WO2015124715A1 - Method for in situ inhibition of regulatory t cells - Google Patents

Method for in situ inhibition of regulatory t cells Download PDF

Info

Publication number
WO2015124715A1
WO2015124715A1 PCT/EP2015/053592 EP2015053592W WO2015124715A1 WO 2015124715 A1 WO2015124715 A1 WO 2015124715A1 EP 2015053592 W EP2015053592 W EP 2015053592W WO 2015124715 A1 WO2015124715 A1 WO 2015124715A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
antigen
engineered
cells
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2015/053592
Other languages
English (en)
French (fr)
Inventor
Laurent Poirot
Philippe Duchateau
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cellectis SA
Original Assignee
Cellectis SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cellectis SA filed Critical Cellectis SA
Priority to CA2939711A priority Critical patent/CA2939711C/en
Priority to AU2015220762A priority patent/AU2015220762B2/en
Priority to US15/120,060 priority patent/US10196608B2/en
Priority to EP15706446.0A priority patent/EP3107552B1/en
Priority to JP2016553321A priority patent/JP6665102B2/ja
Publication of WO2015124715A1 publication Critical patent/WO2015124715A1/en
Anticipated expiration legal-status Critical
Priority to US15/923,771 priority patent/US20180208896A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • C12N5/0638Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • the present invention pertains to engineered T-cells, method for their preparation and their use as medicament, particularly for immunotherapy.
  • the engineered T-cells of the invention are designed to express locally a secreted inhibitor of regulatory T-cells (Treg).
  • a secreted inhibitor is a peptide inhibitor of forkhead/winged helix transcription factor 3 (FoxP3), a specific factor involved into the differentiation of T-cells into regulatory T-cells.
  • FoxP3 forkhead/winged helix transcription factor 3
  • Said T-cells are preferably endowed with Chimeric Antigen Receptors (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell.
  • CAR Chimeric Antigen Receptors
  • the engineered T-cells of the invention thereby direct their immune activity towards specific malignant or infected cells, while at the same time prevent neighbouring regulatory T-cells from modulating the immune response.
  • the invention opens the way to standard and affordable adoptive immunotherapy strategies, especially for treating or preventing cancer, and bacterial or viral infections.
  • T-lymphocytes also known as T-cells
  • T-cells which upon recognition of a non-self or tumoral antigen can either destroy the target cell or orchestrate an immune response with other cells of the immune system.
  • Adoptive immunotherapy which involves the transfer of autologous antigen-specific T-cells generated ex vivo, is a promising strategy to treat viral infections and cancer.
  • the T- cells used for adoptive immunotherapy can be generated either by expansion of antigen- specific T-cells or redirection of T-cells through genetic engineering (Park, Rosenberg et al. 201 1 ). Transfer of viral antigen specific T-cells is a well-established procedure used for the treatment of transplant associated viral infections and rare viral-related malignancies. Similarly, isolation and transfer of tumor specific T-cells has been shown to be successful in treating melanoma.
  • CARs transgenic T-cell receptors or chimeric antigen receptors
  • CARs are synthetic receptors consisting of a targeting moiety that is associated with one or more signaling domains in a single fusion molecule.
  • the binding moiety of a CAR consists of an antigen-binding domain of a single-chain antibody (scFv), comprising the light and variable fragments of a monoclonal antibody joined by a flexible linker. Binding moieties based on receptor or ligand domains have also been used successfully.
  • the signaling domains for first generation CARs are derived from the cytoplasmic region of the CD3zeta or the Fc receptor gamma chains.
  • First generation CARs have been shown to successfully redirect T cell cytotoxicity, however, they failed to provide prolonged expansion and anti-tumor activity in vivo.
  • Signaling domains from co-stimulatory molecules including CD28, OX-40 (CD134), and 4-1 BB (CD137) have been added alone (second generation) or in combination (third generation) to enhance survival and increase proliferation of CAR modified T-cells.
  • CARs have successfully allowed T-cells to be redirected against antigens expressed at the surface of tumor cells from various malignancies including lymphomas and solid tumors (Jena, Dotti et al. 2010).
  • cytotoxic T-lymphocyte also known as cytotoxic T-cells
  • T helper cells play a central role in the cellular immune response
  • regulatory T-cells Tregs
  • suppressor T-cells modulate or suppress immune responses, particularly to prevent autoimmunity and maintain tolerance to self-antigen.
  • the presence of regulatory T-cells at a cancer or infection site may hinder the induction of an immune response against cancer or infectious pathogens (Aandahl E. M. et al. (2004); Cabrera R. et al. (2004); Viguier M. et al. (2004); Woo E. Y. et al (2001 )).
  • Dysfunction of FOXP3 is however associated with serious autoimmune disorders such as systemic lupus erythematosus or X-lined IPEX syndrome, such that systemic administration of inhibitors directed against, e.g, FoxP3, is currently not deemed a suitable option in immune therapy.
  • systemic administration of inhibitors directed against, e.g, FoxP3 is currently not deemed a suitable option in immune therapy.
  • the release of such inhibitors in the blood stream or even locally may lead to toxic effects by unleashing autoimmune reactions in organs not affected by the primary disease.
  • the present invention concerns methods for preparing engineered T-cells able to neutralize the activity of regulatory T-cells in the close environment of pathological cells by heterologous expression of a factor inhibiting the activity of said regulatory T-cells.
  • the method can be more particularly applied to tumor-infiltrating lymphocytes (TIL), which are T-cells expressing endogenous antigen receptor specific for tumor cells (i.e. upon natural clonal selection within the patient).
  • TIL tumor-infiltrating lymphocytes
  • the cells are relieved from their inhibition by regulatory T-cells to help their spread and action against patient's tumor cells.
  • TIL are extracted from a patient's tumor, amplified, genetically modified to express an inhibitor of regulatory T-cells, and then re-introduced into the patient as a therapeutic product.
  • TIL engineered ex-vivo can be used to treat the original patient (autologous strategy) or another patient who bears the same type of tumor (allogeneic approach).
  • Such method more particularly comprises one or several of the steps of: a) extracting a tumor-infiltrating lymphocyte from a patient's tumor; b) expanding said tumor-infiltrating lymphocyte; and c) introducing into said tumor-infiltrating lymphocyte an exogenous nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T- cell activity.
  • the method can be more particularly applied to T-cells interacting with the pathological cells through a chimeric antigen receptor.
  • Such method more particularly comprises one or several of the steps of: a) providing a T-cell; b) introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and c) introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cells activity.
  • CAR Chimeric Antigen Receptor
  • inhibitor of regulatory T-cells is meant a molecule or precursor of said molecule secreted by the T-cells and which allow T-cells to escape the down regulation activity exercised by the regulatory T-cells thereon.
  • inhibitor of regulatory T-cell activity has the effect of reducing FoxP3 transcriptional activity in said cells.
  • said inhibitor of regulatory T-cell activity is an inhibitor of FoxP3, and more preferably is a cell-penetrating peptide inhibitor of FoxP3, such as that referred as P60 (Casares et al., 2010).
  • the engineered T-cell concomitantly expresses a CAR on its surface that binds a surface antigen marker of a pathological cell. This binding has the effect of triggering an immune response by the T-cell directed against the pathological cell, which result into degranulation of various cytokine and degradation enzymes in the interspace between the cells.
  • the method comprises a further step of introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg). After having introduced said nucleic acid, said second Chimeric Antigen Receptor may then be expressed by said T-cell.
  • an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • Said second CAR is directed against the regulatory T-cells in order to primarily physically maintain said regulatory T-cells in the close environment of the T-cells (and also of the pathological cells) for obtaining in-situ inhibition of the regulatory T-cells.
  • the second CAR can also contribute to activating the T-cells immune response.
  • the method further comprises the step of making the T-cells non-alloreactive by inactivating at least one gene coding for one component of the T-Cell receptor (TCR).
  • a specific rare- cutting endonuclease targeting this gene such as a TAL-nuclease, a CAS9 RNA guided endonuclease, a Zinc Finger nuclease or a meganuclease.
  • the present invention thus preferably provides engineered T-cells, in particular, genetically engineered isolated T-cells comprising: a) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and b) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3, such as that referred as P60 (Casares et al., 2010).
  • said first Chimeric Antigen Receptor and said inhibitor of regulatory T-cell activity are expressed by said T-cell.
  • the engineered T-cell further comprises c) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • said second Chimeric Antigen Receptor is expressed by said T-cell.
  • the engineered T-cell further comprises d) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR).
  • said rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR) is expressed by said T-cell.
  • the disruption of TCR provides non-alloreactive T-cells that can be used in allogeneic treatment strategies.
  • the present invention further provides isolated nucleic acid molecules comprising a nucleotide sequence coding for a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3, such as that referred as P60 (Casares et al., 2010).
  • said nucleic acid molecule is a vector, such as a viral vector or plasmid.
  • said nucleic acid molecule is a vector, such as a viral vector or plasmid, and said nucleotide sequences being operatively linked to one or more promoters suitable for expression in a T-cell.
  • the present invention further provides compositions comprising one or more nucleic acid molecules comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a nucleotide sequence coding for an inhibitor of regulatory T- cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3, such as that referred as P60 (Casares et al., 2010).
  • CAR Chimeric Antigen Receptor
  • the composition comprises a nucleic acid molecule comprising a nucleotide sequence coding for said first Chimeric Antigen Receptor (CAR); and a nucleotide sequence coding for said an inhibitor of regulatory T-cell activity.
  • CAR Chimeric Antigen Receptor
  • the composition comprises a first nucleic acid molecule comprising a nucleotide sequence coding for said first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a second nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell- penetrating peptide inhibitor of FoxP3, such as that referred as P60 (Casares et al., 2010).
  • CAR Chimeric Antigen Receptor
  • the composition comprises a further nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • said nucleic acid molecules are vectors, such as viral vectors or plasmids. More particularly, said nucleic acid molecules are vectors, such as viral vectors or plasmids, and said nucleotide sequences being operatively linked to one or more promoters suitable for expression in a T-cell.
  • the present invention further provides kits comprising one or more isolated nucleic acid according to the present invention or one or more compositions according to the present invention.
  • engineered T-cells can be used as therapeutic products, ideally as an "off the shelf” product, for use in the treatment or prevention cancer, bacterial or viral infections, or auto-immune diseases.
  • the present invention further provides an engineered T-cell or a composition, such as a pharmaceutical composition, comprising same for use as a medicament.
  • the engineered T-cell or composition is for use in the treatment of a cancer, and more particularly for use in the treatment of lymphoma.
