precipitated by centrifugation (Centrifuge 5415D, 16,100 g) for 30 seconds, 800 ⁇ l of LB medium was removed, and the cells were resuspended in the remaining LB medium.
  • LB solid medium containing 25 ⁇ g / ml gentamycin and 50 ⁇ g / ml kanamycin antibiotic was plated and incubated at 28 ° C. for 3 days.
  • Colony PCR was used to confirm whether the construct was inserted and inoculated in 200 ml of LB medium containing 25 ⁇ g / ml gentamycin and 50 ⁇ g / ml kanamycin antibiotics. The cells were grown overnight by shaking at 250 rpm at 28 ° C. The cells were collected by centrifugation (Centrifuge 5810R, 2129 g) for 10 minutes at room temperature and the medium was removed.
  • the plant was taken out, laid on a dry flat side, wrapped in a wrap, and placed at room temperature for 24 hours to prevent light. After that, the wraps were taken off and the plants were upright and grown in a 24 ° C growth chamber and the first three days were not watered. After receiving seeds from plants, the transformed plants were selected by growing them in selection medium.
  • Primer sets for PCR include CANP for CANP-RT5 (5 ⁇ -TCAGTTTACCAGTGGATTGTTAAGC-3 ⁇ ) (SEQ ID NO: 46) and CANP-RT3 (5 ⁇ -TCCCCGACGACCCAAGGCGAAGATA-3 ⁇ ) (SEQ ID NO: 47), and RD29A for RD29A-RT1 ( 5 ⁇ -CAACACACACCAGCAGCACCCAGAA-3 ⁇ ) (SEQ ID NO: 48) and RD29A-RT2 (CTTCAGGTTCTAGCTCGTCATCATC-3 ⁇ ) (SEQ ID NO: 49), RD29B is RD29B-RT1 (5 ⁇ -ACCAATCAGAATTCACCATCCAGAA-3 ⁇ ) (SEQ ID NO: 50) -RT2 (5 ⁇ GTTTCACCGTTACACC
  • actin2 a house-keeping gene, for which actin2-1 '(5 ⁇ -GAGATCACCGCTCTTGCACCTAGCA-3 ⁇ ) (SEQ ID NO: 54) and actin2-2 (5 ⁇ -TTCCTGTGAACAATCGATGGACCT-3 ⁇ ) (sequence) No. 55)
  • actin2-1 5 ⁇ -GAGATCACCGCTCTTGCACCTAGCA-3 ⁇
  • actin2-2 5 ⁇ -TTCCTGTGAACAATCGATGGACCT-3 ⁇
  • a primer set was used.
  • Total RNA was extracted from each organ using RNeasy Plant mini kit (Quiagen) and 40 mg per reaction was used as template. Basically, RNA was reverse transcribed at 50 ° C. for 30 minutes, and the resulting cDNA was denaturated at 95 ° C. for 20 minutes.
  • the PCR reactions were performed 35 cycles under the following conditions: denaturation 20 seconds at 94 ° C, annealing 20 seconds at 58 ° C, and extension 30 seconds at 72 ° C. Specificity of the amplified transcript was confirmed using the melting curve generated after the reaction, and the expression level of the gene was analyzed by using the Roter-Gene software in comparison with the control actin2.
  • Wild type (Col-0), CANP knockout mutant ( canp ), canp / CANP complementation, CANP overexpressing seeds were germinated in MS medium and transferred to MS medium containing 125 mM or 150 mM NaCl 4 days later, Root growth was observed. In addition, the susceptibility to salt was observed while growing in soil treated plants for 150 weeks or 150 mM or 300 mM NaCl.
  • the weight loss was determined by measuring the fresh weight with wild type (Col-0), knockout mutant ( canp ), and canp / CANP complementation.
  • Four sets of wild type (Col-0), knockout mutant ( canp ), and canp / CANP complementation were performed using 5 leaves of the same development period as 1 set. , 1, 2, 3, 4, 5, 6 hours) live weight was measured.
  • Photosynthesis ( ⁇ mol g ⁇ 1 s ⁇ 1 ) was measured using plants grown in soil for 5 weeks.
  • the whole plant Arabidopsis (WPA) chamber was directly connected to a portable photosynthetic meter (LI-6400XT) for carbon dioxide gas exchange analysis, and the photosynthetic efficiency of the entire plant was measured on a mass basis.
  • LI-6400-18 RGB red, green, blue
  • Measurement conditions maintain a constant carbon dioxide concentration (400 ⁇ mol mol -1 ), relative humidity (70%), air temperature (25 ° C) in the WPA chamber and artificial light at 0, 100, 200, 400, 500, 600, 800 ⁇ mol.
  • the amount of light of m -2 s - 1 was artificially investigated. Immediately after the measurement, rosettes of plants were taken and mass was measured to calculate photosynthetic efficiency.
  • CBL1 and CBL9 are involved in inducing plant stress responses by recognizing calcium signals produced by dry and high-salt stimuli and delivering them to CIPK1, a member of the CBL-Interacting Protein Kinase (CIPK) family. Doing. Little is known about how the CBL1 / CBL9-CIPK1 complex formed in the plasma membrane of plant cells sends signals into the nucleus to promote the expression of stress genes such as RD22 and RD29B.
  • the present inventors screened Arabidopsis cDNA libraries by the yeast protein hybrid method using yeast protein hybrid method using CIPK1 as bait to find proteins that perform this function, and found proteins that interact with CIPK1.
  • CANP CIPK1-associated nuclear protein
  • CANP clones isolated by yeast protein hybridization were not full-length cDNA. Therefore, the full-length CANP cDNA was PCR amplified using a CANP-1 forward primer and a CANP-2 reverse primer set and cloned into the pGBT.BS vector. As a result of determining and analyzing the nucleotide sequence of the full-length cDNA clone, it was confirmed that the CANP full-length cDNA has an open reading frame of 1,758 bp as shown in FIG. 2.
  • yeast two-hybrid assay to determine whether CAMP interacts with CIPK1.
  • 3 is a diagram confirming that full-length CANP interacts with CIPK1 through a yeast two-hybrid assay.
  • the first panel on the left of FIG. 3 shows the arrangement of Y190 yeast cells carrying the pGBT and pGAD plasmids.
  • the second and third panels show the growth of yeast in synthetic medium lacking Leu and Trp (SC-LT) in complete medium, synthetic medium lacking His, Leu, Trp (SC-HLW) in complete medium.
  • the final panel shows the results of a filter-lift assay showing ⁇ -galactosidase activity.
  • pGBT.CANP cloned with CANP at the binding domain (BD) of the Gal4 transcription factor showed autoactivation activity.
  • FIG. 4A Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA
  • FIG. 4B Schematic diagram of
  • a yeast three-hybrid assay was performed to determine how CIPK1-CANP complex is affected by CBL1 or CBL9, another interacting protein of CIPK1.
  • CBL1 or CBL9 another interacting protein of CIPK1.
  • CIPK1 and CBL1 were cloned into the pBridge vector, and CANP was inserted into the pGADT7 vector.
  • 5 (A) shows a schematic of the pGADT7.CANP and pBridge.CIPK1 / CBL1 (or CBL9) constructs.
  • a bridge vector expressing both pGADT7.CANP and BD-fusion CIPK1 and CBL1 (or CBL9) expressing AD-fusion CANP was used as the third protein.
  • Transformed yeast cultures were diluted at 600 nm in 0.2 absorbance units and on SD / -Met / -Leu / -Trp medium (-MLW) for testing for double transformation (left figure in FIG. 5 (B)).
  • -MLW SD / -Met / -Leu / -Trp medium
  • Protein interactions were spotted on SD / Met / -His / -Leu / -Trp medium (-MHLW) (right plot of FIG. 5 (B)).
  • yeast cells expressing only BD-CIPK1 and AD-CANP grow in SC-MLWH medium, whereas three proteins (BD-CIPK1, AD-CANP, and CBL1 (or CBL9)) Simultaneously expressing yeast cells hardly grew in SC-MLWH medium.
  • CBL1 or CBL9 interacts with CIPK1, thereby preventing CIPK1 from interacting with CANP.
  • CANP-GFP is present in the cytoplasm mainly in the absence of calcium (Fig. 6 (A)), and when processed to move to the nucleus position (Fig. 6 (B)) You can see that. This is because CANP usually forms a complex with CIPK1 in the cytoplasm, but when a calcium signal is generated by drought or salt damage, CBL1 / CBL9 protein, which recognizes it, interacts with CIPK1 in the plasma membrane and in this process CANP is separated from CIPK1. It means getting into the nucleus with me.
  • Example 6 CANP T-DNA knock-out mutation ( canp Separation and complementation line production
  • the T-DNA tagging line of SALK was examined to obtain a canp mutant line in which T-DNA was inserted into the CANP gene (FIG. 7A).
  • a genomic southern blot assay was performed using a probe of the kanamycin resistance gene NPTII gene. As a result, it was confirmed that 1 copy of T-DNA exists.
  • Genomic Sounthern blot assay was performed once again using full-length CANP cDNA probe to confirm that the canp mutant was homozygous line (FIG. 7B).
  • RT-PCR was performed to confirm that the CANP gene expression was completely disappeared from the canp mutant (FIG. 7C).
  • FIG. 8A Cloning a 5,700 bp genomic DNA fragment of 2,000 bp from the start codon and the stop codon of the CANP gene to 3,700 bp of the promoter region was cloned into the plant transformation vector pCAM1300. It was. Complementation by introducing the construct into the floral dipping method canp mutant was prepared canp / CANP complementation plants.
  • Arabidopsis canp mutants showed a morphological phenotype that grew to a somewhat smaller size than the wild type (Col-0). In addition, the canp mutant was more sensitive than the wild type to high salinity and drought stress. Responsiveness to high salinity stress was investigated in two ways. First, the seeds of wild-type and canp mutants were sown in 1/2 MS medium for 4 days, and seedlings were transferred to 1/2 MS medium containing 0 mM, 110 mM, 125 mM, and 150 mM NaCl, respectively. It was.
  • canp mutants were significantly more sensitive to salt than wild type. Root growth of canp mutants was inhibited at 110 mM NaCl and bleaching was observed in the leaves. On the other hand, since the phenotype is recovered in the complementation line, the salt susceptibility of the canp mutant may be attributed to the loss of normal CANP gene expression.
  • the sensitivity test for drought was performed as follows. After 14 days of drought treatment for plants grown in soil for 4 weeks, the survival rate was confirmed through a recovery period of watering for 4 days. As a result, it was confirmed that the canp mutant was more susceptible to drought than the wild type, thereby reducing the survival rate by about three times (FIG. 11A). In addition, the moisture loss of the plant was measured by measuring fresh weight, and the canp mutant lost about 17% more water than the wild type (FIG. 14C). In the Complementation line, these phenotypes recovered as wildtypes.
  • the canp mutant that does not express the CANP protein is slightly smaller in size and less resistant to salt and drought stress than the wild type. This suggests that transformants overexpressing CANP may, on the contrary, exhibit improved resistance to the stress. Therefore, we constructed a CANP overexpressing Arabidopsis transformant to investigate the stress resistance.
  • a plant transformation construct (pBI121 ⁇ GUS.CANP) was first constructed to express CANP by a CaMV 35S promoter (FIG. 12A). The construct was introduced into Arabidopsis (Col-0) by the floral dipping method to produce a transformant. CANP overexpressing transgenic individuals (CANP OX-4 and OX-9) were identified via real-time RT-PCR and homozygous lines were selected (FIG. 12B). Using the selected transformants, the stress response was investigated in the same manner as the canp mutant phenotype investigation. Firstly, CANP overexpressing transformants showed greater resistance than wild type (Col-0) when treated with salt (125 mM, 300 mM NaCl) (FIG. 13).
  • CANP overexpression showed significantly increased resistance to drought stress than wild type (Col-0).
  • the survival rates of Col-0, CANP OX-4, and CANP OX-9 plants were 3%, 47%, and 72%, respectively.
  • the CANP overexpression showed about 15 to 24 times higher survival rate than wild type. This confirmed that CANP overexpression showed much higher resistance to salt and drought stress than wild type.
  • the mature CANP overexpression was slightly larger than the wild-type Arabidopsis (Col-0). Therefore, photosynthetic efficiency was measured. From PAR 100 ⁇ mol m -2 s -1 , it can be seen that the photosynthetic efficiency of CANP overexpression is increased by about 20% compared to wild type (FIG. 15).
  • CANP As a result of searching the GenBank database, as can be seen in Figure 16, it can be seen that genes that are very similar to Arabidopsis CANP exist in almost all plants. This evolutionary conservation means that CANP performs similar functions in other plants as in the Arabidopsis. Thus, CANP pseudogenes in other plants could be used to develop plants that are resistant to salt and drought and have increased photosynthetic efficiency.
  • SlCANP full length cDNA was amplified using SDCANP-1 (ATAACTAGTATGTCTTCTTCAAAGCGAAA) (SEQ ID NO: 56) and SlCANP-2 (TTTGAGCTCTCATACACGCTGCTTCTTTC) (SEQ ID NO: 57) primer set using cDNA prepared from tomato (Solanum lycopersicum) leaves as a template Cloned into pBS vector.
  • SICANP full-length cDNA designates 558 amino acids with an open reading frame of 1,677 bp as expected.
  • Fig. 17 when comparing the amino acid sequence of the Arabidopsis CANP and confirmed that it has 63.4% homology once again (Fig. 17).
  • Tomato was used as Moneymaker variety (Solanum lycopersicum L cv. Moneymaker). Seeds were sterilized for 3 minutes in 70% EtOH and 7 minutes in 50% bleach, and then rinsed 5 times with tertiary distilled water and placed on germination medium. 9-12 days after cutting, the cotyledons of the tomatoes were cut out and soaked in the preculture medium, and then cultured for 2 days at 25 ° C.
  • a plant transformation construct (pATC940 vector) was constructed to express CANP by a super promoter for CANP overexpression (FIG. 18).
  • Agrobacterium (Strain: LBA4404) containing this plasmid was inoculated and grown in LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin the day before coculture. On the day of co-culture, the strains were collected by centrifugation, and then released in liquid MS-0.2% liquid medium containing 200 uM acetosyringone to adjust the OD 600nm to 0.4. The tailored strain was incubated at 100 rpm for 1 hour at 28 ° C. and used as co-culture material.
  • the cotyledon sections were dried on a filter paper and placed on co-cultured medium and then cultured for 2 days at 28 ° C.
  • Cocultured cotyledon sections were placed in distilled water with cefotaxime and stirred to remove uninoculated bacteria and residual Agrobacterium. Thereafter, the cells were re-differentiated and pickled on selective medium and grown at 28 ° C. Subsequently, it was incubated with fresh selection medium at 15 days intervals and grown for a total of 8 weeks.
  • the shoots from callus induced from the cotyledons during regeneration were transferred to shoot kidney medium and healed and incubated at 28 ° C. for 14 days.
  • Cultured shoots were transferred to rooting medium to induce roots from shoots. After the roots were induced, the roots were transferred to the rooting medium once more to induce the growth of the roots and then transferred to the soil for purification (FIG. 19).
  • the amount of SlCANP gene expression of four transformants obtained by using the transformation process was investigated. As a result of confirming the expression level of SlCANP mRNA by real-time RT-PCR, it was found that the transformant overexpressed SlCAN from 7 to 19 times as compared to tomato wild type (WT) (FIG. 20).
  • Photosynthesis ( ⁇ mol g ⁇ 1 s ⁇ 1 ) measurements were performed using individuals 1 and 3 with high expression in tomato wild type (WT) and CANP overexpression grown in soil for 7 weeks (FIG. 21).
  • a photosynthetic meter (LI-6400XT) was connected directly to the chamber for carbon dioxide gas exchange analysis to measure photosynthetic efficiency of the entire plant. Maintain constant carbon dioxide concentration (400 ⁇ mol mol -1 ), relative humidity (65%), air temperature (25 °C) in the chamber and the artificial light is 0, 100, 200, 400, 500, 600, 800 ⁇ mol m -2 s The amount of light of -1 was artificially investigated. As a result, from PAR 400 ⁇ mol m2s1, tomato CANP overexpression No.
  • Self-pollination was performed to harvest seeds from tomato transformants possessing the above characteristics. Seeds were collected from tomato fruit produced as a result of self-pollination, and real-time RT-PCR confirmed that the SlCANP gene was stably integrated in the tomato genome and expressed from tomato individuals obtained by re-sprinkling the seed.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 왜소증 없이, 식물의 광합성 효율 증진과 건조 및 염해 스트레스에 대한 식물의 저항성을 유도하는 유전자를 포함하는 발현벡터, 이에 의해 형질전환된 형질전환 식물, 및 상기 유전자를 이용한 식물의 광합성 효율 증진 및, 건조 및 염해 스트레스에 대한 식물의 저항성 유도 방법에 관한 것이다. 본 발명에 따른 CANP(CIPK1-Associating Nuclear Protein) 유전자는 CBL1/CBL9-CIPK1 칼슘신호전달 기작에 관여하는 것으로 밝혀졌으며, 이 유전자를 과발현하는 형질전환 식물체는 왜소증의 부작용 없이 식물의 광합성 효율 증진과 동시에 내건성 및 내염성 표현형을 나타내는 것으로 확인되었다. 따라서 이러한 CANP 유전자는 가뭄 및 염해에 내성을 가지는 작물의 개발을 위해 유용하게 이용될 수 있다.

