Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6816—Hybridisation assays characterised by the detection means
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
  • G01N15/10—Investigating individual particles
  • G01N15/14—Optical investigation techniques, e.g. flow cytometry
  • G01N15/1434—Optical arrangements
  • G01N15/1436—Optical arrangements the optical arrangement forming an integrated apparatus with the sample container, e.g. a flow cell
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
  • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
  • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
  • G01N21/64—Fluorescence; Phosphorescence
  • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
  • G01N15/01—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials specially adapted for biological cells, e.g. blood cells
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
  • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
  • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
  • G01N21/64—Fluorescence; Phosphorescence
  • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
  • G01N2021/6439—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2201/00—Features of devices classified in G01N21/00
  • G01N2201/06—Illumination; Optics
  • G01N2201/061—Sources
  • G01N2201/06113—Coherent sources; lasers

Definitions

• the present invention relates to a method of detecting a microorganism, in particular Staphylococcus aureus, in a sample, comprising the steps of a) incubating the sample with a slow off-rate modified aptamer (SOMAmer) comprising a fluorescent label, b) optionally washing the sample, c) analyzing the sample by a fluorescence-based detection method.
• SOMAmer slow off-rate modified aptamer
• the invention further relates to a SOMAmer comprising a fluorescent label, wherein the SOMAmer comprises a nucleotide sequence specific for
• Staphylococcus aureus its use for detecting Staphylococcus aureus cells in a sample, and to a microarray or biosensor and a kit comprising at least one of such SOMAmers comprising a fluorescent label.
• Monitoring for microbial contamination of food, water, non-sterile products, or the environment is typically based on traditional microbiology methods, such as culture methods.
• culture methods For the detection of a particular micro-organism, one can use selective or differential culture media that respectively allow the growth of only selected micro-organisms or the differentiation of one micro-organism type from another growing on the same media. These methods require several days to give a result because they rely on the ability of micro-organisms to grow to yield visible colonies.
• NAAT nucleic acid amplification- based technologies
• immunoassays These alternative technologies reduce the detection time compared to traditional culture- based methods.
• NAAT are known to give contamination result in a few hours.
• this technology has several drawbacks, such as the complexity of the protocols which require high technical skills or false positive issues and are still limited by the sample preparation method.
• Immunoassays rely on the use of specific monoclonal or polyclonal antibodies to either capture and/or detect the target micro-organism.
• the efficiency and the success of an immunoassay rely on the quality of the antibodies being used in the test. Due to the way they are produced (in animals or by cell-culture), one drawback of using antibodies is the issue with the batch-to-batch reproducibility.
• new affinity binders have been developed, such as aptamers.
• Aptamers are synthetic, short DNA or RNA strands that can fold into a variety of structures and can bind specifically, like an antibody, to its target.
• DNA aptamers have already been used for the detection of microorganisms (including S. aureus).
• fluorescence-labeled DNA aptamers have also been reported for the detection of whole bacterial cells using fluorescence-based methods: US 2012/0071639 A1 discloses specific DNA sequences for binding various foodborne and waterborne pathogens and biotoxins.
• WO 20 3/064818 A1 discloses fluorescence-labeled aptamers for the detection of pathogenic bacteria in a sample.
• Cao et al. discloses a panel of ssDNA aptamers specific to Staphylococcus aureus obtained by a whole bacterium SELEX procedure. The combination of five of these aptamers resulted in a good effect in the recognition of different S. aureus strains.
• Dwivedi et al. describes DNA aptamers specific for Salmonella enterica serova Typhimurium and their use for the detection of Salmonella by flow cytometry.
• Gold et al. 2010, PLoS One 5, e15004
• Vaught et al. 2010, J Ammonium
• Chem Soc 132, 4141-4151 describe the development of a new aptamer- based reagent called SOMAmer (slow off-rate modified aptamer).
• SOMAmers are made from single-stranded DNA (ssDNA) that contain pyrimidine residues modified at their 5-prime position with mimics of amino acid side-chains and have quite long (> 30 min) dissociation rates. These features lead to better affinity and better kinetic properties of SOMAmers compared to standard RNA or DNA aptamers.