  • the engineered T-cell or composition is for use in the treatment of viral infection.
  • the engineered T-cell or composition is for use in the treatment of bacterial infection.
  • Figure 1 Schematic representation of the engineered T-cell according the invention expressing both a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, and a cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • the peptide inhibitor of FoxP3 expressed and secreted by the engineered T-cell will enter neighbouring regulatory T-cells and prevent them from modulating the antitumor or anti-infection response.
  • FIG. 2 Schematic representation of an engineered T-cell according the invention expressing a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, and a cell-penetrating peptide inhibitor of FoxP3 as well as a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR).
  • CAR Chimeric Antigen Receptor
  • FoxP3 cell-penetrating peptide inhibitor of FoxP3
  • TCR T-Cell receptor
  • Figure 3 Schematic representation of an engineered T-cell according the invention expressing a first Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a malignant or infected cell, a cell-penetrating peptide inhibitor of FoxP3 as well as a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg) which allows the binding of a regulatory T-cell by the engineered T-cell of the invention and facilitates the entry of the peptide inhibitor of FoxP3 into the regulatory T-cell.
  • Treg regulatory T-cell
  • Figure 4 Schematic representation of an engineered T-cell according the invention expressing a first Chimeric Antigen a first Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a malignant or infected cell, a cell-penetrating peptide inhibitor of FoxP3 as well as a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • the engineered T-cell does not necessarily express a transgene that codes for an inhibitor of Treg, but can neutralize Treg by merely specifically binding to them (e.g. CD25 is a specific Treg surface protein).
  • Figure 5 Schematic representation of an engineered T-cell expressing a first Chimeric Antigen a first Chimeric Antigen Receptor, which cytotoxic activity is inhibited by a Treg.
  • Figure 6 Schematic representation of an engineered T-cell according to the invention expressing a first Chimeric Antigen a first Chimeric Antigen Receptor and overexpressing p60 as a cell-penetrating peptide inhibitor of FoxP3 with the effect that the inhibition by the Treg is lifted and the T cells recovers cytolytic activity against the tumor cells.
  • the present invention pertains to methods for preparing engineered T-cells that have the ability to lift their inhibition by Treg, preferably by heterologous expression of an inhibitor of Treg, such as a penetrating peptide inhibitor of FoxP3.
  • regulatory T-cells also known as suppressor T-cells
  • regulatory T-cells play a role in dampening immune responses, in particular to prevent autoimmunity and maintaining tolerance of self-antigens
  • an inhibitor is secreted by the engineered T-cell, preferably a peptide inhibitor of FoxP3 into the environment of the engineered T-cell(s). This later peptide inhibitor will enter neighbouring regulatory T-cells and prevent them from modulating the immune response by inhibition of FoxP3.
  • the localized delivery of the peptide inhibitor of FoxP3 by the engineered T-cell(s) of the present invention has the great advantage of reducing the possibility of toxic effects such inhibitor would unfold elsewhere in the body.
  • the invention is applied to a subset of T-cells called tumor-infiltrating lymphocytes (TIL), which are found in tumors with the particularity of having developed some affinity to at least a population of tumor cells found in said tumors.
  • TIL tumor-infiltrating lymphocytes
  • TILs remain active against the tumor cells and thus are valuable in immunotherapy for treating said tumors (Rosenberg, SA. et al. (1986) A new approach to the adoptive immunotherapy of cancer with tumor-infiltrating lymphocytes. Science.
  • nucleic acid comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity ;
  • the T-cells are engineered to express both a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, herein denoted first CAR, and an inhibitor of regulatory T-cell activity, in particular, a cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • the CAR will direct the engineered T-cells to the tumor site or site of infection and allows the T-cell(s) to kill the tumor or infected cells.
  • the present invention provides a method for preparing an engineered T- cell comprising the steps of: a) providing a T-cell; b) introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and c) introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, such as a cell- penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • an engineered T-cell which expresses a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, and an inhibitor of regulatory T-cell activity, such as a cell- penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • the method may further comprise introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg). After having introduced said nucleic acid, said second Chimeric Antigen Receptor may then be expressed by said T-cell.
  • a regulatory T-cell such as the surface antigen CD25
  • an engineered T-cell which further expresses a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • the engineered T-cell of the present invention further expresses a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR).
  • T-cell receptors are cell surface receptors that participate in the activation of T cells in response to the presentation of antigen.
  • the TCR is generally made from two chains, alpha and beta, which assemble to form a heterodimer and associates with the CD3-transducing subunits to form the T-cell receptor complex present on the cell surface.
  • Each alpha and beta chain of the TCR consists of an immunoglobulin-like N-terminal variable (V) and constant (C) region, a hydrophobic transmembrane domain, and a short cytoplasmic region.
  • V variable
  • C constant
  • cytoplasmic region the variable region of the alpha and beta chains are generated by V(D)J recombination, creating a large diversity of antigen specificities within the population of T cells.
  • T cells are activated by processed peptide fragments in association with an MHC molecule, introducing an extra dimension to antigen recognition by T cells, known as MHC restriction.
  • TCRalpha or TCRbeta can result in the elimination of the TCR from the surface of T cells preventing recognition of alloantigen and thus GVHD.
  • the inactivation of at least one gene coding for a TCR component thus renders the genetically engineered T-cell non-alloreactive.
  • the method of the present invention may further comprise introducing into said T-cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage, preferably double-strand break, at least one gene coding for one component of the T-Cell receptor (TCR).
  • the rare-cutting endonuclease is able to selectively inactivate by DNA cleavage the gene coding for TCR alpha or TCR beta.
  • rare-cutting endonuclease refers to a wild type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA molecule.
  • said nuclease can be an endonuclease, more preferably a rare-cutting endonuclease which is highly specific, recognizing nucleic acid target sites ranging from 10 to 45 base pairs (bp) in length, usually ranging from 10 to 35 base pairs in length, more usually from 12 to 20 base pairs.
  • the endonuclease according to the present invention recognizes at specific polynucleotide sequences, further referred to as "target sequence” and cleaves nucleic acid inside these target sequences or into sequences adjacent thereto, depending on the molecular structure of said endonuclease.
  • target sequence specifically referred to as "target sequence”
  • the rare-cutting endonuclease can recognize and generate a single- or double-strand break at specific polynucleotides sequences.
  • said rare-cutting endonuclease according to the present invention is a RNA-guided endonuclease such as the Cas9/CRISPR complex.
  • RNA guided endonucleases constitute a new generation of genome engineering tool where an endonuclease associates with a RNA molecule.
  • the RNA molecule nucleotide sequence determines the target specificity and activates the endonuclease (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al. 2012; Cong, Ran et al. 2013; Mali, Yang et al. 2013).
  • Cas9 also named Csn1 is a large protein that participates in both crRNA biogenesis and in the destruction of invading DNA. Cas9 has been described in different bacterial species such as S. thermophiles, Listeria innocua (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al. 2012) and S. Pyogenes (Deltcheva, Chylinski et al. 201 1 ).
  • Cas9 protein contains two predicted nuclease domains, namely HNH (McrA- like) nuclease domain that is located in the middle of the protein and a splitted RuvC-like nuclease domain (RNase H fold).
  • Cas9 variant can be a Cas9 endonuclease that does not naturally exist in nature and that is obtained by protein engineering or by random mutagenesis.
  • Cas9 variants according to the invention can for example be obtained by mutations i.e. deletions from, or insertions or substitutions of at least one residue in the amino acid sequence of a S. pyogenes Cas9 endonuclease (COG3513).
  • said rare-cutting endonuclease can also be a homing endonuclease, also known under the name of meganuclease.
  • homing endonucleases are well-known to the art (Stoddard 2005). Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length.
  • the homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY- YIG endonuclease.
  • Preferred homing endonuclease according to the present invention can be an ⁇ -Crel variant.
  • a "variant" endonuclease i.e. an endonuclease that does not naturally exist in nature and that is obtained by genetic engineering or by random mutagenesis can bind DNA sequences different from that recognized by wild-type endonucleases (see international application WO2006/097854).
  • said rare-cutting endonuclease can be a "Zinc Finger Nucleases” (ZFNs), which are generally a fusion between the cleavage domain of the type IIS restriction enzyme, Fokl, and a DNA recognition domain containing 3 or more C2H2 zinc finger motifs.
  • ZFNs Zinc Finger Nucleases
  • the heterodimerization at a particular position in the DNA of two individual ZFNs in precise orientation and spacing leads to a double-strand break (DSB) in the DNA.
  • DSB double-strand break
  • the use of such chimeric endonucleases have been extensively reported in the art as reviewed by Urnov et a/. (Genome editing with engineered zinc finger nucleases (2010) Nature reviews Genetics 1 1 :636-646).
  • Standard ZFNs fuse the cleavage domain to the C- terminus of each zinc finger domain.
  • the two individual ZFNs bind opposite strands of DNA with their C-termini a certain distance apart.
  • the most commonly used linker sequences between the zinc finger domain and the cleavage domain requires the 5' edge of each binding site to be separated by 5 to 7 bp.
  • the most straightforward method to generate new zinc-finger arrays is to combine smaller zinc-finger "modules" of known specificity.
  • the most common modular assembly process involves combining three separate zinc fingers that can each recognize a 3 base pair DNA sequence to generate a 3-finger array that can recognize a 9 base pair target site.
  • said rare-cutting endonuclease is a "TALE-nuclease” or a "MBBBD-nuclease” resulting from the fusion of a DNA binding domain typically derived from Transcription Activator Like Effector proteins (TALE) or from a Modular Base-per-Base Binding domain (MBBBD), with a catalytic domain having endonuclease activity.
  • TALE Transcription Activator Like Effector proteins
  • MBBD Modular Base-per-Base Binding domain
  • Such catalytic domain usually comes from enzymes, such as for instance l-Tevl, ColE7, NucA and Fok-I.
  • TALE-nuclease can be formed under monomeric or dimeric forms depending of the selected catalytic domain (WO2012138927).
  • TALE-nucleases are commercially available under the trade name TALENTM (Cellectis, 8 rue de la Croix Jarry, 75013 Paris, France).
  • the DNA binding domain is derived from a Transcription Activator like Effector (TALE), wherein sequence specificity is driven by a series of 33-35 amino acids repeats originating from Xanthomonas or Ralstonia bacterial proteins AvrBs3, PthXol , AvrHahl , PthA, Tal1 c as non-limiting examples. These repeats differ essentially by two amino acids positions that specify an interaction with a base pair (Boch, Scholze et al. 2009; Moscou and Bogdanove 2009).