Description

식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법
본 발명은 왜소증 없이, 식물의 광합성 효율을 증진하고 건조 및 염해 스트레스에 대한 식물의 저항성을 유도하는 유전자를 포함하는 발현벡터, 이에 의해 형질전환된 형질전환 식물, 및 상기 유전자를 이용한 식물의 광합성 효율 증진 및 건조 및 염해 스트레스에 대한 식물의 저항성 유도 방법에 관한 것이다.
세계적으로 농작물 생산량 증대를 위한 과도한 비료 사용으로 토질의 문제가 심각한 상황이다. 이것은 농경지의 염류화작용(salinization)을 유도하여 작물의 염해에 대한 피해가 증가하고 있으며, 그밖에 염해의 피해인 해수면 상승으로 농경지 피해가 매년 약 500,000 헥타르씩 증가하고 있어 염해 피해 해결이 시급한 상황이다. 따라서, 최근에는 염해에 저항성이 있는 작물의 개발이 염해에 피해를 입은 토양에서의 작물생산에 가장 효과적인 전략으로 제안되고 있다.
가뭄 역시 농작물 생산에 큰 영향을 미치고 있다. 전 세계적으로 농작물이 가뭄에 영향을 받은 지역은 팔머 가뭄지수 (Palmer Drought Severity Index, PDSI)에 따르면 1960년 이래로 약 15~25%가 증가하였으며, 현재 가뭄에 의한 생산량 감소율의 경우 벼는 5.82%, 옥수수는 11.98% 감소하였고, 2050까지 작물생산량이 50%이상 감소할 것으로 예상하고 있다.
한편, 애기장대 모델식물에서 최초로 밝혀진 CBL-CIPK 칼슘신호전달 네트워크는 가뭄, 고염도, 저온 등과 같은 다양한 비생물적 환경스트레스 반응에 매우 중요한 역할을 수행하고 있는 것으로 알려져 있다. 애기장대에는 10개의 CBL과 26개의 CIPK 유전자들이 존재하며, 흥미롭게도 벼, 밀, 콩, 옥수수 등의 주요작물을 포함하는 거의 모든 식물에서 애기장대의 CBL 및 CIPK 패밀리와 매우 유사한 유전자가 발견되고 있다. 따라서 모델식물인 애기장대에서 얻어진 CBL-CIPK관련 내재해성 정보는 다른 작물에도 유사하게 적용할 수 있을 것으로 판단된다.
현재까지 보고된 바에 의하면 칼슘센서인 CBL은 세린/트레오닌 단백질 키나아제인 CIPK와 세포질, 원형질막, 또는 액포막 등에서 복합체를 형성한다. 핵 밖에서 형성되는 CBL-CIPK 복합체가 어떠한 작용기작을 통해 핵 안으로 신호를 전달하여 스트레스 유전자의 발현을 조절하는 가에 대해서는 알려진 바가 없었다.
본 발명은 왜소증 없이, 식물의 광합성 효율 증진과 건조 및 염해 스트레스에 대한 식물의 저항성을 유도하는 유전자를 포함하는 발현벡터, 이에 의해 형질전환된 형질전환식물 및 이의 제조방법, 상기 형질전환식물의 종자 및 이의 제조방법, 상기 형질전환 식물로부터 유래되는 식물 세포, 상기 유전자를 이용한 식물의 광합성 효율 증진 및 건조 및 염해 스트레스에 대한 식물의 저항성 유도 방법을 제공하고자 한다.
본 발명자들은 가뭄, 염해 등의 환경재해에 대한 식물 반응에 중요한 역할을 수행하고 있는 것으로 알려져 있는 애기장대 CBL1/CBL9-CIPK1 칼슘신호전달경로에 대해 지속적으로 연구를 수행해왔다. 세포의 원형질막에서 형성되는 CBL1/CBL9-CIPK1 복합체가 어떻게 핵 안으로 신호를 전달하여 스트레스 유전자의 발현을 조절하는가에 대해서는 알려진 바가 없었기 때문에, 본 발명자들은 yeast two-hydrid screening 방법으로 CIPK1과 상호작용하는 단백질을 분리하고자 하였으며, 그 결과, 가뭄 및 염해 반응에 관여하는 유전자를 동정하고, 이를 CIPK1-Associating Nuclear Protein (CANP)라고 명명한 후, 그 작용기작을 규명하였다.
연구 결과, 평상시 CANP는 세포질에서 CIPK1과 복합체를 형성하고 있지만, 가뭄 또는 염해 등에 의해 칼슘신호가 생성되면 이를 인식한 CBL1/CBL9 단백질이 CIPK1과 상호작용을 하게 되고 이 과정에서 CANP가 CIPK1으로부터 떨어져 나와 핵 안으로 들어가게 된다. 핵 안으로 들어간 CANP는 bZIP transcription factor인 AREB/ABF와 상호작용하여 ABRE cis-acting element를 가지는 스트레스 유전자의 프로모터 활성을 높여 내건성 및 내염성을 증가시킨다. 뿐만 아니라, 상기 유전자의 과발현은 왜소증 없이 식물의 광합성 효율 증가를 나타내는 것으로 확인되었다.
따라서, 본 발명은 왜소증 없이, 식물의 광합성 효율 증진과 건조 및 염해 스트레스에 대한 식물의 저항성을 유도하는 유전자 CANP(CIPK1-Associating Nuclear Protein)를 포함하는 발현벡터, 이에 의해 형질전환된 형질전환 식물, 및 상기 유전자를 이용한 식물의 광합성 효율 증진과 건조 및 염해 스트레스에 대한 식물의 저항성 유도 방법을 제공한다.
한 구체예에서, 본 발명은 왜소증 없이 식물의 광합성 효율 증진과 건조 및 염해 스트레스에 대한 식물의 저항성을 유도하는 유전자 CANP(CIPK1-Associating Nuclear Protein )를 포함하는 형질전환식물 제조용 재조합 벡터를 제공한다.
보다 구체적으로, 본 발명은 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물 제조용 재조합 벡터를 제공한다.
본 발명에 있어서, CANP(CIPK1-Associating Nuclear Protein) 유전자라 함은 본 발명에서 CBL1/CBL9-CIPK1 칼슘신호전달경로의 연구를 위해 사용된 애기장대 및 토마토 유래의 CANP를 비롯하여, 이와 상동성을 갖는 다양한 식물 유래의 CANP를 모두 포함하는 개념이다.
본 발명의 한 구체예에서, CANP(CIPK1-Associating Nuclear Protein) 유전자는 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 대부분의 식물에서 나타나는 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 유전자이다.
여기에서, 서열번호 1 내지 서열번호 13의 아미노산 서열은 각각 애기장대(서열번호 1, NCBI No. NP_180214), 쌀(서열번호 2, NCBI No. EEC67667), 옥수수(서열번호 3, NCBI No. NP_001105988), 콩(서열번호 4, NCBI No. XP_003533803), 감자(서열번호 5, NCBI No. XP_006344564), 조(서열번호 6, NCBI No. XP_004978650), 토마토(서열번호 7, NCBI No. (서열번호 7, NCBI No. XP_004242897), 오이(서열번호 8, NCBI No. XP_004136540), 포도(서열번호 9, NCBI No. XP_002274576), 딸기(서열번호 10, NCBI No. XP_004287674), 오렌지(서열번호 11, NCBI No. KDO73769), 복숭아(서열번호 12, NCBI No. XP_007204321), 카카오(서열번호 13, NCBI No. XP_007012533) 유래의 아미노산 서열이다.
한편, 애기장대의 CANP 유전자는 인간의 RED 또는 뮤린 MuRED 유전자와 상동성이 높은 서열을 갖고 있는 것으로 보고된 바 있다(E. Assier et al., Gene 230(1999) 145-154). 상기 보고에서 애기장대의 CANP 유전자는 기능이 밝혀지지 않은 단백질로서 RED 유전자와의 상동성이 높은 “RED-like protein N-terminal region“과 “RED-like protein C-terminal region“을 보유하고 있는 것으로 밝혀졌다. “RED-like protein N-terminal region”의 위치는 서열번호 1의 아미노산 서열 중 5번부터 214번, “RED-like protein C-terminal region“의 위치는 서열번호 1의 아미노산 서열 중 461번부터 585번에 존재한다.
본 발명자들의 연구 결과, 애기장대에서 나타난 “RED-like protein N-terminal region“과 “RED-like protein C-terminal region“은 대부분의 식물에서 대부분의 식물에서 진화적으로 보존되어 있는 보존 서열로서, 본 발명에서 지칭하고 있는 CANP(CIPK1-Associating Nuclear Protein) 유전자의 N 말단 및 C 말단에 포함되어 있는 것으로 나타났다. 본 발명에서, 이러한 보존 서열은 각각 RED_N_Superfamily 및 RED_C_Superfamily로 지칭한다. 서열번호 1 내지 13의 아미노산 서열의 얼라인먼트 결과를 보여주는 도 16으로부터, 상기 보존 서열 RED_N_Superfamily 및 RED_C_Superfamily가 대부분의 주요 작물의 CANP 내에 공통적으로 존재함을 확인할 수 있다. CANP 유전자를 코딩하는 아미노산 서열은 이에 제한되는 것은 아니나, 540 내지 600개의 아미노산으로 고정적이다. 이는 CANP 유전자에 의해 코딩되는 아미노산 서열이 보존 서열 RED_N_Superfamily 및 RED_C_Superfamily 외에도 서열 내에 커다란 변동이 없으며, 서열 상동성이 매우 높다는 사실을 나타낸다. 따라서, 본 발명의 CANP 유전자로는 구체 서열로서 제시된 서열번호 1 내지 13의 아미노산 서열을 코딩하는 유전자뿐만 아니라 이와 서열상동성이 높은 유사 유전자, 즉 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 유전자가 포함된다.
본 명세서 내에서 정의되는 RED_N_Superfamily 및 RED_C_Superfamily는 도 16에 나타낸 바와 같이, 각각 7개, 4개의 보존 서열 블록을 포함할 수 있다. 이들 보존 서열 블록은 RED_N_Superfamily 또는 RED_N_Superfamily에 속하는 서열 중 보존도가 가장 높은 구역을 임의로 블록으로 표현한 것으로, 본 명세서 내에서 정의되는 RED_N_Superfamily 또는 RED_N_Superfamily가 반드시 이에 제한되는 것은 아니다. 하기 블록에서 Xn으로 표시되는 아미노산은 n번째 위치에 존재하는 임의의 아미노산을 의미하며, Xn 이 어떠한 아미노산인지는 아래에서 별도로 표시한다. 이들 서열은 첨부된 서열목록에서는 임의의 아미노산을 나타내는 Xaa로 공통적으로 표시되며, 서열의 구체적인 설명에서 위치에 따른 아미노산의 종류를 기재하게 된다.
RED_N_Superfamily 블록 A
서열번호 14: PKYRDRAKX9X10X11ENQNPX17YD
X9= E 또는 D
X10= D 또는 E
X11= Q 또는 K
X17= E 또는 D
RED_N_Superfamily 블록 B
서열번호 15: FHAVAPPG
RED_N_Superfamily 블록 C
서열번호 16: KISIEX6SKYLGGDVEHTHLVKGLDYALLX29KVRSEIX36KKP
X6= K, N 또는 H
X29= N, H, 또는 T
X36= D, E, 또는 V
RED_N_Superfamily 블록 D
서열번호 17: AKSVYX6X7WX9VKPQ
X6= Q 또는 K
X7= W 또는 C
X9= V 또는 I
RED_N_Superfamily 블록 E
서열번호 18: KX6NEX5FLPGRX11X12FVY
X2= S, T 또는 E
X5= M, T 또는 L
X11= M, T 또는 L
X12= T, A 또는 S
RED_N_Superfamily 블록 F
서열번호 19: DIPX4TLX7RSKADC
X4= T 또는 M
X7= H 또는 Y
RED_N_Superfamily 블록 G
서열번호 20: MSYLRLGSS
RED_C_Superfamily 블록 H
서열번호 21: YSECYPGYQEYN
RED_C_Superfamily 블록 I
서열번호 22: DLSKMDMGGKAKGX14LHRWDFX27TEEEWE
X14= R 또는 G
X27= A 또는 E
RED_C_Superfamily 블록 J
서열번호 23: QKEAMPKAAFQFGVKMQDGRKTRKQNRD
RED_C_Superfamily 블록 K
서열번호 24: QKLX4NX6LX8X9INKILX15RKK
X4= N, T, 또는 S
X6= E 또는 D
X8= H 또는 N
X9= K, Q 또는 R
X15= A 또는 T
상기 CANP 유전자를 포함하는 재조합 벡터는 식물의 형질전환에 사용되는 공지의 발현 벡터에 상기 유전자가 삽입되어 제조된 것이다. 본 발명에서, "벡터 (vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자, 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드 (plasmid)" 및 "벡터 (vector)"는 때로 상호 교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 것이 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수백 개의 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록 하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 리포터 유전자, 및 (c) 외래 DNA 절편이 삽입될 수 있는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation)할 수 있다.
본 명세서에서, "형질전환"은 식물의 숙주세포 내에 도입하고자 하는 이종 유전자를 코딩하는 핵산 또는 상기 핵산을 포함하는 벡터를 숙주세포 내로 도입하고 통합시켜, 유전적으로 안정한 유전을 생성시키는 것을 지칭하며, “형질전환식물”은 상기 이종 유전자가 도입 및 유전적으로 안정하게 통합되어 원하는 표현형을 얻게 된 식물을 의미한다.
형질전환식물을 생산하는 것과 관련하여, 식물의 유전공학 방법은 관련 기술분야에 널리 공지되어 있다. 예를 들어, 쌍떡잎 식물 뿐만 아니라 외떡잎 식물에 대한 생물학적 및 생리적 형질전환 프로토콜을 포함한, 식물 형질전환을 위한 수많은 방법이 개발되어 왔다 (예를 들어, 문헌 [Goto-Fumiyuki et al., Nature Biotech 17:282-286 (1999)]; [Miki et al., Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 67-88 (1993)]). 또한, 식물 세포 또는 조직 형질전환, 및 식물의 재생을 위한 벡터 및 시험관내 배양 방법은, 예를 들어 다음 문헌에서 이용 가능하다 [Gruber et al., Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 89-119 (1993)].
