WO2015152609A1 - ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물 - Google Patents

ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물 Download PDF

Info

Publication number
WO2015152609A1
WO2015152609A1 PCT/KR2015/003175 KR2015003175W WO2015152609A1 WO 2015152609 A1 WO2015152609 A1 WO 2015152609A1 KR 2015003175 W KR2015003175 W KR 2015003175W WO 2015152609 A1 WO2015152609 A1 WO 2015152609A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
csf
seq
expression
shrna
Prior art date
Application number
PCT/KR2015/003175
Other languages
English (en)
French (fr)
Inventor
송재진
김주항
김소영
강수진
강동욱
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150044507A external-priority patent/KR101713873B1/ko
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2015152609A1 publication Critical patent/WO2015152609A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention provides an anti-tumor composition comprising GM-CSF gene and shRNA that inhibits TGF- ⁇ 2 expression and GM-CSF gene; Decorin genes; ShRNA that inhibits TGF- ⁇ 2 expression; And it relates to an anti-tumor composition comprising shRNA that inhibits FoxP3 expression.
  • Granulocyte-macrophage stimulating factor acts in a variety of ways. First, it plays a role in collecting antigen-transmitting cells such as natural killer cells or dendritic cells. In addition, GM-CSF stimulates dendritic cells in the vicinity of the tumor to increase the expression of costimulatory molecules, thereby enhancing CD4 + and CD8 + T cells' immune response and promoting the differentiation of dendritic cells. In addition, it is known to be involved in the regulation of the molecules that make up MHC class II in primary monocytes [J. Immunol. 171: 2374 by Hornell et al., 2003.
  • the present inventors inhibited TGF- ⁇ 2 expression by using RNA interference of the shRNA method that acts on TGF- ⁇ 2 tumor-associated gene, which is a protein that causes disease, thereby limiting factors that cause immune tolerance and at the same time, GM-CSF
  • the present invention was completed by confirming the improvement of the antitumor effect by inducing an immune enhancing response.
  • the present invention provides granulocyte-macrophage colony stimulating factor (GM-CSF) gene; And to provide a gene carrier for GM-CSF and shTGF- ⁇ 2 co-expression, including shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression and an anti-tumor composition comprising the same.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • shTGF- ⁇ 2 co-expression including shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression and an anti-tumor composition comprising the same.
  • the invention also relates to granulocyte-macrophage colony stimulating factor (GM-CSF) genes; Gene carriers for GM-CSF, decorin, shTGF- ⁇ 2 and shFoxP3 co-expression, including the decorin gene, shRNA that inhibits TGF- ⁇ 2 expression (shTGF- ⁇ 2) and shRNA that inhibits FoxP3 expression (shFoxP3) And another object to provide an anti-tumor composition comprising the same.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • the present invention as a means for solving the above problems
  • Granulocyte-macrophage colony stimulating factor (GM-CSF) gene provides a gene carrier for GM-CSF and shTGF- ⁇ 2 co-expression, including shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression.
  • GM-CSF Granulocyte-macrophage colony stimulating factor
  • the present invention is another means for solving the above problems
  • Granulocyte-macrophage colony stimulating factor (GM-CSF) gene Gene carriers for GM-CSF, decorin, shTGF- ⁇ 2 and shFoxP3 co-expression, including the decorin gene, shRNA that inhibits TGF- ⁇ 2 expression (shTGF- ⁇ 2) and shRNA that inhibits FoxP3 expression (shFoxP3) To provide.
  • GM-CSF Granulocyte-macrophage colony stimulating factor
  • the present invention is another means for solving the above problems
  • Granulocyte-macrophage colony stimulating factor (GM-CSF) gene provides an anti-tumor composition comprising shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression.
  • the present invention is another means for solving the above problems
  • Granulocyte-macrophage colony stimulating factor (GM-CSF) gene Provided is an anti-tumor composition comprising a decorin gene, shRNA that inhibits TGF- ⁇ 2 expression (shTGF- ⁇ 2) and shRNA that inhibits FoxP3 expression (shFoxP3).
  • the present invention inhibits the expression of TGF- ⁇ 2 by using RNA interference of the shRNA method that acts on TGF- ⁇ 2 tumor-associated genes, which is a protein that causes disease, thereby limiting the factors that induce immunity and by GM-CSF. By inducing an immune boosting reaction, antitumor effects were enhanced.
  • the present invention significantly improved the antitumor effect by simultaneously expressing GM-CSF and decorin (Decorin) and simultaneously inhibiting the expression of TGF- ⁇ 2 and FoxP3.
  • an anti-tumor composition comprising shRNA that inhibits GM-CSF gene and TGF- ⁇ 2 expression by the present invention; And a GM-CSF gene, a decorin gene, a shRNA that inhibits TGF- ⁇ 2 expression and a shRNA that inhibits FoxP3 expression is provided.
  • most cancer cells can be applied to all cancers by assigning a target to adenovirus having excellent delivery efficiency.
  • Figure 1 shows a recombinant adenovirus vector ((a) Preparation Example 7, (b) Preparation Example 10] according to the present invention.
  • Figure 2 shows the homologous recombination process (a) of the dl324 BstBI vector and pCA14-mGM-CSF, and shows the amount of mGM-CSF secretion after cancer cell infection (b).
  • Figure 3 confirms the homologous recombination of the dl324 BstBI vector and pCA14-hGM-CSF.
  • 4A, 4B and 4C illustrate the fabrication process of pVAX1-3484- ⁇ E1B-E1R.
  • Figure 6 shows the shuttle vector pVAX1-3484-CMVp- ⁇ E1B-E1R.
  • Figure 7 shows that pVAX1-3484-CMVp- ⁇ E1B-E1R-mGMCSF was cut with SmaI to confirm the introduction of mouse GM-CSF gene [lane 1: control (pVAX1-3484-CMVp- ⁇ E1B-E1R, lane 2: pVAX1-3484). -CMVp- ⁇ E1B-mGMCSF-E1R).
  • Figure 9 shows the fabrication of tumor selective replicable adenoviruses expressing human GM-CSF.
  • Figure 10 shows the pBSKII-3484 vector (a), pCA14-3484 vector (b), pCA14-CMV-3484 vector (c) and pCA14-CMV-3484- ⁇ E1B55 vector (d).
  • 11 shows the pSP72 ⁇ E3 / si-negative vector, which is an E3 shuttle vector.
  • FIG. 13 shows pVAX1-3484-CMVp- ⁇ E1B-E1R, and (b) confirms pVAX shuttle vector completion for E1 homologous recombination as a restriction enzyme pattern.
  • FIG. 13 shows pVAX1-3484-CMVp- ⁇ E1B-E1R
  • (b) confirms pVAX shuttle vector completion for E1 homologous recombination with a restriction enzyme pattern [C: dl324-BstBI- ⁇ E3-H1- shmTGF- ⁇ 2: 8010 5324 4947 4597 2937 2440 2081 1627 75, lanes 1-3: dl324-BstBI- ⁇ E3-H1-shmTGF- ⁇ 2 homologous recombination candidate: 8010 5324 4947 4597 2937 2884 2440 2081 1627 75].
  • Figure 14 confirms human decorin expression by ELISA.
  • 15A shows homologous recombination of tumor-selectable replicable adenoviruses expressing mouse decorin.
  • Figure 15b confirms mouse decorin expression by ELISA.
  • FIG. 16 is a schematic diagram of a process in which FoxP3 shRNA is subcloned into a shuttle vector.
  • Figure 17 shows FoxP3 shRNA subcloned into shuttle vector (arrow: shFoxP3 entered instead of shGFP).
  • shFoxP3 entered instead of shGFP.
  • the smaller shFoxP3 size is inserted compared to the second leftmost band. Results when using SphI / KpnI].
  • Figure 18 confirms the ability to inhibit FoxP3 expression by shuttle vector plasmid expressing human FoxP3 shRNA by Western blotting.
  • 19 is a schematic diagram of homologous recombination between a dl324-IX adenovirus backbone and a shuttle vector expressing human FoxP3 shRNA.
  • FIG. 20 illustrates screening results of E3 region PCR of adenoviruses, and (b) shows IX gene region PCR results of adenoviruses for screening homologous colonies homologous in recombinant bacteria.
  • (c) confirmed the HindIII pattern from the clones identified in (a) and (b) confirmed clone 9 and (d) confirmed the possibility of transfection of homologous recombination adenovirus genomic DNA
  • the fragment DNA is expressed after PacI cleavage.
  • Figure 21 confirms the final recombinant colony selection with the HindIII digestion pattern of dl324-IX-E3-U6-FoxP3 containing mouse FoxP3. On the right is confirmed with PacI.
  • Figure 22 confirms the ability to inhibit FoxP3 expression by adenovirus expressing human FoxP3 shRNA by Western blotting.
  • Figure 23 confirms the ability to inhibit FoxP3 expression by adenovirus expressing mouse FoxP3 shRNA by Western blotting.
  • 24 and 25 show the process of constructing pSP72 ⁇ E3 / U6-shFoxP3 + H1-shTGF ⁇ 2 shuttle vector.
  • FIG. 26A shows homologous recombination of tumor-selectable replicable adenoviruses expressing shRNAs of mouse FoxP3 and TGF- ⁇ 2.
  • Figure 26b is confirmed by real-time PCR the reduction effect of FoxP3 and TGF ⁇ 2 upon transfection of human A375 in the form of pSP72 ⁇ E3 / U6-shFoxP3 + H1-shTGF ⁇ 2 shuttle vector.
  • FIG. 27 shows a pIRES vector in which a GM-CSF gene is inserted into MCS A and a decorin gene is inserted into MCS B.
  • FIG. 28 shows the subcloning with HindIII with pIRES / mGM-CSF-mDCN.
  • Figure 30 shows the expression of pVAX1-3484-CMVp- ⁇ E1B-IRES-mGMCSF-mDCN.
  • FIG. 31 shows the homologous recombination with adenovirus expressing mouse GM-CSF and mouse decorin at HindIII and PacI.
  • 32A and 32B confirm mouse GM-CSF and mouse decorin expression by ELISA.
  • Figure 33 shows subcloning of the human decorin gene into pIRES-hGM-CSF.
  • 35A is a schematic diagram of homologous recombination to adenovirus expressing mouse GM-CSF and mouse decorin at the same time.
  • Figure 35b is confirmed by ELISA expression by transfection of the shuttle vector of the plasmid form expressing human GM-CSF and decorin at the same time.
  • Figure 37a shows the first homologous recombination process between dl324-BstBI and the shuttle vector pSP72 ⁇ E3-H1-shmTGF- ⁇ 2.
  • Figure 37b shows the manufacturing process of dl324-3484-CMVp- ⁇ E1B-mGMCSF- ⁇ E3-H1-shmTGF ⁇ 2.
  • Figure 38 shows the homologous recombination of dl324-BstB1- ⁇ E3-H1-shmTGF ⁇ 2 and pVAX1-3484-CMVp- ⁇ E1B-mGMCSF with HindIII and PacI.
  • Figure 41 shows dl324-CMV- ⁇ E1B-mGMCSF-IRES-mDCN- ⁇ E3-H1-shmTGF ⁇ 2 virus homologous recombination by HindIII and PacI.
  • Figure 42a shows the HindIII pattern of the samples homologous recombination of shmFoxP3 and shmTGF ⁇ 2 to dl324 ⁇ E3.
  • Figure 42b shows the HindIII pattern of the samples homologous recombination of shhFoxP3 and shhTGF ⁇ 2 to dl324 ⁇ E3.
  • 43A and 43B illustrate the manufacturing process of dl324-3484-CMVp- ⁇ E1B-GMCSF-IRES-DCN-U6-shFoxP3-H1-shTGF ⁇ 2.
  • Figure 44 shows the fabrication process of pCA14-3484-CMVp- ⁇ E1B-mGM-CSF-IRES-mDCN.
  • FIG. 45 shows ELISA expression of GM-CSF and decorin when pCA14-3484-CMVp- ⁇ E1B-mGM-CSF-IRES-mDCN was transfected.
  • 46A shows a homologous remodeling scheme between dl324-BstBI- ⁇ E3-U6-mFoxP3-H1-shmTGF ⁇ 2 and pCA14-3484-CMV- ⁇ E1B-mGMCSF-IRES-mDCN and mouse infection with mouse cells in adenovirus obtained by homologous recombination MRNA of TGF ⁇ 2 and mRNA of FoxP3 are shown.
  • 46B shows the homologous recombination between dl324-BstBI- ⁇ E3-U6-mFoxP3-H1-shmTGF ⁇ 2 and pCA14-3484-CMV- ⁇ E1B-mGMCSF-IRES-mDCN dl324-3484-CMVp- ⁇ E1B-mGMCSF-IRES-mDCN -U6-shFoxP3-H1-shTGF ⁇ 2
  • HindIII picture above
  • PacI picture below
  • Figure 47 shows the homologous recombination of dl324-3484-CMVp- ⁇ E1B-GMCSF-IRES-DCN-U6-shFoxP3-H1-shTGF ⁇ 2 with HindIII and PacI.
  • 49 shows the expression of human GM-CSF and human decorin by ELISA.
  • Figure 50 confirms the expression of mouse GM-CSF and mouse decorin by ELISA.
  • FIG. 51 shows the inhibition of FoxP3 or TGF- ⁇ 2 mRNA expression in mouse melanoma cells by real-time PCR.
  • Figure 53 shows the mouse survival rate.
  • 54 is a graph showing antitumor effect.
  • Figure 56 shows the effect of immune activity by human-derived adenovirus in nude mice.
  • Figure 57 shows the effect of the immune activity by mouse-derived adenovirus in C57BL / 6 mice.
  • Figure 58 shows the effect of immunological activity by mouse-derived adenovirus in vitro .
  • Figure 60 confirms the anti-tumor effect by adenovirus expressing 1 to 4 genes.
  • the invention is a granulocyte-macrophage colony stimulating factor (GM-CSF) gene; And it provides a gene carrier for GM-CSF and shTGF- ⁇ 2 co-expression, including shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • the invention is a granulocyte-macrophage colony stimulating factor (GM-CSF) gene; Gene carriers for GM-CSF, decorin, shTGF- ⁇ 2 and shFoxP3 co-expression, including the decorin gene, shRNA that inhibits TGF- ⁇ 2 expression (shTGF- ⁇ 2) and shRNA that inhibits FoxP3 expression (shFoxP3) To provide.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • the present inventors have made extensive efforts to develop gene antitumor compositions in which antitumor activity is maximized by increasing tumor specific immune activity and tumor immunogenicity.
  • GM-CSF gene carrier co-expressing GM-CSF and shTGF- ⁇ 2
  • shRNA RNA interference acting on the TGF- ⁇ 2 tumor-related gene which is a protein causing disease. It was confirmed that the antitumor effect was improved by inhibiting TGF- ⁇ 2 expression and limiting the factors that induce immune tolerance, and at the same time inducing an immune enhancing response by GM-CSF.
  • anti-tumor tumors are expressed more particularly than for the expression of individual genes, especially when GM-CSF, shTGF- ⁇ 2 is expressed. The effect was confirmed to be more excellent.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • the mouse GM-CSF gene is represented by SEQ ID NO: 1 as shown in Cancer Gene Therapy (2006) 13, 1061-1071.
  • the human GM-CSF gene is represented by SEQ ID NO: 2, as shown in Genebank M11220.
  • shRNA inhibiting TGF- ⁇ 2 expression was used as disclosed in Korean Patent Publication No. 2013-0088792, the shRNA is represented by SEQ ID NO: 3 or SEQ ID NO: 4.
  • decorin includes not only the decorin exemplified in the Examples, but all analogs of decorin that can increase gene transfer efficiency.
  • decorin (DCN) for improving gene delivery efficiency is a protein belonging to the class of small leucine rich proteoglycan (SLRP) and is composed of 10-12 leucine rich repeats, and the core region is It is arched and is easily formed with various growth factors or decorin receptors present in the extracellular matrix (Krusius T, Ruoslahti E., Proc Natl Acad Sci USA, 1986, 83). (20): 7683-7687; Day AA, et al., Biochem J, 1987, 248 (3): 801-805; Fisher LW, Termine JD, Young MF., J Biol Chem, 1989, 264 (8): 4571-4576).
  • SLRP small leucine rich proteoglycan
  • TGF tumor growth factor
  • MMP-1 matrix metalloproteinase-1
  • MMP-2 matrix metalloproteinase-1
  • the mouse decorin gene is represented by SEQ ID NO: 5 as represented by Genbank BC138564.
  • the human decorin gene is represented by SEQ ID NO: 6 as represented by Genbank BT019800.
  • shRNA shFoxP3 that inhibits FoxP3 expression
  • shRNA shFoxP3 that inhibits FoxP3 expression
  • Human target sequence 5'- CAT GCG ACC CCC TTT CAC C -3 '[SEQ ID NO: 8]
  • shRNA that inhibits FoxP3 expression has a sequence complementary to a portion of the FoxP3 gene, and may degrade mRNA or inhibit translation of FoxP3 gene. Complementarity of 80-90% can inhibit the translation of mRNA, and 100% can degrade mRNA.
  • shRNA that inhibits FoxP3 expression is 80% or more, preferably, complementary to the 1005--1023 nucleotides of mouse mRNA, and to the 1005--1023 nucleotides of human mRNA, which is the same site in humans. Preferably at least 90%, more preferably at least 100% homology.
  • the mouse shRNA consists of the nucleotide sequence shown in SEQ ID NO: 7 (target sequence) and its complementary nucleotide sequence
  • the human shRNA consists of the nucleotide sequence shown in SEQ ID NO: 8 (target sequence) and its complementary nucleotide sequence Can be.
  • Each base sequence and its complementary base sequence may be palindrom-linked by a loop region of 9 bp to form a hairpin structure.
  • shFoxP3 may include the following sequence:
  • ShRNA as a mouse target sequence of SEQ ID NO: 7: 5'-GAT CCG TAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TAT TTT TTG GAA A-3 '[SEQ ID NO: 9]
  • ShRNA as the human target sequence of SEQ ID NO: 8 '5'-GAT CCG CAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TGT TTT TTG GAA A-3' SEQ ID NO: 10].
  • shRNA short hairpin RNA
  • shRNA short hairpin RNA
  • RNAi The substance which inhibits the expression of FoxP3 by RNAi may be artificially chemically synthesized, and the DNA of the hairpin structure in which the DNA sequences of the sense strand and the antisense strand are reversely connected by T7 RNA polymerase is used in laboratory conditions. RNA may also be synthesized and produced. When synthesized in laboratory conditions, T7 RNA polymerase and T7 promoter can be used to synthesize antisense and sense RNA from template DNA. After annealing them in laboratory conditions, introduction into cells induces RNAi, leading to degradation of FoxP3 mRNA. Introduction into a cell can be performed by the method using the calcium phosphate method or various transfection reagents (for example, oligofectamine, lipofectamine, lipofection, etc.).
  • an expression vector containing shRNA or DNA may be used, or a cell containing the expression vector may be used.
  • the said expression vector and the kind of cell are not specifically limited, The expression vector and cell which are already used as a medicine are preferable.
  • shRNA having a target sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8 can be used.
  • the present invention includes the recombinant expression vector for shRNA expression.
  • the recombinant vector of the present invention can be constructed by recombinant DNA methods known in the art.
  • Viruses (or viral vectors) useful for delivering shRNAs in the present invention include adenoviruses, retroviruses, lentiviruses, adenoviruses, and the like, and adenoviruses are preferred for reasons such as tumor induction.
  • the following DNA can be prepared based on the shRNA sequence.
  • non-viral vector useful for delivering shRNA in the present invention means all the vectors commonly used in gene therapy, except for the aforementioned viral vector, and examples thereof include various plasmids and liposomes that can be expressed in eukaryotic cells. .
  • shRNA that inhibits FoxP3 expression is preferably operably linked to at least a promoter in order to be properly transcribed in the delivered cells.
  • the promoter may be any promoter capable of functioning in eukaryotic cells, but the U6 promoter is particularly preferable for the advantage of producing small size RNA as RNA polymerase III.
  • additional regulatory sequences including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences, and transcription terminators may be added as needed. It may also include.
  • operably linked means that the binding between nucleic acid sequences is functionally related.
  • the case where any nucleic acid sequence is operably linked is when any nucleic acid sequence is positioned to be functionally related to another nucleic acid sequence.
  • any transcriptional regulatory sequence affects the transcription of shRNA, said transcriptional regulatory sequence is said to be operably linked to the shRNA.
  • the decorin genes, shTGF- ⁇ 2 and shFoxP3 are preferably present in suitable expression constructs.
  • the genes are preferably operably linked to a promoter.
  • operably linked means a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence.
  • the promoter coupled to the target genes of the present invention is preferably capable of controlling transcription of the decorin gene by operating in animal cells, more preferably mammalian cells, derived from mammalian viruses.
  • promoters derived from genomes of mammalian cells such as, for example, cytomegalo virus (CMV) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, RSV promoter, EF1 alpha Promoter, metallothionine promoter, ⁇ -actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, promoter of human IL-4 gene, promoter of human lymphotoxin gene and promoter of human GM-CSF gene Including but not limited to.
  • CMV cytomegalo virus
  • adenovirus late promoter vaccinia virus 7.5K promoter
  • SV40 promoter vaccinia virus 7.5K promoter
  • the expression construct used in the present invention comprises a polyaninylation sequence (eg, a ileogen hormone terminator and a SV40 derived poly adenylation sequence).
  • a polyaninylation sequence eg, a ileogen hormone terminator and a SV40 derived poly adenylation sequence.
  • Gene carriers of the present invention can be produced in a variety of forms, including (i) naked recombinant DNA molecules, (ii) plasmids, (iii) viral vectors, and (iv) the naked recombinant DNA molecules or plasmids. It can be produced in the form of liposomes or niosomes containing.
  • the decorin genes, shTGF- ⁇ 2 and shFoxP3 can be applied to all gene carriers used in conventional gene therapy, preferably plasmids, adenoviruses (Lockett LJ, et al., Clin. Cancer Res. 3: 2075-2080). (1997)), Adeno-associated viruses (AAV, Lashford LS., Et al., Gene Therapy Technologies, Applications and Regulations Ed.A. Meager, 1999), retroviruses (Gunzburg WH, et al., Retroviral vectors.Genine Therapy Technologies, Applications and Regulations Ed.A. Meager, 1999), lentiviruses (Wang G.
  • the gene carrier of the present invention is a GM-CSF gene and shTGF- ⁇ 2; Or GM-CSF gene;
  • the decorin genes, shTGF- ⁇ 2 and shFoxP3, are prepared by applying to adenoviruses.
  • Adenoviruses are widely used as gene transfer vectors because of their medium genome size, ease of manipulation, high titers, wide range of target cells and excellent infectivity. Both ends of the genome contain 100-200 bp of Inverted Terminal Repeat (ITR), which is an essential cis element for DNA replication and packaging.
  • ITR Inverted Terminal Repeat
  • the genome El region (E1A and E1B) encodes proteins that regulate transcription and transcription of host cell genes.
  • the E2 regions (E2A and E2B) encode proteins that are involved in viral DNA replication.
  • non-replicating adenoviruses lacking the E1 region are widely used.
  • the E3 region is removed from conventional adenovirus vectors to provide sites for insertion of foreign genes (Thimmappaya, B. et al., Cell, 31: 543-551 (1982); and Riordan, JR et al., Science, 245: 1066-1073 (1989).
  • shRNAs that inhibit GM-CSF gene and TGF- ⁇ 2 expression of the present invention are preferably inserted into the deleted E1 region (E1A region and / or E1B region, preferably E1B region) or E3 region.
  • the term "deletion" as used in connection with a viral genome sequence has the meaning including not only a complete deletion of the sequence, but also a partial deletion.
  • adenovirus can pack up to about 105% of the wild-type genome, about 2 kb can be additionally packaged (Ghosh-Choudhury et al., EMBO J., 6: 1733-1739 (1987)).
  • the above-described foreign sequence inserted into the adenovirus may additionally bind to the genome of the adenovirus.
  • Adenoviruses have 42 different serotypes and subgroups of A-F. Of these, adenovirus type 5 belonging to subgroup C is the most preferred starting material for obtaining the adenovirus vector of the present invention. Biochemical and genetic information for adenovirus type 5 is well known. Foreign genes carried by adenoviruses replicate in the same way as episomes, with very low genetic toxicity to host cells. Therefore, gene therapy using the adenovirus gene delivery system of the present invention is considered to be very safe.
  • Retroviruses are widely used as gene transfer vectors because they insert their genes into the host genome, carry large amounts of foreign genetic material, and have a broad spectrum of cells that can infect them.
  • the target nucleotide sequence to be delivered is inserted into the retroviral genome instead of the sequence of the retrovirus to produce a nonreplicating virus.
  • a packaging cell line is constructed that contains gag, pol and env genes but does not have long terminal repeat (LTR) and ⁇ sequences (Mann et al., Cell, 33: 153-159 (1983)).
  • RNA transcripts of the recombinant plasmids When a recombinant plasmid comprising the target nucleotide sequence, LTR, and ⁇ sequences to be transported is introduced into the cell line, the ⁇ sequences enable the production of RNA transcripts of the recombinant plasmids, which are packaged into a virus and the virus is Discharged to the medium (Nicolas and Rubinstein "Retroviral vectors," In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (eds.), Stoneham: Butterworth, 494-513 (1988)). The medium containing the recombinant retrovirus is collected, concentrated and used as a gene carrier.
  • MMLV Mollony murine rheumatoid virus
  • EPO erythropoietin
  • the gene carrier of the present invention can also be prepared according to such a construction strategy of a second generation retroviral vector.
  • Adenovirus (AAV) is suitable as the gene carrier of the present invention because it can infect non-dividing cells and has the ability to infect various kinds of cells. Details of the preparation and use of AAV vectors are disclosed in detail in US Pat. Nos. 5,139,941 and 4,797,368.
  • AAV vectors have undergone clinical I as a therapeutic agent for cystic fibrosis.
  • AAV viruses are plasmids (McLaughlin et al., J. Virol., 62: 1963-1973 (1988); and Samulski containing a gene sequence of interest with two AAV terminal repeats located next to them). et al., J. Virol., 63: 3822-3828 (1989) and expression plasmids comprising wild type AAV coding sequences without terminal repeats (McCarty et al., J. Virol., 65: 2936-2945 (1991) )) Is co-transformed.
  • viral vectors can also be used as gene carriers of the present invention.
  • Vaccinia virus Panhlmann M. et al., Human Gene Therapy 10: 649-657 (1999); Ridgeway, "Mammalian expression vectors," In: Vectors: A survey of molecular cloning vectors and their uses.Rodrigue and Denhardt, eds Stoneham: Butterworth, 467-492 (1988); Baichwal and Sugden, "Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes," In: Kucherlapati R, ed.
  • Liposomes are automatically formed by phospholipids dispersed in the aqueous phase. Examples of successfully delivering foreign DNA molecules into liposomes into cells include Nicolau and Sene, Biochim. Biophys. Acta, 721: 185-190 (1982) and Nicolau et al., Methods Enzymol., 149: 157-176 (1987). Meanwhile, the most widely used reagent for transforming animal cells using liposomes is lipofectamine (Lipofectamine, Gibco BRL).
  • Liposomes containing the target nucleotide sequence to be transported carry the target nucleotide sequence to be transported into the cell by interacting with the cell through mechanisms such as endocytosis, adsorption to the cell surface, or fusion with a plasma cell membrane.
  • the gene carrier of the invention is a recombinant adenovirus vector.
  • the recombinant adenovirus vector of the present invention is a deletion of the E1B and E3 region, the GM-CSF gene is inserted into the deleted E1B region, shRNA that inhibits the TGF- ⁇ 2 expression Is inserted into the deleted E3 region.
  • the recombinant adenovirus vector in which the four genes are introduced is inserted into the deleted E1B region and the shTGF- ⁇ 2 and shFoxP3 are inserted into the deleted E3 region.
  • Recombinant adenoviruses containing an active E1A gene have a replicable property, and can increase cellular high capacity when the E1B region is deleted.
  • the term “deletions” as used in the context of viral genome sequences has the meaning including not only complete deletion of the sequence, but also partial deletion.
  • the recombinant adenovirus of the present invention may comprise an unmutated E1A gene or may comprise a mutated E1A gene.
  • the recombinant adenovirus vector of the invention inhibits GM-CSF gene in the 5 'to 3' direction in the deleted E1 region, and TGF- ⁇ 2 expression in the 5 'to 3' direction in the deleted E3 region.
  • shRNA is included (FIG. 1A).
  • the recombinant adenovirus vector into which the four genes were introduced may have a GM-CSF gene, an internal ribosome entry site (IRES), a decorin gene, and a 5 'to 3' in the E1 region.
  • IRS internal ribosome entry site
  • shFoxP3 and shTGF- ⁇ 2 in the direction (Fig. 1 (b)).
  • the present invention provides an anti-tumor composition comprising the gene carrier.
  • the gene carrier included as an active ingredient in the pharmaceutical composition of the present invention is the same as the gene carrier of the present invention described above, the detailed description of the gene carrier is applied to the pharmaceutical composition of the present invention as it is. Therefore, in order to avoid excessive complexity by unnecessary repetitive description of this specification, common description is abbreviate