  • TALE binding domains may further comprise an N-terminal translocation domain responsible for the requirement of a first thymine base (TO) of the targeted sequence and a C-terminal domain that containing a nuclear localization signals (NLS).
  • a TALE nucleic acid binding domain generally corresponds to an engineered core TALE scaffold comprising a plurality of TALE repeat sequences, each repeat comprising a RVD specific to each nucleotides base of a TALE recognition site.
  • each TALE repeat sequence of said core scaffold is made of 30 to 42 amino acids, more preferably 33 or 34 wherein two critical amino acids (the so-called repeat variable dipeptide, RVD) located at positions 12 and 13 mediates the recognition of one nucleotide of said TALE binding site sequence; equivalent two critical amino acids can be located at positions other than 12 and 13 specially in TALE repeat sequence taller than 33 or 34 amino acids long.
  • RVDs associated with recognition of the different nucleotides are HD for recognizing C, NG for recognizing T, Nl for recognizing A, NN for recognizing G or A.
  • critical amino acids 12 and 13 can be mutated towards other amino acid residues in order to modulate their specificity towards nucleotides A, T, C and G and in particular to enhance this specificity.
  • a TALE nucleic acid binding domain usually comprises between 8 and 30 TALE repeat sequences. More preferably, said core scaffold of the present invention comprises between 8 and 20 TALE repeat sequences; again more preferably 15 TALE repeat sequences. It can also comprise an additional single truncated TALE repeat sequence made of 20 amino acids located at the C-terminus of said set of TALE repeat sequences, i.e. an additional C-terminal half- TALE repeat sequence.
  • MBBD modular base-per-base specific nucleic acid binding domains
  • Said MBBBD can be engineered, for instance, from newly identified proteins, namely EAV36_BURRH, E5AW43_BURRH, E5AW45_BURRH and E5AW46_BURRH proteins from the recently sequenced genome of the endosymbiont fungi Burkholderia Rhizoxinica.
  • These nucleic acid binding polypeptides comprise modules of about 31 to 33 amino acids that are base specific. These modules display less than 40 % sequence identity with Xanthomonas TALE common repeats and present more polypeptides sequence variability.
  • TALE-MBBBD proteins The different domains from the above proteins (modules, N and C- terminals) from Burkholderia and Xanthomonas are useful to engineer new proteins or scaffolds having binding properties to specific nucleic acid sequences and may be combined to form chimeric TALE-MBBBD proteins.
  • an engineered T-cell is obtained which further expresses a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR).
  • the engineered T-cell of the present invention further expresses a rare-cutting endonuclease able to selectively inactivate by DNA cleavage, preferably double-strand break, the gene coding for the surface antigen CD25.
  • a rare-cutting endonuclease able to selectively inactivate by DNA cleavage, preferably double-strand break, the gene coding for the surface antigen CD25.
  • the engineered T-cells are unlikely to self- associate or to self-interact and prevented from targeting T-cells other than Treg.
  • the T-cell to be modified according to the present invention may be any suitable T- cell.
  • the T-cell can be an inflammatory T-lymphocyte, cytotoxic T-lymphocyte, or helper T-lymphocyte.
  • the T-cell is a cytotoxic T-lymphocyte.
  • said T-cell is selected from CD4+ T-lymphocytes and CD8+ T-lymphocytes.
  • the T-cell to be modified according to the present invention is a human T-cell.
  • a source of cells can be obtained from a subject, such as a patient, through a variety of non- limiting methods.
  • T-cell can be obtained from a number of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors.
  • any number of T cell lines available and known to those skilled in the art may be used.
  • said cell can be derived from a healthy donor, from a patient diagnosed with cancer or from a patient diagnosed with an infection.
  • said cell is part of a mixed population of cells which present different phenotypic characteristics.
  • the nucleic acid molecules detailed herein may be introduced in the T-cell by any suitable methods known in the art.
  • Suitable, non- limiting methods for introducing a nucleic acid molecule into a T-cell according include stable transformation methods, wherein the nucleic acid molecule is integrated into the genome of the cell, transient transformation methods wherein the nucleic acid molecule is not integrated into the genome of the cell and virus mediated methods.
  • Said nucleic acid molecule may be introduced into a cell by, for example, a recombinant viral vector (e.g., retroviruses, adenoviruses), liposome and the like.
  • Transient transformation methods include, for example, microinjection, electroporation or particle bombardment.
  • the nucleic acid molecule is a vector, such as a viral vector or plasmid.
  • said vector is an expression vector enabling the expression of the respective polypeptide(s) or protein(s) detailed herein by the T-cell.
  • a nucleic acid molecule introduced into the T-cell may be DNA or RNA.
  • a nucleic acid molecule introduced into the T-cell is DNA.
  • a nucleic acid molecule introduced into the T-cell is RNA, and in particular an mRNA encoding a polypeptide or protein detailed herein, which mRNA is introduced directly into the T-cell, for example by electroporation.
  • a suitable electroporation technique is described, for example, in International Publication WO2013/176915 (in particular the section titled "Electroporation" bridging pages 29 to 30).
  • a particular nucleic acid molecule which may be an mRNA is the nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell Receptor (TCR).
  • TCR T-Cell Receptor
  • the peptide inhibitor of FoxP3 in accordance with the present invention may be any peptide or polypeptide capable of inhibiting the activity of the forkhead/winged helix transcription factor 3 (FoxP3, preferably human FoxP3), a transcription factor specific for regulatory T-cells and required for their development and function.
  • “inhibiting” is meant that the activity of FoxP3 in regulatory T-cells is reduced by at least 10%, such as at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80, at least 90%, at least 95%, at least 99% or 100%.
  • “activity of FoxP3” means transcriptional activity.
  • FoxP3 in accordance of the present invention is capable of penetrating a cell membrane.
  • This functionality may be inherent to the peptide inhibitor of FoxP3 or may be the result of fusing a known cell-penetrating peptide (CPP) and a peptide or polypeptide having FoxP3 inhibitory activity.
  • CPP sequence may be N-terminally or C-terminally linked to the amino acid sequence providing for the FoxP3 inhibitory activity.
  • CPPs include, but are not limited to: Tat, a nuclear transcriptional activator protein which is a 101 amino acid protein required for viral replication by human immunodeficiency virus type 1 (HIV-1 ), penetratin, which corresponds to the third helix of the homeoprotein Antennapedia in Drosophilia, Kaposi fibroblast growth factor (FGF) signal peptide sequence, integrin ⁇ 3 signal peptide sequence; Guanine rich-molecular transporters, MPG, pep-1 , sweet arrow peptide, dermaseptins, transportan, pVEC, Human calcitonin, mouse prion protein (mPrPr), polyarginine peptide Args sequence, VP22 protein from Herpes Simplex Virus, antimicrobial peptides Buforin I and SynB (US2013/0065314).
  • Tat a nuclear transcriptional activator protein which is a 101 amino acid protein required for viral replication by human immunodeficiency virus type 1 (HIV-1
  • a non-limiting example of peptide inhibitor of FoxP3 in accordance with the present invention is the polypeptide P60 described by Casares et al. (2010). In addition to its FoxP3 inhibitory activity, it has been shown that P60 is also able to penetrate a cell membrane.
  • This polypeptide has the amino acid sequence: RDFQSFRKMWPFFAM [SEQ ID NO: 1 ].
  • An illustrative nucleotide sequence coding for this polypeptide is represented by CGCGACTTTCAAAGTTTCCGTAAGATGTGGCCGTTTTTTGCAATG [SEQ ID NO: 2]. However, it is understood that due to the degeneration of the genetic code any other suitable nucleotide sequence coding for the amino acid sequence set forth in SEQ ID NO: 1 is also encompassed by the present disclosure.
  • the cell-penetrating peptide inhibitor of FoxP3 is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 80%, at least 85%, at least 90% or at least 95%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 over the entire length of SEQ ID NO: 1 .
  • an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 80%, at least 85%, at least 90% or at least 95%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 over the entire length of SEQ ID NO: 1 is introduced into the T-cell.
  • the variant may comprise an amino acid sequence which has one or more, such as two, three, four, five or six amino acid substitutions compared to SEQ I D NO: 1 .
  • such amino acid substitution is a conservative substitution which means that one amino acid is replaced by another one that is similar in size and chemical properties. Such conservative amino acid substitution may thus have minor effects on the peptide structure and can thus be tolerated without compromising function.
  • such variant is capable of inhibiting the activity of FoxP3 and is capable of penetrating a cell membrane.
  • the exogenous nucleic acid molecule may thus comprise the nucleotide sequence set forth in SEQ ID NO: 2 or any other nucleotide sequence which due to the degeneration of the genetic code also codes for the amino acid sequence set forth in SEQ ID NO: 1.
  • an engineered T-cell may be obtained which expresses a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 80%, at least 85%, at least 90% or at least 95%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 over the entire length of SEQ ID NO: 1.
  • the cell-penetrating peptide inhibitor of FoxP3 is a polypeptide comprising the amino acid sequence MRDFQSFRKMWPFFAM [SEQ ID NO: 3] or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 80% sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID NO: 3.
  • an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3 or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 62,5%, at least 75% or at least 87,5% sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID NO: 3 is introduced into the T-cell.
  • the polypeptide comprising an amino acid sequence that has at least 60% sequence identify with the amino acid sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID NO: 3 may comprise an amino acid sequence which has one or more, such as two, three, four, five or six amino acid substitutions compared to SEQ ID NO: 3.
  • amino acid substitution is a conservative substitution which means that one amino acid is replaced by another one that is similar in size and chemical properties. Such conservative amino acid substitution may thus have minor effects on the peptide structure and can thus be tolerated without compromising function.
  • such variant is capable of inhibiting the activity of FoxP3 and is capable of penetrating a cell membrane.
  • the exogenous nucleic acid molecule may thus comprise the nucleotide sequence ATGCGCGACTTTCAAAGTTTCCGTAAGATGTGG CCGTTTTTTGCAATG [SEQ ID NO: 4] or any other nucleotide sequence which due to the degeneration of the genetic code also codes for the amino acid sequence set forth in SEQ ID NO: 3.
  • an engineered T-cell may be obtained which expresses a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3 or a variant thereof comprising an amino acid sequence that has at least 60%, such as at least 62,5%, at least 75% or at least 87,5% sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID NO: 3.
  • CARs Chimeric Antigen Receptors
  • T-cells generated ex vivo is a promising strategy to treat cancer or viral infections.
  • the T- cells used for adoptive immunotherapy can be generated either by expansion of antigen- specific T cells or redirection of T cells through genetic engineering (Park, Rosenberg et al. 201 1 ). Transfer of viral antigen specific T-cells is a well-established procedure used for the treatment of transplant associated viral infections and rare viral-related malignancies. Similarly, isolation and transfer of tumor specific T cells has been shown to be successful in treating melanoma.
  • CARs transgenic T-cell receptors or chimeric antigen receptors
  • CARs are synthetic receptors consisting of a targeting moiety that is associated with one or more signaling domains in a single fusion molecule.