• ssDNA single-stranded DNA
• Ochsner at al. (2013, Diagn Microbiol Infect Dis. 76, 278-285) describes the characterization of SOMAmers specific for Clostridium difficile toxins, i.e. microbial proteins.
• SOMAmers are a very effective tool for the detection of microorganisms in complex samples via fluorescence-based methods.
• the present invention therefore relates to a method of detecting a microorganism in a sample, comprising the steps of
• SOMAmers slow off-rate modified aptamers
• ssDNA single- stranded DNA
• pyrimidine residues modified at their 5- prime position with mimics of amino acid side-chains and have quite long (> 30 min) dissociation rates.
• slow off-rate refers to the time it takes for an
• aptamer/target complex to begin to dissociate. This can be expressed as a half life or the point at which 50% of the aptamer/target complex has dissociated.
• the off-rate or dissociation rate of a SOMAmer expressed as half-life (t-1/2) values, can be more than 30 min, more than 60 min, more than 90 min or more than 120 min.
• the dissociation time can be measured by dynamic systems monitoring the association and dissociation of complexes well known in the art, e.g. Surface Plasmon Resonance.
• SOMAmer reagents can be generated to cell surface-associated proteins of microorganisms via SELEX methods with multiple modified DNA libraries using native or purified recombinant proteins. Suitable SELEX methods for generating such SOMAmers are disclosed in US 7947447 B2, which is incorportated by reference to the disclosure of the present patent
• microorganism relates to bacteria, yeast or fungi.
• the microorganism is a bacterium, preferably a pathogenic bacterium.
• Salmonella spp. such as Salmonella typhimurium, Salmonella enteritidis
• Escherichia coli Listeria spp
• Listeria monocytogenes Staphylococcus aureus
• the microorganism is Staphylococcus aureus.
• Examples for surface-associated proteins of Staphylococcus aureus include SpA, ClfA, ClfB, FnbA, FnbB, SasD, IsdA, IsdB, IsdC, and IsdH. All of these proteins are attached to the cell-wall via sortase-mediated cleavage between the threonine and the glycine of the LPXTG sortase motif and become amide- linked to the pentaglycine cross-bridge of peptidoglycan (Marraffini et al., 2006, Microbiol Mol Biol Rev 70: 192-221 ). S.
• aureus protein A (SpA) is present on the bacterial surface as well as secreted into the extracellular milieu.
• ClfA and ClfB are structurally related fibrinogen-binding proteins (McDevitt et al., 1997, Eur J Biochem 247: 416-424; Ni Eidhin et al., 1998, Mol Microbiol 30: 245-257).
• ClfB is one of the key factors responsible for adherence to desquamated epithelial cells of the anterior nares, and is typically produced during early exponential phase of growth (Ni Eidhin et al., 1998, see above).
• FnbA and FnbB adhere to components of the extracellular matrix, both fibronectin and elastin, and are important for colonization of host tissues during infection (Roche et al., 2004, J Biol Chem 279: 38433-38440).
• SasD is a putative adhesion protein with unknown physiological role (Roche et al., 2003, Microbiology 149: 643-654; Ythier et al., 2012, Mol Cell Proteomics 11 : 1 123-1 139).
• Four of the proteins belong to the iron-responsive surface determinant (Isd) system that is induced in S.
• aureus under iron-limiting conditions and is important for capture of heme from hemoglobin (IsdB, IsdH) and its transport (IsdA, IsdC) across the cell wall (Grigg et al., 2010, J Inorg Biochem 104: 341 -348;
• the sample to be analyzed is a complex sample, such as a clinical sample, a food or feed sample, a beverage sample, a
• the sample may be a raw ingredient, a finished product or may be taken from the environment of manufacture or storage.
• the sample is a clinical sample, a food sample, a
• “Complex sample” means a sample which comprises more than one component.