  • the invention is a GM-CSF gene; And shRNA (shTGF- ⁇ 2) that inhibits TGF- ⁇ 2 expression, or a GM-CSF gene;
  • shRNA that inhibits TGF- ⁇ 2 expression
  • shFoxP3 shRNA that inhibits FoxP3 expression
  • the pharmaceutical composition of the present invention can be used for various diseases or diseases related to tumors such as gastric cancer, lung cancer, breast cancer, ovary Cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer and the like.
  • treatment includes (i) prevention of tumor cell formation; (ii) inhibiting a disease or condition associated with the tumor following removal of the tumor cells; And (iii) alleviation of a disease or disorder associated with a tumor following removal of tumor cells.
  • therapeutically effective amount herein means an amount sufficient to achieve the pharmacological effect described above.
  • compositions of the present invention are those commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate , Microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto. no.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • the pharmaceutical composition of the present invention is preferably parenteral, and may be administered using, for example, intravenous administration, intraperitoneal administration, intramuscular administration, subcutaneous administration or topical administration.
  • Intraperitoneal administration in ovarian cancer and in the portal vein in liver cancer can be administered by infusion method, in the case of breast cancer can be directly injected into the tumor mass, in the case of colon cancer by direct injection into the enema In the case of bladder cancer, it may be administered by injection directly into the catheter.
  • Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex of the patient, degree of disease symptom, food, time of administration, route of administration, rate of excretion and response to reaction. In general, the skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment.
  • the pharmaceutical compositions of the present invention comprise 1 ⁇ 10 5 to 1 ⁇ 10 15 pfu / ml of recombinant adenovirus, and typically 1 ⁇ 10 8 to 1 ⁇ 10 12 pfu, injected every other day for two weeks do.
  • compositions of the present invention are prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulations here may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.
  • the pharmaceutical composition of the present invention may be used as a single therapy, but may also be used in combination with other conventional chemotherapy or radiation therapy, and when the combination therapy is performed, cancer treatment may be more effectively performed.
  • Chemotherapeutic agents that can be used with the compositions of the present invention are cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, phospho Ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorubicin, doxorubicin, doxorubicin, Bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluorouracil (5-fluorouracil), vincristin, vinblastin, methotrexate and the like.
  • Radiation therapy that can be used with the composition of the present invention is X-ray irradiation, ⁇
  • the composition of the present invention enhances immunoactivity and immunogenicity.
  • the present invention also provides an adenovirus incorporating the gene carrier.
  • Viruses (viral vectors) useful for delivering nucleic acid molecules for RNAi in the present invention include adenoviruses, retroviruses, lentiviruses, adenoviruses, and the like. desirable.
  • PCA14-mGM-CSF shuttle vector was constructed by inserting into pCA14 vector of Microvix from mouse GM-CSF gene of pMG-mGM-CSF donated by Dr O'Sullivan.
  • the shuttle vector thus obtained was cut with XmnI and then cut with BstBI to convert into single-stranded backbone DNA dl324 BstBI (Heider, H et al., Biotechniques, 28 (2): 260-270 , 2000) and E. coli BJ5183 (purchased from Addgene) to induce homologous recombination to prepare an adenovirus dl324-mGM-CSF expressing an immunoactivated cytokine [FIG. 2].
  • B16F10 mouse melanoma cells were infected with various concentrations of MOI, and media were collected 48 hours after infection to measure the amount secreted by ELISA analysis.
  • XhoI / HindIII sites were used at both ends of the 5 'and 3' primers.
  • Antisense Primer ccc aag ctt tca ttt ttg gcc tgg ttt ttt gca [SEQ ID NO: 16]
  • FIG. 2 shows the homologous recombination of the dl324 BstBI vector with pCA14-mGM-CSF (right) and the amount of mGM-CSF of about 600 pg / ml secreted for 24 hours when infected with 100 MOI (left). Showed.
  • Human GM-CSF gene was obtained from pORF-hGM-CSF (InvivoGen).
  • DNA was obtained by gel extraction, cut with XhoI and HindIII and then linked with pCA14 cut with XhoI and HindIII to obtain pCA14-hGM-CSF.
  • dl324 vector was enzymatically cut with BstB1
  • pCA14-hGM-CSF was enzymatically cut with XmnI and transformed to E. coli BJ5183 for homologous recombination. .
  • Lane 3 of FIG. 3 shows homologous recombination of the dl324-BstB1 vector and pCA14-hGM-CSF.
  • FIG. 5 shows a DNA fragment cut by restriction enzyme showing that the shuttle vector pVAX1-3484-CMVp- ⁇ E1B-E1R and its production intermediate plasmid constructs are properly subcloned.
  • the [CMVp-mGM-CSF] portion of pCA14-mGM-CSF was cut using BglII (blunt) and SalI, and the pVAX1-3484-CMVp- ⁇ E1B-E1R shuttle vector was cut with EcoRI (blunt) and SalI and cloned. 6). As a result, it was confirmed that pVAX1-3484-CMVp- ⁇ E1B-E1R-mGMCSF was cut and inserted into SmaI (FIG. 7).
  • the dl324-BstBI backbone was cut with Bsp1191 and the pVAX1-3484-CMVp- ⁇ E1B-E1R-mGMCSF shuttle vector was cut with Pme I linearized and homologous recombination (FIG. 7).
  • Figure 8 (a) shows the HindIII pattern confirmed that all 1-6 clones were recombined, and (b) was again confirmed whether the cut with Pac I.
  • DNA from bacterial clones identified for homologous recombination was digested with PacI and transfected into a subclone of the 293 human embryonic kidney cell line (A93A) to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • shRNA (hereinafter referred to as shTGF ⁇ 2 business card) that suppresses TGF- ⁇ 2 expression represented by SEQ ID NO: 3 or SEQ ID NO: 4 was prepared.
  • the pBSKII plasmid [Stratagene, USA] includes the E1A and E1B55kDa genes and various enzyme sites.
  • PBSKII-3484 synthetic gene was prepared including [FIG. 10 (a)].
  • pBSKII-3484 was PCR-treated with restriction enzymes using Fsp I and then blunt end with a blunting enzyme. was prepared and treated with Bam HI again.
  • pCA14 [Microbix BiosystemsInc, Canada] was Ssp were cut using a restriction enzyme to I, create a blunt end using a block reonting enzyme, which processes the Bgl II same transmission restriction enzyme (Isoschizomer) Bam HI and Bgl II and ends
  • a shuttle vector pCA14-3484 was constructed by inserting the synthesized gene through the blunt end of [Fig. 10 (b)]. After that [in Fig. 10 (c)] produced pCA14-CMV-3484 was inserted into Kpn I pCA14-3484 the CMV promoter gene and Xho I.
  • pCA14-3484-CMV cut and blunted the E1B55kDa portion by EcoRI and SalI restriction enzymes, and then re-linked to obtain pCA14-3484-CMV-ER1 (FIG. 10 (d)).
  • pSP72 ⁇ E3 / H1-shTGF- ⁇ 2 was prepared by cleaving with Sph I and BamHI between the E3-left and U6 promoters of pSP72 ⁇ E3 / si seq (FIG. 11) and inserting the H1 promoter and shmTGF- ⁇ 2.
  • Dl324-BstBI- without IX gene was cut with SpeI and transformed simultaneously with pSP72 ⁇ E3 / H1-shmTGF ⁇ 2 and Escherichia coli BJ5183 cut with XmnI to confirm the HindIII pattern after induction of homologous recombination. After the two recombinant HindIII patterns and after the four PacI cleavage, both patterns were confirmed (FIG. 12).
  • mice surviving promoter of pVAX1-3484- ⁇ E1B-E1R was changed to CMV promoter using KpnI, XhoI (FIG. 6).
  • dl324-BstBI- ⁇ E3-H1-shmTGF ⁇ 2 was cut into BstBI and linearized, and pVAX1-3484-CMVp- ⁇ E1B-E1R was cut into PmeI and linearized to homologous recombination (Fig. 13 (a)).
  • Figure 13 (b) confirmed the restriction enzyme pattern to complete the pVAX shuttle vector for E1 homologous recombination.
  • Lane C is dl324-BstBI- DELTA E3-H1-shmTGF- ⁇ 2 viral vector DNA
  • lanes 1-3 are vector dl324-3484- DELTA E3-H1-shmTGF- ⁇ 2 bacterial clone DNAs obtained after homologous recombination with HindIII and PacI. As a result of cutting and checking, clones 1,2 and 3 were newly recombined.
  • DNA from bacterial clones identified for homologous recombination was digested with PacI and transfected into a subclone of the 293 human embryonic kidney cell line (A93A) to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • the human decorin gene Obtained from InvivoGen (San Diego, CA, USA) and represented by SEQ ID NO: 6, as shown in Genebank BT019800.
  • the mouse decorin gene is Obtained from InvivoGen (San Diego, CA, USA) and represented by SEQ ID NO: 5, as shown in Genebank BC138564.
  • PCR products containing decorin were subcloned into pCA14.
  • dl324-BsttBI was linearized with BstBI
  • the shuttle vector pCA14-human decorin was linearized with XmnI and transformed to E. coli BJ5183 for homologous recombination.
  • Viruses obtained by homologous recombination were infected with DU-145 after proliferation and purification followed by titation, and then human decorin expression was confirmed by ELISA (FIG. 14).
  • Mouse decorin was obtained from pORF-mDCN (InvivoGen).
  • Defective type pCA14 (Micorvix, Canada) was used for the expression of mouse decorin.
  • a primer (sense: 5'- CGC GAATTC ATGAAGGCAACTCTCATCTTCTTCCTTC (EcoRI) [SEQ ID NO: 21]
  • antisense 5'- GCCG GTCGAC TTACTTGTAGTTTCCAAGTTGAATGGCTT (SalI) [SEQ ID NO: 22]
  • the non-replicating adenovirus expressing mouse decorin was homologous by linearizing dl324-BstBI with Bsp119 and the shuttle vector pCA14-mDCN with FspII. As a result, dl324-CMVp- ⁇ E1B55-mDCN was established.
  • Replicable adenoviruses expressing mouse decorin were homologous by linearizing dl324-BstBI with Bsp119 and the shuttle vector pVAX1-3484-mDCN with PmeI.
  • dl324-3484-CMVp- ⁇ E1B-mDCN was established (FIG. 15A).
  • 15B shows serum-free medium after 1 day of infection in DU-145 cells with non-replicating and replicable adenovirus transfected or loaded with a shuttle vector having a decorin gene to human DU-145. The amount of decorin released from the medium by incubation for 1 day was measured by ELISA.
  • DNA from bacterial clones identified with homologous recombination was digested with PacI and transformed into a subclone of the 293 human embryonic kidney cell line (A93A) cell line to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • shRNAs based on sense 25 mer / antisense 25 mer were constructed and introduced into shuttle vectors for expression in adenovirus and homologous recombination. (homologous recombination) virus was produced.
  • the experimental method is as follows.
  • Antisense 5'-AGCTTTTCCAAAAAACATGCGACCCCCTTTCACCTCTCTTGAAGGTGAAAGGGGGTCGCATGCG-3 'After constructing DNA oligonucleotides of [SEQ ID NO: 26], two DNA strands of sense and antisense for human shRNA candidates 1 and 2 were annealed, respectively, and then pSP72 ⁇ E3- U6-NC was cut with BamHI and HindIII to connect annealed DNA strands (both ends naturally have BamHI and HindIII recognition sites) to prepare pSP72 ⁇ E3-U6-shFoxP3 (FIG. 16).
  • FIG. 18 shows 500 ng and 1000 ng of shRNAs 1 and 2 pSP72 ⁇ E3-U6-shFoxP3 for human FoxP3 transfected into human prostate cancer cells DU145 and cultured for 48 hours, followed by Western blot for human FoxP3 2.
  • the results of the shRNA screening of the dogs confirmed the silencing effect of at least 50% on the shRNA corresponding to the second target.
  • Human target sequence '5-CAT GCG ACC CCC TTT CAC C -3' [SEQ ID NO: 8]
  • the shRNAs having 25/30 +9 loops were synthesized with respect to the target sequences, and their inhibitory effects on the target sequences were confirmed by Western blotting.
  • ShRNA for human target sequence (SEQ ID NO: 8): 5'- GATCCGCATGCGACCCCCTTTCACC TTCAAGAGA GGTGAAAGGGGGTCGCATGTTTTTTGGAAA -3 '[SEQ ID NO: 10]
  • ShRNA for mouse target sequence (SEQ ID NO: 7): 5'-5'- GAT CCG TAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TAT TTT TTG GAA A-3 '[SEQ ID NO: 9]
  • Top Strand 5'- GATCC GTATGCGACCCCCTTTCACC TTCAAGAGA GGTGA AAGGGGGTCGCATATTTTTTGGAAA-3 '[SEQ ID NO: 13]
  • oligonucleotides consisting of bases with sense and antisense sequences with TTCAAGAGA between them, and with BamHI and HindIII restriction enzyme sequences at both ends. And oligonucleotides were synthesized and annealed, respectively, and then adenovirus E3L (26591-28588) and E3R (30504-) were added to the pSP72 ⁇ E3 / si-negative vector (Fig. 11, pSP72 cloning vector (Promega)).
  • shRNA FoxP3 In order to introduce shRNA FoxP3 into human or mouse, the above-described pSP72 ⁇ E3 / si-negative plasmid was first treated with BamHI and HindIII, and then shRNA FoxP3 of human or mouse was inserted to insert pSP72 ⁇ E3-sh-human FoxP3 or pSP72 ⁇ . E3-sh-mouse FoxP3 was produced (FIGS. 16, 17). Negative control adenoviruses had BamHI and HindIII at both ends, and scrambled sequences (actaccgttgttataggtg) and loop (ttcaagaga) were prepared.
  • FIG. 17 confirmed that shFoxP3 sized DNA was obtained by cutting the cloned with pSP72 ⁇ E3-shhFoxP3 with BamHI / HindIII.
  • Figure 18 was confirmed that the DNA sequence No. 2 more effective by transfecting the confirmed shuttle DNA pSP72 ⁇ E3-shhFoxP3 1 and 2 to DU-145 (transfection) to determine how much FoxP3 levels in the cells.
  • the homologous recombination of the identified shuttle vector DNA (expressing FoxP3 shRNA 2) with the dl324-IX viral DNA vector is shown. At this time, the shuttle vector was cut with XmnI and linearized, and dl324-IX was cut with SpeI and linearized to transform E. coli BJ5183 to homologous recombination (FIG. 19).
  • lane dl324 / IX is the dl324 backbone;
  • the shuttle lane is pSP72-U6-sh-hFoxP3.
  • Lanes 1 to 13 show a result of amplifying the E3 region of the plasmid obtained from the bacterial clone after homologous recombination between the dl324 backbone and pSP72-shhFoxP3, and a band corresponding to about 1 kb should be positive.
  • lane dl324 / IX is the dl324 backbone;
  • the shuttle vector is pSP72-U6-hFoxP3.
  • Subsequent screening experiments in (a) of 20 indicate that both clones were homologous.
  • PCR was performed on the IX gene region, homologous recombination was confirmed using the difference between the dl324 backbone having the IX gene and the shuttle vector having no IX gene. As a result, # 1, 2, 4, 5, 9 and 13 were reselected.
  • Figure 20 (c) is finally confirmed whether the homologous recombination according to the difference in the pattern when the cut (cut) the HindIII of the backbone and the sample. Only # 9 clone of each DNA showed a different HindIII pattern from the existing dl324-IX (first left lane). DNA from other clones was of unknown origin. This means that only # 9 clone-derived DNA is homologous recombination of backbone adenovirus DNA with the shuttle vector, and thus the present invention is based on the # 9 clone.
  • Figure 20 (d) determines the final structure required for virus production by cutting the Ad-dl324-IX-sh-hFoxP3 inserted in the PacI site in the plasmid pPoly2 with PacI to determine whether pPoly2 is properly cleaved It is an experiment. DNA belonging to the # 9 clone identified in (c) of FIG. 20, when cut with PacI, pPoly2 backbone DNA corresponding to about 2 kb escaped. After confirmation, acevirus was produced by transfection of 293A cells together after PacI cleavage.
  • the E3 shuttle vectors prepared by the above method were treated with XmnI restriction enzymes to form single strands, and then SpeI restriction enzymes were simultaneously transformed with E. coli BJ5183 together with dl324, a non-replicable adenovirus. Gene homologous recombination was induced. Homologously recombined plasmid DNA was obtained and treated with HindIII restriction enzyme to confirm the change of DNA pattern and finally sequenced to confirm homologous recombination. The identified plasmids were cut with PacI and transformed into 293 cell lines to shRNA FoxP3. A non-replicating adenovirus expressing a was prepared.
  • a shRNA When a shRNA is produced in a replicable adenovirus, an inhibitor of a shRNA and a cell lysis effect are mixed, so that only an inhibitory effect is difficult to be clearly identified.
  • the adenovirus was grown in 293 cell lines and concentrated to CsCl gradients to determine the titer of the virus by limiting dilution or plaque assay. Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • FIG. 21 is a homologous recombination process between genomic DNA dl324-IX and shuttle vector pSP72 ⁇ E3-U6-shFoxP3, and mouse FoxP3 shRNA expressing viral DNA homologously recombined through HindIII pattern and PacI cutting of the generated DNA. Indicates that it is obtained.
  • mouse melanoma cells B16BL6 showed a silencing effect of 50% in adenoviruses of 1000 moi or more. Due to the relatively low infection rate compared to humans, a large amount of virus was infected and confirmed its effect [FIG. 23].
  • the U6 promoter site was removed by cleaving with BamHI between the Sph I and U6 promoters and the shTGF ⁇ 2 sequence between the E3 left and U6 promoters of pSP72 ⁇ E3 / U6-shTGF ⁇ 2.
  • DNA oligonucleotides having the H1 promoter sequence were prepared by annealing by inserting the top strand, the bottom strand having the SphI at the 3 'end and the BamHI site at the 5' end, respectively, to prepare pSP72 ⁇ E3 / H1-shTGF ⁇ 2 (FIG. 24).
  • DNA from bacterial clones identified with homologous recombination was digested with PacI and transformed into a subclone of the 293 human embryonic kidney cell line (A93A) cell line to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • Tumor-selective replicable adenoviruses expressing GM-CSF and decorin at the same time were constructed as follows.
  • the GM-CSF gene was inserted into MCS (multi cloning site) A of pIRES (Clontech), and the decorin gene was inserted into MCS B (FIG. 27).
  • Primers for PCR were constructed to subclone the human GM-CSF gene to the MCS A site with pIRES.
  • the sense strand is composed of 5'-CCG CTCGAG ATGTGGCTGC AGAGCCTGCT G-3 'having the XhoI site at the 5' end, and 5'-CCGACGCGTTCACTCCTGGACTGGCTCCCA-3 'having the MluI at the 5' end with the antisense strand [SEQ ID NO: 31].
  • PORF-hGMCSF was used as a PCR template, and after initial denaturation at -95 ° C 2 min, denaturation at -95 ° C 1 min, annealing -55 ° C 1 min, elongation -72 ° C 1 min was repeated 30 times. And finally 5 min of final elongation -72 °C.
  • Primers for PCR were constructed to subclone the human decorin gene to the MCS B site with pIRES.
  • the sense strand produced 5'-GGC TCTAGA ATGAAGGCCACTATCATCC-3 'having the XbaI site at the 5' end [SEQ ID NO: 32] and 5'-ATAGTTTAGCGGCCGCTTACTTATAGTTTCCGAG-3 'having the NotI at the 5' end with the antisense strand [SEQ ID NO: 33]. It was.
  • Primers for PCR were prepared to subclone the mouse GM-CSF gene to the MCS A site with pIRES.
  • the sense strand has 5'-CCG CTCGAG ATGTACAGGATGGAACTCCTGTCT-3 'having the XhoI site at the 5' end and 5'-CCGACGCGT TCATTTTTGGCCTGGTTTTTTGCA-3 'having the MluI at the 5' end with the antisense strand.
  • Primers for PCR were prepared to subclone the mouse decorin gene into the MCS B site with pIRES.
  • the sense strand is composed of 5'- gggg gtcgac ATGAAGGCAACTCTCATCTTCTTC-3 'having a SalI site at the 5' end and 5'-gggg gcggccgc TTACTTGTAGTTTCCAAGTTGAATGG-3 'having a NotI at the 5' end as an antisense strand.
  • the sense strand is composed of 5'- gggg gtcgac ATGAAGGCAACTCTCATCTTCTTC-3 'having a SalI site at the 5' end and 5'-gggg gcggccgc TTACTTGTAGTTTCCAAGTTGAATGG-3 'having a NotI at the 5' end as an antisense strand.
  • C1 is a control group with pIRES
  • C2 is a control group with two genes cloned into the pIRES vector similar to the sample with pIRES / mGM-CSF-hDCN, but the HindIII pattern is different, and lanes 1 to 4 are pIRES / mGM.
  • lane 3 was confirmed by HindIII.
  • Cloning into an oncolytic shuttle vector was performed as follows.
  • pIRES-mGMCSF-mDCN was cut with BglII and FspI to obtain mouse GM-CSF and mouse decorin.
  • pVAX1-3484-CMVp- ⁇ E1B-E1R was blunted after SalI treatment, BglII, and then linked to fragments of BglII and FspI (FIG. 29).
  • Viral DNA was transfected into melanoma cell line B16F10 (2 ⁇ g), and after 1 day, the medium was changed to serum-free medium, and then cultured for one day and measured for mouse GM-CSF and mouse decorin released into the medium. It was. As a result, it was confirmed by ELISA that mouse GM-CSF and mouse decorin are normally expressed from these DNAs [FIG. 32].
  • GM-CSF and human decorin are expressed from subcloned pCA14-3484-CMV- ⁇ E1B-hGMCSF-IRES-hDCN.
  • DNA from bacterial clones identified with homologous recombination was digested with PacI and transformed into a subclone of the 293 human embryonic kidney cell line (A93A) cell line to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • a part of the CMV-mGMCSF obtained in pCA14-mGMCSF obtained in Preparation Example 1 was obtained by cutting a portion into BglII (blunt) and SalI, and then connected to pVAX1-3484-CMVp- ⁇ E1B-E1R (after EcoRI / SalI) to perform subcloning. It was confirmed (FIG. 7).
  • PVAX1-3484-CMV- ⁇ E1B-E1R expressing mouse GM-CSF is shown in FIG. 6, and pVAX1-3484-CMV- ⁇ E1B-E1R expressing human GM-CSF was prepared in the same manner as in mouse. ( Figure 36).
  • dl324-BstBI- ⁇ E3-H1-shmTGF ⁇ 2 was prepared in step 1 of Preparation Example 2, dl324-BstBI was linearized with SpeI (site cut), and the shuttle vector pSP72 ⁇ E3 / shmTGF ⁇ 2 was linearized with XmnI and homologous to E. coli BJ5183. Recombination was performed (FIG. 37A).
  • Human GM-CSF and human shTGF- ⁇ 2 were also produced in the same manner as above with mice (FIG. 39).
  • the dl324- ⁇ 3-U6-shhTGF- ⁇ 2 backbone was enzymatically cut with Bsp1191, the shuttle (pVAX1-3484-mouse GM-CSF) was enzymatically cut with Pme I, linearized, and transformed into E. coli BJ5183 to perform homologous recombination.
  • DNA from bacterial clones identified with homologous recombination was digested with PacI and transformed into a subclone of the 293 human embryonic kidney cell line (A93A) cell line to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • Dl324-BstBI- ⁇ E3-H1-shmTGF ⁇ 2 in Preparation Example 2 was cut to BstBI sites.
  • the shuttle vector was linearized with pmeI of pVAX1-3484-CMVp- ⁇ E1B-E1R-mGMCSF-IRES-mDCN obtained in Preparation Example 6 to transduce E. coli BJ5183 to induce homologous recombination.
  • plasmid DNA was extracted from homologous recombination clones, cut into HindIII, and the pattern was compared with dl324-BstBI- ⁇ E3-H1-shmTGF ⁇ 2. PacI splitting was taking place.
  • DNA from bacterial clones identified for homologous recombination was digested with PacI and transfected into a subclone of the 293 human embryonic kidney cell line (A93A) to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • the fabrication was made in two stages.
  • the first step is homologous recombination of pSP72 ⁇ E3-U6-shFoxP3-H1-shTGF ⁇ 2 shuttle vector to dl324-BstBI.
  • dl324-BstBI is a SpeI enzyme and pSP72- ⁇ E3-U6-shmFoxP3-H1-shmTGF ⁇ 2 is XmnI.
  • Step 2 here again homologizes the pCA14-3484-CMVp- ⁇ E1B-GMCSF-IRES-DCN shuttle vector.
  • pCA14-3484-CMVp- ⁇ E1B-mGMCSF-IRES-mDCN was NruI enzyme
  • dl324- ⁇ E3-U6-shmFoxP3-H1-shmTGF ⁇ 2 was transformed to E. coli BJ5183 after cutting with BstBI enzyme [Fig. )].
  • six bacterial clones of about 50 clone DNAs were homologously recombined by HindIII test from each of the bacterial clones obtained (top of FIG. 46B), and only one of them showed PacI cleavage (bottom of FIG. 46B). ).
  • TGF- ⁇ 2 was markedly reduced in 500 moi and especially 1000 moi in B16BL6 mouse cells, and in the mRNA level, FoxP3 showed a decrease in transfection of the shuttle vector (FIG. 46A).
  • DNA from bacterial clones identified for homologous recombination was digested with PacI and transfected into a subclone of the 293 human embryonic kidney cell line (A93A) to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • Step 1 homologous recombination of the pSP72 ⁇ E3-U6-shFoxP3-H1-shTGF ⁇ 2 shuttle vector to dl324-BstBI, dl324-BstBI as the SpeI enzyme, and pSP72- ⁇ E3-U6-shmFoxP3-H1-shmTGF ⁇ 2 as XmnI
  • E. coli BJ5183 was transformed.
  • the DNA of each clone extracted from the bacteria was analyzed by HindIII pattern, and it was confirmed that homologous recombination of all of samples 1,2,3,4, PacI splitting was also normal (Fig. 42B).
  • Step 2 here again homologizes the pCA14-3484-CMV- ⁇ E1B-hGMCSF-IRES-hDCN shuttle vector.
  • pCA14-3484-hGMCSF-IRES-hDCN shuttle vector subcloned in Preparation Example 6 was cut and linearized with NruI, and the dl324-BstbI- ⁇ E3-U6-shhFoxp3-H1-shhTGF- ⁇ 2 backbone (Fig. 43 (1)) was cut and linearized with Bsp1191 and transformed into E. coli BJ5183 to induce homologous recombination. It was confirmed that clone 2 was properly homologous by HindIII pattern and PacI cleavage (FIG. 47).
  • DNA from bacterial clones identified with homologous recombination was digested with PacI and transformed into a subclone of the 293 human embryonic kidney cell line (A93A) cell line to produce adenoviruses.
  • the purified adenovirus obtained through dialysis was isolated by CsCl concentration gradient by ultracentrifugation in 293 cell lines, and titers were calculated using a standard plaque assay kit developed by Qbiogene (Carlsbad, CA, USA). Final virus titers ranged from 6 ⁇ 10 10 to 4 ⁇ 10 11 .
  • mouse GM-CSF and mouse decorin are normally expressed in B16F10, a mouse melanoma cell (FIG. 50).
  • Mouse melanoma cell line [KCLRF-BP-00313] 1 x 10 6 cell / 100 ⁇ l of cells were injected into the abdominal wall and 4 times (1 ⁇ 10 10 virus particle / 50 ⁇ l) every two days when the tumor size reached 60 mm 3 , Adenovirus (control oncolytic virus, oncolytic virus of Preparation Example 9, shTGF ⁇ 2 of Preparation Example 2) was infected. Six animals were used for each experimental group.
  • Human melanoma cells A375 1 ⁇ 10 7 cells / 100 ⁇ l were introduced into nude mice, and when the tumor reached 30-40 mm 3 , the 4m adenovirus and the control adenovirus of Preparation Example 10 were each concentrated at a concentration of 1 ⁇ 10 10 VP / 100 ⁇ l. Three times at two-day intervals, and six days later, the spleens, which are the immune organs of mice, were extracted. The isolated spleen was placed in a 50 ml conical tube containing 10 ml of culture medium (RPI 1640 media containing 10% FBS) and placed on the mesh and sprinkled with a 5 ml syringe plunge.
  • culture medium RPI 1640 media containing 10% FBS
  • the supernatant was removed by centrifugation for 5 minutes at 1500 rpm. After resuspension of the cells with 1 ml of 1X RBC lysis buffer, the cells were left at room temperature for 5 minutes to remove RBCs, filled with culture medium, and washed twice by centrifugation at 1500 rpm for 5 minutes. After the supernatant was removed, the cells were resuspensioned in 1 ml of the culture medium, and the cells were counted and dispensed into each well at 1 ⁇ 10 5 cells / 50 ⁇ l on a 96 well U bottom plate. After culturing the divided cells for 2 days, the amount of IFN- ⁇ and IL-12 in the culture medium was measured by ELISA.
  • the supernatant was removed by centrifugation at 1500 rpm for 5 minutes.
  • the cells were left at room temperature for 5 minutes to remove RBC, filled with culture medium to 14 ml, and centrifuged for 5 minutes at 1500 rpm for 5 minutes to remove the supernatant. Resuspension in ml. Count the cells and dispense each well at 1 ⁇ 10 5 cells / 50 ⁇ l on a 96 well U bottom plate, incubate the cells for 2 days and measure the amount of IFN- ⁇ and IL-12 in the culture medium by ELISA. It was.
  • Splenocytes were isolated from C57BL / 6 mice to obtain splenocytes in the same manner as in Example 3.
  • the mouse melanoma cell line [KCLRF-BP-00313] was divided into 2 ⁇ 10 5 cells, and 4 m adenovirus and control adenovirus of Preparation Example 9 were infected with 0, 5, 10, and 50 100 MOI, respectively, and after 2 days, the medium was cultured.
  • Mouse GM-CSF secreted into the medium was measured by ELISA.
  • Mouse melanoma cell line [KCLRF-BP-00313] was injected into the abdominal wall with 1 ⁇ 10 6 cell / 100 ⁇ l and three times (1 ⁇ 10 9 pfu /) with PBS negative control at two-day intervals when tumor size reached 60 mm 3 50 ⁇ l), adenovirus (control: control virus, oncolytic NC, C; oncolytic adenovirus-mGMCSF (G); oncolytic adenovirus-mDecorin (D); oncolytic adenovirus-shmFoxP3 (F); oncolytic adenovirus-shmTGF ⁇ 2 (T); oncolytic adenovirus-mGMCSF-mDecorin (GD); oncolytic adenovirus-mGMCSF-shmTGF ⁇ 2 (GT); oncolytic adenovirus-shmFoxP3-shmTGF ⁇ 2 (FT); oncolytic adenoviurs-mGMCSF-