  • the binding moiety of a CAR consists of an antigen-binding domain of a single-chain antibody (scFv), comprising the light and variable fragments of a monoclonal antibody joined by a flexible linker. Binding moieties based on receptor or ligand domains have also been used successfully.
  • the signaling domains for first generation CARs are derived from the cytoplasmic region of the CD3zeta or the Fc receptor gamma chains.
  • First generation CARs have been shown to successfully redirect T cell cytotoxicity, however, they failed to provide prolonged expansion and anti-tumor activity in vivo.
  • Signaling domains from co-stimulatory molecules including CD28, OX-40 (CD134), and 4-1 BB (CD137) have been added alone (second generation) or in combination (third generation) to enhance survival and increase proliferation of CAR modified T-cells.
  • CARs have successfully allowed T-cells to be redirected against antigens expressed at the surface of tumor cells from various malignancies including lymphomas and solid tumors (Jena, Dotti et al. 2010).
  • CD19 is an attractive target for immunotherapy because the vast majority of B-acute lymphoblastic leukemia (B-ALL) uniformly express CD19, whereas expression is absent on non hematopoietic cells, as well as myeloid, erythroid, and T cells, and bone marrow stem cells. Clinical trials targeting CD19 on B-cell malignancies are underway with encouraging anti-tumor responses. Most infuse T cells genetically modified to express a chimeric antigen receptor (CAR) with specificity derived from the scFv region of a CD19-specific mouse monoclonal antibody FMC63 (WO2013/126712).
  • CAR chimeric antigen receptor
  • the first Chimeric Antigen Receptor is directed against the B-lymphocyte antigen CD19.
  • the first Chimeric Antigen Receptor is a single chain Chimeric Antigen Receptor.
  • single-chain Chimeric Antigen Receptor to be expressed in the engineered T-cells according to the present invention is a single polypeptide that comprises at least one extracellular ligand binding domain, a transmembrane domain and at least one signal transducing domain, wherein said extracellular ligand binding domain comprises a scFV derived from the specific anti-CD19 monoclonal antibody 4G7.
  • the first Chimeric Antigen Receptor is a polypeptide comprising the amino acid sequence forth in SEQ ID NO: 5 or a variant thereof comprising an amino acid sequence that has at least 70%, such as at least 80%, at least 90%, at least 95%, or at least 99%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 5 over the entire length of SEQ ID NO: 5.
  • the variant is capable of binding CD19.
  • the first Chimeric Antigen Receptor may be directed against another antigen expressed at the surface of a malignant or infected cell, such as a cluster of differentiation molecule, such as CD16, CD64, CD78, CD96,CLL1 , CD1 16, CD1 17, CD71 , CD45, CD71 , CD123 and CD138, a tumor-associated surface antigen, such as ErbB2 (HER2/neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvlll), CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal-epithelial mucine, gp36, TAG-72, glycosphingolipids, glioma-associated antigen, ⁇ -human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, th
  • virus-specific surface antigen such as an HIV-specific antigen (such as HIV gp120); an EBV-specific antigen, a CMV-specific antigen, a HPV-specific antigen, a Lasse Virus-specific antigen, an Influenza Virus-specific antigen as well as any derivate or variant of these surface antigens.
  • HIV-specific antigen such as HIV gp120
  • EBV-specific antigen such as HIV gp120
  • CMV-specific antigen such as HIV gp120
  • HPV-specific antigen such as HIV gp120
  • Lasse Virus-specific antigen such as Influenza Virus-specific antigen
  • the first Chimeric Antigen Receptor is a multi-chain Chimeric Antigen Receptor.
  • Chimeric Antigen Receptors from the prior art introduced in T- cells have been formed of single chain polypeptides that necessitate serial appending of signaling domains. However, by moving signaling domains from their natural juxtamembrane position may interfere with their function. To overcome this drawback, the applicant recently designed a multi-chain CAR derived from FceRI to allow normal juxtamembrane position of all relevant signaling domains.
  • the high affinity IgE binding domain of FceRI alpha chain is replaced by an extracellular ligand-binding domain such as scFv to redirect T-cell specificity against cell targets and the N and/or C-termini tails of FceRI beta chain are used to place costimulatory signals in normal juxtamembrane positions as described in WO 2013/176916.
  • a CAR expressed by the genetically engineered T-cell according to the invention can be a multi-chain chimeric antigen receptor particularly adapted to the production and expansion of engineered T-cells of the present invention.
  • Such multi-chain CARs comprise at least two of the following components: a) one polypeptide comprising the transmusinembrane domain of FceRI alpha chain and an extracellular ligand-binding domain,
  • ligands binding domains and signaling domains are born on separate polypeptides.
  • the different polypeptides are anchored into the membrane in a close proximity allowing interactions with each other.
  • the signaling and co-stimulatory domains can be in juxtamembrane positions (i.e. adjacent to the cell membrane on the internal side of it), which is deemed to allow improved function of co- stimulatory domains.
  • the multi-subunit architecture also offers more flexibility and possibilities of designing CARs with more control on T-cell activation. For instance, it is possible to include several extracellular antigen recognition domains having different specificity to obtain a multi-specific CAR architecture.
  • the multi-chain CAR can comprise several extracellular ligand-binding domains, to simultaneously bind different elements in target thereby augmenting immune cell activation and function.
  • the extracellular ligand-binding domains can be placed in tandem on the same transmembrane polypeptide, and optionally can be separated by a linker.
  • said different extracellular ligand-binding domains can be placed on different transmembrane polypeptides composing the multi-chain CAR.
  • the signal transducing domain or intracellular signaling domain of the multi-chain CAR(s) of the invention is responsible for intracellular signaling following the binding of extracellular ligand binding domain to the target resulting in the activation of the immune cell and immune response.
  • the signal transducing domain is responsible for the activation of at least one of the normal effector functions of the immune cell in which the multi-chain CAR is expressed.
  • the effector function of a T cell can be a cytolytic activity or helper activity including the secretion of cytokines.
  • the term "signal transducing domain” refers to the portion of a protein which transduces the effector signal function signal and directs the cell to perform a specialized function.
  • Preferred examples of signal transducing domain for use in single or multi-chain CAR can be the cytoplasmic sequences of the Fc receptor or T cell receptor and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivate or variant of these sequences and any synthetic sequence that as the same functional capability.
  • Signal transduction domain comprises two distinct classes of cytoplasmic signaling sequence, those that initiate antigen-dependent primary activation, and those that act in an antigen-independent manner to provide a secondary or co- stimulatory signal.
  • Primary cytoplasmic signaling sequence can comprise signaling motifs which are known as immunoreceptor tyrosine-based activation motifs of ITAMs.
  • ITAMs are well defined signaling motifs found in the intracytoplasmic tail of a variety of receptors that serve as binding sites for syk/zap70 class tyrosine kinases.
  • ITAM used in the invention can include as non-limiting examples those derived from TCRzeta, FcRgamma, FcRbeta, FcRepsilon, CD3gamma, CD3delta, CD3epsilon, CD5, CD22, CD79a, CD79b and CD66d.
  • the signaling transducing domain of the multichain CAR can comprise the CD3zeta signaling domain, or the intracytoplasmic domain of the FceRI beta or gamma chains.
  • the signal transduction domain of multi-chain CARs of the present invention comprises a co-stimulatory signal molecule.
  • a co-stimulatory molecule is a cell surface molecule other than an antigen receptor or their ligands that is required for an efficient immune response.
  • Ligand binding-domains can be any antigen receptor previously used, and referred to, with respect to single-chain CAR referred to in the literature, in particular scFv from monoclonal antibodies.
  • the first Chimeric Antigen Receptor is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 (encoded by, e.g., SEQ ID NO: 7) or a variant thereof comprising an amino acid sequence that has at least 70%, such as at least 80%, at least 90%, at least 95%, or at least 99%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 6 over the entire length of SEQ ID NO: 6.
  • the variant is capable of binding CD19.
  • a particularly preferred first Chimeric Antigen Receptor is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 8 or a variant thereof comprising an amino acid sequence that has at least 80 %, such as at least 90%, at least 95%, or at least 99%, sequence identity with the amino acid sequence set forth in SEQ ID NO: 8 over the entire length of SEQ ID NO: 8.
  • said variant is capable of binding CD19.
  • bispecific or multi-specific CARs as described, for instance, in International Publication WO 2014/401 1988. Such bi-specific or multi-specific CARs are particularly contemplated with respect to the second CAR which is directed against at least one antigen expressed at the surface of a regulatory T-cell.
  • a suitable target antigen for the second CAR is the surface antigen CD25, which is known to be expressed on the surface of regulatory T-cells. This will allow the binding of a regulatory T-cell by the engineered T-cell of the invention.
  • Other exemplary surface antigens may be CD4, CD152, IL3R, CCR4, CCR6, CD161 and CXR3.
  • the second Chimeric Antigen Receptor is monospecific and, preferably, is directed against surface antigen CD25. According to other certain embodiments, the second Chimeric Antigen Receptor is bi- specific. According to particular embodiments, such bi-specific second Chimeric Antigen Receptor is directed against surface antigen CD25 and one other surface antigen selected from the group consisting of CD4, CD152, IL3R, CCR4, CCR6, CD161 and CXR3.
  • the second Chimeric Antigen Receptor may be a single chain Chimeric Antigen Receptor or a multi-chain CAR.
  • the details provided above with respect to the single chain and multi-chain CARs apply mutatis mutandis.
  • the T-cell(s) can be activated and expanded generally using methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681 ; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041 ; and U.S. Patent Application Publication No. 20060121005.
  • the T-cell(s) may be expanded in vitro or in vivo.
  • the T-cell(s) of the invention is expanded by contact with a surface having attached thereto an agent that stimulates a CD3 TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells.
  • T- cell populations may be stimulated in vitro such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore.
  • a ligand that binds the accessory molecule is used for co-stimulation of an accessory molecule on the surface of the T-cells.
  • a T-cell or population of T- cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T-cells.
  • the T-cells are combined with agent-coated beads, the beads and the cells are subsequently separated, and then the cells are cultured.
  • the agent-coated beads and cells prior to culture, are not separated but are cultured together.
  • Cell surface proteins may be ligated by allowing paramagnetic beads to which anti-CD3 and anti-CD28 are attached (3x28 beads) to contact the T cells.
  • the cells for example, 4 to 10 T-cells
  • beads for example, DYNABEADS® M-450 CD3/CD28 T paramagnetic beads at a ratio of 1 :1
  • a buffer preferably PBS (without divalent cations such as, calcium and magnesium).
  • the mixture may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between. In another embodiment, the mixture may be cultured for 21 days.
  • Conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-g , 1 L-4, 1 L-7, GM-CSF, -10, - 2, 1 L-15, TGFp, and TNF- or any other additives for the growth of cells known to the skilled artisan.
  • serum e.g., fetal bovine or human serum
  • IL-2 interleukin-2
  • insulin IFN-g , 1 L-4, 1 L-7, GM-CSF, -10, - 2, 1 L-15, TGFp, and TNF- or any other additives for the growth
  • additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanoi.