예를 들어, 원하는 유전자를 식물 숙주세포 내로 형질전환시키기 위한 다수의 기술이 이용 가능하다. 이들 기술은 형질전환 작용제로서 아그로박테리움 투메파시엔스 또는 아그로박테리움 리조게네스를 사용하여 비-아암 T-DNA로 형질전환시키는 것, 인산칼슘 형질감염, 폴리브렌 형질전환, 원형질체 융합, 전기천공, 초음파 방법 (예를 들어, 소노포레이션), 리포솜 형질전환, 미세주사, 있는 그대로의 DNA, 플라스미드 벡터, 바이러스성 벡터, 바이오리스틱스 (극미립자 충격), 탄화규소 WHISKERS 매개된 형질전환, 에어로솔 비밍, 또는 PEG 형질전환뿐만 아니라 다른 가능한 방법을 포함한다.
본 발명은 또한 상기 CANP 유전자를 포함하는 재조합 벡터를 포함하는 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물 제조용 조성물을 제공한다. 상기 형질전환 식물 제조용 조성물은 본 발명에 따른 CANP 유전자를 포함하는 재조합 벡터 외에, 재조합 벡터를 숙주세포에 전달해 주기 위한 담체, 혹은 형질전환시에 필요한 배지나 버퍼 등의 성분을 추가로 포함할 수 있다.
본 발명은 또한 상기 CANP 유전자를 포함하는 재조합 벡터로 숙주세포를 형질전환함으로써 숙주세포 내 CANP 유전자를 과발현시키는 것을 포함하는 왜소증 없이 식물의 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물의 제조방법을 제공한다.
앞서 설명한 바와 같이, 상기 CANP 유전자를 포함하는 재조합 벡터를 이용하여 통상의 방법을 통해 숙주세포를 형질전환시킬 수 있다. 본 발명에 따른 숙주세포는 가뭄 및 염해에 대한 내성 증가와 광합성효율 향상을 부여하고자 하는 식물의 세포로서 그 종류는 제한되지 않는다.
본 발명은 또한 상기 CANP 유전자를 포함하는 재조합 벡터로 형질전환된, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물 및 이의 종자를 제공한다. 이에 제한되는 것은 아니나, 예를 들어, 가뭄 및 염해에 대한 내성 증가와 광합성효율 향상을 부여하고자 하는 식물로는 애기장대, 쌀, 옥수수, 콩, 감자, 조, 토마토, 오이, 포도, 딸기, 오렌지, 복숭아 또는 카카오 등이 포함된다.
식물 세포 내로의 이종의 외래 DNA의 도입 후, 상기 식물 게놈 내의 이종 유전자의 형질전환이나 통합은 이와 관련한 핵산, 단백질 또는 대사물의 분석과 같은 다양한 방법들로 확인된다.
예를 들어, PCR 분석은 토양 내로의 이식 전에 조기 단계에서 포함된 유전자의 존재에 대해 형질전환된 세포들, 조직 또는 슈트들을 스크리닝하는 신속한 방법이다(Sambrook 및 Russell의 "Molecular Cloning： A Laboratory Manual"(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001)). PCR은 관심의 대상인 유전자 또는 아그로박테리움 벡터 등에 특이적인 올리고뉴클레오티드(oligonucleotide) 프라이머들을 이용하여 수행된다.
또한, 식물 형질전환은 게놈 DNA의 서던 블롯(Southern blot) 분석에 의해 확인될 수 있다. 일반적으로, 형질 전환체(transformant)로부터 전체 DNA를 추출하고, 적절한 제한 효소들(restriction enzymes)로 소화되며, 아가로즈 겔(agarose gel) 내에서 분별되고 니트로셀룰로오스(nitrocellulose) 또는 나일론(nylon) 멤브레인으로 이송된다. 상기 멤브레인 또는 "블롯(blot)"은 이후에 표준 기술들에 따라 상기 식물 게놈 내의 도입된 유전자의 통합을 확인하도록, 예를 들면, 방사성 원소 표시된 32P 표적 DNA 조각으로 조사될 수 있다(앞서 언급한 Sambrook 및 Russell(2001)).
노던(Northern) 분석에 있어서, RNA는 형질 전환체의 특정 조직으로부터 분리되고, 포름알데히드(formaldehyde) 아가로스 겔 내에서 분별되며, 해당 기술 분야에서 일상적으로 이용되는 표준 순서들에 따라 나일론 필터 상에 블롯된다(앞서 언급한 Sambrook 및 Russell(2001)). 본 발명의 뉴클레오티드 서열들에 의해 인코드되는 RNA의 발현은 이후에 상기 필터를 해당 기술 분야에서 알려진 방법들에 의해 GDC로부터 유래되는 방사성 프로브에 교잡시킴에 의해 테스트된다(앞서 언급한 Sambrook 및 Russell(2001)).
웨스턴 블롯(Western blot), ELISA, 측면 유동(lateral flow) 시험 및 생화학적 분석들과 유사한 것들이 상기 제초제 내성 단백질 상에 존재하는 하나 또는 그 이상의 에피토프들(epitopes)에 결합되는 항체들을 이용하여 표준 순서들에 의해 상기 제초제 내성 유전자로 인코드된 단백질의 존재를 판단하도록 상기 형질전환 식물들에 대해 수행될 수 있다.
상기 유전적 구조물을 식물 세포 내로 도입한 후, 식물 세포는 성장할 수 있고, 싹 및 뿌리와 같은 분화성 조직의 출아시 성숙한 식물이 생성될 수 있다. 일부 실시양태에서, 복수 개의 식물이 생성될 수 있다. 식물을 재생시키기 위한 방법론은 통상의 기술자에게 공지되어 있고, 이는 예를 들어, 문헌 [Plant Cell and Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer Academic Publishers] 및 [Plant Cell Culture Protocols (Methods in Molecular Biology 111, 1999 Hall Eds Humana Press)]에서 발견될 수 있다. 본원에 기재된 유전적으로 변형된 식물은 발효 배지에서 배양하거나 또는 토양과 같은 적합한 배지에서 성장시킬 수 있다. 일부 실시양태에서, 고등 식물에 적합한 성장 배지는 모든 식물용 성장 배지를 포함할 수 있는데, 이는 토양, 모래, 뿌리 성장을 지지해주는 다른 모든 미립자 배지 (예를 들어, 질석, 펄라이트 등) 또는 수경 재배 뿐만 아니라 적합한 빛, 물, 및 고등 식물의 성장을 최적화시켜 주는 영양 보충제를 포함하지만, 이에 제한되지 않는다.
상기 형질전환 기술 중 어느 것에 의해 생성되는 형질전환된 식물 세포를 배양하여, 형질전환된 유전자형을 보유하여 목적하는 표현형을 갖는 완전 식물을 재생시킬 수 있다. 이러한 재생 기술은 조직 배양 성장 배지 중의 특정 식물 호르몬의 조작에 좌우되는데, 전형적으로 이는 목적하는 뉴클레오티드 서열과 함께 도입시킨 살생물제 및/또는 제초제 마커에 좌우된다. 배양된 원형질체로부터의 식물 재생은 문헌 [Evans, et al., "Protoplasts Isolation and Culture" in Handbook of Plant Cell Culture, pp. 124-176, Macmillian Publishing Company, New York, 1983]; 및 [Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985]에 기재되어 있다. 재생은 또한, 식물 캘러스, 외식편, 기관, 화분, 배아 또는 그의 일부로부터 수득할 수 있다. 이러한 재생 기술은 일반적으로, 문헌 [Klee et al. (1987) Ann. Rev. of Plant Phys. 38:467-486]에 기재되어 있다.
형질전환된 세포 또는 조직 또는 식물 부분 또는 식물을 선택하기 위한 리포터 또는 마커 유전자의 사용이 형질전환 벡터 또는 구조물에 포함될 수 있다는 것을 통상의 기술자는 인지할 것이다. 선택 마커의 예는 항대사제, 예컨대 제초제 또는 항생제에 대한 저항성을 부여해주는 것, 예를 들어 메토트렉세이트에 대한 저항성을 부여해주는 디히드로폴레이트 환원효소 (문헌 [Reiss, Plant Physiol. (Life Sci. Adv.) 13:143-149, 1994]; [Herrera Estrella et al., Nature 303:209-213, 1983]; [Meijer et al., Plant Mol. Biol. 16:807-820, 1991] 참조); 아미노글리코시드 네오마이신, 카나마이신 및 파로마이신에 대한 저항성을 부여해주는 네오마이신 포스포트랜스퍼라제 (문헌 [Herrera-Estrella, EMBO J. 2:987-995, 1983] 및 [Fraley et al. Proc. Natl. Acad. Sci USA 80:4803 (1983)]) 및 히그로마이신에 대한 저항성을 부여해주는 히그로마이신 포스포트랜스퍼라제 (문헌 [Marsh, Gene 32:481-485, 1984]; [Waldron et al., Plant Mol. Biol. 5:103-108, 1985]; [Zhijian et al., Plant Science 108:219-227, 1995] 참조); 세포가 트립토판 대신 인돌을 활용할 수 있게 해주는 trpB; 세포가 히스티딘 대신 히스티놀을 활용할 수 있게 해주는 hisD (문헌 [Hartman, Proc. Natl. Acad. Sci., USA 85:8047, 1988]); 세포가 만노스를 활용할 수 있게 해주는 만노스-6-포스페이트 이소머라제 (WO 94/20627); 오르니틴 데카르복실라제 억제제, 2-(디플루오로메틸)-DL-오르니틴 (DFMO)에 대한 저항성을 부여해주는 오르니틴 데카르복실라제 (문헌 [McConlogue, 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.]); 및 블라스티시딘 S에 대한 저항성을 부여해주는, 아스페르길루스 테레우스(Aspergillus terreus)로부터의 데아미나제 (문헌 [Tamura, Biosci. Biotechnol. Biochem. 59:2336-2338, 1995])를 포함한다.
달리 구체적으로 정의되지 않는 한, 본원에 사용된 모든 기술적 및 과학적 용어는 본 개시내용이 속하는 기술 분야에서 통상의 기술자에 의해 흔히 이해되는 바와 동일한 의미를 갖는다. 분자 생물학에서의 통상의 용어에 관한 정의는, 예를 들어 문헌 [Lewin B., Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9)]; [Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9)]; 및 [Meyers R.A. (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8]에서 발견될 수 있다.
본 발명은 또한 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는 재조합 벡터로 형질전환된, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물로부터 유래되는 식물 세포를 제공한다. 본 발명에 따른 “형질전환식물”에는 성숙한 식물체 및 그의 일부, 즉, 잎, 줄기, 꽃, 열매 등의 조직뿐만 아니라, 식물체나 조직을 구성하고 있는 식물 세포 또한 포함되는 것이라는 점은 자명하다.
본 발명은 또한 다음의 단계를 포함하는, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물의 종자 제조 방법을 제공한다:
(a) 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는 벡터로 식물을 형질전환시키는 단계;
(b) 상기 CANP 유전자가 도입되어 염해 저항성, 건조 저항성 및 광합성 효율 증가 중 하나 이상의 표현형을 나타내는 식물 개체군을 선별하는 단계; 및
(c) 상기 선택된 식물 개체군으로부터 종자를 채종하는 단계.
형질전환의 방법, 형질전환된 식물 개체군의 선별 방법은 앞서 설명한 바와 같다.
선별된 형질전환식물로부터 채종된 종자는 염해 저항성, 건조 저항성, 광합성 효율 증가 중 하나 이상의 표현형을 나타낼 수 있다.
본 발명에 따라 CANP(CIPK1-Associating Nuclear Protein) 유전자는 CBL1/CBL9-CIPK1 칼슘신호전달 기작에 관여하는 것으로 밝혀졌으며, 이 유전자를 과발현하는 형질전환 식물체는 왜소증의 부작용없이, 광합성 효율 증진과 동시에 내건성 및 내염성 표현형을 나타내는 것으로 확인되었다. 따라서 이러한 CANP 유전자는 가뭄 및 염해에 내성을 가지는 작물의 개발을 위해 유용하게 이용될 수 있다.
도 1은 CANP 단백질 분석 결과를 도식화한 것이다.
도 2는 CANP 전장 cDNA 서열을 도식화한 것이다.
도 3은 yeast two-hybrid assay를 통해서 전장 CANP가 CIPK1과 상호작용함을 확인한 도면이다.
도 4는 pVYNE.CANP-c-myc 및 pMAS.SCYCE(R).CIPK1-HA 의 모식도 (A)와 이들 벡터를 양파(B), 애기장대(C), 담배(D)에서 발현한 후 공초점 레이져 스캐닝을 통해 CANP와 CIPK1 단백질의 복합체를 관찰한 결과를 보여준다.
도 5는 pGADT7.CANP 및 pBridge.CIPK1/CBL1 (또는 CBL9) 구조체의 모식도(A)와 yeast three-hybrid assay의 분석결과(B)를 보여준다.
도 6은 칼슘 처리에 의한 CANP-GFP의 세포 내 이동을 보여준다.
도 7은 CANP 유전자 안에 T-DNA가 삽입되어 있는 canp mutant line의 모식도(A), 이에 대한 Genomic Southern blot assay의 결과(B), 및 RT-PCR 분석 결과(C)를 보여준다.
도 8은 CANP 유전자에 대한 complementation 컨스트럭트의 모식도(A) 및 이를 도입한 canp/CANP complementation 식물체의 real-time RT-PCR 분석결과를 보여준다(B).
도 9 및 10은 염해 스트레스에 대한canp 돌연변이체 및 야생형의 반응성을 보여준다.
도 11은 가뭄 스트레스에 대한 canp 돌연변이체 및 야생형의 반응성을 보여준다.
도 12는 CANP가 과량 발현되는 애기장대 식물체 제작을 위한 식물 형질전환용 컨스트럭트 (pBI121ΔGUS.CANP)의 모식도(A) 및 Real-time RT-PCR을 통한 형질전환체의 선별(B)을 보여준다.
도 13은 염해 스트레스에 대한 CANP 과발현 형질전환체의 저항성을 보여준다.
도 14는 가뭄 스트레스에 대한 CANP 과발현체의 저항성을 보여준다.
도 15는 야생형에 비한 CANP 과발현체의 광합성 효율 증가를 보여주는 그래프이다.
도 16은 CANP 유전자의 진화적 보존을 보여주는 서열 분석 결과를 보여준다.
도 17은 애기장대의 CANP(AtCANP)와 토마토의 CANP(SlCANP)의 아미노산 서열을 비교 분석한 결과를 보여준다.