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 GM-CSF 유전자 및 TGF-β2 발현을 억제하는 shRNA를 포함하는 항종양 조성물 및 GM-CSF 유전자; 데코린 유전자; TGF-β2 발현을 억제하는 shRNA; 및 FoxP3 발현을 억제하는 shRNA를 포함하는 항종양 조성물에 관한 것이다.

Description

ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물
본 발명은 GM-CSF 유전자 및 TGF-β2 발현을 억제하는 shRNA를 포함하는 항종양 조성물 및 GM-CSF 유전자; 데코린 유전자; TGF-β2 발현을 억제하는 shRNA; 및 FoxP3 발현을 억제하는 shRNA를 포함하는 항종양 조성물에 관한 것이다.
과립구-대식세포 콜로니 자극 인자(GM-CSF, Granulocyte-macrophage stimulating factor)는 다양한 방법으로 작용하는데, 우선 자연살상세포나 수지상세포(dendritic cell)와 같은 항원전달세포 등을 불러 모으는 역할을 한다. 또한, GM-CSF는 종양 근처에서 수지상세포를 자극하여 공동촉진 분자(costimulatory molecule)의 발현을 증가시켜 CD4+ 및 CD8+ T 세포들이 면역반응을 강화시켜 주는 역할을 하며, 수지상세포의 분화를 촉진시키는 기능 외에 일차 단핵구(primary monocyte)에서 MHC class II를 구성하는 분자들의 발현조절에도 관여하는 것으로 알려져 있다[J. Immunol. 171: 2374 by Hornell et al., 2003. Regulation of the class II MHC pathway in primary human monocytes by granulocyte-macrophage colony-stimulating factor]. 뿐만 아니라 종양 내에서 GM-CSF를 발현시키면 종양 주변으로 APC가 모이게 되고 종양 항원을 효과적으로 처리하여 항암면역반응을 강하게 유도하는 것으로 알려져 있다[Cancer Immunol. Immunother. 53: 17 by Pan et al., 2004 In situ recruitment of antigen-presenting cells by intratumoral GM-CSF gene delivery].
그러나, TGF-β2 발현을 억제하는 shRNA을 GM-CSF와 함께 사용하여 항종양 치료에 적용한 연구에 대해서는 아직까지 보고된 바 없다.
이에, 본 발명자들은 질병유발의 원인이 되는 단백질인 TGF-β2 종양 관련 유전자에 작용하는 shRNA 방식의 RNA 간섭을 이용하여 TGF-β2 발현을 억제하여 면역내성을 유발하는 요소를 제한하고 동시에 GM-CSF에 의한 면역증강반응을 유도하여 항종양 효과의 향상을 확인함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명은 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 GM-CSF 및 shTGF-β2 공동 발현용 유전자 전달체 및 이를 포함하는 항종양 조성물을 제공하는데 그 목적이 있다.
본 발명은 또한, 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 GM-CSF, 데코린, shTGF-β2 및 shFoxP3 공동 발현용 유전자 전달체 및 이를 포함하는 항종양 조성물을 제공하는데 다른 목적이 있다.
본 발명은 상기 과제를 해결하기 위한 수단으로서,
과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 GM-CSF 및 shTGF-β2 공동 발현용 유전자 전달체를 제공한다.
본 발명은 상기 과제를 해결하기 위한 다른 수단으로서,
과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 GM-CSF, 데코린, shTGF-β2 및 shFoxP3 공동 발현용 유전자 전달체를 제공한다.
본 발명은 상기 과제를 해결하기 위한 또 다른 수단으로서,
과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 항종양 조성물을 제공한다.
본 발명은 상기 과제를 해결하기 위한 또 다른 수단으로서,
과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 항종양 조성물을 제공한다.
본 발명은 질병유발의 원인이 되는 단백질인 TGF-β2 종양 관련 유전자에 작용하는 shRNA 방식의 RNA 간섭을 이용하여 TGF-β2 발현을 억제하여 면역내성을 유발하는 요소를 제한하고 동시에 GM-CSF에 의한 면역증강반응을 유도함으로써 항종양 효과를 향상시켰다.
특히, 본 발명은 GM-CSF와 데코린(Decorin)을 동시에 발현하고 TGF-β2와 FoxP3의 발현을 동시에 억제시킴으로써 항종양 효과를 현저히 향상시켰다.
즉, 본 발명에 의해 GM-CSF 유전자 및 TGF-β2 발현을 억제하는 shRNA를 포함하는 항종양 조성물; 및 GM-CSF 유전자, 데코린 유전자, TGF-β2 발현을 억제하는 shRNA 및 FoxP3 발현을 억제하는 shRNA을 포함하는 항종양 조성물이 제공된다. 특히, 대부분의 암세포에서 전달효율성이 뛰어난 아데노바이러스에 표적성을 부여함으로써 모든 암에 적용 가능하다.
도 1은 본 발명에 따른 재조합 아데노바이러스 벡터[(a) 제조예 7, (b) 제조예 10]를 나타낸 것이다.
도 2는 dl324 BstBI 벡터와 pCA14-mGM-CSF와의 상동재조합 제작과정(a)을 나타낸 것이고, 암세포 감염 후 mGM-CSF의 분비양(b)을 나타낸 것이다.
도 3은 dl324 BstBI 벡터와 pCA14-hGM-CSF와의 상동재조합을 확인한 것이다.
도 4a, 도 4b 및 도 4c는 pVAX1-3484-ΔE1B-E1R의 제작과정을 나타낸 것이다.
도 5는 셔틀벡터 pVAX1-3484-CMVp-ΔE1B-E1R의 클로닝을 확인한 것이다.
도 6은 셔틀벡터 pVAX1-3484-CMVp-ΔE1B-E1R을 나타낸 것이다.
도 7은 pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF은 SmaI로 잘라 마우스 GM-CSF 유전자의 도입을 확인한 것이다[레인 1: 대조군(pVAX1-3484-CMVp-ΔE1B-E1R, 레인 2: pVAX1-3484-CMVp-ΔE1B-mGMCSF-E1R).
도 8의 (a)는 HindIII 패턴을 확인한 것이며, (b)는 Pac I 패턴을 확인한 것이다.
도 9는 인간 GM-CSF를 발현하는 종양선택적 복제가능 아데노바이러스의 제작과정을 나타낸 것이다.
도 10은 pBSKⅡ-3484 벡터(a), pCA14-3484 벡터(b), pCA14-CMV-3484 벡터(c)와 pCA14-CMV-3484-ΔE1B55 벡터(d)를 나타낸 것이다.
도 11은 E3 셔틀 벡터인 pSP72ΔE3/si-negative 벡터를 나타낸 것이다.
도 12는 HindIII 패턴을 확인한 것이다.
도 13의 (a)는 pVAX1-3484-CMVp-ΔE1B-E1R를 나타낸 것이고, (b)는 E1 상동 재조합용 pVAX 셔틀벡터 완성을 제한효소 패턴으로 확인한 것이다.
도 13의 (a)는 pVAX1-3484-CMVp-ΔE1B-E1R를 나타낸 것이고, (b)는 E1 상동 재조합용 pVAX 셔틀벡터 완성을 제한효소 패턴으로 확인한 것이다[C: dl324-BstBI-ΔE3-H1-shmTGF-β2: 8010 5324 4947 4597 2937 2440 2081 1627 75, 레인 1~3: dl324-BstBI-ΔE3-H1-shmTGF-β2 상동재조합 후보: 8010 5324 4947 4597 2937 2884 2440 2081 1627 75].
도 14는 인간 데코린 발현을 ELISA로 확인한 것이다.
도 15a는 마우스 데코린 발현하는 종양선택적 복제가능 아데노바이러스의 상동재조합을 나타낸 것이다.
도 15b는 마우스 데코린 발현을 ELISA로 확인한 것이다.
도 16은 FoxP3 shRNA가 셔틀 벡터로 서브클로닝(subcloning)하는 과정의 모식도이다.
도 17은 FoxP3 shRNA가 셔틀 벡터로 서브클로닝(subcloning)됨을 나타낸 것이다[화살표: shGFP 대신 shFoxP3가 들어감. 맨 왼쪽의 두 번째 밴드에 비해 더 작아진 shFoxP3 사이즈가 삽입되었음을 의미. SphI/KpnI 사용 시 결과].
도 18은 인간 FoxP3 shRNA를 발현하는 셔틀벡터 플라스미드에 의한 FoxP3 발현 억제능을 웨스턴 블랏팅으로 확인한 것이다.
도 19는 dl324-IX 아데노바이러스 백본과 인간 FoxP3 shRNA를 발현하는 셔틀벡터와의 상동재조합한 모식도이다.
도 20은 실제로 재조합이 용이한 박테리아에서 상동재조합된 콜로니의 선별을 위하여, (a)는 아데노바이러스의 E3 부위 PCR 결과를 나타낸 것이고, (b)는 아데노바이러스의 IX 유전자 부위 PCR 결과를 나타낸 것이며, (c)는 (a)와 (b)에서 확인한 클론에서 HindIII 패턴 확인하여 9번 클론을 확인하고 (d)는 상동재조합된 아데노바이러스 게놈(genomic) DNA의 트랜스펙션(transfection) 가능 여부를 확인하는 PacI 절단 후 단편(fragment) DNA가 발현한 결과를 나타낸 것이다.
도 21은 마우스 FoxP3 포함하는 dl324-IX-E3-U6-FoxP3의 HindIII 절단 패턴(digestion pattern)으로 최종 재조합된 콜로니 선별을 확인한 것이다. 오른쪽은 PacI로 확인한 것이다.
도 22는 인간 FoxP3 shRNA를 발현하는 아데노바이러스에 의한 FoxP3 발현 억제능을 웨스턴 블랏팅으로 확인한 것이다.
도 23은 마우스 FoxP3 shRNA를 발현하는 아데노바이러스에 의한 FoxP3 발현 억제능을 웨스턴 블랏팅으로 확인한 것이다.
도 24 및 도 25는 pSP72△E3/U6-shFoxP3+H1-shTGFβ2 셔틀벡터 제작과정을 나타낸 것이다.
도 26a는 마우스 FoxP3와 TGF-β2의 shRNA를 발현하는 종양선택적 복제가능 아데노바이러스의 상동재조합을 나타낸 것이다.
도 26b는 사람의 A375에서 pSP72△E3/U6-shFoxP3+H1-shTGFβ2 셔틀벡터 형태로의 트랜스펙션 시 FoxP3 및 TGFβ2의 감소 효과를 실시간 PCR로 확인한 것이다.
도 27은 MCS(multi cloning site) A에는 GM-CSF 유전자를 삽입하고, MCS B에는 데코린 유전자를 삽입한 pIRES 벡터를 나타낸 것이다.
도 28은 pIRES/mGM-CSF-mDCN으로 서브클로닝을 HindIII로 확인한 것이다
도 29는 Oncolytic 셔틀벡터로의 클로닝을 나타낸 것이다
도 30은 pVAX1-3484-CMVp-△E1B-IRES-mGMCSF-mDCN 발현을 확인한 것이다.
도 31은 마우스 GM-CSF 및 마우스 데코린을 동시에 발현하는 아데노바이러스로의 상동재조합을 HindIII 및 PacI로 확인한 것이다.
도 32a 및 도 32b는 마우스 GM-CSF 및 마우스 데코린 발현을 ELISA로 확인한 것이다.
도 33은 pIRES-hGM-CSF로의 인간 데코린 유전자의 서브클로닝을 확인한 것이다.
도 34는 pCA14-3484-CMV-△E1B-hGMCSF-IRES-hDCN에서 유전자 삽입 여부를 확인한 것이다.
도 35a는 마우스 GM-CSF 및 마우스 데코린을 동시에 발현하는 아데노바이러스로의 상동재조합 모식도이다.
도 35b는 사람의 GM-CSF 및 데코린을 동시에 발현하는 플라스미드 형태의 셔틀벡터를 트랜스펙션하여 발현을 ELISA로 확인한 것이다.
도 36은 pVAX1-3484-CMV-△E1B-hGMCSF 제작을 위한 서브클로닝을 확인한 것이다.
도 37a는 dl324-BstBI와 셔틀벡터인 pSP72△E3-H1-shmTGF-β2 간의 1차 상동재조합 과정을 나타낸 것이다.
도 37b는 dl324-3484-CMVp-△E1B-mGMCSF-△E3-H1-shmTGFβ2 제작과정을 나타낸 것이다.
도 38은 dl324-BstB1-△E3-H1-shmTGFβ2와 pVAX1-3484-CMVp-△E1B-mGMCSF의 상동 재조합을 HindIII 및 PacI로 확인한 것이다.
도 39는 pVAX1-3484-hGMCSF 상동 재조합 과정을 나타낸 것이다.
도 40은 HindIII 패턴으로 상동 재조합된 DNA를 확인한 것이다.
도 41은 dl324-CMV-△E1B-mGMCSF-IRES-mDCN-△E3-H1-shmTGFβ2 바이러스 상동재조합을 HindIII 및 PacI로 확인한 것이다.
도 42a는 dl324△E3에 shmFoxP3와 shmTGFβ2를 상동재조합한 샘플들의 HindIII 패턴을 나타낸 것이다.
도 42b는 dl324△E3에 shhFoxP3와 shhTGFβ2를 상동재조합한 샘플들의 HindIII 패턴을 나타낸 것이다.
도 43a 및 도 43b는 dl324-3484-CMVp-△E1B-GMCSF-IRES-DCN-U6-shFoxP3-H1-shTGFβ2 제작과정을 나타낸 것이다.
도 44는 pCA14-3484-CMVp-△E1B-mGM-CSF-IRES-mDCN의 제작과정을 나타낸 것이다.
도 45는 pCA14-3484-CMVp-△E1B-mGM-CSF-IRES-mDCN을 트랜스펙션하였을 때 GM-CSF 및 데코린의 발현 여부를 ELISA로 확인한 것이다.
도 46a는 dl324-BstBI-△E3-U6-mFoxP3-H1-shmTGFβ2와 pCA14-3484-CMV-△E1B-mGMCSF-IRES-mDCN 간의 상동재조합 모식도 및 상동재조합으로 얻은 아데노바이러스에서 마우스세포주에 감염 시 마우스 TGFβ2의 mRNA 및 FoxP3의 mRNA 감소를 나타낸 것이다.
도 46b는 dl324-BstBI-△E3-U6-mFoxP3-H1-shmTGFβ2와 pCA14-3484-CMV-△E1B-mGMCSF-IRES-mDCN 간의 상동재조합으로 dl324-3484-CMVp-△E1B-mGMCSF-IRES-mDCN-U6-shFoxP3-H1-shTGFβ2 생성된 것을 HindIII (위 그림) 및 PacI (아래 그림)로 확인한 것이다 (마크표시: 상동재조합된 클론들).
도 47은 dl324-3484-CMVp-△E1B-GMCSF-IRES-DCN-U6-shFoxP3-H1-shTGFβ2의 상동재조합을 HindIII 및 PacI로 확인한 것이다.
도 48은 인간 흑색종 세포에서 FoxP3 또는 TGF-β2 mRNA 발현 억제를 실시간-PCR로 확인한 것이다.
도 49는 인간 GM-CSF 및 인간 데코린의 발현 여부를 ELISA로 확인한 것이다.
도 50은 마우스 GM-CSF 및 마우스 데코린의 발현 여부를 ELISA로 확인한 것이다.
도 51은 마우스 흑색종 세포에서 FoxP3 또는 TGF-β2 mRNA 발현 억제를 실시간-PCR로 확인한 것이다.
도 52는 항종양 효과를 나타낸 그래프이다.
도 53은 마우스 생존율을 확인한 것이다.
도 54는 항종양 효과를 나타낸 그래프이다.
도 55는 누드마우스에서 사람 유래 아데노바이러스에 의한 항종양 효과를 나타낸 것이다.
도 56은 누드마우스에서 사람 유래 아데노바이러스에 의한 면역활성 효과 확인한 것이다.
도 57은 C57BL/6 마우스에서 마우스 유래 아데노바이러스에 의한 면역활성 효과 확인한 것이다.
도 58은 In vitro에서 마우스 유래 아데노바이러스에 의한 면역활성 효과 확인한 것이다.
도 59는 마우스 유래 아데노바이러스에 의한 면역증강 효력 확인을 위한 조직화학적 검사를 결과이다.
도 60은 1~4종 유전자를 발현하는 아데노바이러스에 의한 항종양 효과를 확인한 것이다.
본 발명의 일 구현예에 따르면, 본 발명은 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 GM-CSF 및 shTGF-β2 공동 발현용 유전자 전달체를 제공한다.
본 발명의 일 구현예에 따르면, 본 발명은 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 GM-CSF, 데코린, shTGF-β2 및 shFoxP3 공동 발현용 유전자 전달체를 제공한다.
본 발명자들은 종양 특이적 면역활성과 종양의 면역원성을 증가시킴으로써 항종양 활성이 극대화된 유전자 항종양 조성물을 개발하고자 예의 연구 노력하였다. 그 결과, GM-CSF 및 shTGF-β2를 공동 발현하는 유전자 전달체를 이용하여 대상세포에 형질도입시킬 경우, 질병유발의 원인이 되는 단백질인 TGF-β2 종양 관련 유전자에 작용하는 shRNA 방식의 RNA 간섭을 이용하여 TGF-β2 발현을 억제하여 면역내성을 유발하는 요소를 제한하고 동시에 GM-CSF에 의한 면역증강반응을 유도함으로써 항종양 효과가 향상되는 것을 확인하였다.
GM-CSF, 데코린, shTGF-β2 및 shFoxP3 공동 발현용 유전자 전달체를 이용하여 대상세포에 형질도입시킬 경우, 각각의 유전자를 발현하는 경우 보다 특히 GM-CSF, shTGF-β2 발현하는 경우보다 항종양 효과가 더욱 뛰어남을 확인하였다.
본 명세서에서, 용어 "과립구-대식세포 콜로니 자극 인자(GM-CSF)"은 실시예에 예시된 GM-CSF뿐만 아니라, 면역증강반응을 유도하는 GM-CSF의 모든 유사체(homologues)를 포함한다.
마우스 GM-CSF 유전자는 Cancer Gene Therapy (2006) 13, 1061-1071에 나타낸 바와 같이, 서열번호 1로 표시된다.
인간 GM-CSF 유전자는 진뱅크 M11220에 나타낸 바와 같이, 서열번호 2로 표시된다.
본 명세서에서, 용어 "TGF-β2 발현을 억제하는 shRNA(shTGF-β2)"는 국내 특허 공개 제2013-0088792호로 개시된 것을 사용하였으며, 상기 shRNA는 서열번호 3 또는 서열번호 4로 표시된다.
본 명세서에서, 용어 "데코린(Decorin)"은 실시예에 예시된 데코린뿐만 아니라, 유전자 전달 효율을 증가시킬 수 있는 데코린의 모든 유사체(homologues)를 포함한다.
본 발명에서 유전자 전달 효율을 개선하는 데코린(decorin: DCN)은 SLRP (small leucine rich proteoglycan) 부류에 속하는 단백질로서 10-12개의 루이신 리치 리피트 (leucine rich repeat)로 구성되어 있으며, 코어 부위는 아치(arch) 형태로 되어 있어 세포외기질에 존재하는 여러 종류의 성장인자 또는 데코린 수용체와 결합이 용이한 구조로 형성되어 있다(Krusius T, Ruoslahti E., Proc Natl Acad Sci U S A, 1986, 83(20):7683-7687; Day AA, et al., Biochem J, 1987, 248(3):801-805; Fisher LW, Termine JD, Young MF., J Biol Chem, 1989, 264(8):4571-4576). 데코린은 종양 성장인자 (TGF)-β의 활성을 억제시킴으로써 콜라겐의 섬유화를 막고 세포외기질의 구성(matrix assembly)에 관여하고, 종양 세포 성장을 억제하여 종양의 형성과 성장에 천연 길항제 (antagonist)로 작용한다고 알려져 있다 (Iozzo RV., Crit Rev Biochem Mol Biol, 1997, 32(2):141-174; Isaka Y, et al., Nat Med , 1996, 2(4):418-423). 또한, 데코린은 성장인자나 금속이온과 같은 세포외기질의 구성 성분과 반응하여 MMP-1(matrix metalloproteinase-1)과 MMP-2 등의 발현을 촉진시켜 세포외기질을 분해시킨다 (Yamaguchi Y, Mann DM, Ruoslahti E., Nature, 1990, 346(6281):281-284; Vogel KG, Paulsson M, Heinegard D., Biochem J, 1984, 223(3):587-597; Danielson KG, et al., J Cell Biol, 1997, 136(3) :729-743).
마우스 데코린 유전자는 진뱅크 BC138564로 나타낸 바와 같이 서열번호 5로 표시된다.
인간 데코린 유전자는 진뱅크 BT019800로 나타낸 바와 같이 서열번호 6으로 표시된다.
본 명세서에서, 용어 "FoxP3 발현을 억제하는 shRNA(shFoxP3)"은 하기 서열을 표적서열로 할 수 있다.
마우스 표적서열: 5'- TAT GCG ACC CCC TTT CAC C - 3' [서열번호 7]
인간 표적서열 : 5'- CAT GCG ACC CCC TTT CAC C -3' [서열번호 8]
본 발명에서 FoxP3 발현을 억제하는 shRNA는 FoxP3 유전자의 일부에 상보적인 서열을 가지고, FoxP3 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있다. 상보성이 80-90%인 경우에는 mRNA의 번역을 억제할 수 있고, 100%인 경우에는 mRNA를 분해시킬 수 있다.
따라서, 본 발명에서 FoxP3 발현을 억제하는 shRNA는 마우스 mRNA의 1005~1023째 뉴클레오타이드에, 그리고 인간의 경우에도 동일한 부위인 인간 mRNA의 1005~1023번째 뉴클레오타이드에 대한 상보적인 서열에 대하여 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 100% 상동성을 갖는 염기서열을 포함할 수 있다.