  • Media can include RPMI 1640, A1 M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 , and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells.
  • Antibiotics e.g., penicillin and streptomycin
  • the target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% C02). T cells that have been exposed to varied stimulation times may exhibit different characteristics.
  • the T-cells may be expanded by co-culturing with tissue or cells. Said T-cells may also be expanded in vivo, for example in the subject's blood after administrating said cell into the subject.
  • the present invention provides an engineered, preferably isolated, T-cell which is characterized by the expression of both a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, herein denoted first CAR, and an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • the present invention provides an engineered, preferably isolated, T-cell which comprises: a) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and b) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • the engineered T-cell further comprises c) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • said second Chimeric Antigen Receptor is expressed by said T-cell.
  • the engineered T-cell further comprises d) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR).
  • said rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR) is expressed by said T-cell.
  • the engineered T-cell further comprises e) an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage the gene coding for the surface antigen CD25.
  • said rare-cutting endonuclease able to selectively inactivate by DNA cleavage the gene coding for the surface antigen CD25 is expressed by said T-cell.
  • the details given herein in particularly with respect to the first Chimeric Antigen Receptor, the inhibitor of regulatory T-cell activity, especially the cell- penetrating peptide inhibitor of FoxP3, the second Chimeric Antigen Receptor, the rare- cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR) and the rare-cutting endonuclease able to selectively inactivate by DNA cleavage the gene coding for the surface antigen CD25 also apply to this aspect of the invention.
  • the present invention provides nucleic acid molecules suitable for expressing the various CARs, the inhibitor of regulatory T-cell activity, especially the peptide inhibitors FoxP3, and endonucleases in a T-cell as well as compositions and kits comprising such nucleic acid molecules.
  • the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence coding for a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell- penetrating peptide inhibitor of FoxP3.
  • the nucleic acid molecule may be DNA or RNA.
  • the nucleic acid molecule is DNA. In certain other embodiments, the nucleic acid molecule is RNA molecule, and in particular an mRNA encoding said Chimeric Antigen Receptor and said cell-penetrating peptide inhibitor of FoxP3.
  • the nucleotide sequence coding for said Chimeric Antigen Receptor (CAR) and the nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3 are operatively linked to each other by a nucleotide sequence coding for ribosomal skip sequence, such as a nucleotide sequence coding for a 2A peptide.
  • ribosomal skip mechanisms are well known in the art and are known to be used by several vectors for the expression of several proteins encoded by a single mRNA.
  • the nucleic acid is a vector, such as a viral vector or plasmid.
  • the nucleotide sequence coding for said Chimeric Antigen Receptor (CAR) and the nucleotide sequence coding for an inhibitor of regulatory T-cels activity are operatively linked to one or more promoters suitable for expression in a T-cell.
  • the inhibitor of regulatory T-cells activity such as the cell- penetrating peptide inhibitor of FoxP3
  • the expression of the cell-penetrating peptide inhibitor of FoxP3 is preferably under the control of an inducible promoter, such as a NFAT minimal promoter.
  • compositions which comprise one or more of the nucleic acid molecules detailed herein.
  • the present invention provides compositions comprising one or more nucleic acid molecules comprising a nucleotide sequence coding for a first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a nucleotide sequence coding for a cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • a composition which comprises a nucleic acid molecule comprising a nucleotide sequence coding for said first Chimeric Antigen Receptor (CAR); and a nucleotide sequence coding for said an inhibitor of regulatory T-cell activity, preferably said cell-penetrating peptide inhibitor of FoxP3.
  • CAR Chimeric Antigen Receptor
  • a composition which comprises a first nucleic acid molecule comprising a nucleotide sequence coding for said first Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell; and a second nucleic acid molecule comprising a nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably said cell-penetrating peptide inhibitor of FoxP3.
  • the composition may comprise a further nucleic acid molecule comprising a nucleotide sequence coding for a second Chimeric Antigen Receptor directed against at least one antigen expressed at the surface of a regulatory T-cell (Treg).
  • composition may comprise a further nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR) and/or a nucleic acid molecule comprising a nucleotide sequence coding for a rare-cutting endonuclease able to selectively inactivate by DNA cleavage the gene coding for the surface antigen CD25.
  • the nucleic acid molecule(s) comprised by the compositions may be DNA or RNA.
  • a nucleic acid molecule is DNA.
  • a nucleic acid molecule is RNA molecule.
  • the nucleic acid molecule or nucleic acid molecules are vectors, such as viral vectors or plasmids.
  • the nucleotide sequence coding for said Chimeric Antigen Receptor (CAR) and/or the nucleotide sequence coding for an inhibitor of regulatory T-cell activity, preferably a cell-penetrating peptide inhibitor of FoxP3, are operatively linked to one or more promoters suitable for expression in a T-cell.
  • kits comprising one or more of the nucleic acid molecules or one or more compositions detailed herein. It is understood that the details given herein in particularly with respect to the first
  • Chimeric Antigen Receptor the inhibitor of regulatory T-cell activity, especially the cell- penetrating peptide inhibitor of FoxP3, the second Chimeric Antigen Receptor, the rare- cutting endonuclease able to selectively inactivate by DNA cleavage at least one gene coding for one component of the T-Cell receptor (TCR) and the rare-cutting endonuclease able to selectively inactivate by DNA cleavage the gene coding for the surface antigen CD25 also apply to these aspects of the invention.
  • TCR T-Cell receptor
  • the T-cells obtainable in accordance with the present invention are intended to be used as a medicament, and in particular for treating, among others, cancer, infections (such viral infections) or immune diseases in a patient in need thereof.
  • the present invention provides engineered T-cells for use as a medicament.
  • the present invention provides engineered T-cells for use in the treatment of a cancer, such as lymphoma, or viral infection.
  • a composition may comprise a population of engineered T-cell of the present invention.
  • the treatment can be ameliorating, curative or prophylactic. It may be either part of an autologous immunotherapy or part of an allogenic immunotherapy treatment.
  • autologous it is meant that cells, cell line or population of cells used for treating patients are originating from said patient or from a Human Leucocyte Antigen (HLA) compatible donor.
  • allogeneic is meant that the cells or population of cells used for treating patients are not originating from said patient but from a donor.
  • the invention is particularly suited for allogenic immunotherapy, insofar as it enables the transformation of T-cells, typically obtained from donors, into non-alloreactive cells. This may be done under standard protocols and reproduced as many times as needed.
  • the resulted modified T-cells may be pooled and administrated to one or several patients, being made available as an "off the shelf" therapeutic product.
  • the treatments are primarily to treat patients diagnosed with cancer.
  • Cancers are preferably leukemias and lymphomas, which have liquid tumors, but may also concern solid tumors.
  • Types of cancers to be treated with the genetically engineered T-cells of the invention include, but are not limited to, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas.
  • sarcomas e.g., sarcomas, carcinomas, and melanomas.
  • Adult tumors/cancers and pediatric tumors/cancers are also included.
  • T-cells of the invention can undergo robust in vivo
  • T-cell expansion upon administration to a patient can persist in the body fluids for an extended amount of time, preferably for a week, more preferably for 2 weeks, even more preferably for at least one month.
  • the T-cells according to the invention are expected to persist during these periods, their life span into the patient's body are intended not to exceed a year, preferably 6 months, more preferably 2 months, and even more preferably one month.
  • the administration of the cells or population of cells according to the present invention may be carried out in any convenient manner, including by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • the compositions described herein may be administered to a patient subcutaneously, intradermaliy, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous or intralymphatic injection, or intraperitoneally.
  • the cell compositions of the present invention are preferably administered by intravenous injection.
  • the administration of the cells or population of cells can consist of the administration of 104-109 cells per kg body weight, preferably 105 to 106 cells/kg body weight including all integer values of cell numbers within those ranges.
  • the cells or population of cells can be administrated in one or more doses.
  • said effective amount of cells are administrated as a single dose.
  • said effective amount of cells are administrated as more than one dose over a period time. Timing of administration is within the judgment of managing physician and depends on the clinical condition of the patient.
  • the cells or population of cells may be obtained from any source, such as a blood bank or a donor. While individual needs vary, determination of optimal ranges of effective amounts of a given cell type for a particular disease or conditions within the skill of the art.
  • An effective amount means an amount which provides a therapeutic or prophylactic benefit.
  • the dosage administrated will be dependent upon the age, health and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment and the nature of the effect desired.
  • said effective amount of cells or composition comprising those cells are administrated parenterally.
  • Said administration can be an intravenous administration.
  • Said administration can be directly done by injection within a tumor.
  • cells are administered to a patient in conjunction with (e.g., before, simultaneously or following) any number of relevant treatment modalities, including but not limited to treatment with agents such as antiviral therapy, cidofovir and interleukin- 2, Cytarabine (also known as ARA-C) or nataliziimab treatment for MS patients or efaliztimab treatment for psoriasis patients or other treatments for PML patients.
  • agents such as antiviral therapy, cidofovir and interleukin- 2, Cytarabine (also known as ARA-C) or nataliziimab treatment for MS patients or efaliztimab treatment for psoriasis patients or other treatments for PML patients.
  • the T cells of the invention may be used in combination with chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAMPATH, anti-CD3 antibodies or other antibody therapies, cytoxin, fludaribine, cyclosporin, FK506, rapamycin, mycoplienolic acid, steroids, FR901228, cytokines, and irradiation.
  • immunosuppressive agents such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies
  • immunoablative agents such as CAMPATH, anti-CD3 antibodies or other antibody therapies
  • cytoxin fludaribine
  • cyclosporin FK506, rapamycin
  • mycoplienolic acid steroids
  • steroids FR901228
  • cytokines irradiation
  • the cell compositions of the present invention are administered to a patient in conjunction with (e.g., before, simultaneously or following) bone marrow transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external-beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH,
  • the cell compositions of the present invention are administered following B-cell ablative therapy such as agents that react with CD20, e.g., Rituxan.