도 18은 토마토 CANP 과발현 벡터((pATC940 vector)의 구조를 보여준다.
도 19는 토마토 야생형 (WT) 및 토마토 CANP 과발현 형질전환체들의 토양순화 모습을 보여준다.
도 20은 토마토 CANP 과발현 형질전환체에서의 SlCANP 유전자 발현양을 확인한 Real-time RT-PCR결과를 보여준다.
도 21은 7주 동안 흙에서 키운 토마토 야생형 (WT)과 CANP 과발현체(SICANP OX-1 및 SICANP OX-3)의 모습을 모여준다.
도 22는 야생형에 비한 토마토 CANP 과발현체의 광합성 효율 증가를 보여주는 그래프이다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
[실시예]
I. CANP( CIPK1 -Associating Nuclear Protein) 유전자의 역할 규명, 및 애기장대 CANP 유전자를 과발현하는 형질전환 애기장대의 제작 및 표현형 검정
<실험 방법 및 재료>
1. Yeast Two-Hybrid Screening
Yeast transformation을 위해서 His, Leu, Trp의 auxotroph인 Y190의 효모 세포주를 사용하였다. YPD 배지 (bacto yeast extract, bacto peptone, glucose)에 streaking 하여 Y190 세포의 단일 클로니를 얻었다. 이 클로니를 5 ㎖의 YPD 배지에 배양하여 30℃, 200 rpm으로 14～16시간동안 preculture 하였다. OD600nm = 1.0～2.0가 될 때까지 배양한 후 50 ㎖ YPD 배지에 5 ㎖의 세포를 옮긴 후 OD600nm = 0.2～0.5가 될 때까지 배양하였다. 키운 세포를 3,000 rpm에서 5분간 원심분리하여 침전 시키고 배지를 제거한 다음 20 ㎖의 증류수로 남은 배지를 씻어내고 1 ㎖의 증류수로 재현탁하였다. 그 다음 세포를 1.5 ㎖ 튜브에 옮기고 15초간 13,200 rpm에서 원심 분리 하여 상층액을 완전히 제거 하였다. 남은 세포에 100 mM 리튬 아세테이트 (pH7.5) 400 ㎕를 넣고 재현탁한 후 30℃에서 15분간 인큐베이션 하였다. 그 동안 2 ㎎/㎖의 salmon sperm DNA를 10분간 끓이고 얼음에 꽂아 식혀 놓은 것을 사용하여 transformation mix (50% PEG solution, 1M Litume Acetate, D.I, salmon sperm DNA)를 만들어 두었다. 15분 인큐베이션 후에 세포를 50 ㎕씩 분주하여 15초간 원심분리 한 후에 상층액을 제거하고 transforming DNA와 transformation mix를 잘 섞어주고 30℃에서 30분간 인큐베이션하였다. 42℃에서 20분간 heat shock을 준 후에 13,200 rpm에서 원심분리하여 transformation mix 용액을 제거 하고 증류수 1㎖로 재현탁하였다. 200 ㎕씩 분주하여 SC-LW (Leu과 Trp가 빠진 합성 완전 배지)배지에 spreading하여 30℃에서 3일간 키웠다.
2. β-갈락토시다아제 Filter-Lift Assay
형질전환된 효모 세포를 SC-LW plate 배지에 streaking하여 30℃에서 키운 뒤 β-갈락토시다아제 filter-lift assay를 다음과 같이 수행하였다. 먼저 Z 버퍼 (60mM Na2HPO4H2O, 40mM Na2HPO4, 10mM KCl, 1mM MgSO4) 1.8㎖에 X-gal stock (N,N-dimethylformide에 5-bromo-4chloro-3-indolyl-β-D-galactosidae가 들어있음, 20㎎/㎖)을 90 ㎕ 넣고 4.86 ㎕의 β-머캅토에탄올을 혼합한 후 이 용액을 페트리 디쉬에 부어 3MM 페이터를 올려서 적셔 놓는다. 그리고 세포가 있는 플레이트에 니트로셀룰로스 필터 (Osmonics Inc., NitroPure, 45 Micron, 82mm)를 올려놓아 세포를 멤브레인으로 이동시켰다. 이 멤프레인에 세포가 옮겨지면 멤브레인을 액체질소에 넣어서 세포를 얼린 후 꺼내어 실온에서 녹였다. 이때 세포가 있는 부분이 항상 위로 오게 하였다. 녹은 멤브레인을 X-gal이 포함된 Z 버퍼에 적셔 놓은 페이퍼에 포개고 30℃에서 인큐베이션하면서 푸른색이 띄는지를 관찰하였다.
3. 플라스미드의 제작
pGAD.CANP 플라스미드를 만들기 위해 CANP-1과 CANP-2 프라이머로 CANP cDNA의 코딩 영역을 증폭했고, 그 PCR 산물을 pGAD.GH 벡터의 EcoRⅠ, SalⅠsite에 클로닝하였다. pGEX.4T-3.CANP를 만들기 위해 pGAD.CANP 플라스미드를 EcoRⅠ, SalⅠ 제한효소로 digestion하여 insert를 pGEX.4T-3 벡터에 삽입하였다. CANP 유전자의 프로모터 부위를 얻기 위해 Col-0 genomic DNA를 템플레이트로 사용하였고, CANP-PF와 CANP-PR 프라이머를 이용하여 PCR을 수행하였다. 1,560bp 크기의 PCR 산물을 HindⅢ, BamHⅠ으로 digestion하였고, GUS 유전자가 삽입된 pBI101.1 벡터에 클로닝하여 pBI101.CANPp 플라스미드를 제작하였다. pMDDI.CANP 플라스미드를 제작하기 위해 CANP-5 와 CANP-6 프라이머 세트를 이용하여 PCR을 수행하였고, 종결코돈이 빠진 CANP PCR 산물을 얻어 XbaⅠ, BamHⅠ 제한효소로 digestion하였다. 이것을 sGFP (S65T)가 삽입된 binary 벡터 pMDDI (Shiu et al., 1996)에 클로닝하여 CANP-GFP 컨스트럭트를 만들었다. pMDDI.CANPC 플라스미드를 제작하기 위해 CANP cDNA 템플레이트를 이용하여 CANP-11, CANP-6 프라이머로 PCR을 수행한 후 증폭된 PCR 산물을 XbaⅠ, BamHⅠ 제한효소로 digestion하였다. 이 PCR 산물을 pMDDI 벡터에 삽입하여 N-말단이 결실된 CANPC-GFP 컨스트럭트를 만들었다. pCAM35S.CBL9과 pCAM35S.CIPK1을 제작하기 위해 CBL9 및 CIPK1 cDNA를 템플레이트를 이용하여 CBL9-3 / CBL9-4 프라이머와 CIPK1-14 / CIPK1-23 프라이머 세트를 이용하여 증폭하였다. 증폭된 PCR 산물을 각각 XbaⅠ, BamHⅠ 제한효소로 digestion 하여 pCAM35S 벡터에 클로닝하였다. Complementation line을 제작하기 위해 CANP 유전자의 시작코돈과 종결코돈까지의 2,000bp와 프로모터부위의 3,700bp를 합친 5,700bp의 genomic DNA 단편을 CANPP-1 와 CANP-17 프라이머 세트를 이용하여 PCR 산물을 얻은 후에 식물형질전환 벡터인 pCAM1300 벡터에 삽입한 결과 pCAM1300.CANPG 플라스미드를 제작하였다. pVYNE.CANP-c-myc과 pMAS.SCYCE(R).CIPK1-HA 컨스트럭트를 제작하기 위해 CANP와 CIPK1 cDNA를 템플레이트로 CANP-5 / CANP-10 와 CIPK1-14 / CIPK1-23 프라이머 세트를이용하여 증폭하였다. 각각의 얻어진 PCR 산물을 XbaⅠ, BamHⅠ 제한효소로 digestion하여 pVYNE-c-myc, pMAS.SCYCE(R)-HA 벡터에 클로닝하였다. CANP 과량발현체 (pBI121ΔGUS.CANP)를 얻기 위해 CANP-5 와 CANP-10 프라이머 세트를 이용한 PCR 산물을 XbaⅠ, BamHⅠ 제한효소로 digestion하여 CaMV 35S 프로모터가 삽입된 pBI121ΔGUS 벡터에 클로닝하였다. Yeast three hyrid를 수행하기 위해 pGADT7.CANP, pBridge.CIPK1, pBridge.CIPK1/CBL1 그리고 pBridge.CIPK1/CBL9을 제작하였다. pGADT7.CANP와 pBridge.CIPK1는 CANP와 CIPK1 cDNA를 템플레이트로 CANP-12 / CANP-2 프라이머와 CIPK1-15 / CIPK1-2 프라이머 세트를 이용하여 증폭하였다. 증폭된 PCR 산물을 EcoRⅠ, SalⅠ으로 digestion을 하여 pGADT7, pBridge 벡터에 각각 클로닝하였다. 또한 pBridge.CIPK1/CBL1과 pBridge.CIPK1/CBL9는 CBL1과 CBL9 cDNA를 템플레이트로 CBL1-7 / CBL1-8 프라이머와 CBL9-5 / CBL9-6 프라이머 세트를 이용하여 증폭하여, 각각의 PCR 산물을 NotⅠ, BglⅡ로 digestion하여 pBridge.CIPK1 플라스미드에 클로닝 하였다. 사용한 모든 컨스트럭트들은 DNA 시퀀싱을 통하여 확인하였다.
4. 플라스미드 구축에 사용된 올리고뉴클레오타이드 프라이머
이 연구에서 사용한 프라이머들은 제한효소 site가 밑줄이 그어진 상태로 나열되어있다. Dimer와 hairpin의 형성 그리고 Tm 값에 영향을 고려하여 프라이머의 5` 끝부분에 세 개의 추가적인 염기를 붙이고 그 다음에는 필요에 따라 제한효소 site를 붙여서 프라이머를 제작하였다.
CANP-1, 5'-TAAGAATTCAATGAAACCTTCAAAATCGC-3' (서열번호 25);
CANP-2, 5'-GATGTCGACTCAATGCTT-GGATCTCTTA-3'(서열번호 26);
CANP-5, 5'-TAATCTAGAATGAAACCTTCAAAATCGCA-3'(서열번호 27);
CANP-6, 5'-TTTGGATCCATGCTTGGATCTCTTAGGAG-3'(서열번호 28);
CANP-10, 5'-TTTGGATCCTCAATGCTT-GGATCTCTTAG-3'(서열번호 29);
CANP-11, 5`-AAATCTAGAATGCGTGCTAAAGAAAGAAG-3'(서열번호 30);
CANP-12, 5`-TAAGAATTCATGAAACCTTCAAAATCGCA-3`(서열번호 31);
CANP-17, 5`-TTTTCTAGATCAATGCTTGG-ATCTCTTAG-3`(서열번호 32);
CANPP-1, 5`- ACTAAGCTTCTTGGTGATAAGGATTCAAT-3`(서열번호 33);
CANP-PF, 5'-ACTAAGCTTCTTGGTGATAAGGATTCAAT-3'(서열번호 34);
CANP-PR, 5'-ATAGGATCCTAGATTTCGT-TAATTCGATT-3'(서열번호 35);
CIPK1-2, 5'-TTAGTCGACCTAAGTTACTATCTCTTGCT-3(서열번호 36);
CIPK1-14, 5'-ATATCTAGAATGGTGAGAAGGCAAGAGGA-3'(서열번호 37);
CIPK1-23, 5'-TTTGGATCCAGTTACTATCTCT-TGCTCCG-3'(서열번호 38);
CIPK1-15, 5'-ATAGAATTCATGGTGAGAAGGCAAGAGGA-3'(서열번호 39);
CBL1-7, 5`-ATAGCGGCCGCAATGGGCTGCTTCCACTC-3`(서열번호 40);
CBL1-8, 5`-TAAAGATCTTCATGTGGCAATC-TCATCGA-3' (서열번호 41)
CBL9-3, 5`-TTTTCTAGAATGGGTTGTTTCCATTCCAC-3` (서열번호 42);
CBL9-4, 5`-AAAGGATCC-TCACGTCGCAATCTCGTCCA-3`(서열번호 43);
CBL9-5, 5`-TTAGCGGCCGCAATGGGTTGTTTCCATTC-3`(서열번호 44);
CBL9-6, 5`-TTTAGATCTTCACGTCGCAATCTCGTCCA-3`(서열번호 45).
5. Particle Bambardments
텅스텐 microcarrier (Bio-RAD, Tungsten M-17, 11.1micron)에 pMDDI.CANP 컨스트럭트를 코팅하여 particle bambardment (Bio-RAD Laboratories)를 이용하여 양파세포에 삽입한 후 발현 양상을 관찰하였다. 우선 플라스미드를 5 ㎍의 농도로 준비하였다. 그리고 3 mg의 텅스텐에 100% 에탄올 1 ㎖을 첨가하여 재현탁하고 10,000 rpm으로 10초간 원심분리하였다. 상층액을 제거하고 1 ㎖의 멸균수로 2번 세척한 후 원심분리하여 상층액을 제거하고 30 ㎕의 멸균수를 첨가하였다. CANP 플라스미드 5 ㎍을 텅스텐에 첨가하고 볼텍싱하였다. 50 ㎕의 2.5M CaCl2와 20 ㎕의 0.1m spermidine을 넣으면서 3분간 볼텍싱하여 텅스텐에 DNA를 코팅시켰다. 그 후에 10,000 rpm에서 10초간 원심분리하여 상층액을 제거하고 250 ㎕의 100% 에탄올을 첨가하여 세척한 후에 원심분리하여 상층액을 제거하고 60 ㎕의 에탄올을 첨가하였다. macrocarrier holder에 macrocarrier를 끼운 뒤에 그 위에 플라스미드로 코팅된 텅스텐을 tapping하여 풀어준 뒤 10 ㎕씩 떨어뜨린 후 말렸다. 양파의 epidermal layer를 분리하여 MS 배지에 올려 준비하였다. 1,100 psi rupture disk (Bio-RAD Laboratories)는 사용하여 bambardment를 한 후 23℃에서 16～24시간 동안 인큐베이션하였다.
6. DAPI 염색
Particle bambardment한 시료를 DAPI 염색하기 위해 DAPI를 DMSO에 10 ㎎/㎖로 5,000배 stock으로 만들어 두었다. DAPI를 running 버퍼 (1X PBS 버퍼, 5 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.01% Tween-80)에 1/5,000으로 희석시켜 이 버퍼에 조직을 담가 5분 동안 인큐베이션하였다. 그 후 버퍼를 제거하고 DAPI가 첨가되지 않은 버퍼로 5분씩 3번 인큐베이션 하여 염색되고 남은 DAPI를 세척하였다.
7. Protoplast 분리와 DNA 주입
꽃대가 올라오지 않은 4주된 애기장대 식물체로부터 잎을 얻어 0.5~1mm의 두께로 잘라주었다. 자른 잎을 즉시 Enzyme solution (20 mM MES, pH 5.7, containing 1.5% (w/v) cellulase R10, 0.4% (w/v) macerozyme R10, 0.4 M 만니톨, 20 mM KCl, 10 mM CaCl2, 1 mM β-머캅토에탄올 및 0.1% BSA)이 담긴 페트리 디쉬에 넣고 호일로 감싼 후 데시케이터를 이용하여 진공상태에서 30분, 이어서 상온에서 3시간 동안 인큐베이션 하였다. 페트리 디쉬에 W5 용액(154 mM NaCl, 125 mM CaCl2 및 5 mM KCl을 함유하는 2 mM MES, pH 5.7)을 넣은 뒤 살살 흔들어서 잘 섞어주고, nylon mesh를 이용하여 용액을 걸러 protoplast를 harvest하였다. 용액을 200g에서 2분간 원심 분리하여 상층액을 제거한 뒤 MMG 용액 (0.4 M 만니톨 및 15 mM MgCl2 를 함유하는 4 mM MES (pH 5.7))을 이용하여 1X106 /㎖이 되도록 protoplast를 재현탁하였다. 40% PEG 용액 (0.2 M 만니톨 및 100 mM CaCl2) 4 ㎖ 에2.5 ㎍/㎕의 DNA와 protoplast를 섞고 조심히 inverting하고, 10분 뒤 W5 버퍼 (154 mM NaCl, 125 mM CaCl2 및 5 mM KCl를 함유하는 2 mM MES, pH 5.7)를 넣고 다시 inverting하였다. 100g에서 2분간 원심분리하여 상층액을 제거한 뒤 곧바로 W1 버퍼 (0.5 M 만니톨 및 20 mM KCl를 함유하는 4 mM MES, pH 5.7)를 넣어주었다. 12-웰 플레이트로 옮겨 호일로 감싼 후 24℃에서 15시간 인큐베이션하였다.