한 양태로서, 마우스 shRNA는 서열번호 7(표적서열)에 나타낸 염기서열과 그의 상보적인 염기서열로 이루어지고, 인간 shRNA는 서열번호 8(표적서열)에 나타낸 염기서열과 그의 상보적인 염기서열로 이루어질 수 있다. 상기 각각의 염기서열과 그의 상보적인 염기서열은 9 bp의 루프 영역에 의해 회문적으로(palindrom) 연결되어 헤어핀 구조를 형성하는 것일 수 있다.
상기 shFoxP3의 구체적인 예로는 하기 서열을 포함할 수 있다:
서열번호 7의 마우스 표적서열로 하는 shRNA: 5'- GAT CCG TAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TAT TTT TTG GAA A-3' [서열번호 9]
서열번호 8의 인간 표적서열로 하는 shRNA: 5'- GAT CCG CAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TGT TTT TTG GAA A-3' 서열번호 10].
RNAi에 의해 FoxP3의 발현을 억제하는 물질로서는, 3'말단에 돌출부를 가지는 짧은 헤어핀 구조로 구성된 shRNA(short hairpin RNA)를 사용할 수도 있다.
RNAi에 의해 FoxP3의 발현을 억제하는 물질은, 인공적으로 화학 합성하여도 좋고, 센스 가닥 및 안티센스 가닥의 DNA 서열을 역방향으로 연결한 헤어핀 구조의 DNA를 T7 RNA 폴리머라제에 의해 실험실 조건(in vitro)에서 RNA를 합성하여 제작하여도 무방하다. 실험실 조건에서 합성하는 경우, T7 RNA 폴리머라제 및 T7 프로모터를 이용하여, 주형 DNA로부터 안티센스 및 센스 RNA를 합성할 수 있다. 이들을 실험실 조건에서 어닐링한 후, 세포에 도입하면 RNAi가 유발되어, FoxP3 mRNA의 분해를 유도한다. 세포에의 도입은 예를 들면, 인산칼슘법, 또는 각종 트랜스펙션 시약(예를 들면, oligofectamine, lipofectamine 및 lipofection 등)을 이용한 방법에 의해 행할 수 있다.
RNAi에 의해 FoxP3의 발현을 억제하는 물질로서는, shRNA 또는 상기 DNA을 포함하는 발현벡터를 이용하여도 좋고, 상기 발현벡터를 함유하는 세포를 이용하여도 좋다. 상기 발현벡터나 세포의 종류는 특별히 한정되지 않으나, 이미 의약으로서 사용되고 있는 발현벡터나 세포가 바람직하다.
본 발명에서는 서열번호 7 또는 서열번호 8로 표시되는 염기서열을 표적서열로 하는 shRNA를 이용할 수 있다.
따라서, 본 발명은 상기 shRNA 발현용 재조합 발현벡터를 포함한다.
본 발명의 재조합 벡터는 당해 분야에 공지된 재조합 DNA 방법에 의해 구성될 수 있다.
본 발명에서 shRNA를 전달하기에 유용한 바이러스 (또는 바이러스 벡터)로는 아데노바이러스, 레트로바이러스, 렌티바이러스, 아데노부속바이러스 등이 있으며, 종양에서와 같이 한시적인 발현 유도가 필요한 이유로 아데노바이러스가 바람직하다.
아데노바이러스에 상기 shRNA를 도입하기 위하여, shRNA 서열을 근거로 하여 하기 DNA를 제작할 수 있다.
<마우스 표적서열에 대한 DNA>
탑 스트랜드: 5'- GATCC GTATGCGACCCCCTTTCACC TTCAAGAGA GGTGA AAGGGGGTCGCATATTTTTTGGAAA - 3' [서열번호 11]
바텀 스트랜드: 5'- AGCTT TTCCAAAAAATATGCGACCCCCTTTCACC TCTCTTGAA GGTGAAAGGGGGTCGCATACG - 3' [서열번호 12]
<인간 표적서열에 대한 DNA>
탑 스트랜드: 5'- GATCCGCATGCGACCCCCTTTCACC TTCAAGAGA GGTGAAAGGGGGTCGCATGTTTTTTGGAAA - 3' [서열번호 13]
바텀 스트랜드: 5'-AGCTT TTCCAAAAAACATGCGACCCCCTTTCACC TCTCTTGAA GGTGAAAGGGGGTCGCATGCG - 3' [서열번호 14]
또한, 본 발명에서 shRNA를 전달하기에 유용한 비바이러스 벡터로는 전술한 바이러스 벡터를 제외한 통상적으로 유전자 요법에 사용되는 모든 벡터를 의미하며, 그러한 예로는 진핵세포에서 발현 가능한 다양한 플라스미드 및 리포좀 등이 있다.
한편, 본 발명에서 FoxP3 발현을 억제하는 shRNA는 전달된 세포에서 적절히 전사되기 위하여 적어도 프로모터에 작동 가능하게 연결되는 것이 바람직하다. 상기 프로모터는 진핵세포에서 기능할 수 있는 프로모터라면 어떤 것이든지 무방하나, U6 프로모터가 RNA 중합효소 Ⅲ로서 small size RNA를 생성하는데 유리한 이유로 특히 바람직하다. FoxP3 발현을 억제하는 shRNA의 효율적인 전사를 위하여 필요에 따라 리더 서열, 폴리아데닐화 서열, 프로모터, 인핸서(enhancer), 업스트림(upstream) 활성화 서열, 시그날 펩타이드 서열 및 전사 종결인자를 비롯한 조절서열을 추가로 포함할 수도 있다.
여기서, 이용된 용어 "작동 가능하게 연결된"이란 핵산 서열간의 결합이 기능적으로 연관되어 있는 것을 의미한다. 임의의 핵산서열이 작동 가능하게 연결된 경우는 임의의 핵산서열이 다른 핵산서열과 기능적으로 관련성을 가지도록 위치해 있는 경우이다. 본 발명에 있어서, 임의의 전사 조절서열이 shRNA의 전사에 영향을 미치는 경우, 상기 전사 조절서열이 상기 shRNA와 작동 가능하게 연결되어 있다고 말한다.
본 발명의 유전자 전달체를 제조하기 위해, GM-CSF 유전자 및 shTGF-β2; 또는 GM-CSF 유전자; 데코린 유전자, shTGF-β2 및 shFoxP3은 적합한 발현 구조체(expression construct) 내에 존재하는 것이 바람직하다. 상기 발현 구조체에서, 상기 유전자들은 프로모터에 작동적으로 결합되는 것이 바람직하다. 본 명세서에서, 용어 "작동적으로 결합된"은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열 사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다. 본 발명에 있어서, 본 발명의 상기 목적 유전자들에 결합된 프로모터는, 바람직하게는 동물세포, 보다 바람직하게는 포유동물 세포에서 작동하여 데코린 유전자의 전사를 조절할 수 있는 것으로서, 포유동물 바이러스로부터 유래된 프로모터 및 포유동물 세포의 지놈으로부터 유래된 프로모터를 포함하며, 예컨대, CMV(cytomegalo virus) 프로모터, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, HSV의 tk 프로모터, RSV 프로모터, EF1 알파 프로모터, 메탈로티오닌 프로모터, β-액틴 프로모터, 인간 IL-2 유전자의 프로모터, 인간 IFN 유전자의 프로모터, 인간 IL-4 유전자의 프로모터, 인간 림포톡신 유전자의 프로모터 및 인간 GM-CSF 유전자의 프로모터를 포함하나, 이에 한정되는 것은 아니다.
바람직하게는, 본 발명에 이용되는 발현 구조체는 폴리아네닐화 서열을 포함한다 (예: 소성장 호르몬 터미네이터 및 SV40 유래 폴리 아데닐화 서열).
본 발명의 유전자 전달체는 다양한 형태로 제작할 수 있는데, 이는 (i) 네이키드(naked) 재조합 DNA 분자, (ii) 플라스미드, (iii) 바이러스 벡터, 그리고, (iv) 상기 네이키드 재조합 DNA 분자 또는 플라스미드를 내포하는 리포좀 또는 니오좀의 형태로 제작할 수 있다.
GM-CSF 유전자 및 shTGF-β2; 또는 GM-CSF 유전자; 데코린 유전자, shTGF-β2 및 shFoxP3은 통상적인 유전자 치료에 이용되는 모든 유전자 전달체에 적용될 수 있으며, 바람직하게는 플라스미드, 아데노바이러스(Lockett LJ, et al., Clin. Cancer Res. 3:2075-2080(1997)), 아데노부속 바이러스(Adeno-associated viruses: AAV, Lashford LS., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), 레트로바이러스(Gunzburg WH, et al., Retroviral vectors. Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), 렌티바이러스(Wang G. et al., J. Clin. Invest. 104(11):R55-62(1999)), 헤르페스 심플렉스 바이러스(Chamber R., et al., Proc. Natl. Acad. Sci USA 92:1411-1415(1995)), 백시니아 바이러스(Puhlmann M. et al., Human Gene Therapy 10:649-657(1999)), 리포좀(Methods in Molecular Biology, Vol 199, S.C. Basu and M. Basu (Eds.), Human Press 2002) 또는 니오좀에 적용될 수 있다. 가장 바람직하게는, 본 발명의 유전자 전달체는 GM-CSF 유전자 및 shTGF-β2; 또는 GM-CSF 유전자; 데코린 유전자, shTGF-β2 및 shFoxP3을 아데노바이러스에 적용하여 제조된다.
i. 아데노바이러스
아데노바이러스는 중간 정도의 지놈 크기, 조작의 편의성, 높은 타이터, 광범위한 타깃세포 및 우수한 감염성 때문에 유전자 전달 벡터로서 많이 이용되고 있다. 지놈의 양 말단은 100-200 bp의 ITR (inverted terminal repeat)를 포함하며, 이는 DNA 복제 및 패키징에 필수적인 시스 엘리먼트이다. 지놈의 E1 영역 (E1A 및 E1B)은 전사 및 숙주 세포 유전자의 전사를 조절하는 단백질을 코딩한다. E2 영역 (E2A 및 E2B)은 바이러스 DNA 복제에 관여하는 단백질을 코딩한다. 현재 개발된 아데노바이러스 벡터 중에서, E1 영역이 결여된 복제 불능 아데노바이러스가 많이 이용되고 있다. 한편, E3 영역은 통상적인 아데노바이러스 벡터에서 제거되어 외래 유전자가 삽입되는 자리를 제공한다(Thimmappaya, B. et al., Cell, 31:543-551(1982); 및 Riordan, J. R. et al., Science, 245:1066-1073(1989)).
따라서, 본 발명의, GM-CSF 유전자 및 TGF-β2 발현을 억제하는 shRNA은 결실된 E1 영역(E1A 영역 및/또는 E1B 영역, 바람직하게는 E1B 영역) 또는 E3 영역에 삽입되는 것이 바람직하다. 본 명세서에서 바이러스 지놈 서열과 관련하여 사용되는 용어,“결실”은 해당 서열이 완전히 결실된 것뿐만 아니라, 부분적으로 결실된 것도 포함하는 의미를 가진다.
또한, 아데노바이러스는 야생형 지놈의 약 105%까지 패킹할 수 있기 때문에, 약 2 kb를 추가적으로 패키징할 수 있다(Ghosh-Choudhury et al., EMBO J., 6:1733-1739(1987)). 따라서, 아데노바이러스에 삽입되는 상술한 외래 서열은 아데노바이러스의 지놈에 추가적으로 결합시킬 수도 있다. 아데노바이러스는 42개의 상이한 혈청형 및 A-F의 서브그룹을 갖는다. 이 중에서, 서브그룹 C에 속하는 아데노바이러스 타입 5가 본 발명의 아데노바이러스 벡터를 얻기 위한 가장 바람직한 출발물질이다. 아데노바이러스 타입 5에 대한 생화학적 및 유전적 정보는 잘 알려져 있다. 아데노바이러스에 의해 운반되는 외래 유전자는 에피좀과 동일한 방식으로 복제되며, 이에 숙주세포에 대해 유전적 독성이 매우 낮다. 따라서, 본 발명의 아데노바이러스 유전자 전달 시스템을 이용한 유전자 치료가 매우 안전할 것으로 판단된다.
ii. 레트로바이러스
레트로바이러스는 자신의 유전자를 숙주의 지놈으로 삽입시키고, 대량의 외래 유전 물질을 운반할 수 있으며, 감염시킬 수 있는 세포의 스펙트럼이 넓기 때문에 유전자 전달 벡터로서 많이 이용되고 있다.
레트로바이러스 벡터를 구축하기 위하여, 운반하고자 하는 목적 뉴클레오타이드 서열은 레트로바이러스의 서열 대신에 레트로바이러스 지놈에 삽입되어 복제 불능의 바이러스를 생산한다. 바이리온을 생산하기 위하여, gag, pol 및 env 유전자를 포함하지만 LTR(long terminal repeat)와 Ψ서열은 없는 패키징 세포주를 구축한다(Mann et al., Cell, 33:153-159(1983)). 운반하고자 하는 목적 뉴클레오타이드 서열, LTR 및 Ψ서열을 포함하는 재조합 플라스미드를 상기 세포주에 이입하면, Ψ서열은 재조합 플라스미드의 RNA 전사체의 생산을 가능하게 하며, 이 전사체는 바이러스로 패키징되고, 바이러스는 배지로 배출된다(Nicolas and Rubinstein "Retroviral vectors," In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt(eds.), Stoneham: Butterworth, 494-513(1988)). 재조합 레트로바이러스를 함유하는 배지를 수집하고 농축하여 유전자 전달체로 이용한다.
2세대 레트로바이러스 벡터를 이용한 유전자 전달이 발표되었다. Kasahara et al. Science, 266:1373-1376(1994))는 몰로니 뮤라인 류케미아 바이러스(MMLV)의 변이체를 제조하였고, 여기에서 EPO(erythropoietin) 서열을 엔벨로프 부위에 삽입하여 새로운 결합 특성을 갖는 키메릭 단백질을 생산하였다. 본 발명의 유전자 전달체도 이와 같은 2세대 레트로바이러스 벡터의 구축 전략에 따라 제조할 수 있다.
iii. AAV 벡터
아데노부속 바이러스(AAV)는 비분열 세포을 감염시킬 수 있고, 다양한 종류의 세포에 감염할 수 있는 능력을 갖고 있기 때문에 본 발명의 유전자 전달체로 적합하다. AAV 벡터의 제조 및 용도에 대한 상세한 설명은 미국 특허 제 5,139,941 호 및 제 4,797,368 호에 상세하게 개시되어 있다.
유전자 전달체로서의 AAV에 대한 연구는 LaFace et al, Viology, 162:483486(1988), Zhou et al., Exp. Hematol. (NY), 21:928-933(1993), Walsh et al, J. Clin. Invest., 94:1440-1448(1994) 및 Flotte et al., Gene Therapy, 2:29-37(1995)에 개시되어 있다. 최근에, AAV 벡터는 낭포성 섬유증의 치료제로서 임상 I을 실시하고 있다.
전형적으로, AAV 바이러스는 두 개의 AAV 말단 리피트가 옆에 위치되어 있는 [0033] 목적의 유전자 서열을 포함하는 플라스미드(McLaughlin et al., J. Virol., 62:1963-1973(1988); 및 Samulski et al., J. Virol., 63:3822-3828(1989)) 및 말단 리피트가 없는 야생형 AAV 코딩 서열을 포함하는 발현 플라스미드(McCarty et al., J. Virol., 65:2936-2945( 1991))를 동시 형질전환시켜 제조된다.
iv. 다른 바이러스 벡터
다른 바이러스 벡터들도 본 발명의 유전자 전달체로 이용할 수 있다. 백시니아 바이러스(Puhlmann M. et al., Human Gene Therapy 10:649-657(1999); Ridgeway, "Mammalian expression vectors," In: Vectors: A survey of molecular cloning vectors and their uses. Rodriguez and Denhardt, eds. Stoneham: Butterworth, 467-492(1988); Baichwal and Sugden, "Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes," In: Kucherlapati R, ed. Gene transfer. New York: Plenum Press, 117-148( 1986) 및 Coupar et al., Gene, 68:1-10(1988)), 렌티바이러스(Wang G. et al., J. Clin. Invest. 104(11):R55-62(1999)) 또는 헤르페스 심플렉스 바이러스(Chamber R., et al., Proc.
Natl. Acad. Sci USA 92:1411-1415(1995))로부터 유래된 벡터들도, 운반하고자 하는 목적 뉴클레오타이드 서열을 세포 내로 운반할 수 있는 운반 시스템으로 이용할 수 있다.
v. 리포좀
리포좀은 수상에 분산된 인지질에 의해 자동적으로 형성된다. 외래 DNA 분자를 리포좀으로 성공적으로 세포 내로 운반한 예는 Nicolau 및 Sene, Biochim. Biophys. Acta, 721:185-190(1982) 및 Nicolau et al., Methods Enzymol., 149:157-176(1987)에 개시되어 있다. 한편, 리포좀을 이용한 동물세포의 형질전환에 가장 많이 이용되는 시약으로는 리포펙타민(Lipofectamine, Gibco BRL)이 있다. 운반하고자 하는 목적 뉴클레오타이드 서열을 내포한 리포좀은 엔도사이토시스, 세포 표면에로의 흡착 또는 플라즈마 세포막과의 융합 등의 기전을 통해 세포와 상호작용하여 세포 내로 운반하고자 하는 목적 뉴클레오타이드 서열을 운반한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 유전자 전달체는 재조합 아데노바이러스 벡터이다.
본 발명의 보다 바람직한 구현예에 따르면, 본 발명의 재조합 아데노바이러스 벡터는 E1B 및 E3 영역이 결실된 것이고, 상기 GM-CSF 유전자는 결실된 E1B 영역에 삽입되며, 상기 TGF-β2 발현을 억제하는 shRNA은 결실된 E3 영역에 삽입된다. 또한, 4종 유전자가 도입된 재조합 아데노바이러스 벡터는, 상기 GM-CSF 유전자 및 데코린 유전자는 결실된 E1B 영역에 삽입되며, 상기 shTGF-β2 및 shFoxP3은 결실된 E3 영역에 삽입된다
활성의 E1A 유전자를 포함하는 재조합 아데노바이러스는 복제 가능한 특성을 갖게 되고, E1B 영역이 결실되는 경우에는 세포 고사능을 증대시킬 수 있다. 본 명세서에서 바이러스 지놈 서열과 관련하여 사용되는 용어“결실”은 해당 서열이 완전히 결실된 것뿐만 아니라, 부분적으로 결실된 것도 포함하는 의미를 가진다. 본 발명의 재조합 아데노바이러스는 변이되지 않은 E1A 유전자를 포함하거나 또는 변이된 활성의 E1A 유전자를 포함할 수 있다.
가장 바람직하게는, 본 발명의 재조합 아데노바이러스 벡터는 결실된 E1 영역에 5’에서 3’방향으로 GM-CSF 유전자, 및 결실된 E3 영역에 5’에서 3’방향으로 TGF-β2 발현을 억제하는 shRNA을 포함한다(도 1의 (a)).
또한, 4종 유전자가 도입된 재조합 아데노바이러스 벡터는 결실된 E1 영역에 5’에서 3’방향으로 GM-CSF 유전자, IRES(internal ribosome entry site), 데코린 유전자, E3 영역에 5’에서 3’방향으로 shFoxP3 및 shTGF-β2를 포함한다(도 1의 (b)).
본 발명의 다른 양태에 따르면, 본 발명은 상기 유전자 전달체를 포함하는 항종양 조성물을 제공한다.
본 발명의 약제학적 조성물에 유효성분으로 포함되는 유전자 전달체는 상술한 본 발명의 유전자 전달체와 동일한 것이므로, 유전자 전달체에 대한 상세한 설명은 본 발명의 약제학적 조성물에도 그대로 적용된다. 따라서, 본 명세서의 불필요한 반복 기재에 의한 과도한 복잡성을 피하기 위하여 공통 사항은 그 기재를 생략한다.
본 발명의 다른 양태에 따르면, 본 발명은 GM-CSF 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 항종양 조성물, 또는 GM-CSF 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 항종양 조성물을 제공한다.
본 발명의 조성물에 포함되는 재조합 아데노바이러스는 상술한 바와 같이, 다양한 종양 세포에 대하여 살상 효능을 나타내므로, 본 발명의 약제학적 조성물은 종양과 관련된 다양한 질병 또는 질환, 예컨대 위암, 폐암, 유방암, 난소암, 간암, 기관지암, 비인두암, 후두암, 췌장암, 방광암, 결장암 및 자궁경부암 등의 치료에 이용될 수 있다. 본 명세서에서 용어 “치료”는 (i) 종양 세포 형성의 예방; (ii) 종양 세포의 제거에 따른 종양과 관련된 질병 또는 질환의 억제; 및 (iii) 종양 세포의 제거에 따른 종양과 관련된 질병 또는 질환의 경감을 의미한다. 따라서, 본 명세서에서 용어“치료학적 유효량”은 상기한 약리학적 효과를 달성하는 데 충분한 양을 의미한다.