  • subjects may undergo standard treatment with high dose chemotherapy followed by peripheral blood stem cell transplantation.
  • subjects receive an infusion of the expanded genetically engineered T-cells of the present invention.
  • expanded cells are administered before or following surgery.
  • the present invention provides the use of at least one engineered T-cell of the present invention, and preferably a population of said T-cell, in the manufacture of a medicament.
  • a medicament is for use in the treatment of a cancer, such as lymphoma, or viral infection.
  • - Amino acid substitution means the replacement of one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a peptide sequence is an amino acid substitution.
  • nucleosides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine.
  • r represents g or a (purine nucleotides)
  • k represents g or t
  • s represents g or c
  • w represents a or t
  • m represents a or c
  • y represents t or c (pyrimidine nucleotides)
  • d represents g, a or t
  • v represents g, a or c
  • b represents g, t or c
  • h represents a, t or c
  • n represents g, a, t or c.
  • nucleic acid or “polynucleotides” refers to nucleotides and/or polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • PCR polymerase chain reaction
  • Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties.
  • Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
  • sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
  • modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
  • Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Nucleic acids can be either single stranded or double stranded.
  • delivery vector or “ delivery vectors” is intended any delivery vector which can be used in the present invention to put into cell contact ( i.e “contacting") or deliver inside cells or subcellular compartments (i.e “introducing") agents/chemicals and molecules (proteins or nucleic acids) needed in the present invention. It includes, but is not limited to liposomal delivery vectors, viral delivery vectors, drug delivery vectors, chemical carriers, polymeric carriers, lipoplexes, polyplexes, dendrimers, microbubbles (ultrasound contrast agents), nanoparticles, emulsions or other appropriate transfer vectors. These delivery vectors allow delivery of molecules, chemicals, macromolecules (genes, proteins), or other vectors such as plasmids, or penetrating peptides. In these later cases, delivery vectors are molecule carriers.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a “vector” in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acids.
  • Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
  • Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adenoassociated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.
  • orthomyxovirus e. g., influenza virus
  • rhabdovirus e. g., rabies and vesicular stomatitis virus
  • paramyxovirus e. g. measles and Sendai
  • viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example.
  • retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV- BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott- Raven Publishers, Philadelphia, 1996).
  • lentiviral vector HIV-Based lentiviral vectors that are very promising for gene delivery because of their relatively large packaging capacity, reduced immunogenicity and their ability to stably transduce with high efficiency a large range of different cell types.
  • Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope and transfer) or more plasmids into producer cells.
  • lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface.
  • the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex.
  • the product of reverse transcription is a double-stranded linear viral DNA, which is the substrate for viral integration in the DNA of infected cells.
  • integrative lentiviral vectors or LV
  • NILV non integrative lentiviral vectors
  • efficient gene delivery vectors that do not integrate the genome of a target cell through the action of the virus integrase.
  • - Delivery vectors and vectors can be associated or combined with any cellular permeabilization techniques such as sonoporation or electroporation or derivatives of these techniques.
  • - By cell or cells is intended any eukaryotic living cells, primary cells and cell lines derived from these organisms for in vitro cultures.
  • the cell or cells are human cells.
  • primary cell or “primary cells” are intended cells taken directly from living tissue (i.e. biopsy material) and established for growth in vitro, that have undergone very few population doublings and are therefore more representative of the main functional components and characteristics of tissues from which they are derived from, in comparison to continuous tumorigenic or artificially immortalized cell lines.
  • mutant is intended the substitution, deletion, insertion of up to one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, twenty, twenty five, thirty, fourty, fifty, or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence.
  • the mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
  • variant(s) it is intended a repeat variant, a variant, a DNA binding variant, a
  • TALE-nuclease variant a polypeptide variant obtained by mutation or replacement of at least one residue in the amino acid sequence of the parent molecule.
  • - by "functional variant” is intended an active mutant of a protein, polypeptide or a protein domain; such mutant may have the same activity compared to its parent protein, polypeptide or protein domain or additional properties, or higher or lower activity.
  • gene is meant the basic unit of heredity, consisting of a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein.
  • a gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, a 3' untranslated region.
  • the gene may further comprise a terminator, enhancers and/or silencers.
  • cleavage refers to the breakage of the covalent backbone of a polynucleotide. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. Double stranded DNA, RNA, or DNA RNA hybrid cleavage can result in the production of either blunt ends or staggered ends.
  • fusion protein is intended the result of a well-known process in the art consisting in the joining of two or more genes which originally encode for separate proteins or part of them, the translation of said "fusion gene” resulting in a single polypeptide with functional properties derived from each of the original proteins.
  • identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the nucleic acid or amino acid sequences, respectively.
  • polypeptides having at least 70%, 85%, 90%, 95%, 98% or 99% identity to specific polypeptides described herein and preferably exhibiting substantially the same functions, as well as polynucleotide encoding such polypeptides, are contemplated.
  • signal-transducing domain or "co-stimulatory ligand” refers to a molecule on an antigen presenting cell that specifically binds a cognate co-stimulatory molecule on a T-cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation activation, differentiation and the like.
  • a co-stimulatory ligand can include but is not limited to CD7, B7-1 (CD80), B7-2 (CD86), PD- L1 , PD-L2, 4-1 BBL, OX40L, inducible costimulatory igand (ICOS-L), intercellular adhesion molecule (ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, M1 CB, HVEM, lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3.
  • a co-stimulatory ligand also encompasses, inter alia, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as but not limited to, CD27, CD28, 4-IBB, OX40, CD30, CD40, PD-1 , ICOS, lymphocyte function-associated antigen-1 (LFA-1 ), CD2, CD7, LTGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83.
  • an antibody that specifically binds with a co-stimulatory molecule present on a T cell such as but not limited to, CD27, CD28, 4-IBB, OX40, CD30, CD40, PD-1 , ICOS, lymphocyte function-associated antigen-1 (LFA-1 ), CD2, CD7, LTGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83.
  • co-stimulatory molecule refers to the cognate binding partner on a Tcell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the cell, such as, but not limited to proliferation.
  • Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and Toll ligand receptor.
  • a "co-stimulatory signal” as used herein refers to a signal, which in combination with primary signal, such as TCR/CD3 ligation, leads to T cell proliferation and/or upregulation or downregulation of key molecules.
  • bispecific antibody refers to an antibody that has binding sites for two different antigens within a single antibody molecule. It will be appreciated by those skilled in the art that other molecules in addition to the canonical antibody structure may be constructed with two binding specificities. It will further be appreciated that antigen binding by bispecific antibodies may be simultaneous or sequential. Bispecific antibodies can be produced by chemical techniques (see e.g., Kranz et al. (1981 ) Proc. Natl. Acad. Sci. USA 78, 5807), by "polydoma” techniques (See U.S. Pat. No. 4,474,893) or by recombinant DNA techniques, which all are known per se.
  • each binding domain comprises at least one variable region from an antibody heavy chain ("VH or H region"), wherein the VH region of the first binding domain specifically binds to the lymphocyte marker such as CD3, and the VH region of the second binding domain specifically binds to tumor antigen.
  • VH or H region an antibody heavy chain
  • extracellular ligand-binding domain is defined as an oligo- or polypeptide that is capable of binding a ligand.
  • the domain will be capable of interacting with a cell surface molecule.
  • the extracellular ligand-binding domain may be chosen to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state.
  • cell surface markers that may act as ligands include those associated with viral, bacterial and parasitic infections, autoimmune disease and cancer cells.
  • subject or "patient” as used herein includes all members of the animal kingdom including non-human primates and humans.
  • Human primary T cells were activated with anti-CD3/CD28 beads. At day 3, they were transfected with a messenger RNA coding for foxp3 inhibitory peptide p60 (SEQ ID NO: 1 ) fused to a mutated Chicken lysozyme signal peptide (3R CLSP - SEQ ID NO: 12) ( alternative SEQ ID NO.13 to 17 displayed in Table 1 may also be used). At day four, the transfected T cells were mixed with human regulatory T cells (Treg) and their proliferation was followed according to the assay described by Collison, L.W et al. (In vitro Treg suppression assays, Methods Mol. Biol., 201 1 , 707:21 -37).
  • This assay shows that the T-cells transfected with the p60 messenger RNAs, proliferate faster than those transfected with the mock RNA (scrambled p60 - SEQ ID NO: 9), upon contact with the regulatory T cells. It resulted that p60 peptide expression allowed T cells to resist Treg inhibition.
  • Example 2 Cytotoxic activity test Human primary T cells is activated with anti-CD3/CD28 beads.
  • the activated T cells are transduced with a lentiviral vector encoding the chimeric antigen receptor anti-CD19 set forth as SEQ ID NO: 5 along with the Foxp3 inhibitory peptide p60 (SEQ ID NO: 1 ) fused to a mutated Chicken lysozyme signal peptide (3R CLSP - SEQ ID NO: 12) (alternative SEQ ID NO.13 to 17 displayed in Table 1 may also be used).
  • the cytotoxic activity of the transduced T cells are assayed according to the method described by Yang, Z.Z. et al.
  • the assay shows that regulatory T cells usually have an inhibitory effect on the cytotoxic capacity of CAR+ T cells, whereas p60 peptide expression by the T cell restores cytotoxic activity by lifting this inhibition.
  • Table 1 Sequences used in the examples
  • T-cell clones can be rendered specific for CD19: toward the selective augmentation of the graft-versus-B-lineage leukemia effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Developmental Biology & Embryology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/EP2015/053592 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory t cells Ceased WO2015124715A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA2939711A CA2939711C (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory t cells
AU2015220762A AU2015220762B2 (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory T cells
US15/120,060 US10196608B2 (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory T cells
EP15706446.0A EP3107552B1 (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory t cells
JP2016553321A JP6665102B2 (ja) 2014-02-21 2015-02-20 制御性t細胞をインサイチューで阻害するための方法
US15/923,771 US20180208896A1 (en) 2014-02-21 2018-03-16 Method for in situ inhibition of regulatory t cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA201470088 2014-02-21
DKPA201470088 2014-02-21