8. Agrobacterium Infiltration 및 BiFC (Bimolecular Fluorescence Complementation) 분석
단백질이 in vivo 상에서 서로 상호 작용하는지를 알아보기 위하여 Venus N-말단 부분을 가진 pVYNE 벡터에 CANP을 클로닝하고, SCFP3A의 C-말단 부분을 가진 pMAS.SCYCE 벡터에 CIPK1을 클로닝하여 필요한 컨스트럭트를 제작하였다. pVYNE.CANP-c-myc, pMAS.SCYCE.CIPK1-HA 를 아그로박테리움 GV1301에 형질전환 시켜 단일 콜로니를 LB Kn,Gn 액체배지를 이용하여 28℃에서 배양하였다. 각각의 유전자는 OD600 = 0.5, p19는 OD600 = 0.3의 농도가 되도록 세포를 harvest한 뒤 infiltration 버퍼로 재현탁하여 담배 (N.benthamiana 및 SR1)의 잎 뒷면에 infiltrating하고 5일 뒤 confocal laser scanning microscope (Leica TCS SP5, Microsystems)을 이용하여 관찰하였다.
9. Flower Bud Infiltration에 의한 형질전환체 제작
제작된 컨스트럭트 1 ㎍을 50 ㎕의 Agrobacterium tumefaciens (GV3101) competent cell과 섞어 37℃ 수조 에서 5분 동안 heat shock처리 한 후 1 ㎖ LB 배지를 첨가하였다. 28℃에서 3시간 동안 인큐베이션 한 후 30초간 원심분리(Centrifuge 5415D, 16,100g)를 하여 세포를 침전시키고 800 ㎕ LB 배지를 제거하고 남은 LB 배지에 세포를 재현탁하였다. 25 ㎍/㎖ 젠타마이신과 50 ㎍/㎖ 카나마이신 항생제가 함유되어 있는 LB 고체 배지에 도말하여 28℃에서 3일간 인큐베이션하였다. 콜로니 PCR을 통하여 컨스트럭트의 삽입여부를 확인하고 25 ㎍/㎖ 젠타마이신과 50 ㎍/㎖ 카나마이신 항생제가 함유되어 있는 LB 배지 200 ㎖에 접종하여 28℃에서 250 rpm으로 shaking하며 밤새 세포를 키웠다. 이를 상온에서 10분간 원심분리(Centrifuge 5810R, 2,129g)하여 세포를 모으고 배지는 제거하였다. 여기에 미리 준비한 infiltration 버퍼 (1/2 MS, 50g 수크로스, 1 ㎖ 1000X Gamborg’s vitamin, 10 ㎕ 벤질아미드 퓨린 (1 ㎎/㎖), 250 ㎕ Silwet L-77 )에 세포를 재현탁하여 OD600=1.5~2.0로 맞추었다. 4주된 야생형 애기장대 (Col-0) 식물의 silique을 제거하고 분무기로 식물에 전체적으로 물을 뿌려두었다. 세포를 재현탁한 infiltration 버퍼에 식물을 뒤집어서 꽃이 잠기도록 담그고 흔들어서 공기방울을 제거해 주어 꽃이 infiltration 버퍼에 완전히 잠기도록 하였다. 2분 후 식물을 꺼내어 물기 없는 flat에 옆으로 눕히고 랩으로 감싼 뒤 빛이 들지 않도록 하여 상온에서 24시간 두었다. 그 후 랩을 벗기고 식물을 바로 세워 24℃ growth 챔버에서 키웠고 처음 3일간은 물을 주지 않았다. 식물에서 씨앗을 받은 뒤에는 selection 배지에서 키워서 형질전환된 식물체를 선별하였다.
10. Quantitative Real-Time RT-PCR
Quantitative real-time RT-PCR을 수행하기 위하여 Roter-Gene Real-Time Centrifugal DNA Amplication System (Corbett Research)과 QuantiTect SYBR Green RT-PCR Kit (Quiagen)가 이용되었다. PCR을 위한 프라이머 세트로 CANP는 CANP-RT5 (5`-TCAGTTTACCAGTGGATTGTTAAGC-3`) (서열번호 46)과 CANP-RT3 (5`-TCCCCGACGACCCAAGGCGAAGATA-3`)(서열번호 47), RD29A는 RD29A-RT1 (5`-CAACACACACCAGCAGCACCCAGAA-3`)(서열번호 48)과 RD29A-RT2 (CTTCAGGTTCTAGCTCGTCATCATC-3`)(서열번호 49), RD29B는 RD29B-RT1 (5`-ACCAATCAGAATTCACCATCCAGAA-3`)(서열번호 50)과 RD29B-RT2 (5`GTTTCACCGTTACACCACCTCTCA-3`)(서열번호 51), RD22는 RD22-RT1 (5`-CTGTCTTCTTGGTTCATTCATGGTA-3`)(서열번호 52)과 RD22-RT2 (5`-TCCACGCGTACACCTCCCTTTCCAA-3`)(서열번호 53)가 사용되었다. 내부 대조군으로는, house-keeping 유전자인 actin2가 이용되었으며, 이를 위해서 actin2-1’ (5`-GAGATCACCGCTCTTGCACCTAGCA-3`)(서열번호 54)과 actin2-2 (5`-TTCCTGTGAACAATCGATGGACCT-3`)(서열번호 55) 프라이머 세트가 사용되었다. Total RNA는 RNeasy Plant mini kit (Quiagen)을 이용하여 각각의 기관으로부터 추출되어 반응당 40 ㎎이 템플레이트로 사용되었다. 기본적으로 RNA는 50℃에서 30분간 역전사시키고 그 결과 합성된 cDNA를 다시 95℃에서 20분 동안 denaturation시켰다. PCR 반응은 다음과 같은 조건에서 35 cycles 수행하였다: denaturation은 94℃에서 20초, annealing은 58℃에서 20초, 그리고 extension은 72℃에서 30초. 증폭된 transcript의 특이성은 반응 후 생성된 melting curve을 이용하여 확인하였으며, 유전자의 발현정도는 Roter-Gene software를 이용하여 대조군인 actin2와 비교하여 분석하였다.
11. 건조(drought) 스트레스 처리
가뭄 스트레스는 4주 동안 흙에서 키운 야생형 (Col-0), 넉아웃 돌연변이(canp), canp/CANP complementation, CANP overexpression 식물체를 14 또는 16일 동안 수분 공급을 중단한 후 다시 물을 준 4일 동안 관찰한 후 생존율을 측정하였다.
12. 염 스트레스 처리
야생형 (Col-0), CANP 넉아웃 돌연변이 (canp), canp/CANP complementation, CANP 과발현 종자를 MS 배지에 발아시켜서 4일 후 125 mM 또는 150 mM NaCl이 포함된 MS 배지에 옮기어 염에 대한 민감성과 뿌리성장을 관찰하였다. 또한, 4주 동안 흙에서 키운 식물체에 150 mM 또는 300 mM NaCl 처리하여 키우면서 염에 대한 민감성을 관찰하였다.
13. Water-loss assay
4주 동안 흙에서 키운 야생형 (Col-0), 넉아웃 돌연변이 (canp), canp/CANP complementation을 가지고 생체중 (fresh weight)을 측정하여 수량손실 정도를 알아보았다. 같은 발달시기의 잎 5장을 1 set로 하여 야생형 (Col-0), 넉아웃 돌연변이 (canp), canp/CANP complementation 각각 4 set를 수행하였으며, 층류로 바람이 흐르는 hood에서 건조시켜 시간별로 (0, 1, 2, 3, 4, 5, 6 시간) 생체중을 측정하였다.
14. 광합성 측정
광합성 (μmol g-1s-1) 측정은 5주 동안 흙에서 키운 식물체를 이용하였다. 휴대용 광합성 측정기 (LI-6400XT)에 이산화탄소 가스 교환 분석을 위해 Whole Plant Arabidopsis (WPA) 챔버를 직접 연결하여 식물 전체의 광합성 효율을 질량 기준으로 측정하였다. 광원으로 LI-6400-18 RGB (red, green, blue)를 사용하였으며, LI-6400-17 WPA 챔버 바로위에 연결하였다. 측정 조건은 WPA 챔버 안의 이산화탄소 농도 (400 μmol mol-1), 상대습도 (70%), 기온 (25℃)을 일정하게 유지하고 인공광선은 0, 100, 200, 400, 500, 600, 800 μmol m-2s- 1 의 광량을 인위적으로 조사하였다. 측정직후 식물체의 rosettes를 채취하여 질량을 측정하여 광합성 효율을 계산하였다.
15. 종자 수확
CANP 유전자 또는 CANP-유사유전자(예; SlCANP 등)를 과발현하는 형질전환체 중에서 전술한 11-14의 특징 (건조 저항성, 염해 저항성, 광합성 효율 등) 이 야생형에 비해 최소 20% 이상 증가된 개체를 선별하였다. 선별된 개체를 자가수분하여 종자를 채종하였으며, 채종된 종자를 다시 뿌려서 키운 형질전환체로부터 CANP 유전자(또는 SlCANP)가 안정하게 유전체에 고정되어 발현되고 있는지를 real time RT-PCR 실험을 통해 확인하였다. 향후 이용을 위해 건조 저항성, 염해 저항성, 광합성 효율 중 한 가지 이상의 특징에 증가를 보인 개체로부터 종자를 채종하여 보관하였다.
<실험 결과>
실시예 1: CIPK1과 상호작용 하는 새로운 핵 단백질의 분리
애기장대 칼슘 결합 단백질인 CBL1과 CBL9는 건조 및 고염도 자극에 의해 생성된 칼슘신호를 인식하여 CBL-Interacting Protein Kinase (CIPK) family member중 하나인 CIPK1에 전달하여 식물의 스트레스 반응을 유도하는 데 관여하고 있다. 식물세포의 원형질막에 형성되는 CBL1/CBL9-CIPK1 complex가 어떻게 신호를 핵 안으로 보내 RD22와 RD29B 등과 같은 스트레스 유전자의 발현을 촉진하는 가에 대해서는 알려진 바가 거의 없었다. 본 발명자는 이와 같은 기능을 수행하는 단백질을 찾고자 CIPK1을 미끼(bait)로 사용하여 애기장대 cDNA 라이브러리를 효모단백질잡종법(yeast two-hybrid method)으로 스크리닝하여 CIPK1과 상호작용하는 단백질들을 찾았다. 이들 상호작용 단백질의 아미노산 서열을 분석하여 핵 안으로 위치될 수 있는 것을 선별하고 이를 CIPK1-associated nuclear protein (CANP)으로 명명하였다. TIGR 웹사이트 (http://www.tigr.org)를 참조하여 CANP 단백질을 분석한 결과, 도 1에 나타낸 바와 같이 CANP는 N-말단 부위에 bipartite nuclear localization signal을, 그리고 중간 부위에 proline-rich region을 가지고 있다.
실시예 2: CANP 유전자의 전장 cDNA 클로닝
효모단백질잡종법으로 스크리닝하여 분리한 CANP 클론은 전장 cDNA가 아니었다. 따라서 CANP 전장 cDNA를 CANP-1 전방 프라이머와 CANP-2 역방 프라이머 세트를 이용하여 PCR 증폭하여 pGBT.BS 벡터에 클로닝하였다. 이 전장 cDNA 클론의 염기서열을 결정하여 분석한 결과 CANP 전장 cDNA는 도 2에서 볼 수 있는 바와 같이, 1,758 bp의 오픈리딩프레임(open reading frame)을 가지고 있음을 확인할 수 있었다.
또한, Yeast two-hybrid assay를 통해 CAMP가 CIPK1과 상호작용하는지 여부를 확인하고자 하였다. 도 3은 yeast two-hybrid assay를 통해서 전장 CANP가 CIPK1과 상호작용함을 확인한 도면이다. 도 3의 왼쪽 첫번째 패널은 pGBT 및 pGAD 플라스미드를 운반하는 Y190 효모 세포의 배열을 보여준다. 두번째 및 세번째 패널은 완전 배지에서 Leu 및 Trp (SC-LT)이 결핍된 합성 배지, 완전 배지에서 His, Leu, Trp (SC-HLW)이 결핍된 합성 배지에서의 효모의 성장을 보여준다. 마지막 패널은 β-갈락토시다아제 활성을 보여주는 필터-리프트 어세이(filter-lift assay)의 결과를 보여준다. 흥미롭게도 Gal4 전사 인자의 결합 도메인(binding domain, BD) 부위에 CANP가 클로닝 된 pGBT.CANP는 autoactivation 활성을 보였다.
실시예 3: CIPK1-CANP 상호작용 분석
Yeast two-hybrid assay에서 확인된 CIPK1과 CANP의 상호작용을 BiFC assay로 검증하였다. 먼저 BiFC용 벡터를 도 4A(pVYNE.CANP-c-myc 및 pMAS.SCYCE(R).CIPK1-HA 의 모식도)와 같이 제작하여 양파세포 (도 4B), 애기장대 protoplast (도 4C), 그리고 담배세포 (도 4D)에서 발현한 후 공초점 레이져 스캐닝을 통해 관찰하였다. 도 4에서 볼 수 있는 바와 같이, CANP와 CIPK1 단백질은 식물세포에서도 복합체(complex)를 형성하였다. 이들의 상호작용은 주로 원형질막과 세포질에서 관찰되었으나, 흥미롭게도 핵 안에서는 관찰되지 않았다.
실시예 4: CBL1과 CBL9가 CIPK1-CANP 복합체에 미치는 영향
CIPK1의 또 다른 상호작용 단백질로 알려진 CBL1 또는 CBL9에 의해서 CIPK1-CANP 복합체가 어떠한 영향을 받는지 알아보기 위해 yeast three-hybrid assay를 수행하였다. 이를 위해 pBridge 벡터에는 CIPK1과 CBL1 (또는 CBL9)을 클로닝하였고, pGADT7 벡터에는 CANP를 집어넣었다. 도 5(A)는 pGADT7.CANP 및 pBridge.CIPK1/CBL1 (또는 CBL9) 구조체의 모식도를 보여준다. 효모 균주 Y190을 공-형질전환시키기 위해, AD-융합 CANP를 발현하는 pGADT7.CANP 및 BD-융합 CIPK1 및 CBL1(또는 CBL9) 모두를 발현하는 bridge 벡터가 3번째 단백질로서 사용되었다. 형질전환된 효모 배양액을 600nm에서 0.2 흡광도 단위로 희석하고, 이중 형질전환에 대한 테스트에 대해 SD/-Met/-Leu/-Trp medium(-MLW) 상에(도 5(B)의 좌측 도면), 단백질 상호작용에 대해 SD/Met/-His/-Leu/-Trp medium(-MHLW) 상에(도 5(B)의 우측 도면) 스폿팅하였다. Yeast two-hybrid assay의 결과와 마찬가지로 BD-CIPK1과 AD-CANP만을 발현하는 효모 세포는 SC-MLWH 배지에서 자라는 반면, 세 가지 단백질(BD-CIPK1, AD-CANP, 그리고 CBL1 (또는 CBL9))을 동시에 발현하는 효모 세포는 SC-MLWH 배지에서 거의 성장하지 못했다. 이것은 CBL1 또는 CBL9이 CIPK1과 상호작용을 함으로써 CIPK1이 CANP와 상호작용하는 것을 방해함을 의미한다고 할 수 있다.