본 발명의 조성물에 포함되는 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명의 약제학적 조성물은 비경구 투여가 바람직하고, 예컨대 정맥내 투여, 복강내 투여, 근육내 투여, 피하 투여 또는 국부 투여를 이용하여 투여할 수 있다. 난소암에서 복강 내로 투여하는 경우 및 간암에서 문맥으로 투여하는 경우에는 주입 방법으로 투여할 수 있고, 유방암의 경우에는 종양 매스에 직접 주사하여 투여할 수 있으며, 결장암의 경우에는 관장으로 직접 주사하여 투여할 수 있고, 방광암의 경우에는 카테터 내로 직접 주사하여 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 질병 증상의 정도, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 목적하는 치료에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 일반적으로, 본 발명의 약제학적 조성물은 1 × 105 ~ 1 × 1015 pfu/㎖의 재조합 아데노바이러스를 포함하며, 통상적으로 1 × 108 ~ 1 × 1012 pfu를 이틀에 한번씩 2주 동안 주사한다.
본 발명의 약제학적 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화됨으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질 중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약제학적 조성물은 단독의 요법으로 이용될 수 있으나, 다른 통상적인 화학 요법 또는 방사 요법과 함께 이용될 수도 있으며, 이러한 병행 요법을 실시하는 경우에는 보다 효과적으로 암 치료를 할 수 있다. 본 발명의 조성물과 함께 이용될 수 있는 화학 요법제는 시스플라틴(cisplatin), 카르보플라틴(carboplatin), 프로카르바진(procarbazine), 메클로레타민(mechlorethamine), 시클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 멜팔(melphalan), 클로라부실(chlorambucil), 비술판(bisulfan), 니트로소우레아(nitrosourea), 디악티노마이신(dactinomycin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 블레오마이신(bleomycin), 플리코마이신(plicomycin), 미토마이신(mitomycin), 에토포시드(etoposide), 탁목시펜(tamoxifen), 택솔(taxol), 트랜스라티눔(transplatinum), 5-플루오로우라실(5-fluorouracil), 빈크리스틴(vincristin), 빈블라스틴(vinblastin) 및 메토트렉세이트(methotrexate) 등을 포함한다. 본 발명의 조성물과 함께 이용될 수 있는 방사 요법은 X-선 조사 및 γ-선 조사 등이다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 면역활성 및 면역원성을 증대시킨다.
또한, 본 발명은 상기 유전자 전달체를 도입한 아데노바이러스를 제공한다.
본 발명에서 RNAi를 위한 핵산 분자를 전달하기에 유용한 바이러스(바이러스 벡터)로는 아데노바이러스, 레트로바이러스, 렌티바이러스, 아데노부속 바이러스, 등이 있으며, 종양에서와 같이 한시적인 발현 유도가 필요한 이유로 아데노바이러스가 바람직하다.
이하, 본 발명에 따르는 실시예를 통하여 본 발명을 보다 상세히 설명하나, 본 발명의 범위가 하기 제시된 실시예에 의해 제한되는 것은 아니다.
참조예 1: GM-CSF 유전자 준비
마우스 GM-CSF 유전자는 Dr. Gerald C. O'Sullivan (Cork Cancer Research Centre, Mercy University Hospital and Leslie C. Quick Jnr. Laboratory, University College Cork, Cork, Ireland)로부터 입수하였으며, 염기서열은 Cancer Gene Therapy (2006) 13, 1061-10710에 나타낸 바와 같고, 서열번호 1로 표시된다.
인간 GM-CSF 유전자는 InvivoGen로부터 입수하였으며, 염기서열은 진뱅크 M11220에 나타낸 바와 같고, 서열번호 2로 표시된다.
제조예 1: GM-CSF 발현 아데노바이러스 제작
1) 복제불능 아데노바이러스 제작
바이러스의 제작을 위하여 Dr O'Sullivan으로부터 기증받은 pMG-mGM-CSF의 마우스 GM-CSF 유전자로부터 Microvix사의 pCA14 벡터에 삽입하여 pCA14-mGM-CSF 셔틀벡터를 제작하였다. 이렇게 얻은 셔틀벡터는 XmnI으로 절단한 후, 복제불능바이러스 제작을 위해 BstBI으로 절단하여 단일가닥으로 전환된 아데노바이러스 backbone DNA dl324 BstBI(Heider, H et al., Biotechniques, 28(2):260-270, 2000)와 함께 대장균 BJ5183(Addgene에서 구입)에 형질전환시켜 상동 재조합을 유도함으로써 면역활성화 사이토카인을 발현하는 아데노바이러스 dl324-mGM-CSF를 제작하였다[도 2].
제작된 바이러스로부터 발현되는 사이토카인의 생성량을 측정하기 위해서 B16F10 마우스 흑색종 세포에 여러 농도의 MOI로 감염시키고 감염 후 48시간 후에 배지를 수거하여 ELISA 분석으로 분비되는 양을 측정하였다.
mGM-CSF 유전자 PCR을 위하여 프라이머의 5'과 3' 양 끝단에 XhoI/ HindIII 부위를 각각 사용하였다.
센스 프라이머: ccg ctc gag atg tac agg atg caa ctc ctg tct [서열번호 15]
안티센스 프라이머: ccc aag ctt tca ttt ttg gcc tgg ttt ttt gca [서열번호 16]
PCR 조건:
변성-95 ℃ 1 min, 어닐링-55 ℃ 1 min, 신장-72 ℃ 1 min -> 30 cycle
72 ℃ 5 min
마우스 GM-CSF를 발현하는 복제불능 아데노바이러스를 인간 전립선암세포에 감염시켜 24시간 후 배지를 무혈청 배지로 교체한 후 다시 24시간 배양하여 배지 내로 분비된 mGM-CSF를 ELISA로 측정하였다. 도 2는 dl324 BstBI벡터와 pCA14-mGM-CSF와의 상동재조합에 해당되는 도면(우)과 100 MOI로 감염되었을 때 24시간 동안 약 600 pg/ml의 mGM-CSF 양이 분비되고 있음(좌)을 보여주었다.
인간 GM-CSF 유전자는 pORF-hGM-CSF(InvivoGen)로부터 얻었다.
인간 GM-CSF 프라이머(센스 프라이머: 5'- TAT CTC GAG ATG TGG CTG CAG AGC CTG CTG (XhoI) [서열번호 17], 안티센스 프라이머: 5'- GGT AAG CTT TCA CTC CTG GAC TGG CTC CCA (HindIII)) [서열번호 18]을 사용하여 다음과 같은 조건의 PCR을 실시하였다.
PCR 조건:
예열-95 ℃ 2분,
변성-95 ℃ 1분, 어닐링-65 ℃ 1 분, 신장-72 ℃ 1분 -> 30 cycle
72 ℃ 5 분
인간 GM-CSF 유전자를 PCR 후, gel extraction으로 DNA를 얻고, XhoI과 HindIII로 자른 후 XhoI과 HindIII로 자른 pCA14와 연결하여 pCA14-hGM-CSF를 얻었다.
인간 GM-CSF를 발현하는 복제 불능 아데노바이러스는 dl324 벡터는 BstB1으로 효소 컷팅(enzyme cutting)하고, pCA14-hGM-CSF는 XmnI으로 효소 컷팅하여 대장균 BJ5183에 형질전환(transformation)하여 상동 재조합을 진행하였다.
도 3의 레인 3은 dl324-BstB1 벡터와 pCA14-hGM-CSF의 상동재조합된 것을 보여주고 있다.
2) 복제가능 아데노바이러스 제작- dl324-3484-CMV-ΔE1B-mGM-CSF
pVAX1 플라스미드(Life Technologies)를 이용한 E1 셔틀벡터를 만드는 과정은 다음과 같다.
먼저, pBSKII-3484[합성한 3484 염기DNA (inverted terminal repeats-packaging signal-mouse survivin promoter-E1A-BGH poly A-E1B 55 kDa gene cassette)가 HindIII/BamHI site로 pBSKII안에 들어간 형태임]의 [ITR-Ψ-mSurp-E1A-BGHpA] 부분을 HindⅢ, EcoRⅠ을 이용하여 pVAX1 플라스미드에 클로닝하였다. 그렇게 하여 pVAX1-3484-△E1B를 얻었다. 그런 다음, pCA14의 [SV40-E1R] 부분을 EcoRⅠ, StuⅠ(blunt) 을 이용하여 pVAX1-3484-ΔE1B 플라스미드에 클로닝하여 pVAX1-3484-ΔE1B-E1R를 제작하였다. pVAX1-3484-ΔE1B 벡터는 EcoRⅠ, ApaⅠ(blunt) 이용하였다(도 4).
그 다음 pVAX1-3484-ΔE1B-E1R의 MSP(mouse surviving promoter)를 KpnⅠ, XhoⅠ이용하여 CMV 프로모터로 변경하였다. 도 5는 셔틀벡터 pVAX1-3484-CMVp-ΔE1B-E1R 및 이의 제작과정 중간생성 plasmid construct들이 제대로 서브클로닝되는지 보여주는 제한효소에 의해 절단된 DNA 단편지도를 나타낸 것이다.
pCA14-mGM-CSF에서 [CMVp-mGM-CSF] 부분을 BglⅡ(blunt), SalⅠ을 이용하여 자르고, pVAX1-3484-CMVp-ΔE1B-E1R 셔틀벡터를 EcoRⅠ(blunt), SalⅠ로 자른 후에 클로닝하였다(도 6). 그 결과, pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF은 SmaI로 잘라 삽입된 것을 확인하였다(도 7).
dl324-BstB1 + pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF
dl324-BstBI 백본은 Bsp1191로 자르고 pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF 셔틀 벡터는 Pme I로 잘라 선형화(linearization)시킨 후 상동 재조합하였다(도 7).
도 8의 (a)는 HindIII 패턴 확인하여 1~6 클론 모두 재조합된 것을 보이며 (b)는 Pac I로 잘리는지 재차 확인하였다.
인간 GM-CSF를 발현하는 종양선택적 복제가능 아데노바이러스 제작
인간 GM-CSF를 발현하는 기존 pCA14-hGM-CSF로부터 BglII(blunt) 후 SalI으로 잘랐다. 이것을 아가로스 겔에서 전개시켜 hGM-CSF 유전자를 빼내고 pVAX1-3484-CMVp-ΔE1B-E1R을 EcoRI으로 자르고 블런팅 후 SalI으로 잘라 hGM-CSF DNA와 연결시켰다. 종양선택적 복제가능 아데노바이러스를 제작하기 위해 dl324 Δ3-백본은 Bsp1191로 자르고 셔틀벡터는 Pme I로 잘랐다. 그리고 대장균 BJ5183에 형질전환(transformation)하여 상동 재조합을 실시함으로써 아데노바이러스 dl324-3484-CMVp-ΔE1B-hGM-CSF를 제작하였다(도 9). 도 9의 레인 1~5는 상동 재조합되었다.
상동 재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
참조에 2: TGF-β2 발현을 억제하는 shRNA(shTGFβ2) 제작
국내 출원 제2013-0010233호에 개시된 바와 같이 서열번호 3 또는 서열번호 4로 표시되는 TGF-β2 발현을 억제하는 shRNA(이하, shTGFβ2라 명함)을 제작하였다.
제조예 2: 마우스 shTGFβ2를 발현하는 아데노바이러스 제작
종양 선택적 살상 복제 가능한 아데노바이러스를 만들기에 앞서 아데노바이러스의 E1A부분에 여러 유전자를 넣을 수 있는 셔틀 벡터를 제작하고자 pBSKII 플라스미드[Stratagene, USA]에 E1A와 E1B55kDa 유전자를 포함하며 다양한 효소 부위(Enzyme site)를 포함하는 pBSKⅡ-3484 합성 유전자를 제작하였다[도 10의 (a)]. 합성된 유전자를 상동 재조합 확인을 용이하게 하기 위한 pCA14 셔틀벡터에 도입하기 위한 형태로 바꾸기 위하여 pBSKⅡ-3484를 PCR하여 FspⅠ로 제한효소를 처리한 뒤 블런팅(blunting) 효소로 블런트 엔드(blunt end)를 만들고 다시 BamHⅠ으로 처리하였다. pCA14[Microbix BiosystemsInc, Canada]는 SspⅠ으로 제한효소를 이용하여 자른 후 블런팅 효소를 이용하여 블런트 엔드를 만든 후, BglⅡ를 처리하여 동일전달 제한효소(Isoschizomer)인 BamHⅠ과 BglⅡ 그리고 양끝의 블런트 엔드를 통해 합성된 유전자를 삽입하여 셔틀 벡터 pCA14-3484를 제작하였다[도 10의 (b)]. 그 후 CMV 프로모터 유전자를 KpnⅠ과 XhoⅠ로 pCA14-3484에 삽입하여 pCA14-CMV-3484를 제작[도 10의 (c)]. 그리고 pCA14-3484-CMV에서 EcoRI과 SalI 제한효소의 의해 E1B55kDa 부분을 자르고 블런팅(blunting)한 후 다시 연결(ligation)된 pCA14-3484-CMV-ER1를 얻었다[도 10의 (d)].
1단계-dl324-BstB1-ΔE3-H1-shmTGFβ2 제작
pSP72△E3/si seq(도 11)의 E3-left와 U6 프로모터 사이에 있는 Sph I과 BamHI으로 절단해 H1 프로모터와 shmTGF-β2를 삽입하여 pSP72△E3/H1-shTGF-β2를 제작하였다.
IX 유전자가 없는 dl324-BstBⅠ-를 SpeI으로 자른 후 XmnI으로 자른 pSP72△E3/H1-shmTGFβ2와 대장균 BJ5183에서 동시에 형질전환시켜 상동재조합을 유도 후 HindIII 패턴을 확인하였다. 재조합된 2번의 HindIII 패턴 후와 4번의 PacI 절단 후 패턴을 모두 확인하였다(도 12).
2 단계-dl324-BstB1-ΔE3-H1-shmTGFβ2 + pVAX1-3484-CMV-ΔE1B-E1R 상동 재조합
1) pVAX1-3484-CMVp-ΔE1B-E1R 제작
pVAX1 벡터(도 4)에 pBSKⅡ-3484(도 10의 (a))의 [ITR-Ψ-mouse Survivin promoter-E1A-BGHpA] 부분을 HindⅢ, EcoRⅠ를 이용하여 서브클로닝하였다. pCA14(Microvix, Canada)의 [SV40-E1R] 부분을 EcoRⅠ, StuⅠ (blunt)을 이용하여 앞에 만들어진 벡터에 서브클로닝하였다. pVAX1-3484-ΔE1B 벡터는 EcoRⅠ, ApaⅠ(blunt)을 이용하였다(도 4).
그런 다음, pVAX1-3484-ΔE1B-E1R의 마우스 서바이빈(surviving) 프로모터를 KpnⅠ, XhoⅠ를 이용하여 CMV 프로모터로 변경하였다(도 6).
dl324-BstBⅠ-ΔE3-H1-shmTGFβ2는 BstBⅠ로 잘라 선형화시키고 pVAX1-3484-CMVp-ΔE1B-E1R은 PmeⅠ로 잘라 선형화시켜 상동재조합하였다(도 13의 (a)). 도 13의 (b)는 E1 상동재조합용 pVAX 셔틀벡터 완성을 제한효소 패턴으로 확인하였다. 레인 C는 dl324-BstBI-△E3-H1-shmTGF-β2 viral vector DNA이고, 레인 1~3은 상동재조합 후 얻은 벡터 dl324-3484-△E3-H1-shmTGF-β2 박테리아 클론 DNA들을 HindIII와 PacI로 잘라 확인한 결과 클론 1,2,3 모두 새로이 재조합되었음을 확인하였다.
3단계-아데노바이러스 제작
상동 재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
참조예 3: 데코린 유전자 준비
인간 데코린 유전자는 InvivoGen (San Diego, CA, USA)로부터 입수하였으며, 진뱅크 BT019800에 나타낸 바와 같이, 서열번호 6으로 표시된다.
마우스 데코린 유전자는 InvivoGen (San Diego, CA, USA)로부터 입수하였으며, 진뱅크 BC138564에 나타낸 바와 같이, 서열번호 5로 표시된다.
제조예 3: 데코린 발현 아데노바이러스 제작
인간 데코린(decorin)은 pORF-hDCN (InvivoGen)으로부터 얻었다.
양 끝단에 각각 XhoI/EcoRV 가지게 프라이머(센스 프라이머: 5'- TAT ctcgag ATGAAGGCCACTATCATCCTCCTTCTG (Xho I, 57.1) [서열번호 19], 안티센스 프라이머: 5'- GCG GATATC TTACTTATAGTTTCCGAGTTGAATGGCAG (EcoRV, 57.31) [서열번호 20])를 이용하여 다음과 같은 조건의 PCR을 실시하였다.
PCR 조건:
예열 95℃ 5 min,
변성-95℃ 30 sec. 어닐링-58℃ 30 sec. 신장-72℃ 1 min 10 sec → 30 cycle,
72℃ 5 min
데코린을 포함하는 PCR 산물을 pCA14에 서브클로닝하였다. 상동재조합을 위하여 dl324-BsttBI은 BstBI으로 선형화시키고, 셔틀 벡터인 pCA14-인간 데코린은 XmnI으로 선형화시킨 후 대장균 BJ5183에 형질전환(transformation)시켜 상동재조합하였다.
상동 재조합하여 얻은 바이러스는 증식과정 및 정제 후 titation을 거치고 DU-145에 감염시킨 다음, 인간 데코린 발현을 ELISA로 확인하였다(도 14).
마우스 데코린은 pORF-mDCN (InvivoGen)로부터 얻었다.
마우스 데코린의 발현을 위해 defective type은 pCA14(Micorvix, Canada)를 사용하였다. 이때, 유전자 도입을 위해 프라이머(센스 : 5'- CGC GAATTC ATGAAGGCAACTCTCATCTTCTTCCTTC (EcoRI)[서열번호 21], 안티센스: 5'- GCCG GTCGAC TTACTTGTAGTTTCCAAGTTGAATGGCTT (SalI) [서열번호 22])을 사용하였다.
PCR은 다음과 같이 실시하였다.
PCR 조건:
예열 95℃ 5 min,
변성-95℃ 30 sec. 어닐링-58℃ 30 sec. 신장-72℃ 1 min 10 sec → 30 cycle,
72℃ 5 min
마우스 데코린을 발현하는 복제불능 아데노바이러스는 dl324-BstBI을 Bsp119로 선형화시키고 셔틀벡터인 pCA14-mDCN은 FspII으로 선형화시켜 상동재조합하였다. 그 결과 dl324-CMVp-△E1B55-mDCN을 확립하였다.
마우스 데코린을 발현하는 복제가능 아데노바이러스는 dl324-BstBI을 Bsp119로 선형화시키고 셔틀벡터인 pVAX1-3484-mDCN은 PmeI으로 선형화시켜 상동재조합하였다. 그 결과 dl324-3484-CMVp-△E1B-mDCN을 확립하였다 (도 15a). 도 15b는 데코린 유전자를 가지는 셔틀벡터를 사람의 DU-145에 트랜스펙션하거나 탑재한 복제불능 및 복제가능 아데노바이러스를 DU-145 세포에서 감염 1일 후 배지를 무혈청(serum-free) 배지로 바꾸고, 1일 동안 배양하여 배지로 나온 데코린의 양을 ELISA로 측정한 결과이다, 셔틀벡터 및 복제불능 및 복제가능 아데노바이러스 모두 데코린을 효과적으로 분비하였다.
상동재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
참조예 4: FoxP3 발현을 억제하는 shRNA 제작
FoxP3의 사일런싱(silencing)을 유도하기 위하여, 센스 25 mer/안티센스 25 mer(9 개 염기를 가지는 루프를 가운데에 포함)에 근거한 shRNA를 제작하고 아데노바이러스에서 발현시키기 위해 셔틀벡터에 도입하고 상동 재조합(homologous recombination) 바이러스를 제작하였다.
shRNA FoxP3의 특이성 검증을 위하여, 스크램블드(scrambled) shRNA를 가지는 셔틀벡터도 동시에 제작하였다. 종래 방법에 비하여 특이성과 발현억제능이 크게 향상되었다.
실험방법은 다음과 같다.
shRNA 1의 세포내 발현을 유도하기 위하여,
센스: 5'-GATC CGT TCC ACA ACA TGC GAC CCT TCA AGA GAG GGT CGC ATG TTG TGG AAC TTT TTT GGA AA-3' [서열번호 23]
안티센스:5'-AGCTTTTCCAAAAAAGTTCCACAACATGCGACCCTCTCTTGAAGGGTCGCATGTTGTGGAACG-3' [서열번호 24]의 DNA 올리고뉴클레오타이드를 제작하였다.
shRNA 2의 세포 내 발현을 유도하기 위하여,
센스: 5'-GAT CCG CAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TGT TTT TTG GAA A-3' [서열번호 25]
안티센스:5'-AGCTTTTCCAAAAAACATGCGACCCCCTTTCACCTCTCTTGAAGGTGAAAGGGGGTCGCATGCG-3' [서열번호 26]의 DNA 올리고뉴클레오타이드를 제작한 후, 인간의 shRNA 후보 1번과 2번에 대한 센스, 안티센스 두 DNA가닥을 각각 어닐링시킨 다음, pSP72△E3-U6-NC를 BamHI과 HindIII로 잘라 어닐링된 DNA 가닥(양끝단이 BamHI과 HindIII 인식부위 자연히 가지게 됨)을 연결시켜 pSP72△E3-U6-shFoxP3를 제작하였다(도 16).
도 18은 인간 FoxP3용 shRNA 1번과 2번 pSP72△E3-U6-shFoxP3을 500 ng과 1000 ng을 인간 전립선암세포인 DU145에 트랜스펙션하고 48시간 배양 후, 웨스턴 블랏을 통하여 인간 FoxP3에 대해 2개의 shRNA 스크리닝 결과 2번 타겟에 해당되는 shRNA에서 50% 이상의 사일런싱(silencing) 효과를 확인하였다.