• a food or feed - it may be meat or a meat product (e.g. raw or cooked meat product), a dairy product or a composition used in the production of a dairy product, such as cheese or yoghurt, a vegetable based food product, a ready to eat food or a food ingredient, a salad product, an infant formula.
• the sample may be a personal care or cosmetic product such as an eye care product, such as contact lens solution.
• the sample is a beverage, it may be for example beer or a sample taken during the brewing of beer, drinking water.
• Pharmaceutical samples cover pharmaceuticals for humans as well as for animals (i.e. veterinary applications).
• a clinical sample may for example be a body fluid, in particular blood, plasma or serum or a tissue sample.
• Exemplary samples include, but are not limited to, food (e.g. milk of cows, ewes, nanny goats, mares, donkeys, camels, yak, water buffalo and reindeer, milk products, meat of beef, goat, lamb, mutton, pork, frog legs, veal, rodents, horse, kangaroo, poultry, including chicken, turkey, duck, goose, pigeon or dove, ostrich, emu, seafood, including finfish such as salmon and tilapia, and shellfish such as molluscs and crustaceans and snails, meat products, plant products, seeds, cereals from grasses, including maize, wheat, rice, barley, sorghum, and millet, cereals from non- grasses, including buckwheat, amaranth, and quinoa, legumes, including beans, peanuts, peas
• the SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus.
• nucleotide sequence refers to an oligonucleotide sequence or polynucleotide sequence, and variant, homologues, fragments and derivatives thereof (such as portions thereof).
• the nucleotide sequence may be of synthetic or recombinant origin, which may be single-stranded whether representing the sense or anti-sense strand.
• nucleotide sequence in relation to the present invention includes synthetic DNA and RNA.
• nucleotide sequence of the present invention includes synthetic DNA and RNA.
• nucleotide sequence of the present invention includes synthetic DNA and RNA.
• SOMAmer according to the present invention could be synthesised, in whole or in part, using chemical methods well known in the art.
• the SOMAmers according to the present invention may be used in a fashion analogous to antibodies. Like antibodies the SOMAmers provide target binding specificity.
• the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO:16 or a fragment thereof or a sequence which is at least 80 % identical therewith, or a sequence which hybridizes under stringent conditions therewith.
• the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:1 1 and SEQ ID NO:12 or a fragment thereof or a sequence which is at least 80 % identical therewith, or a sequence which hybridizes under stringent conditions therewith.
• the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:1 1 and SEQ ID NO: 12.
• the SOMAmer comprises a nucleotide sequence according to SEQ ID NO:1 or SEQ ID NO:3.
• the term "fragment" as used herein means a portion of the aptamer sequence taught herein which has the same or better affinity, specificity or functional activity for the target of interest compared with the full sequence.
• the fragment may be comprised of about 35 nucleotides (e.g. 33-37 nucleotides).
• the fragment preferably has a secondary structure similar to that of the original full length aptamer over the region represented by the fragment.
• the present invention also encompasses the use of sequences having a at least 80% of sequence identity with the nucleic acid sequence(s) of the present invention.
• a similar sequence is taken to include a nucleotide sequence which may be at least 80%, preferably at least 90%) identical, more preferably at least 95 or 98% identical to the subject sequence.
• the similar sequences will comprise the same or similar secondary structure as the subject SOMAmer.
• a similar sequence is taken to include a nucleotide sequence which has one or several additions, deletions and/or substitutions compared with the subject sequence.
• Sequence identity comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % identity between two or more sequences.
• the present invention also encompasses sequences that are
• the SOMAmers comprise a fluorescent label.
• the label may be attached to either the 5' or 3' end of the SOMAmer. In a preferred embodiment the label is attached to the 5'-end of the SOMAmer.
• the skilled person is well aware of techniques for attaching fluorescent labels to nucleic acid strands. Any one of these methods may be utilized in the present invention to attach a fluorescent label to the SOMAmers, e.g. as described by Schubert et al, 1990, Nucleic Acids Research 18, 3427. In principle, the fluorescent label can be attached during or after the oligonucleotide synthesis.