실시예 5: Ca2 + 결합 CBL1 / CBL9 의존적으로 핵 안으로 들어가는 CANP
앞의 실험결과는 CANP는 CIPK1과 핵 밖에서 상호작용을 하고 있으며 이러한 상호작용은 CBL1 또는 CBL9에 의해 방해될 수 있음을 보여주고 있다. 이를 식물세포에서 확인하기 위하여 CBL9과 CIPK1 그리고 CANP-GFP 단백질을 발현시켜 칼슘의 유무에 따른 CANP-GFP 단백질의 위치를 관찰하였다. Particle bombardment를 이용하여 양파의 표피세포에 pCAM35S.CBL9, pCAM35S.CIPK1, pMDDI.CANP 컨스트럭트를 각각 4:2:1 비율(몰 비율)로 도입하여 해당 단백질을 발현시켰다. 칼슘이 없는 조건(1mM EGTA)에서 18시간 동안 인큐베이션하여 CANP-GFP의 세포내 위치를 확인한 후, 같은 세포에 칼슘 용액(10 mM CaCl2과 3.8 mM calcium ionophore A23187)을 30분 동안 처리하여 CANP-GFP의 세포내 위치의 변화를 형광 현미경을 통해 관찰하였다.
실험 결과, 도 6에서 볼 수 있는 바와 같이, CANP-GFP는 칼슘이 없는 조건에서 주로 세포질에 존재하며(도 6(A)), 칼슘을 처리하게 되면 핵 안으로 이동해서 위치(도 6(B))하는 것을 알 수 있다. 이것은 평상시 CANP는 세포질에서 CIPK1과 복합체를 형성하고 있지만, 가뭄 또는 염해 등에 의해 칼슘신호가 생성되면 이를 인식한 CBL1/CBL9 단백질이 CIPK1과 상호작용을 원형질막에서 하게 되고, 이 과정에서 CANP가 CIPK1으로부터 떨어져 나와 핵 안으로 들어가는 것을 의미한다.
실시예 6: CANP T-DNA 넉-아웃 돌연변이( canp )의 분리 및 complementation line 제작
SALK의 T-DNA tagging line을 조사하여 CANP 유전자 안에 T-DNA가 삽입되어 있는 canp mutant line을 얻었다 (도 7A). 우선 이 돌연변이주에 T-DNA가 몇 카피 삽입되어 있는지 알아보기 위해 카나마이신 저항성 유전자인 NPTII 유전자를 프로브를 사용하여 Genomic Southern blot assay를 수행하였다. 그 결과 T-DNA가 1 copy 존재한다는 것을 확인하였다. 또한 전장 CANP cDNA를 프로브로 다시 한 번 Genomic Sounthern blot assay를 수행하여 canp mutant가 homozygous line임을 확인하였다 (도 7B). 또한, RT-PCR을 수행하여 canp mutant에서 CANP 유전자의 발현이 완전히 사라진 것을 확인하였다 (도 7C).
canp mutant의 표현형이 CANP 유전자의 기능상실에 의한 결과인지 검증하기 위해서는 정상적인 CANP 유전자 도입에 따른 phenotype rescue 여부를 조사할 필요가 있다. 따라서 도 8A에 나타낸 바와 같이 complementation 컨스트럭트를 제작하였다: CANP 유전자의 시작코돈과 종결코돈까지의 2,000 bp와 프로모터부위의 3,700 bp를 합친 5,700 bp의 genomic DNA 단편을 식물형질전환 벡터인 pCAM1300에 클로닝하였다. 이 complementation 컨스트럭트를 canp mutant에 floral dipping method로 도입시켜 canp/CANP complementation 식물체를 제작하였다. 야생형 애기장대와 비슷한 수준의 CANP transcript level을 보이는 complementation line을 선별하고자 T2 세대의 형질전환 식물체들로부터 total RNA를 추출하여 real-time RT-PCR 분석을 수행하였다. 그 결과 야생형과 거의 비슷한 수준의 발현양을 보이는 complementation line pCAMBIA1300.CANPG-3-A을 확보할 수 있었다 (도 8B).
실시예 7: canp 돌연변이체의 표현형 분석 및 Phenotype rescue
정상적인 조건에서 애기장대 canp 돌연변이체는 야생형(Col-0)에 비해 다소 작은 크기로 성장하는 형태적 표현형을 보였다. 또한, canp 돌연변이체는 고염도(high salinity)와 가뭄(drought) 스트레스에 대해서 야생형보다 더욱 민감하게 반응하였다. 고염도 스트레스에 대한 반응성 조사는 두 가지 방법으로 수행하였다. 먼저 야생형과 canp 돌연변이체의 씨앗을 1/2 MS 배지에서 뿌려 4일 동안 키운 후 seedling을 0 mM, 110 mM, 125 mM, 150 mM NaCl이 각각 포함된 1/2 MS 배지로 옮겨 키우면서 표현형을 관찰하였다.
도 9에 나타난 바와 같이 canp 돌연변이체는 야생형에 비해 현저히 염해에 민감하였다. 110 mM의 NaCl 처리 시에 canp 돌연변이체의 뿌리 성장은 억제되고 잎에서는 백화현상이 나타남을 확인할 수 있었다. 한편, 이와 같은 표현형이 complementation line에서 회복되는 것으로 보아 canp 돌연변이체의 염해 민감성은 정상적인 CANP 유전자의 발현 상실에 기인하는 것임을 알 수 있다.
또한, 토양에서 자란 4주된 식물체에서 일에 한 번씩 150 mM NaCl 또는 300 mM NaCl을 처리하여 염해 민감성 조사를 수행하였다. 도 10A에서 볼 수 있는 바와 같이, 300 mM NaCl 처리시 야생형과는 달리 canp 의 rosette leaf에서 백화현상이 나타나는 것을 확인할 수 있었다. 한편, 150mM NaCl을 처리하여 shoot growth assay를 수행하였을 때 canp 돌연변이체는 야생형과 달리 줄기를 제대로 형성하지 못했다 (도 10B). Complementation line에서는 이러한 표현형이 야생형처럼 회복되었다.
한편, 가뭄(drought)에 대한 민감성 실험은 다음과 같이 수행하였다. 4주 동안 흙에서 키운 식물체에 14일 동안 가뭄 처리하고 나서 4일 동안 물을 주는 회복기를 거쳐 생존율을 확인하였다. 그 결과 야생형에 비해 canp 돌연변이체가 가뭄에 더욱 민감해서 생존율이 약 3배 정도 감소하는 것을 확인하였다 (도 11A). 또한, 생체중 (fresh weigh)을 측정하여 식물체의 수분손실을 측정한 결과 야생형에 비해 canp 돌연변이체가 약 17%정도 더 많이 수분을 손실하였다 (도 14C). Complementation line에서는 이러한 표현형이 야생형처럼 역시 회복되었다.
실시예 8: CANP 과발현 형질전환체 제작 및 표현형 분석
앞의 실험결과를 통해서 CANP 단백질을 발현하지 못하는 canp 돌연변이체가 야생형에 비해 크기가 약간 작고 염해와 가뭄 스트레스에 대한 저항성이 떨어짐을 알 수 있었다. 이것은 CANP를 과발현하는 형질전환체는 반대로 상기 스트레스에 향상된 저항성을 보일 가능성이 있음을 시사한다. 따라서 우리는 CANP 과발현 애기장대 형질전환체를 제작하여 스트레스 저항성을 조사하였다.
CANP가 과량 발현되는 애기장대 식물체를 제작하기 위하여 우선 CaMV 35S 프로모터에 의해 CANP가 발현되도록 식물 형질전환용 컨스트럭트 (pBI121ΔGUS.CANP)를 제작하였다 (도 12A). 이 컨스트럭트를 floral dipping method로 애기장대 (Col-0)에 도입하여 형질전환체를 만들었다. Real-time RT-PCR을 통해 CANP 과발현 형질전환 개체(CANP OX-4와 OX-9)를 확인하고 homozygous line을 선발하였다 (도 12B). 선발된 형질전환체를 이용하여 앞의 canp 돌연변이체 표현형 조사의 경우와 동일한 방법으로 스트레스 반응을 조사하였다. 우선 염해 (125 mM, 300 mM NaCl) 처리시 CANP 과발현 형질전환체는 야생형(Col-0) 보다 매우 월등한 저항성을 나타내었다 (도 13).
또한, 가뭄 (drought) 스트레스 실험은 4주 동안 흙에서 키운 식물에 16일 동안 가뭄 스트레스를 처리한 다음 물을 주어 4일 동안 회복기를 거치도록 하였다. 도 14에서 보듯이 CANP 과발현체가 가뭄 (drought) 스트레스에 야생형(Col-0)보다 현저히 증가된 저항성을 나타냈다. 주어진 스트레스 조건에서 Col-0, CANP OX-4, CANP OX-9 식물체의 생존율은 각각 3%, 47%, 72%로 CANP 과발현체가 야생형에 비해 약 15배에서 24배 높은 생존율을 보였다. 이것으로 CANP 과발현체가 염, 가뭄 스트레스에 대해 야생형 보다 매우 증가된 저항성을 나타내는 것을 확인할 수 있었다.
한편, 다자란 CANP 과발현체는 야생형 애기장대 (Col-0) 보다 약간 크기가 컸다. 따라서 광합성 효율을 측정하였다. PAR 100 μmol m-2s-1에서부터 야생형에 비해 CANP 과발현체의 광합성 효율이 약 20% 정도 증가함을 알 수 있었다 (도 15).
실시예 9: 식물에서 진화적으로 보존된 CANP 유전자
GenBank 데이터베이스를 탐색한 결과, 도 16에서 볼 수 있는 바와 같이, 애기장대 CANP와 매우 유사한 유전자들이 거의 모든 식물에서 존재함을 알 수 있었다. 이와 같은 진화적 보존은 CANP가 애기장대에서처럼 다른 식물체에서도 비슷한 기능을 수행하고 있음을 의미한다. 따라서 다른 식물체에 존재하는 CANP 유사유전자들도 염해와 가뭄에 저항성을 가지고 광합성 효율이 증가된 식물체를 개발하는데 사용될 수 있을 것으로 전망된다.
실시예 II: 토마토 CANP 유전자를 과발현하는 형질전환 토마토 제작 및 표현형 검정
실시예 10: 토마토의 CANP 유전자의 full-length cDNA 클로닝
토마토(Solanum lycopersicum) 잎으로부터 제작된 cDNA를 주형으로 사용하고 SlCANP-1 (ATAACTAGTATGTCTTCTTCAAAGCGAAA)(서열번호 56) 와 SlCANP-2 (TTTGAGCTCTCATACACGCTGCTTCTTTC)(서열번호 57) 프라이머 세트를 이용하여 SlCANP 전장 cDNA를 PCR로 증폭하여 pBS 벡터에 클로닝하였다. 이 전장 cDNA 클론의 염기서열을 결정하여 분석한 결과 SICANP 전장 cDNA는 예상대로 1,677 bp의 오픈 리딩 프레임을 가지고 558개의 아미노산을 지정하고 있음을 알 수 있었다. 또한, 애기장대의 CANP와 아미노산 서열을 비교한 결과 63.4% 상동성을 가지고 있음도 다시 한 번 확인하였다 (도 17).
실시예 11: 토마토 CANP 형질전환체 제작 및 검정
토마토는 Moneymaker 품종 (Solanum lycopersicum L cv.Moneymaker)을 이용하였다. 종자를 70% EtOH에서 3분, 50% bleach에서 7분 소독 한 뒤에 3차 증류수로 5번 헹구어 발아배지에 치상하였다. 치상 후 9 - 12일된 토마토의 자엽 부위를 잘라내어 전배양 배지에 치상한 후 25℃에서 2일간 암배양 하였다. CANP 과발현을 시키기 위한 super promoter에 의해 CANP가 발현되도록 식물 형질전환용 construct (pATC940 vector)를 제작하였다 (도 18).
이 플라스미드가 들어간 아그로박테리움 (Strain: LBA4404)을 공동배양 전일 50 mg/L 카나마이신과 25 mg/L 리팜피신이 들어간 LB배지에 접종하여 키워주었다. 공동배양 당일 균주를 원심분리 하여 모은 후 200 uM 아세토시린곤(acetosyringone)이 들어간 liquid MS-0.2% 액체 배지로 풀어주어 OD600nm 값이 0.4가 되게 맞추어 주었다. 맞춘 균주를 28℃에서 100rpm으로 1시간동안 배양한 후 공동 배양재료로 이용하였다. 전배양한 자엽절편을 균주에 5분간 접종한 후 필터 페이퍼에 자엽절편을 말린 후 공동배양배지에 치상하여 28℃에서 2일간 암배양하였다. 공동배양이 완료된 자엽절편은 세포탁심(cefotaxime)이 첨가된 증류수에 넣고 교반하여 세척함으로써 미 접종된 균과 잔여 아그로박테리움을 제거하였다. 이 후 재분화 및 선택배지에 치상한 후 28℃에서 키워주었다. 이후 15일 간격으로 신선한 선택배지로 계대배양하며 키워주면서 총 8주간 배양 하였다. 재분화 과정에서 자엽부위로부터 유도된 캘러스에서 발생한 신초부위는 신초신장배지로 옮겨주어 치상한 후 28℃에서 14일간 배양하였다. 배양한 신초를 발근배지로 옮겨주어 신초로부터 뿌리를 유도하였다. 뿌리가 유도된 후 한번 더 발근배지로 옮겨주어 뿌리의 성장을 유도한 후 토양으로 옮겨 순화해주었다 (도 19).
형질전환과정을 이용하여 얻어진 4개의 형질전환체의 SlCANP 유전자 발현양을 조사하였다. Real-time RT-PCR을 수행하여 SlCANP mRNA의 발현양을 확인한 결과, 토마토 야생형 (WT)에 비하여 형질전환체가 7배에서 19배까지 SlCAN을 과발현하고 있음을 알 수 있었다 (도 20).
실시예 12: 토마토 CANP 과발현체의 광합성 측정
광합성 (μmol g-1s-1) 측정은 7주 동안 흙에서 키운 토마토 야생형 (WT)과 CANP 과발현체 중에서 발현량이 높은 1, 3번 개체를 이용하였다 (도 21). 광합성 측정기 (LI-6400XT)에 이산화탄소 가스 교환 분석을 위해 챔버를 직접 연결하여 식물 전체의 광합성 효율을 측정하였다. 챔버 안의 이산화탄소 농도 (400 μmol mol-1), 상대습도 (65%), 기온 (25℃)을 일정하게 유지하고 인공광선은 0, 100, 200, 400, 500, 600, 800 μmol m-2s-1의 광량을 인위적으로 조사하였다. 그 결과 PAR 400 μmol m2s1에서부터 야생형 (WT)에 비해 토마토 CANP 과발현체 1번 개체는 39%, 3번 개체는 20%가 증가하였다 (도 22). 이것은 real-time RT-PCR의 결과와 비교하여 CANP 발현이 증가할수록 광합성 효율이 증가함을 알 수 있다. 이러한 결과는 애기장대에서 확인된 CANP 유전자의 기능이 토마토에서도 동일하게 적용될 수 있음을 보여주는 증거라고 할 수 있다. 나아가 다른 식물에 존재하는 CANP 유전자들도 비슷한 기능을 수행할 수 있음을 추론할 수 있다.
실시예 13: 토마토 종자의 수확
상기한 특성을 소유하는 토마토 형질전환체로부터 종자를 수확하기 위해 자가수분을 실시하였다. 자가수분 결과 생성된 토마토 열매로부터 종자를 채종하였으며, 채종된 종자를 다시 뿌려서 얻은 얻은 토마토 개체로부터 SlCANP 유전자가 토마토 유전체에 안정하게 통합되어 발현되고 있음을 real-time RT-PCR로 확인하였다.