이에 근거하여 하기 타겟을 선정하였다
인간 표적서열 : ‘5-CAT GCG ACC CCC TTT CAC C -3' [서열번호 8]
마우스의 경우에는 인간에서 선정한 염기서열과 같은 위치에서 상동성을 가지는 염기서열을 타겟으로 선정하였다
마우스 표적서열: 5'- TAT GCG ACC CCC TTT CAC C - 3' [서열번호 7]
웨스턴 블랏팅에 의해 선정된 서열번호 2의 염기서열을 아데노바이러스에서 발현시키기 위해 양 끝단에 BamHI과 HindⅢ 염기 사이트를 삽입하고 중간에 TTCAAGAGA의 9개의 염기를 가지는 루프(loop)를 가지게끔 제작하였다. 마우스의 경우에는 인간에서 선정한 염기서열과 같은 위치에서 상동성을 가지는 염기서열을 마찬가지의 방법으로 어닐링시켜 마우스 FoxP3 shRNA를 발현하는 pSP72△E3-U6-shFoxP3를 얻는다.
상기 표적서열에 대하여 25/30 +9 루프를 가지는 shRNA를 합성하고 이들의 표적서열에 대한 억제 효과를 웨스턴 블랏팅으로 확인하였다.
인간 표적서열(서열번호 8)을 위한 shRNA: 5'- GATCCGCATGCGACCCCCTTTCACC TTCAAGAGA GGTGAAAGGGGGTCGCATGTTTTTTGGAAA -3‘ [서열번호 10]
마우스 표적서열 (서열번호 7)을 위한 shRNA: 5'-5'- GAT CCG TAT GCG ACC CCC TTT CAC CTT CAA GAG AGG TGA AAG GGG GTC GCA TAT TTT TTG GAA A-3' [서열번호 9]
앞서 설명한 웨스턴 블랏팅에 의해 선정된 서열번호 3 또는 4의 염기서열을 아데노바이러스에서 발현시키기 위해 양 끝단에 BamHI과 HindIII 염기사이트를 삽입하고 중간에 TTCAAGAGA의 9개의 염기를 가지는 루프를 가지게끔 제작하였다. 즉, 인간 shRNA의 기본 구조는 5'-25 mer-루프(4 mer)-30mer-3'으로 구성되어 있다.
이에 근거하여 아데노바이러스에 도입시키기 위한 사람의 하기 2가닥의 DNA를 제작하였다.
탑 스트랜드: 5'-GATCCGCATGCGACCCCCTTTCACC TTCAAGAGA GGTGAAAGGGGGTCGCATGTTTTTTGGAAA - 3' [서열번호 11]
바텀 스트랜드: 5'-AGCTT TTCCAAAAAACATGCGACCCCCTTTCACC TCTCTTGAA GGTGAAAGGGGGTCGCATGCG - 3' [서열번호 12]
그리고 아데노바이러스에 도입시키기 위한 마우스의 하기 2가닥의 DNA를 제작하였다. 탑 스트랜드: 5'- GATCC GTATGCGACCCCCTTTCACC TTCAAGAGA GGTGA AAGGGGGTCGCATATTTTTTGGAAA - 3' [서열번호 13]
바텀 스트랜드: 5'- AGCTT TTCCAAAAAATATGCGACCCCCTTTCACC TCTCTTGAA GGTGAAAGGGGGTCGCATACG - 3' [서열번호 14]
제조예 4: shFoxP3 발현하는 복제 불능 아데노바이러스 벡터 제작
실시간 RT-PCR을 통하여 확인된 가장 효과적으로 발현을 억제하는 shRNA 염기서열을 센스와 안티센스 서열이 TTCAAGAGA를 사이에 두고 위치하게 하고, 양 끝에 BamHI과 HindⅢ 제한효소 염기서열을 가진 염기로 구성된 올리고뉴클레오티드와 상보적인 올리고뉴클레오티드를 각각 합성하여 어닐링(annealing)시킨 뒤, E3 셔틀 벡터인 pSP72△E3/si-negative 벡터[도 11, pSP72 cloning 벡터(Promega)에 아데노바이러스 E3L(26591-28588)과 E3R(30504-31057)을 삽입하고 Ambion사의 psilencer 2.1-U6 hygro에서 -EcoRI-U6 promoter + -BamHI-nonsense shRNA용 염기서열인 actaccgttgttataggtgttcaagagacacctataacaacggtagttttttggaa-HindⅢ [서열번호 27]가 들어간 형태의 pSP72△E3/si-negative (scrambled)]를 제작하였다.
인간 또는 마우스의 shRNA FoxP3 도입을 위하여, 먼저 상기한 pSP72△E3/si-negative 플라스미드를 BamHI과 HindⅢ를 처리한 후, 인간 또는 마우스의 shRNA FoxP3를 삽입시켜 pSP72△E3-sh-human FoxP3 또는 pSP72△E3-sh-mouse FoxP3를 제작하였다[도 16, 17]. 음성 대조군 아데노바이러스로는 양끝에 BamHI과 HindⅢ를 가지게 하고 스크램블드(scrambled) 염기서열(actaccgttgttataggtg)과 loop(ttcaagaga) 제작하였다.
도 17은 pSP72△E3-shhFoxP3로 클로닝된 것을 BamHI/HindIII로 잘라 shFoxP3 크기의 DNA가 나온 것을 확인하였다. 도 18은 확인된 셔틀 DNA pSP72△E3-shhFoxP3 1번과 2번을 DU-145에 형질전환(transfection)시켜 세포 내 FoxP3 수준이 얼마나 감소하는지를 확인하여 2번 DNA 서열이 더 효과 있음을 확인하였다. 확인된 셔틀벡터 DNA (2번 FoxP3 shRNA를 발현)와 dl324-IX viral DNA 벡터와의 상동재조합을 보여주고 있다. 이때 셔틀벡터는 XmnI으로 잘라 선형화시키고 dl324-IX는 SpeI으로 잘라 선형화시켜 대장균 BJ5183에 형질전환(transformation)시켜 상동재조합하였다(도 19).
아데노바이러스의 E3 부위 PCR로 양성 클론(#1, 2, 4, 5, 9, 13)만을 선별한 후[도 20의 (a): dl324/IX 아데노바이러스 백본(backbone) 게놈(genomic) DNA와 pSP72-shhFoxP3 셔틀 벡터와의 상동 재조합 후 sh-hFoxP3가 포함된 클론들을 선별한 PCR 결과, 도 20의 (b): dl324/IX 아데노바이러스 백본 게놈 DNA와 pSP72-shhFoxP3 셔틀 벡터와의 상동 재조합 후 IX 유전자 유무를 통하여 도 20의 (a)에서 확인된 shhFoxP3가 포함된 클론 중에서 게놈 DNA도 포함된 클론들을 재차 선별한 PCR 결과], 도 20의 (c), (d)에서 보듯이 HindⅢ 절단 패턴(digestion pattern)과 PacI으로 최종 재조합체를 선별하였다.
도 20 (a)에서, dl324/IX 레인은 dl324 백본이고; 셔틀 레인은 pSP72-U6-sh-hFoxP3이다. 레인 1~13은 dl324 백본과 pSP72-shhFoxP3 간의 상동 재조합 후 박테리아 클론(bacterial clone)으로부터 얻은 플라스미드를 E3 부위 증폭시킨 결과를 보여주는 것으로 약 1 kb에 해당하는 밴드가 나타나야 positive이다. E3 부분을 PCR을 하였을 때 E3 부분이 없는 dl324 백본에서는 1 kb에 해당하는 밴드가 나타나지 않지만, E3부분에 U6 프로모터와 shhFoxP3의 sh 컨스트럭트(construct)가 삽입된 셔틀 벡터의 경우 PCR하면 1 kb의 산물(product)의 크기(size)가 나타나는 것을 통하여 상동 재조합되었는지 확인할 수 있다.
도 20의 (b)에서, dl324/IX 레인은 dl324 백본이고; 셔틀 벡터는 pSP72-U6-hFoxP3이다. 도 20의 (a)에서 확인된 shhFoxP3이 포함된 클론 중(#1, 2, 4, 5, 9, 13)에서 게놈 DNA도 포함된 클론들을 재차 선별하는 PCR 결과로 상동재조합이 되었다는 것을 확인한 도 20의 (a)에 이은 연속적인 선별 실험으로 양쪽에서 positive한 클론들이 상동 재조합이 되었음을 의미한다. IX 유전자 부분을 PCR을 하였을 때 IX 유전자를 가지고 있는 dl324 백본과 IX 유전자를 가지고 있지 않은 셔틀 벡터의 차이를 이용하여 상동 재조합이 되었는지를 확인하였다. 그 결과 #1, 2, 4, 5, 9, 13 모두 다시 선별되었다.
도 20의 (c)는 백본과 샘플과의 HindIII로 컷팅(cutting)하였을 때 달라지는 패턴의 차이에 따라 상동 재조합되었는지를 최종적으로 확인한 것이다. 각각의 DNA들 중 #9 클론만이 기존의 dl324-IX(맨 왼쪽 첫 번째 레인)과는 다른 HindⅢ 패턴을 보였다. 다른 클론에서 유래된 DNA는 출처를 알 수 없는 DNA였다. 이는 #9 클론유래 DNA만이 백본 아데노바이러스 DNA가 셔틀 벡터와 상동 재조합을 이루었음을 의미하며, 따라서 본 발명은 #9 클론에 기초로 하고 있다.
도 20의 (d)는 pPoly2라는 플라스미드에 PacI 부위에 삽입되어있는 Ad-dl324-IX-sh-hFoxP3을 PacI으로 절단하여 pPoly2가 제대로 절단되는지 확인함으로써 바이러스 생산에 요구되는 최종 구조체(construct)를 결정하는 실험이다. 도 20의 (c)에서 확인한 #9 클론에 속하는 DNA는 PacI으로 절단 시 약 2 kb에 해당하는 pPoly2 백본 DNA가 빠져나왔다. 확인 후, PacI 절단 후 함께 293A 세포에 트랜스펙션(transfection)하여 아데노바이러스를 생산하였다.
즉, 상기의 방법으로 제작된 E3 셔틀 벡터들을 각각 XmnI 제한 효소로 처리하여 단일가닥으로 만든 다음, SpeI 제한효소를 처리하여 단일가닥이 된 복제 불능 아데노바이러스인 dl324와 함께 대장균 BJ5183에서 동시에 형질전환시켜 유전자 상동재조합을 유도하였다. 상동 재조합된 플라스미드 DNA를 수득하여 HindⅢ 제한효소로 처리하여 DNA 패턴의 변화를 확인하고 최종적으로 서열 분석하여 상동재조합 유무를 확인한 후, 확인된 플라스미드들을 PacI으로 절단한 뒤 293 세포주에 형질전환하여 shRNA FoxP3을 발현하는 복제불능 아데노바이러스를 제작하였다. (복제 가능 아데노바이러스에 shRNA를 제작하는 경우에는 shRNA에 의한 억제 효과와 세포 라이시스(lysis) 효과가 혼재되어 있어 억제 효과만을 명확하게 확인하기 어렵기 때문에 복제 불능 아데노바이러스를 제작하였다). 이 아데노바이러스는 293 세포주에서 증식시켜 CsCl 변화도(gradient)로 농축하여 한계 희석배양법(limiting dilution) 또는 용균반검사(plaque assay)로 바이러스의 역가를 결정하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
도 21은 마우스에서의 genomic DNA인 dl324-IX와 셔틀벡터인 pSP72ΔE3-U6-shFoxP3와의 상동재조합 과정으로, 생성된 DNA의 HindIII 패턴 및 PacI 컷팅을 통해 제대로 상동재조합된 마우스 FoxP3 shRNA 발현하는 바이러스성 DNA를 얻었음을 나타낸 것이다.
3) 암세포에서의 효과 확인-shRNA 발현하는 아데노바이러스에 의한 FoxP3 발현 억제 확인
인간 FoxP3의 shRNA 확인 결과, 인간 흑색종 세포 A375에서 1 moi의 아데노바이러스에서 사일런싱 효과가 나타났으며 50 MOI의 바이러스 감염 시 50% 이상의 사일런싱 효과를 보였다[도 22].
마우스 FoxP3의 shRNA 확인 결과, 마우스 흑색종 세포 B16BL6에서 1000 moi 이상의 아데노바이러스에서 50%의 사일런싱(silencing) 효과를 보였다. 인간에 비해 상대적으로 낮은 감염율 때문에 매우 많은 양의 바이러스를 감염시켜 그 효과를 확인하였다[도 23].
제조예 5: shTGFβ2와 shFoxP3 동시에 발현되는 복제불능 아데노바이러스 제작
1) pSP72△E3/H1-shTGFβ2의 제작
pSP72△E3/U6-shTGFβ2의 E3 left와 U6 프로모터 사이에 있는 Sph I과 U6 프로모터와 shTGFβ2 서열 사이의 BamHI으로 절단하여 U6 프로모터 부위를 제거하였다. 여기에 H1 프로모터 서열을 가지는 DNA 올리고뉴클레오타이드를 탑 스트랜드와 3' 말단에는 SphI과 5' 말단에는 BamHI 부위를 가지는 바텀 스트랜드 각각 제작하여 어닐링시켜 삽입하여 pSP72△E3/H1-shTGFβ2를 제작하였다(도 24)
top: 5'-cgaattcatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatg
tctttggatttgggaatcttataagttctgtatgagaccactc g-3' [서열번호 28]
bottom: 5'-gatccgagtggtctcatacagaacttataagattcccaaatccaaagacatttca
cgtttatggtgatttcccagaacacatagcgacatgcaaatatgaattc gcatg-3' [서열번호 29]
제조예 4에서 제작한 pSP72△E3-H1-shFoxP3에서 HindIII 블런팅 처리 후 KpnI 처리하여 SV40 poly A 부위를 제거한 다음, 상기 pSP72△E3/H1-shTGF-β2에서 SphI 블런팅 후 KpnI 처리하여 H1 프로모터-shTGFβ2-SV40 poly A를 빼내어 HindIII (blunt)/KpnI 처리한 pSP72△E3-H1-shFoxP3와 연결시켰다. 그 결과, pSP72△E3/U6-shFoxP3-H1-shTGFβ2 셔틀벡터를 제작하였다(도 25).
제작한 벡터에서 shFoxP3, shTGF-β2가 효과적으로 단백질 발현을 억제하는지 알아보기 위하여 실험을 사람의 A375에서 셔틀 벡터 형태로의 트랜스펙션 시 FoxP3 및 TGFβ2의 감소 효과를 실시간-PCR로 확인하였다(도 26b). 바이러스의 제작을 위하여 genomic viral DNA인 dl324-BstBI-△E3-U6-shmFoxp3-H1-shmTGFβ2는 BstBI으로 사이트 컷팅하고 셔틀벡터인 pVAX1-3484-CMVp-△E1B-E1R은 PmeI으로 사이트 컷팅한 후 대장균 BJ5183에 형질도입시켜 상동재조합을 유도하였다(도 26a).
상동재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
제조예 6: GM-CSF 및 데코린 탑재 복제 가능 아데노바이러스 제작
GM-CSF와 데코린을 동시에 발현하는 종양선택적 복제 가능 아데노바이러스를 다음과 같이 제작하였다.
pIRES (Clontech)의 MCS(multi cloning site) A에는 GM-CSF 유전자를 삽입하고, MCS B에는 데코린 유전자를 삽입하였다(도 27).
인간 GM-CSF 유전자를 pIRES로 MCS A 부위로 서브클로닝하기 위하여 PCR용 프라이머를 제작하였다. 센스 스트랜드는 5'말단에 XhoI 부위를 가지는 5'-CCG CTCGAG ATGTGGCTGC AGAGCCTGCT G-3' [서열번호 30]과 안티센스 스트랜드로 5' 말단에 MluI을 가지는 5'-CCGACGCGTTCACTCCTGGACTGGCTCCCA-3' [서열번호 31]을 제작하였다. PCR 주형으로는 pORF-hGMCSF를 사용하여 초기 변성-95 ℃ 2 min 후, 변성-95℃ 1 min, 어닐링-55℃ 1 min, 신장-72 ℃ 1 min을 30회 반복하였다. 그리고 마지막으로 최종 신장-72℃ 5 min을 수행하였다.
인간 데코린 유전자를 pIRES로 MCS B 부위로 서브클로닝하기 위하여 PCR용 프라이머를 제작하였다. 센스 스트랜드는 5'말단에 XbaI 부위를 가지는 5'-GGC TCTAGA ATGAAGGCCACTATCATCC-3' [서열번호 32]과 안티센스 스트랜드로 5' 말단에 NotI을 가지는 5'-ATAGTTTAGCGGCCGCTTACTTATAGTTTCCGAG-3' [서열번호 33]을 제작하였다. PCR 주형으로는 pCA14-hDCN를 사용하여 초기 변성-95 ℃ 2 min한 후, 변성-95 ℃ 1 min, 어닐링-55 ℃ 1 min, 신장-72 ℃ 1 min 30 sec을 30회 반복하였다. 그리고 마지막으로 최종 신장 72 ℃ 5 min을 수행하였다.
마우스 GM-CSF 유전자를 pIRES로 MCS A 부위로 서브클로닝하기 위하여 PCR용 프라이머를 제작하였다. 센스 스트랜드는 5'말단에 XhoI 부위를 가지는 5'-CCG CTCGAG ATGTACAGGATGCAACTCCTGTCT-3' [서열번호 34]과 안티센스 스트랜드로 5' 말단에 MluI을 가지는 5'-CCGACGCGT TCATTTTTGGCCTGGTTTTTTGCA-3' [서열번호 35]을 제작하였다. PCR 주형으로는 pCA14-mGM-CSF를 사용하여 초기 변성-95 ℃ 2 min한 후, 변성-95 ℃ 1 min, 어닐링-55 ℃ 1 min, 신장-72 ℃ 1 min을 30회 반복하였다. 그리고 마지막으로 최종 신장-72 ℃ 5 min을 수행하였다.
마우스 데코린 유전자를 pIRES로 MCS B 부위로 서브클로닝하기 위하여 PCR용 프라이머를 제작하였다. 센스 스트랜드는 5'말단에 SalI 부위를 가지는 5'- gggg gtcgac ATGAAGGCAACTCTCATCTTCTTC-3' [서열번호 36]과 안티센스 스트랜드로 5' 말단에 NotI을 가지는 5'-gggg gcggccgc TTACTTGTAGTTTCCAAGTTGAATGG-3' [서열번호 37]을 제작하였다. PCR 주형으로는 pORF-mDCN를 사용하여 초기 변성-95 ℃ 2 min한 후, 변성-95 ℃ 1 min, 어닐링-55 ℃ 1 min, 신장-72 ℃ 1 min 30 sec을 30회 반복하였다. 그리고 마지막으로 최종 신장-72 ℃ 5 min을 수행하였다.
다음은 pIRES에 마우스 GM-CSF와 마우스 데코린을 삽입하는 과정을 나타낸 것이다.
도 28에서, C1은 pIRES로 대조군이며, C2는 pIRES/mGM-CSF-hDCN으로 샘플과 유사하게 pIRES 벡터에 두 개의 유전자가 클로닝되어 있지만 HindⅢ 패턴이 다른 대조군이고, 레인 1~4는 pIRES/mGM-CSF-mDCN으로 서브클로닝을 시도한 것 중 레인 3이 성공한 것을 HindIII로 확인한 것이다.
1) pVAX1-3484-CMVp-ΔE1B-E1R 제작
pVAX1에 pBSKII-3484의 HindIII/EcoRI 단편을 삽입한 후 여기에 다시 pCA14의 ECORI/StuI 단편을 연결시켜 pVAX1-3484-CMVp-ΔE1B-E1R를 얻었다[도 4].
1) pVAX1-mart1 2) pVAX1-3484-△E1B-E1R 3) pVAX1-3484-CMV-△E1B-E1R을 Pmei/SmaI으로 잘라 확인하여 성공적으로 셔틀벡터가 제작되었음을 확인하였다[도 5].
2) 마우스 GM-CSF와 마우스 데코린이 삽입된 셔틀벡터 제작
Oncolytic 셔틀벡터로의 클로닝은 다음과 같이 수행하였다.
pIRES-mGMCSF-mDCN은 BglII와 FspI으로 잘라 마우스 GM-CSF와 마우스 데코린을 얻었다. pVAX1-3484-CMVp-ΔE1B-E1R은 SalI 처리 후 블런팅하고 BglII한 다음, BglII와 FspI의 단편과 연결시켰다[도 29].
서브클로닝된 것은 다음과 같이 확인하였다.
PmeI으로 잘라 두 개의 DNA 크기로 확인하여 최종적으로 pVAX1-3484-CMVp-△E1B-IRES-mGMCSF-mDCN을 얻었다[도 30].
3) 마우스 GM-CSF와 마우스 데코린이 발현하는 종양선택적 복제가능 아데노바이러스 제작
바이러스 생성을 위하여 viral backbone DNA는 BstBI으로 자르고 pVAX1-3484-CMVp-△E1B-IRES-mGMCSF-mDCN을 PmeI로 선형화시켜 대장균 BJ5183에 형질전환(transformation)시켜 상동재조합 DNA를 생성하였다. 그 결과, HindIII 패턴과 PacI 절단으로 두 개 클론 모두 성공적으로 재조합된 것을 확인하였다[도 31].
바이러스 DNA를 흑색종 세포주 B16F10에 형질전환(transfection)(2 μg)하고 1일 후 배지를 무혈청 배지로 갈아준 다음, 하루 동안 배양한 후 배지 내로 방출된 마우스 GM-CSF와 마우스 데코린을 측정하였다. 그 결과, 이들 DNA로부터 마우스 GM-CSF와 마우스 데코린이 정상적으로 발현되고 있음을 ELISA로 확인할 수 있었다[도 32].
4) pIRES-인간 GM-CSF로의 인간 데코린 유전자의 서브클로닝
확인은 XbaI/NotI 절단으로 레인 2,3,4,5,7이 제대로 서브클로닝되어 pIRES-hGMCSF-IRES-hDCN이 완성되었다. 그 다음으로 pCA14-3484-CMV-△E1B와 pIRES-hGMCSF-IRES-hDCN과의 연결을 유도하였다.
pIRES-hGMCSF-hDCN으로부터 BglII/FspI (blunt end)하고, pCA14-3484-CMV-△E1B (이것은 pCA14 SspI (blunt end)/EcoRI 한 후 3484 함유 플라스미드를 HindIII (blunting)/EcoRI 하여 얻음)를 pCA14의 SalI (blunting)/BglII 한 것과 연결하여 pCA14-3484-CMV-△E1B-hGM-CSF-IRES-hDCN을 얻었다. 이의 확인은 앞서 사용한 인간 데코린 프라이머(센스는 XhoI, 안티센스는 NotI을 가지는 새로운 프라이머 사용, 센스: 5'-GGC TCT AGA ATG AAG GCC ACT ATC ATC C-3' [서열번호 38]; 안티센스: 5'-ATA GTT TAG CGG CCG CTT ACT TAT AGT TTC CGA G-3' [서열번호 39])와 인간 GM-CSF 프라이머(서열번호 17 및 18)를 이용하여 PCR을 실시하여 유전자 삽입 여부를 확인하였다[도 33]. 도 34에서 보듯이 데코린과 GM-CSF 모두 제대로 유전자 삽입된 것을 확인하였다.