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/120,060 A-371-Of-International US10196608B2 (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory T cells
US15/923,771 Continuation US20180208896A1 (en) 2014-02-21 2018-03-16 Method for in situ inhibition of regulatory t cells

Publications (1)

Publication Number Publication Date
WO2015124715A1 true WO2015124715A1 (en) 2015-08-27

Family

ID=50158998

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/053592 Ceased WO2015124715A1 (en) 2014-02-21 2015-02-20 Method for in situ inhibition of regulatory t cells

Country Status (6)

Country Link
US (2) US10196608B2 (enExample)
EP (1) EP3107552B1 (enExample)
JP (1) JP6665102B2 (enExample)
AU (1) AU2015220762B2 (enExample)
CA (1) CA2939711C (enExample)
WO (1) WO2015124715A1 (enExample)

Cited By (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9573988B2 (en) 2013-02-20 2017-02-21 Novartis Ag Effective targeting of primary human leukemia using anti-CD123 chimeric antigen receptor engineered T cells
WO2017086419A1 (ja) * 2015-11-18 2017-05-26 中外製薬株式会社 液性免疫応答の増強方法
WO2017086367A1 (ja) * 2015-11-18 2017-05-26 中外製薬株式会社 免疫抑制機能を有する細胞に対するt細胞リダイレクト抗原結合分子を用いた併用療法
WO2017193059A1 (en) * 2016-05-06 2017-11-09 The Regents Of The University Of California Systems and methods for targeting cancer cells
US9815901B2 (en) 2014-08-19 2017-11-14 Novartis Ag Treatment of cancer using a CD123 chimeric antigen receptor
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
WO2018052142A1 (ja) * 2016-09-16 2018-03-22 キッセイ薬品工業株式会社 遺伝子改変細胞及びその作製方法
ES2665543A1 (es) * 2016-10-26 2018-04-26 Fundación Para La Investigación Médica Aplicada Péptidos de unión a FOXP3 y usos de los mismos
WO2018156886A1 (en) * 2017-02-23 2018-08-30 Board Of Regents Of The University Of Nebraska Compositions and methods for treating cancer
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10208285B2 (en) 2016-10-07 2019-02-19 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
CN109562126A (zh) * 2016-06-24 2019-04-02 美商生物细胞基因治疗有限公司 嵌合抗原受体(car)、组合物及其使用方法
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10358474B2 (en) 2015-05-18 2019-07-23 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
WO2019234221A1 (en) 2018-06-08 2019-12-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for stratification and treatment of a patient suffering from chronic lymphocytic leukemia
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10590182B2 (en) 2015-02-24 2020-03-17 The Regents Of The University Of California Binding-triggered transcriptional switches and methods of use thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
CN111971053A (zh) * 2018-02-12 2020-11-20 综合医院公司 靶向肿瘤微环境的嵌合抗原受体
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
EP3747904A1 (en) * 2019-06-03 2020-12-09 Universität Regensburg Cd25-specific chimeric antigen receptors and their uses
US20200407461A1 (en) * 2014-09-04 2020-12-31 Cellectis Trophoblast glycoprotein (5t4, tpbg) specific chimeric antigen receptors for cancer immunotherapy
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11066483B2 (en) 2010-11-30 2021-07-20 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
WO2021155670A1 (zh) * 2020-02-05 2021-08-12 武汉科技大学 治疗血液肿瘤合并hiv感染的双特异性嵌合抗原受体
US11242376B2 (en) 2016-08-02 2022-02-08 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11401332B2 (en) 2016-08-23 2022-08-02 The Regents Of The University Of California Proteolytically cleavable chimeric polypeptides and methods of use thereof
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11485790B2 (en) 2014-04-07 2022-11-01 Chugai Seiyaku Kabushiki Kaisha Immunoactivating antigen-binding molecule
US11505605B2 (en) 2014-05-13 2022-11-22 Chugai Seiyaku Kabushiki Kaisha T cell-redirected antigen-binding molecule for cells having immunosuppression function
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11851491B2 (en) 2016-11-22 2023-12-26 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11883432B2 (en) 2020-12-18 2024-01-30 Century Therapeutics, Inc. Chimeric antigen receptor system with adaptable receptor specificity
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11939389B2 (en) 2018-06-13 2024-03-26 Novartis Ag BCMA chimeric antigen receptors and uses thereof
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12214037B2 (en) 2014-07-21 2025-02-04 Novartis Ag Treatment of cancer using humanized anti-BCMA chimeric antigen receptor
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12378297B2 (en) 2017-04-14 2025-08-05 The General Hospital Corporation Chimeric antigen receptor T cells targeting the tumor microenvironment
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473343B2 (en) 2017-01-10 2025-11-18 The General Hospital Corporation Targeted t cells with cytotoxicity toward immunosuppressive cells
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9458450B2 (en) 2012-03-15 2016-10-04 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US10322949B2 (en) 2012-03-15 2019-06-18 Flodesign Sonics, Inc. Transducer and reflector configurations for an acoustophoretic device
US9752113B2 (en) 2012-03-15 2017-09-05 Flodesign Sonics, Inc. Acoustic perfusion devices
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10689609B2 (en) 2012-03-15 2020-06-23 Flodesign Sonics, Inc. Acoustic bioreactor processes
US9950282B2 (en) 2012-03-15 2018-04-24 Flodesign Sonics, Inc. Electronic configuration and control for acoustic standing wave generation
US10967298B2 (en) 2012-03-15 2021-04-06 Flodesign Sonics, Inc. Driver and control for variable impedence load
US9745548B2 (en) 2012-03-15 2017-08-29 Flodesign Sonics, Inc. Acoustic perfusion devices
US10737953B2 (en) 2012-04-20 2020-08-11 Flodesign Sonics, Inc. Acoustophoretic method for use in bioreactors
US9745569B2 (en) 2013-09-13 2017-08-29 Flodesign Sonics, Inc. System for generating high concentration factors for low cell density suspensions
WO2015105955A1 (en) 2014-01-08 2015-07-16 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US10196608B2 (en) * 2014-02-21 2019-02-05 Cellectis Method for in situ inhibition of regulatory T cells
US9744483B2 (en) 2014-07-02 2017-08-29 Flodesign Sonics, Inc. Large scale acoustic separation device
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11021699B2 (en) 2015-04-29 2021-06-01 FioDesign Sonics, Inc. Separation using angled acoustic waves
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
US11052111B2 (en) * 2015-12-08 2021-07-06 Chimera Bioengineering, Inc. Smart CAR devices and DE CAR polypeptides for treating disease and methods for enhancing immune responses
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
JP2020513248A (ja) 2016-10-19 2020-05-14 フロデザイン ソニックス, インク.Flodesign Sonics, Inc. 音響による親和性細胞抽出
CA3068286A1 (en) * 2017-06-22 2018-12-27 Board Of Regents, The University Of Texas System Methods for producing regulatory immune cells and uses thereof
US12018080B2 (en) 2017-11-13 2024-06-25 The Broad Institute, Inc. Methods and compositions for treating cancer by targeting the CLEC2D-KLRB1 pathway
BR112020009889A2 (pt) 2017-12-14 2020-11-03 Flodesign Sonics, Inc. acionador e controlador de transdutor acústico
US12491153B2 (en) 2018-01-03 2025-12-09 Qu Biologics Inc. Innate targeting of adoptive cellular therapies
CN111349606A (zh) * 2018-12-20 2020-06-30 上海恒润达生生物科技有限公司 P60抑制剂与cart细胞联合应用
US12404331B2 (en) 2019-04-19 2025-09-02 Tcrcure Biopharma Corp. Anti-PD-1 antibodies and uses thereof
PE20241173A1 (es) 2021-10-14 2024-05-28 Arsenal Biosciences Inc Celulas inmunitarias que tienen arnhc coexpresados y sistemas de compuerta logica
EP4460321A2 (en) * 2022-01-06 2024-11-13 Cedars-Sinai Medical Center Protac molecules targeting foxp3 and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012079000A1 (en) * 2010-12-09 2012-06-14 The Trustees Of The University Of Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2328776B1 (es) * 2007-11-19 2010-07-06 Proyecto De Biomedicina Cima S.L. Peptidos con capacidad para unirse a escurfina y aplicaciones.
US8956828B2 (en) * 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
EP2814846B1 (en) * 2012-02-13 2020-01-08 Seattle Children's Hospital d/b/a Seattle Children's Research Institute Bispecific chimeric antigen receptors and therapeutic uses thereof
CN111676196A (zh) * 2012-05-25 2020-09-18 塞勒克提斯公司 工程化异体和免疫抑制耐受性t细胞的方法
EP3744736A1 (en) * 2013-02-20 2020-12-02 Novartis AG Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
US10196608B2 (en) * 2014-02-21 2019-02-05 Cellectis Method for in situ inhibition of regulatory T cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012079000A1 (en) * 2010-12-09 2012-06-14 The Trustees Of The University Of Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
A LOSKOG ET AL: "Addition of the CD28 signaling domain to chimeric T-cell receptors enhances chimeric T-cell resistance to T regulatory cells", LEUKEMIA, vol. 20, no. 10, 1 October 2006 (2006-10-01), pages 1819 - 1828, XP055109417, ISSN: 0887-6924, DOI: 10.1038/sj.leu.2404366 *
DASGUPTA ALAKANANDA ET AL: "Regulatory T cells: a review.", THE NATIONAL MEDICAL JOURNAL OF INDIA 2012 NOV-DEC, vol. 25, no. 6, November 2012 (2012-11-01), pages 341 - 351, XP009177136, ISSN: 0970-258X *
H. J. PEGRAM ET AL: "Tumor-targeted T cells modified to secrete IL-12 eradicate systemic tumors without need for prior conditioning", BLOOD, vol. 119, no. 18, 21 February 2012 (2012-02-21), pages 4133 - 4141, XP055109416, ISSN: 0006-4971, DOI: 10.1182/blood-2011-12-400044 *
J. C. LEE ET AL: "In vivo Inhibition of Human CD19-Targeted Effector T Cells by Natural T Regulatory Cells in a Xenotransplant Murine Model of B Cell Malignancy", CANCER RESEARCH, vol. 71, no. 8, 12 April 2011 (2011-04-12), pages 2871 - 2881, XP055109419, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-10-0552 *
MOA FRANSSON ET AL: "CAR/FoxP3-engineered T regulatory cells target the CNS and suppress EAE upon intranasal delivery", JOURNAL OF NEUROINFLAMMATION, vol. 9, no. 1, 1 January 2012 (2012-01-01), pages 112, XP055108972, ISSN: 1742-2094, DOI: 10.1517/17425247.2011.566267 *
N. CASARES ET AL: "A Peptide Inhibitor of FOXP3 Impairs Regulatory T Cell Activity and Improves Vaccine Efficacy in Mice", THE JOURNAL OF IMMUNOLOGY, vol. 185, no. 9, 1 November 2010 (2010-11-01), pages 5150 - 5159, XP055075433, ISSN: 0022-1767, DOI: 10.4049/jimmunol.1001114 *