Claims (8)

  1. 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물 제조용 재조합 벡터.
  2. 제1항에 따른 CANP 유전자를 포함하는 재조합 벡터를 포함하는 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물 제조용 조성물.
  3. 제1항에 따른 CANP 유전자를 포함하는 재조합 벡터로 형질전환된, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물.
  4. 제3항에 있어서,
    상기 형질전환식물은 애기장대, 쌀, 옥수수, 콩, 감자, 조, 토마토, 오이, 포도, 딸기, 오렌지, 복숭아 또는 카카오인 형질전환식물.
  5. 제3항 또는 제4항에 따른 형질전환식물의 종자.
  6. 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는 재조합 벡터로 숙주세포를 형질전환함으로써 숙주세포 내 CANP 유전자를 과발현시키는 것을 포함하는 광합성 효율이 증진되고, 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물의 제조방법.
  7. 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는 재조합 벡터로 형질전환된, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물로부터 유래되는 식물 세포.
  8. 다음의 단계를 포함하는, 광합성 효율이 증진되고 건조 및 염해 스트레스에 대한 저항성이 강화된 형질전환식물의 종자 제조 방법:
    (a) 서열번호 1 내지 서열번호 13 중 어느 하나의 아미노산 서열을 코딩하거나 보존 서열(conserved sequence)인 RED_N_Superfamily 및 RED_C_Superfamily를 각각 N 말단 및 C 말단에 포함하며 540 내지 600개의 아미노산으로 이루어진 아미노산 서열을 코딩하는 CANP(CIPK1-Associating Nuclear Protein) 유전자를 포함하는 벡터로 식물을 형질전환시키는 단계;
    (b) 상기 CANP 유전자가 도입되어 염해 저항성, 건조 저항성 및 광합성 효율 증가 중 하나 이상의 표현형을 나타내는 식물 개체군을 선별하는 단계; 및
    (c) 상기 선택된 식물 개체군으로부터 종자를 채종하는 단계.
PCT/KR2015/009357 2014-09-05 2015-09-04 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법 WO2016036195A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20140119236 2014-09-05
KR10-2014-0119236 2014-09-05
KR10-2015-0123824 2015-09-01
KR1020150123824A KR101752324B1 (ko) 2014-09-05 2015-09-01 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법