서브클로닝된 pCA14-3484-CMV-△E1B-hGMCSF-IRES-hDCN으로부터 인간 GM-CSF와 인간 데코린이 발현되는지를 살펴보았다. 이을 위하여 DU-145에 pIRES-hGMCSF, pIRES-hGMCSF-IRES-hDCN 및 pCA14-3484-△E1B-hGMCSF-IRES-hDCN 을 2 μg 트랜스펙션하여 하루 후에 배지를 무혈청 배지로 바꾼 다음, 다시 24시간 경과 후 배지 내의 GM-CSF와 데코린을 ELISA로 측정하였다.
그 결과, 최종 셔틀벡터에서 정상적으로 GM-CSF와 데코린이 분비되고 있음을 확인하였다(도 35b). 바이러스의 제작을 위하여 genomic viral DNA인 dl324-BstBI은 BstBI으로 사이트 컷팅하고 셔틀벡터인 pVAX1-3484-CMVp-△E1B-E1R-mGMCSF-IRES-mDCN은 PmeI으로 사이트 컷팅한 후, 대장균 BJ5183에 형질도입시켜 상동재조합을 유도하였다(도 35a).
상동재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
제조예 7: 마우스 GM-CSF 유전자 및 마우스 shTGFβ2 탑재 아데노바이러스 제작
1) pVAX1-3484-CMV-ΔE1B55-mGMCSF 제작
먼저, 제조예 1에서 확보한 pCA14-mGMCSF에서 CMV-mGMCSF를 부분을 BglⅡ(blunt), SalⅠ로 컷팅하여 얻은 후 pVAX1-3484-CMVp-ΔE1B-E1R (EcoRI/SalI 후)와 연결하여 서브클로닝을 확인하였다 (도 7).
마우스 GM-CSF를 발현하는 pVAX1-3484-CMV-ΔE1B-E1R은 도 6에 나타난 바와 같으며, 인간 GM-CSF를 발현하는 pVAX1-3484-CMV-ΔE1B-E1R도 마우스와 같이 동일한 방식으로 제작하였다(도 36).
2) Ad-3484-CMV-ΔE1B-mGMCSF-ΔE3-H1-shmTGFβ2로 상동재조합
dl324-BstB1-ΔE3-H1-shmTGFβ2와 pVAX1-3484-CMV-ΔE1B-mGMCSF와의 상동재조합을 확인하였다(도 37).
dl324-BstBI-ΔE3-H1-shmTGFβ2는 제조예 2의 1단계에서 제작한 것으로, dl324-BstBI은 SpeI으로 선형화(사이트 컷팅)하고 셔틀 벡터인 pSP72ΔE3/shmTGFβ2는 XmnI으로 선형화시켜 대장균 BJ5183에서 1차 상동재조합을 실시하였다 (도 37a). 2차 상동재조합은 dl324-BstBI-ΔE3-H1-shmTGFβ2를 BstBI 사이트 컷팅하고, pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF를 PmeI 사이트 컷팅하여 2차 상동재조합을 진행하였다 (도 37b). 그 다음 dl324-BstBⅠ-ΔE3-H1-shmTGFβ2와 pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF와의 상동재조합 결과는 도 38에 나타내었다.
인간 GM-CSF와 인간 shTGF-β2도 마우스와 상기와 동일한 방식으로 제작하였다(도 39).
dl324-Δ3-U6-shhTGF-β2 백본은 Bsp1191로 효소 컷트하고 셔틀(pVAX1-3484-마우스 GM-CSF)은 Pme I로 효소 컷트하여 선형화시킨 후, 대장균 BJ5183에 형질전환시켜 상동재조합을 실행하였다.
상동재조합된 DNA의 확인은 상동재조합된 클론들로부터 플라스미드 DNA를 추출하여 HindIII로 잘라 패턴을 dl324-BstBI-ΔE3-U6-shhTGFβ2와 비교한 결과 레인 1, 3, 7, 9, 11, 12에서 성공적으로 재조합된 것을 알 수 있었다(도 40).
상동재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
제조예 8: GM-CSF 유전자, 데코린 유전자 및 shRNA (shTGF-β2)가 탑재된 종양선택적 살상 아데노바이러스 제작
제조예 2에서의 dl324-BstBⅠ-ΔE3-H1-shmTGFβ2를 BstBⅠ 사이트 컷팅하였다. 셔틀벡터는 제조예 6에서 얻은 pVAX1-3484-CMVp-ΔE1B-E1R-mGMCSF-IRES-mDCN을 PmeI으로 선형화하여 대장균 BJ5183에 형질도입하여 상동재조합을 유도하였다.
도 41에서 보듯이, 상동재조합된 클론들로부터 플라스미드 DNA를 추출하여 HindIII로 잘라 패턴을 dl324-BstBI-ΔE3-H1-shmTGFβ2와 비교한 결과, 레인 2, 3, 4 성공적으로 재조합되었으며, 이를 모두 정상적으로 PacI 분할이 이루어지고 있었다.
상동 재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
제조예 9: GM-CSF 유전자, 데코린 유전자, shRNA(shTGF-β2 + shFoxP3)가 탑재된 종양선택적 살상 아데노바이러스 제작 (마우스)
제작은 두 단계에 걸쳐 단계적으로 제작하였다.
1 단계는 dl324-BstBI에 pSP72△E3-U6-shFoxP3-H1-shTGFβ2 셔틀벡터를 상동재조합하는 것이고, 이를 위해 dl324-BstBI은 SpeI 효소로, pSP72-△E3-U6-shmFoxP3-H1-shmTGFβ2는 XmnI로 컷팅한 후 대장균 BJ5183에 형질전환하였다(도 43의 (1)). 그 결과, 도 42a에서와 같이 레인 1,2,3,4 모두 상동 재조합되었음을 알 수 있었다.
2단계는 여기에 다시 pCA14-3484-CMVp-△E1B-GMCSF-IRES-DCN 셔틀벡터를 상동재조합한다.
2단계의 마우스 GM-CSF와 마우스 데코린을 발현하는 셔틀벡터는 다음과 같이 제작하였다.
1) pCA14-3484-CMV-△E1B-mGMCSF-IRES-mDCN으로의 서브클로닝 과정
pIRES-mGMCSF-mDCN으로부터 BglII/FspI (blunt end)하고, pCA14-3484-CMV-△E1B (이것은 pCA14 SspI (blunt end)/EcoRI 한 후 3484 함유 플라스미드를 HindIII (blunting)/EcoRI 하여 얻음)를 pCA14의 SalI (blunting)/Bgl II 한 것과 연결하여 pCA14-3484-CMVp-△E1B-mGMCSF-IRES-mDCN을 얻었다(도 44).
pCA14-3484-CMV-△E1B-mGMCSF-IRES-mDCN 셔틀 벡터 2 μg을 마우스 흑색종세포인 B16F10에 6 웰에 형질전환(transfection)한 후 1일이 지난 다음 무혈청 배지로 바꿔주고, 다시 1일을 경과하였을 때 배지 내로 방출된 마우스 GM-CSF와 마우스 데코린을 ELISA로 측정하였다. 그 결과, 24시간 동안 약 2500 pg/ml의 마우스 GM-CSF 및 마우스 데코린이 분비되었음을 확인하였다[도 45].
pCA14-3484-CMVp-△E1B-mGMCSF-IRES-mDCN는 NruI 효소로, dl324-△E3-U6-shmFoxP3-H1-shmTGFβ2는 BstBI 효소로 컷팅한 후 대장균 BJ5183에 형질전환하였다[도 43의 (2)]. 그 결과 얻은 각 박테리아 클론들로부터 HindIII 검사에 의해 50여개의 클론 DNA 중 6개가 상동재조합된 것을 확인하였고 (도 46b의 위) , 그 중 1개에서만 PacI 절단된 것을 확인할 수 있었다(도 46b의 아래).
상동재조합 후 TGF-β2의 발현양은 B16BL6 마우스 세포에서 500 moi 그리고 특히 1000 moi에서 현저히 감소하는 것을 mRNA에서 확인하였으며, FoxP3의 경우 셔틀벡터를 트랜스펙션 시 감소하는 것을 mRNA 수준에서 확인하였다(도 46a).
상동 재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
제조예 10: GM-CSF 유전자, 데코린 유전자, shRNA(shTGF-β2 + shFoxP3)가 탑재된 종양선택적 살상 아데노바이러스 제작 (인간)-dl324-3484-CMV-E1B-hGMCSF-IRES-hDCN-U6-shhFoxP3-H1-shhTGFβ2
제작은 제조예 9와 같이 두 단계에 걸쳐 단계적으로 제작하였다.
1 단계는 dl324-BstBI에 pSP72△E3-U6-shFoxP3-H1-shTGFβ2 셔틀벡터를 상동재조합하고, 이를 위해 dl324-BstBI은 SpeI 효소로, pSP72-△E3-U6-shmFoxP3-H1-shmTGFβ2는 XmnI로 컷팅한 후 대장균 BJ5183에 형질전환하였다. 그 결과, 박테리아에서 뽑은 각 클론의 DNA들을 뽑아 HindIII 패턴을 분석한 결과, 샘플 1,2,3,4 모두 상동재조합된 것을 확인하였고, PacI 분할도 정상적으로 나타났다 (도 42b).
2단계는 여기에 다시 pCA14-3484-CMV-△E1B-hGMCSF-IRES-hDCN 셔틀벡터를 상동재조합한다.
2단계의 인간 GM-CSF와 인간 데코린을 발현하는 셔틀벡터는 다음과 같이 제작하였다.
1) pCA14-3484-CMV-△E1B-hGMCSF-IRES-hDCN으로의 서브클로닝 과정
pIRES-hGMCSF-hDCN으로부터 BglII/FspI (blunt end)하고, pCA14-3484-CMV-△E1B (이것은 pCA14 SspI (blunt end)/EcoRI 한 후 3484 함유 플라스미드를 HindIII (blunting)/EcoRI 하여 얻음)를 pCA14의 SalI (blunting)/Bgl II 한 것과 연결하여 pCA14-3484-CMV-△E1B-hGMCSF-IRES-hDCN을 얻었다(도 44에서 마우스를 인간으로 치환).
제조예 6에서 서브클로닝한 pCA14-3484-hGMCSF-IRES-hDCN 셔틀 벡터는 NruI으로 잘라 선형화시키고, dl324-BstbI-△E3-U6-shhFoxp3-H1-shhTGF-β2 백본(도 43의 (1))은 Bsp1191로 잘라 선형화시킨 후, 대장균 BJ5183에 형질전환시켜 상동재조합을 유도하였다. HindIII 패턴과 PacI 절단에 의해 2번 클론이 제대로 상동재조합된 것을 확인하였다(도 47).
상동재조합이 확인된 박테리아 클론에서 얻은 DNA는 PacI으로 절단한 다음, 293A(a subclone of the 293 human embryonic kidney cell line) 세포주에 형질전환(transfection)하여 아데노바이러스를 생산하였다. 293세포주에서 증식시킨 뒤 초원심분리에 의한 CsCl 농도구배에 의해 분리한 후 dialysis를 거쳐 얻은 순화된 아데노바이러스를 Qbiogene(Carlsbad, CA, USA)에 의해 개발된 표준 플라크 분석 키트로 역가를 산출하였다. 최종 바이러스 역가는 6x1010~4x1011였다.
인간 흑색종 세포인 A375에서 인간 shFoxP3, 인간 shTGFβ2에 의한 FoxP3 또는 TGF-β2 mRNA 발현 억제를 실시간-PCR로 확인하였다 (도 48).
인간 흑색종 세포인 A375, SK-Mel28에서 인간 GM-CSF, 인간 데코린이 정상적으로 발현되는 것을 ELISA로 확인하였다 (도 49).
마우스 흑색종 세포인 B16F10에서 마우스 GM-CSF, 마우스 데코린이 정상적으로 발현되는 것을 ELISA로 확인하였다 (도 50).
마우스 흑색종 세포인 B16BL6 또는 B16F10에서 마우스 shFoxP3, 마우스 shTGF-β2에 의한 FoxP3 또는 TGF-β2 mRNA 발현 억제를 실시간-PCR로 확인하였다 (도 51).
실시예 1: 마우스에서 마우스 유전자와 shRNA 발현하는 종양선택적 아데노바이러스에 의한 항종양 효과
마우스 흑색종 세포주[기탁번호 KCLRF-BP-00313] 1 x 106 cell/100 ㎕를 복벽에 주입하고 종양 크기가 60 mm3에 이르렀을 때 이틀 간격으로 3회(1x109 pfu/50 ㎕), 아데노바이러스(대조군: control virus, oncolytic NC, oncolytic virus; 제조예 9의 4종:oncolytic virus 4m(GMCSF + DCN + shFoxp3 + shTGFβ2), 2종(제조예 7의 GM-CSF+shTGFβ2 , 제조예 6의 GM-CSF+데코린, 제조예 5의 shFOXP3+shTGFβ2), 제조예 8의 3종(GM-CSF+decorin+shTGFβ2)) 종양 내 주사(intratumoral injection)로 감염시켰다. 각 실험군당 6마리씩 사용하였다.
그 결과, 항종양 효과는 4개의 유전자가 들어간 제조예 9의 4m (multi)에서 항종양 효과가 가장 우세하였으며, 그 다음으로는 제조예 7의 2종에 의한 항종양 효과가 우세하였고(도 52), 생존분석 시 생존율도 다른 비교구에 비해 높았다 (도 53).
마우스 흑색종 세포주[KCLRF-BP-00313] 1 x 106 cell/100 ㎕의 세포를 복벽에 주입하고 종양 크기가 60 mm3에 이르렀을 때 이틀 간격으로 4회(1x1010 virus particle/50 ㎕), 아데노바이러스(control oncolytic virus, 제조예 9의 oncolytic virus, 제조예 2의 shTGFβ2) 감염시켰다. 각 실험군당 6마리씩 사용하였다.
그 결과, 항종양 효과는 4개의 유전자가 들어간 제조예 9의 4m (multi) oncolytic adenovirus에서 항종양 효과가 shTGFβ2 단독 oncolytic adenovirus 처리구 보다 우수하였다 (도 54).
누드마우스에 인간 흑색종 세포 A375 1×107 cells/100 ㎕를 도입시켜 종양이 30~40mm3에 도달했을 때, 제조예 10의 4m 아데노바이러스와 대조군 아데노바이러스를 각각 1x1010 VP/100 ㎕ 농도로 되게 이틀 간격으로 3 회 주사한 후 이틀 간격으로 종양의 크기를 측정하였다. 그 결과, 감염 시 종양의 크기가 가장 효과적으로 억제되었다 (도 55).
실시예 2: In vivo 누드마우스에서 면역활성 효과 확인(인간)
누드마우스에 인간 흑색종 세포 A375 1×107 cells/100 ㎕를 도입시켜 종양이 30~40mm3에 도달했을 때 제조예 10의 4m 아데노바이러스와 대조군 아데노바이러스를 각각 1x1010 VP/100 ㎕ 농도로 되게 이틀 간격으로 3회 주사하고 6일 후에 마우스의 면역장기인 비장을 적출하였다. 적출된 비장은 50 ml conical tube에 배양 배지 (10% FBS 포함 RPMI 1640 media)를 10 ml 담고 mesh에 비장을 올린 다음, 5 ml 주사기의 plunge로 갈았다. 5 ml의 배양 배지로 mesh를 씻어준 후, 1500 rpm, 5분 원심분리하여 상등액을 제거한 후. 1X RBC lysis buffer 1 ml로 세포를 resuspension한 다음 상온에서 5분간 방치하여 RBC를 제거하고 배양 배지로 채운 후 1500 rpm, 5분 동안 원심분리하여 2번 세척하였다. 상등액을 제거한 후 배양배지 1 ml에 resuspension한 후, cell count하여 96 well U bottom plate에 1×105 cells/50 ㎕로 각 well 마다 분주하였다. 분주된 세포를 2일 동안 배양한 후 배양배지 안에 있는 IFN-γ와 IL-12의 양을 ELISA로 측정하였다.
그 결과, IFN-γ 분비량 증가는 뚜렷하지 않은 대신 IL-12의 분비량은 제조예 10의 인간 4m 아데노바이러스에 의해 증가되었다 (도 56).
실시예 3: In vivo 면역능이 있는 C57BL/6 마우스에서 면역활성 효과 확인(마우스)
마우스 흑색종 세포주[KCLRF-BP-00313] 7 × 105 cells/100 ㎕를 C57BL/6 마우스에 도입시켜 종양이 60 mm3에 도달했을 때, 제조에 9의 4m 아데노바이러스와 대조군 아데노바이러스를 각각 1×109 VP/100 ㎕되게 이틀 간격으로 3 회 주사하고, 6일 후에 마우스의 면역장기인 비장을 적출하였다. 적출된 비장은 50 ml conical tube에 배양배지 (10% FBS 포함 RPMI 1640 media)를 10 ml 담고 mesh에 비장을 올린 다음, 5 ml 주사기의 plunger를 이용하여 갈아준 후 5 ml의 배양 배지로 mesh를 씻어준 후, 1500 rpm, 5분 원심분리하여 상등액을 제거하였다. 1X RBC lysis buffer 1 ml로 세포를 resuspension한 다음 상온에서 5분간 방치하여 RBC를 제거하고 14 ml까지 배양 배지로 채운 후 1500 rpm, 5분 동안 원심분리하여 2회 세척하여 상등액을 제거한 후 배양배지 1 ml에 resuspension하였다. 셀 카운트하여 96 well U bottom plate에 1×105 cells/50 ㎕로 각 well마다 분주하고 분주된 세포를 2일 동안 배양한 후 배양 배지 안에 있는 IFN-γ와 IL-12의 양을 ELISA로 측정하였다.
그 결과, IFN-γ와 IL-12의 분비량 모두 제조예 9의 마우스 4m 아데노바이러스에 의해 증가되었다 (도 57).
실시예 4 : In vitro에서 면역활성 효과 확인(마우스)
C57BL/6 마우스로부터 비장을 분리하여 상기 실시예 3과 같은 방법으로 비장세포(splenocyte)를 얻었다. 이와는 별도로 마우스 흑색종 세포주[KCLRF-BP-00313] 2×105 cell로 분주하고 제조예 9의 4m 아데노바이러스 및 대조군 아데노바이러스를 각각 0, 5, 10, 50 100 MOI로 감염시키고, 이틀 후에 배지를 수거하여 배지 안으로 분비된 마우스 GM-CSF를 ELISA로 측정하였다.
50 MOI 감염으로 분비량이 포화된 시점의 배지 (제조예 9의 4m 및 대조군아데노바이러스)를 앞서 분리한 2×106 cell로 splenocyte가 분주된 96 well round-bottom plate에 원래 배지와 1:1로 섞어 48시간 배양한 후 여기에 다시 lipopolysaccharide (1 ㎍/ml)을 24시간 동안 처리하여 배양세포를 더욱 성숙화시켰다. 그 후 배지 내로 분비된 마우스 IL-12 또는 마우스 IFN-γ를 측정하였다.
그 결과, IFN-γ와 IL-12의 분비량 모두 제조예 9의 마우스 4m 아데노바이러스에 의해 증가되었다 (도 58).
실시예 5: 조직화학적 검사에 의한 면역증강 효과 확인
제조예 9의 4m 아데노바이러스의 in vivo 면역증강 효력 실험을 진행하였다. C57BL/6 마우스에 마우스 흑색종 세포주[KCLRF-BP-00313] 7×105 cells/100 ㎕를 이식시킨 후, 종양 크기가 60 mm3에 이르렀을 때 4m 아데노바이러스와 대조군 아데노바이러스를 각각 1×109 VP/100 ㎕되게 이틀 간격으로 3 회 주사하고 주사 후 11일째에 조직면역화학염색법을 시행하였다. 파라핀으로 처리된 조직에서 먼저 크실렌(xylene)을 처리하고 알코올의 농도를 점점 낮춤으로써 가수하였다. Permeabilization을 위해서 0.5% TritonX-100을 30분 동안 처리하였다. 세척 후 블록킹(ultra V block 사용)한 후 슬라이드를 각각 항-CD4 항체 1:200 희석), 항-CD8 항체 (1:500 희석), 항-NK1.1 항체 (1:500 희석), 항-Ad5 항체 (1:800 희석)에 4 ℃에서 12시간 처리한 후 horseradish peroxidase polymer (Thermo Scientific)로 상온에서 5 min 처리한 후 세척한 후 mounting 용액(Shandon Synthetic Mountant+ xylene = 1:1)을 처리한 후 현미경을 관찰하였다. C57BL/6 마우스 실험에서 제조예 9의 4m 아데노바이러스 감염에 의한 종양조직 조직면역 염색 결과, NK 세포, CD4+ T 세포, CD8+ T 세포가 대조군 종양조직에 비교하여 증가된 것을 확인하여 종양조직 주변의 면역증강 효과가 증가되고 있음을 나타내고 있다 (도 59).
마우스 흑색종 세포주[KCLRF-BP-00313] 1 x 106 cell/100 ㎕를 복벽에 주입하고 종양 크기가 60 mm3에 이르렀을 때 이틀 간격으로 PBS 음성대조군을 포함하여 3회(1x109 pfu/50 ㎕), 아데노바이러스(대조군: control virus, oncolytic NC, C; oncolytic adenovirus-mGMCSF (G); oncolytic adenovirus-mDecorin (D); oncolytic adenovirus-shmFoxP3 (F); oncolytic adenovirus-shmTGFβ2 (T); oncolytic adenovirus-mGMCSF-mDecorin (GD); oncolytic adenovirus-mGMCSF-shmTGFβ2 (GT); oncolytic adenovirus-shmFoxP3-shmTGFβ2 (FT); oncolytic adenoviurs-mGMCSF-mDecorin-shmTGFβ2 (GDT); oncolytic adenovirus-mGMCSF-mDecorin-shmTGFβ2-shmFoxP3 (GDTF, 4m)) 모두 11군을 종양 내 주사(intratumoral injection)로 감염시켰다. 각 실험군당 6마리씩 사용하였다. 그 결과, 항종양 효과는 4개의 유전자가 들어간 4m (multi, GDTF)에서 항종양 효과가 가장 우세하였으며, 그 다음으로는 mGMCSF와 shmTGF-β2가 들어간 oncolytic adenovirus (GT)에서 항종양 효과가 우세하였다(도 60).