Cited By (118)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US11066483B2 (en) 2010-11-30 2021-07-20 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11028177B2 (en) 2013-02-20 2021-06-08 Novartis Ag Effective targeting of primary human leukemia using anti-CD123 chimeric antigen receptor engineered T cells
US9573988B2 (en) 2013-02-20 2017-02-21 Novartis Ag Effective targeting of primary human leukemia using anti-CD123 chimeric antigen receptor engineered T cells
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11485790B2 (en) 2014-04-07 2022-11-01 Chugai Seiyaku Kabushiki Kaisha Immunoactivating antigen-binding molecule
US11505605B2 (en) 2014-05-13 2022-11-22 Chugai Seiyaku Kabushiki Kaisha T cell-redirected antigen-binding molecule for cells having immunosuppression function
US12214037B2 (en) 2014-07-21 2025-02-04 Novartis Ag Treatment of cancer using humanized anti-BCMA chimeric antigen receptor
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10703819B2 (en) 2014-08-09 2020-07-07 The Trustees Of The University Of Pennsylvania Treatment of cancer using a CD123 chimeric antigen receptor
US11591404B2 (en) 2014-08-19 2023-02-28 Novartis Ag Treatment of cancer using a CD123 chimeric antigen receptor
US9815901B2 (en) 2014-08-19 2017-11-14 Novartis Ag Treatment of cancer using a CD123 chimeric antigen receptor
US11987639B2 (en) * 2014-09-04 2024-05-21 Cellectis Trophoblast glycoprotein (5T4, TPBG) specific chimeric antigen receptors for cancer immunotherapy
US20200407461A1 (en) * 2014-09-04 2020-12-31 Cellectis Trophoblast glycoprotein (5t4, tpbg) specific chimeric antigen receptors for cancer immunotherapy
US10822387B2 (en) 2015-02-24 2020-11-03 The Regents Of The University Of California Binding-triggered transcriptional switches and methods of use thereof
US10836808B2 (en) 2015-02-24 2020-11-17 The Regents Of The University Of California Binding-triggered transcriptional switches and methods of use thereof
US10590182B2 (en) 2015-02-24 2020-03-17 The Regents Of The University Of California Binding-triggered transcriptional switches and methods of use thereof
US11965012B2 (en) 2015-05-18 2024-04-23 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US10442849B2 (en) 2015-05-18 2019-10-15 Tcr2 Therabeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US10358473B2 (en) 2015-05-18 2019-07-23 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US10358474B2 (en) 2015-05-18 2019-07-23 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11028142B2 (en) 2015-05-18 2021-06-08 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11649293B2 (en) 2015-11-18 2023-05-16 Chugai Seiyaku Kabushiki Kaisha Method for enhancing humoral immune response
US11660340B2 (en) 2015-11-18 2023-05-30 Chugai Seiyaku Kabushiki Kaisha Combination therapy using T cell redirection antigen binding molecule against cell having immunosuppressing function
JPWO2017086367A1 (ja) * 2015-11-18 2018-09-06 中外製薬株式会社 免疫抑制機能を有する細胞に対するt細胞リダイレクト抗原結合分子を用いた併用療法
WO2017086367A1 (ja) * 2015-11-18 2017-05-26 中外製薬株式会社 免疫抑制機能を有する細胞に対するt細胞リダイレクト抗原結合分子を用いた併用療法
WO2017086419A1 (ja) * 2015-11-18 2017-05-26 中外製薬株式会社 液性免疫応答の増強方法
WO2017193059A1 (en) * 2016-05-06 2017-11-09 The Regents Of The University Of California Systems and methods for targeting cancer cells
US11400116B2 (en) 2016-05-06 2022-08-02 The Regents Of The University Of California Systems and methods for targeting cancer cells
CN109562126A (zh) * 2016-06-24 2019-04-02 美商生物细胞基因治疗有限公司 嵌合抗原受体(car)、组合物及其使用方法
US11242376B2 (en) 2016-08-02 2022-02-08 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11401332B2 (en) 2016-08-23 2022-08-02 The Regents Of The University Of California Proteolytically cleavable chimeric polypeptides and methods of use thereof
US12358988B2 (en) 2016-08-23 2025-07-15 The Regents Of The University Of California Proteolytically cleavable chimeric polypeptides and methods of use thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US10683355B2 (en) 2016-09-16 2020-06-16 Kissei Pharmaceutical Co., Ltd. Genetically-modified cells and method for producing same
JPWO2018052142A1 (ja) * 2016-09-16 2019-06-24 キッセイ薬品工業株式会社 遺伝子改変細胞及びその作製方法
WO2018052142A1 (ja) * 2016-09-16 2018-03-22 キッセイ薬品工業株式会社 遺伝子改変細胞及びその作製方法
US11377638B2 (en) 2016-10-07 2022-07-05 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US10208285B2 (en) 2016-10-07 2019-02-19 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11085021B2 (en) 2016-10-07 2021-08-10 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
JP2022191303A (ja) * 2016-10-26 2022-12-27 ファンダシオン パラ ラ インベスティガシオン メディカ アプリカダ Foxp3結合ペプチド及びその使用
JP7212942B2 (ja) 2016-10-26 2023-01-26 ファンダシオン パラ ラ インベスティガシオン メディカ アプリカダ Foxp3結合ペプチド及びその使用
US11560407B2 (en) 2016-10-26 2023-01-24 Fundación Para La Investigación Médica Aplicada FOXP3-binding peptides and uses thereof
ES2665543A1 (es) * 2016-10-26 2018-04-26 Fundación Para La Investigación Médica Aplicada Péptidos de unión a FOXP3 y usos de los mismos
JP2020500167A (ja) * 2016-10-26 2020-01-09 ファンダシオン パラ ラ インベスティガシオン メディカ アプリカダFundacion Para La Investigasion Medica Aplicada Foxp3結合ペプチド及びその使用
US10654896B2 (en) 2016-10-26 2020-05-19 Fundación Para La Investigación Médica Aplicada FoxP3-binding peptides and uses thereof
US11851491B2 (en) 2016-11-22 2023-12-26 TCR2 Therapeutics Inc. Compositions and methods for TCR reprogramming using fusion proteins
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US12473343B2 (en) 2017-01-10 2025-11-18 The General Hospital Corporation Targeted t cells with cytotoxicity toward immunosuppressive cells
WO2018156886A1 (en) * 2017-02-23 2018-08-30 Board Of Regents Of The University Of Nebraska Compositions and methods for treating cancer
US12187780B2 (en) 2017-02-23 2025-01-07 Board Of Regents Of The University Of Nebraska Car t-cells comprising inactivated CBL and CBL-B genes
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US12378297B2 (en) 2017-04-14 2025-08-05 The General Hospital Corporation Chimeric antigen receptor T cells targeting the tumor microenvironment
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
CN111971053A (zh) * 2018-02-12 2020-11-20 综合医院公司 靶向肿瘤微环境的嵌合抗原受体
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
WO2019234221A1 (en) 2018-06-08 2019-12-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for stratification and treatment of a patient suffering from chronic lymphocytic leukemia
US11952428B2 (en) 2018-06-13 2024-04-09 Novartis Ag BCMA chimeric antigen receptors and uses thereof
US11939389B2 (en) 2018-06-13 2024-03-26 Novartis Ag BCMA chimeric antigen receptors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
EP3747904A1 (en) * 2019-06-03 2020-12-09 Universität Regensburg Cd25-specific chimeric antigen receptors and their uses
WO2020245209A1 (en) * 2019-06-03 2020-12-10 Universität Regensburg Cd25-specific chimeric antigen receptors and their uses
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
WO2021155670A1 (zh) * 2020-02-05 2021-08-12 武汉科技大学 治疗血液肿瘤合并hiv感染的双特异性嵌合抗原受体
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11883432B2 (en) 2020-12-18 2024-01-30 Century Therapeutics, Inc. Chimeric antigen receptor system with adaptable receptor specificity
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences

Also Published As

Publication number Publication date
AU2015220762A1 (en) 2016-07-28
US10196608B2 (en) 2019-02-05
US20170067022A1 (en) 2017-03-09
EP3107552A1 (en) 2016-12-28
CA2939711A1 (en) 2015-08-27
AU2015220762B2 (en) 2019-05-02
CA2939711C (en) 2020-09-29
EP3107552B1 (en) 2018-03-28
JP6665102B2 (ja) 2020-03-13
US20180208896A1 (en) 2018-07-26
JP2017506894A (ja) 2017-03-16

Similar Documents

Publication Publication Date Title
EP3107552B1 (en) Method for in situ inhibition of regulatory t cells
US12171820B2 (en) Method for generating immune cells resistant to arginine and/or tryptophan depleted microenvironment
US11007224B2 (en) CD19 specific chimeric antigen receptor and uses thereof
US20240269178A1 (en) Cd19 specific chimeric antigen receptor and uses thereof
US20250277231A1 (en) Method for generating t-cells compatible for allogenic transplantation
US11077144B2 (en) CD19 specific chimeric antigen receptor and uses thereof
HK40109143A (en) Cd19 specific chimeric antigen receptor and uses thereof
HK1222679B (en) Cd19 specific chimeric antigen receptor and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15706446

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2015220762

Country of ref document: AU

Date of ref document: 20150220

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2939711

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 15120060

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016553321

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015706446

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015706446

Country of ref document: EP