• SOMAmer For indirect attachment any mechanism known to the person skilled in the art can be used, such as using biotin and streptavidin or Digoxigenin (DIG) and Antidigoxigenin.
• DIG Digoxigenin
• Antidigoxigenin any mechanism known to the person skilled in the art can be used, such as using biotin and streptavidin or Digoxigenin (DIG) and Antidigoxigenin.
• the suitable fluorescent label is selected by the person skilled in the art depending on different parameters, such as the size of the label and/ or the optical properties, such as the colour, the fluorescence excitation
• fluorescent labels are fluorescein dyes (such as fluorescein, 6-FAM (6-carboxyfluroescein), JOE, TET, HEX), rhodamine dyes (such as 5'- Tamra, ROX, TRITC, X-Rhodamine, Lissamine Rhodamine B), cyanine dyes (such as Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, IRD700, IRD800, Allophycocyanin (APC)), Peridinin chlorophyll (PerCP), R-Phycoerythrin (R- PE), coumarine dyes (such as hydroxycoumarine, aminocoumarine, methoxycoumarine) and quantum dots.
• fluorescein dyes such as fluorescein, 6-FAM (6-carboxyfluroescein), JOE, TET, HEX
• rhodamine dyes such as 5'- Tamra, ROX, TRITC, X-
• Alexa Fluor® 350 Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, Alexa Fluor® 750, Alexa Fluor® 790, DyLight 350, Dyl_ight 408, DyLight 488, DyLight 549, DyLight 594, DyLight 633, DyLight 649, DyLight 680, DyLight 759, DyLight 800, eFluor® 660, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer Yellow, NBD, Red 613, TruRed, FluorX, BODIPY- FL
• the method according to the present invention involves in step a) the incubation of the sample with a slow off-rate modified aptamer (SOMAmer) comprising a fluorescent label.
• SOMAmer slow off-rate modified aptamer
• the sample is directly inoculated into a buffer or a growth medium (optional incubation) before further analysis by fluorescence-based detection method using the SOMAmers.
• a buffer or a growth medium optional incubation
• the sample is a solid sample, it may be necessary to perform stomaching after or during the addition of the buffer or growth medium.
• the solid sample is rinsed with a fluid which is then collected for further optional incubation in a growth medium and further analysis with the SOMAmers.
• the SOMAmers are mixed with a suitable buffer or with a growth medium which is then mixed with the sample. If the sample is a solid sample, it may be necessary to perform stomaching after or during the addition of the buffer/ growth medium comprising the SOMAmers.
• a suitable buffer can be selected by a person skilled in the art. It typically has a pH value greater than 5 and lower than 9, preferably greater than 6 and lower than 8, more preferably between 6.5 and 7.5.
• the buffer which may be used in the method of the present invention is preferably selected from the group of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2-hydroxymethyl-1 , 3-propanediol (TRIS) buffer, TRIS buffered saline buffer (TBS) and TRIS/EDTA (TE).
• the buffer further comprises MgCb.
• the MgCb - if present - is typically present in concentrations between 0.005 and 3 M, preferably between 0.01 and 1 M, more preferably between 0.01 and 0.5 M, e.g. 25 mM.
• SOMAmers typically, approximately 0.07 ⁇ /L would be sufficient for the detection of 10 7 cells of target microorganisms in a sample.
• a SOMAmer concentration of 0.01 to 10 ⁇ / ⁇ buffer is used.
• the incubation is typically performed at temperatures between 16°C and 30°C, preferably between 18°C and 28°C, more preferably at room temperature.
• the time period for incubation is between 1 and 60 min, preferably between 5 and 30 minutes.
• concentration of SOMAmers used in accordance with the present invention may be determined by a person skilled in the art.
• the method according to the present invention may involve a step of washing the sample. During this step any unbound SOMAmer may be washed off before detecting the presence of bound SOMAmer.
• washing means that the sample is centrifuged and the pellet is resuspended in buffer.
• the washing step can be done once or repeated several times, e.g. twice, 3 times or 4 times.
• the sample is analyzed by a fluorescence-based detection method.