Claims (26)

  1. 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 GM-CSF 및 shTGF-β2 공동 발현용 유전자 전달체.
  2. 제 1 항에 있어서,
    상기 GM-CSF 유전자는 서열번호 1 또는 서열번호 2로 표시되는 유전자 전달체.
  3. 제 1 항에 있어서,
    상기 shTGF-β2는 서열번호 3 또는 서열번호 4로 표시되는 유전자 전달체.
  4. 제 1 항에 있어서,
    상기 유전자 전달체는 플라스미드, 재조합 아데노바이러스 벡터, 아데노-관련 바이러스(Adenoassociated viruses: AAV), 레트로바이러스, 렌티바이러스, 헤르페스 심플렉스 바이러스, 백시니아 바이러스, 리포좀 또는 니오좀인 유전자 전달체.
  5. 제 4 항에 있어서,
    상기 유전자 전달체는 재조합 아데노바이러스 벡터인 유전자 전달체.
  6. 제 1 항 내지 제 5 항 중 어느 한 항의 유전자 전달체를 포함하는 항종양 조성물.
  7. 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 항종양 조성물.
  8. 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 및 TGF-β2 발현을 억제하는 shRNA(shTGF-β2)을 포함하는 항종양 조성물.
  9. 제 7 항에 있어서,
    상기 shTGF-β2는 서열번호 3 또는 서열번호 4로 표시되는 항종양 조성물.
  10. 제 6 항 또는 제 7 항에 있어서,
    상기 조성물은 면역활성 및 면역원성을 증대시키는 항종양 조성물.
  11. 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 GM-CSF, 데코린, shTGF-β2 및 shFoxP3 공동 발현용 유전자 전달체.
  12. 제 11 항에 있어서,
    상기 GM-CSF 유전자는 서열번호 1 또는 서열번호 2로 표시되는 유전자 전달체.
  13. 제 11 항에 있어서,
    상기 shTGF-β2는 서열번호 3 또는 서열번호 4로 표시되는 유전자 전달체.
  14. 제 11 항에 있어서,
    상기 데코린은 서열번호 5 또는 서열번호 6으로 표시되는 유전자 전달체.
  15. 제 11 항에 있어서,
    상기 shFoxP3은 서열번호 9 또는 서열번호 10으로 표시되는 유전자 전달체.
  16. 제 11 항에 있어서,
    상기 유전자 전달체는 플라스미드, 재조합 아데노바이러스 벡터, 아데노부속 바이러스(Adenoassociated viruses: AAV), 레트로바이러스, 렌티바이러스, 헤르페스 심플렉스 바이러스, 백시니아 바이러스, 리포좀 또는 니오좀인 유전자 전달체.
  17. 제 16 항에 있어서,
    상기 유전자 전달체는 재조합 아데노바이러스 벡터인 유전자 전달체.
  18. 제 11 항 내지 제 17 항 중 어느 한 항의 유전자 전달체를 포함하는 항종양 조성물.
  19. 제 10 항 내지 제 18 항 중 어느 한 항의 유전자 전달체를 포함하는 항종양 조성물.
  20. 과립구-대식세포 콜로니 자극 인자(GM-CSF) 유전자; 데코린(decorin) 유전자, TGF-β2 발현을 억제하는 shRNA(shTGF-β2) 및 FoxP3 발현을 억제하는 shRNA(shFoxP3)을 포함하는 항종양 조성물.
  21. 제 20 항에 있어서,
    상기 GM-CSF 유전자는 서열번호 1 또는 서열번호 2로 표시되는 항종양 조성물.
  22. 제 20 항에 있어서,
    상기 shTGF-β2는 서열번호 3 또는 서열번호 4로 표시되는 항종양 조성물.
  23. 제 20 항에 있어서,
    상기 데코린은 서열번호 5 또는 서열번호 6으로 표시되는 항종양 조성물.
  24. 제 20 항에 있어서,
    상기 shFoxP3은 서열번호 9 또는 서열번호 10으로 표시되는 항종양 조성물.
  25. 제 19 항 또는 제 20 항에 있어서,
    상기 조성물은 면역활성 및 면역원성을 증대시키는 항종양 조성물.
  26. 제 1 항 또는 제 11 항의 유전자 전달체를 도입한 아데노바이러스.
PCT/KR2015/003175 2014-03-31 2015-03-31 ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물 WO2015152609A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20140037835 2014-03-31
KR10-2014-0037835 2014-03-31
KR10-2015-0044507 2015-03-30
KR1020150044507A KR101713873B1 (ko) 2014-03-31 2015-03-30 ＧＭ－ＣＳＦ 유전자； 데코린 유전자；ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ； 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물

Publications (1)

Publication Number Publication Date
WO2015152609A1 true WO2015152609A1 (ko) 2015-10-08

Family

ID=54240852

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/003175 WO2015152609A1 (ko) 2014-03-31 2015-03-31 ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물

Country Status (1)

Country Link
WO (1) WO2015152609A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019502375A (ja) * 2015-12-08 2019-01-31 ユニバーシティ−インダストリー・ファンデーション・ヨンセイ・ユニバーシティ ＧＭ−ＣＳＦ遺伝子；Ｆｌｔ３Ｌ−ＴＲＡＩＬ融合遺伝子；ＴＧＦ−βの発現を抑制するｓｈＲＮＡ；およびＨＳＰ発現を抑制するｓｈＲＮＡを含む抗腫瘍組成物

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060094630A (ko) * 2005-02-25 2006-08-30 윤채옥 데코린 유전자를 포함하는 유전자 전달 시스템 및 이를 포함하는 약제학적 항종양 조성물
WO2010037042A2 (en) * 2008-09-26 2010-04-01 The General Hospital Corporation Methods for detecting and treating cancer
KR20120099503A (ko) * 2009-12-23 2012-09-10 그래댈리스, 인코포레이티드 푸린?녹다운 및 ｇｍ?ｃｓｆ?증강된 (ｆａｎｇ) 암 백신
KR20130088792A (ko) * 2012-01-31 2013-08-08 연세대학교 산학협력단 ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060094630A (ko) * 2005-02-25 2006-08-30 윤채옥 데코린 유전자를 포함하는 유전자 전달 시스템 및 이를 포함하는 약제학적 항종양 조성물
WO2010037042A2 (en) * 2008-09-26 2010-04-01 The General Hospital Corporation Methods for detecting and treating cancer
KR20120099503A (ko) * 2009-12-23 2012-09-10 그래댈리스, 인코포레이티드 푸린?녹다운 및 ｇｍ?ｃｓｆ?증강된 (ｆａｎｇ) 암 백신
KR20130088792A (ko) * 2012-01-31 2013-08-08 연세대학교 산학협력단 ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GenBank 10 May 2005 (2005-05-10), Database accession no. DQ010327.1 *
DATABASE NCBI, GenBank 12 May 2008 (2008-05-12), Database accession no. BC138564.1 *
DATABASE NCBI, GenBank 8 November 1994 (1994-11-08), Database accession no. M11220.1 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019502375A (ja) * 2015-12-08 2019-01-31 ユニバーシティ−インダストリー・ファンデーション・ヨンセイ・ユニバーシティ ＧＭ−ＣＳＦ遺伝子；Ｆｌｔ３Ｌ−ＴＲＡＩＬ融合遺伝子；ＴＧＦ−βの発現を抑制するｓｈＲＮＡ；およびＨＳＰ発現を抑制するｓｈＲＮＡを含む抗腫瘍組成物
EP3388522A4 (en) * 2015-12-08 2019-05-22 University-Industry Foundation, Yonsei University ANTITUMORIC COMPOSITION WITH GM-CSF-GEN, FLT3L-TRAIL-FUSIONSGEN, SHRNA-INHIBITING TGF-EXPRESSION AND SHRNA-INHIBITOR HSP-EXPRESSION

Similar Documents

Publication Publication Date Title
WO2017099474A1 (ko) ＧＭ－ＣＳＦ 유전자; FLT3L-TRAIL 융합 유전자; ＴＧＦ－β 발현을 억제하는 ｓｈＲＮＡ; 및 HSP 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물
WO2018166307A1 (zh) 靶向nkg2dl的特异性嵌合抗原受体t细胞，其制备方法和应用
WO2009088256A9 (ko) 배큘로바이러스-기반 백신
WO2018194438A1 (ko) 비복제 아데노 바이러스 생산 세포주 및 이의 제조방법
WO2018008903A1 (ko) 이중 플라스미드 벡터를 포함하는 지방세포 표적 비바이러스성 유전자 전달복합체
WO2019143201A1 (ko) 재조합 백시니아 바이러스 및 이를 포함하는 약학 조성물
WO2019117632A1 (ko) 재조합 아데노바이러스 및 이를 포함하는 줄기세포
WO2012134215A2 (ko) 동물세포 발현벡터
WO2022139493A1 (ko) TGF-β 신호전달을 억제할 수 있는 신규한 펩타이드 및 이의 용도
WO2015152609A1 (ko) ＧＭ－ＣＳＦ 유전자; 데코린 유전자; ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ; 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물
KR101713873B1 (ko) ＧＭ－ＣＳＦ 유전자； 데코린 유전자；ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ； 및 ＦｏｘＰ３ 발현을 억제하는 ｓｈＲＮＡ를 포함하는 항종양 조성물
WO2021066612A2 (ko) 종양 표적화 단백질 또는 이의 단편 및 그것에 결합하는 항체 및 이의 용도
AU2021305575C1 (en) Novel intron fragments
WO2023282730A1 (ko) 트랜스포존 시스템 및 이의 용도
WO2022250491A1 (en) Novel dual helper plasmid
WO2022119380A1 (ko) 신규한 ace2 변이체 및 그의 이용
WO2023048516A1 (ko) Pd-1 및 il-21을 포함하는 융합단백질 이량체 및 이의 용도
WO2022035200A1 (ko) Il-12 및 항-cd20 항체를 포함하는 융합단백질 및 이의 용도
WO2019031804A2 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
WO2020013617A1 (ko) 항종양 조성물
WO2019235771A1 (ko) 아데노바이러스의 감염 및 복제가 가능한 중간엽 줄기세포주
WO2022060155A1 (ko) 재조합 발생이 최소화된 유전자치료 벡터, 상기 벡터를 포함하는 재조합 레트로바이러스 및 상기 재조합 레트로바이러스를 포함하는 암의 예방 또는 치료용 약학 조성물
WO2021040496A1 (ko) 백시니아 바이러스 및 과립백혈구 형성 억제제를 유효성분으로 포함하는 암 치료용 약학 조성물
WO2021080377A1 (ko) 헬퍼 플라스미드 기반 가틀리스 아데노바이러스 생산 시스템
WO2022158891A1 (ko) 면역관문 억제제를 발현하는 암 특이적 트랜스-스플라이싱 리보자임 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15773922

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase
122 Ep: pct application non-entry in european phase

Ref document number: 15773922

Country of ref document: EP

Kind code of ref document: A1