Publications (1)

Publication Number Publication Date
WO2016036195A1 true WO2016036195A1 (ko) 2016-03-10

Family

ID=55440141

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/009357 WO2016036195A1 (ko) 2014-09-05 2015-09-04 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법

Country Status (1)

Country Link
WO (1) WO2016036195A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112011560A (zh) * 2020-09-07 2020-12-01 中国农业大学 玉米cpk2基因在植物抗旱中的应用
CN114656532A (zh) * 2020-12-22 2022-06-24 中国农业大学 Cbl9及其编码基因在调控植物耐盐碱中的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100891275B1 (ko) * 2007-02-28 2009-04-06 세종대학교산학협력단 식물 스트레스 저항성을 증가시키는 ＯｓＳＩＰＫ１ 유전자
US8362325B2 (en) * 2007-10-03 2013-01-29 Ceres, Inc. Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100891275B1 (ko) * 2007-02-28 2009-04-06 세종대학교산학협력단 식물 스트레스 저항성을 증가시키는 ＯｓＳＩＰＫ１ 유전자
US8362325B2 (en) * 2007-10-03 2013-01-29 Ceres, Inc. Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Genbank [O] 22 January 2014 (2014-01-22), retrieved from NCBI Database accession no. NP_180214.1 *
KIM, GYEONG NAM: "Studies on The Gene Function of Cold Stress Signaling for Developing New Crop Plants", SEJONG UNIVERSITY, 2006, Sejong University *
KIM, YUNG YEONG: "CIPK1 interacts with an Arabidopsis novel nuclear protein similar to human activating signal cointegrator-1", 18TH INTERNATIONAL CONFERENCE ON ARABIDOPSIS RESEARCH, 20 June 2007 (2007-06-20), Beijing, China, pages 27 *
OK, SUNG HAN ET AL.: "Novel CIPK1-associated proteins in Arabidopsis contain an evolutionarily conserved C-terminal region that mediates nuclear localization", PLANT PHYSIOLOGY, vol. 139, no. 1, September 2005 (2005-09-01), pages 138 - 150 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112011560A (zh) * 2020-09-07 2020-12-01 中国农业大学 玉米cpk2基因在植物抗旱中的应用
CN112011560B (zh) * 2020-09-07 2022-02-08 中国农业大学 玉米cpk2基因在植物抗旱中的应用
CN114656532A (zh) * 2020-12-22 2022-06-24 中国农业大学 Cbl9及其编码基因在调控植物耐盐碱中的应用
CN114656532B (zh) * 2020-12-22 2023-08-18 中国农业大学 Cbl9及其编码基因在调控植物耐盐碱中的应用

Similar Documents

Publication Publication Date Title
Jung et al. OsIAA6, a member of the rice Aux/IAA gene family, is involved in drought tolerance and tiller outgrowth
EP1681349B1 (en) Genetic control of plant growth and development
Nakazawa et al. DFL1, an auxin‐responsive GH3 gene homologue, negatively regulates shoot cell elongation and lateral root formation, and positively regulates the light response of hypocotyl length
CA2244229C (en) Nucleic acid encoding gai gene of arabidopsis thaliana
EP2542568A1 (en) Molecular engineering of a floral inducer for crop improvement
KR100742193B1 (ko) 신규한 환경 스트레스 저항성 전사인자 및 이를 이용하여식물체의 환경 스트레스 저항성을 증가시키는 방법
EP1163341A2 (en) Method for enhancing and/or improving plant growth and/or yield or modifying plant architecture
US20130180009A1 (en) Compositions and Methods for Expression of a Sequence in a Reproductive Tissue of a Plant
EP0698098B1 (en) Method for obtaining male-sterile plants
WO2011049243A1 (ja) バイオマスが増大し、かつ環境ストレス耐性が向上した形質転換植物およびその作出方法
WO2012148121A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도
WO2016036195A1 (ko) 식물의 광합성 효율과 가뭄 및 염해 저항성을 동시에 증가시키는 방법
BRPI1011495B1 (pt) Método para produção de uma planta transgênica tendo tolerância aumentada ao estresse por calor em relação a um controle do tipo selvagem
WO2013062327A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ4 단백질과 그 유전자 및 이들의 용도
Gancheva et al. Role of CLE41 Peptide in the Development of Root Storage Parenchyma in Species of the Genus Raphanus L.
WO2010110591A2 (ko) 환경 스트레스 유도성 프로모터 및 이의 용도
KR100743692B1 (ko) 식물의 발달 조절 유전자 및 이를 이용한 식물의 발달 조절방법
WO2014209036A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도
WO2013125835A1 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ３ 단백질과 그 유전자 및 이들의 용도
US20050044592A1 (en) Plant growth modulation
KR100859988B1 (ko) 지상부 특이적 프로모터 및 이를 이용한 목적 단백질의지상부 특이적 발현 방법
JPWO2008120410A1 (ja) エンドリデュプリケーション促進活性を有する遺伝子
WO2012148122A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ8 단백질과 그 유전자 및 이들의 용도
CN101130777B (zh) 与水稻生长发育和抗病性相关的编码锌指蛋白的水稻新基因
CN112048490B (zh) 棉花丝/苏氨酸蛋白磷酸酶GhTOPP6及其编码基因和应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15837838

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15837838

Country of ref document: EP

Kind code of ref document: A1