• the fluorescence-based detection method is preferably selected from the group consisting of flow cytometry, solid-phase cytometry, fluorescence-based analytical methods, and fluorescence imaging system (such as fluorescence microscopy).
• Flow cytometry is an analytical method that allows the measurement of light scattered and fluorescence emission produced by illuminated single cells.
• the cells or particles to be analyzed are suspended in a liquid and pass individually through a laser beam.
• the scattered light (related to the particle's size and complexity) and fluorescence emissions (due to fluorescence labeling of the target particle/cell) of each particle are collected by detectors and sent to a computer. Since each particle or cell is interrogated separately, the results represent cumulative individual cytometric characteristics (Alvarez-Barrientos et al. 2000, Clin Microbiol Rev, 13(2): 167-195).
• the sample that may contain the target analyte is mixed with a reagent specific to the target analyte (e.g. the SOMAmers according to the present invention) labeled with a suitable fluorescent molecule.
• a reagent specific to the target analyte e.g. the SOMAmers according to the present invention
• the labeled sample is then processed by the flow cytometer: cells pass individually through the laser beam and the resulting scattered light and fluorescence signal are analyzed to collect information related to the target analyte (e.g. cells).
• the target analyte e.g. cells
• a fluorescence imaging system provides an image of observed objects (e.g. single cells, micro-colonies) which is formed using light emitted from fluorescent phenomenon (Barrett and Myers 2003, Foundations of Image Science. In Wiley Series in pure and Applied Optics ed. Saleh B.E.A. USA, New Jersey, Hoboken: John Wiley & Sons, Inc). Fluorescence microscopy is an example of fluorescence imaging system in which the imaged features are small and obtained through an optical magnification.
• the sample that may contain the target analyte is mixed with a reagent specific to the target analyte (e.g. SOMAmers) labeled with a suitable fluorescent molecule.
• a reagent specific to the target analyte e.g. SOMAmers
• the labeled sample is placed under the microscope objective.
• the microscope parameters are set to match the fluorescent label properties.
• Solid-phase cytometry is a method for detecting single particles/cells on a solid surface. Typically the solid phase cytometry is realized on a
• the image-based quantification system will provide the amount, size and shape of any selected markers in conjunction with their localization on the membrane.
• the sample that may contain the target analyte, is filtered over a black membrane filter (e.g. polyester or polycarbonate) with an appropriate pore size (i.e. 0.4 pm for bacteria). Then, the retained cells are labeled with a reagent specific to the target analyte (e.g. SOMAmers) labeled with a suitable fluorescent molecule.
• a reagent specific to the target analyte e.g. SOMAmers
• the filter is subsequently scanned with a laser which allows fluorescent events (e.g. labeled micro-organisms) on the membrane to be detected by a series of detection units.
• Fluorescence-based analytical method is a method measuring an overall amount of fluorescence signal that is used to detect and/or measure the amount of a target analyte which has been labeled with a suitable
• the sample that may contain the target analyte is mixed with a reagent specific to the target analyte (e.g. SOMAmers) labeled with a suitable fluorescent molecule.
• a reagent specific to the target analyte e.g. SOMAmers
• the container with the labeled sample e.g. microplate, tube
• the fluorescence emission occurring as a consequence of the binding between the target analyte and the fluorescent reagent, is collected by a proper light sensor. This amount of fluorescence is quantified by the sensor and processed in correlation with reference data to provide a measure of the analyte.
• Any fluorescent molecule can be used with any fluorescence-based detection method.
• the key requirement is the availability for a given detection method of a suitable excitation source and a suitable
• the method according to the present invention provides several advantages
• the invention further relates to a slow off-rate modified aptamer
• SOMAmer comprising a fluorescent label, wherein the SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus.
• the present invention relates to a SOMAmer comprising a fluorescent label, characterized in that the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:15 and SEQ ID NO:16 or a fragment thereof or a sequence which is at least 80 % identical therewith, or a sequence which hybridizes under stringent conditions therewith.
• the invention relates to a SOMAmer comprising a fluorescent label, characterized in that the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 1 1 and SEQ ID NO: 12 or a fragment thereof or a sequence which is at least 80 % identical therewith, or a sequence which hybridizes under stringent conditions therewith.
• SEQ ID NO:1 SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 1 1 and SEQ ID NO: 12 or a fragment thereof or a sequence which is at least 80 % identical therewith,
• the present invention relates to a SOMAmer comprising a fluorescent label, characterized in that the SOMAmer comprises the nucleotide sequence according to SEQ ID NO: 1 or SEQ ID NO:3.
• the present invention relates to the use of a
• SOMAmer comprising a fluorescent label as defined above for detecting Staphylococcus aureus cells in a sample.
• the SOMAmers according to the present invention may be immobilized on (e.g. bound or adhered to) a substrate or carrier, e.g. a microcarrier.
• the invention also relates to a microarray or biosensor comprising at least one of the SOMAmers comprising a fluorescent label as defined above.
• a biosensor is an analytical device for the detection of a target analyte, which converts a biological response into an electrical signal.
• Biosensor applications use biological recognition elements such as enzymes, antibodies and nucleic acids, to detect the target molecule.
• a typical biosensor contains three components: a biological sensing element that can recognise or bind the analyte, a transducing element which converts the detection event into a measurable signal, and a display that transforms the signal into a digital format.
• the sensing element primarily defines the selectivity and sensitivity of the biosensor.
• the detection of the analytes is usually based on sensing the analytes with either an electrical or optical readout.
• the SOMAmers comprising a fluorescent label according to the present invention can be used as biological elements in the biosensor application.
• the present invention relates in a further embodiment to a kit comprising at least one SOMAmer comprising a fluorescent label as defined above.
• the kit according to the present invention may be a rapid detection test kit.
• the kit may for example comprise i) at least one (such as 2, 3 or 4)
• SOMAmer comprising a fluorescent label according to the present invention and ii) instructions on how to use the SOMAmers.
• Figure 1 Detection of Staphylococcus aureus by flow cytometry after staining of 10 7 cells with different concentrations of fluorescence labeled 4520-8 (SEQ ID NO:3) and 4531-56 (SEQ ID NO:1) SpA SOMAmers (15 min binding reaction).
• Mean fluorescence intensities are represented in columns and percentages of stained cells as line graph.
• Example 1 Purification of S. aureus targets
• the clfA genes are transferred as BamH ⁇ -Sac ⁇ cassettes into the expression vector pET-51 b (EMD-Novagen) that harbors an
• the plasmids are sequenced to verify the gene identity and proper gene fusion of the cloned DNA fragment with the vector-encoded sequences for the His-tag and Strep tag.
• Table 1 Amplification and cloning of genes encoding S. aureus cell surface proteins
• the recombinant proteins are over-expressed in E. coli BL21 (DE3) or in
• BL21 (DE3)/pl_ysE (EMD/Novagen).
• Conditions for optimal expression of soluble proteins are optimized with respect to growth temperature (25- 37°C) and induction time (4-15 h).
• Cells from 0.1-0.8 L cultures are lysed with 10 mL BugBuster/ Benzonase reagent (EMD Millipore). The
• Strep*Tactin ® SuperflowTM agarose EMD Millipore.
• Native staphylococcal protein A is purchased from VWR and is biotinylated with NHS-PEG4-biotin (Pierce Biotechnology). Protein concentrations are determined using the
• Buffer SB18T is used through-out SELEX and subsequent binding assays, consisting of 40 mM HEPES pH 7.5, 0.1 M NaCI, 5 mM KCI, 5 mM MgCI 2 , and 0.05% Tween-20. Eight rounds of selection are carried out, and, beginning with round 2, a kinetic challenge with 10 mM dextran sulfate is performed to favor slow off-rates.
• Partitioning of the SOMAmer-target complexes is achieved with paramagnetic Talon Dynabeads ® Talon ® (Invitrogen) that bind the Hisio-tag on the recombinant proteins, or with MyOne Streptavidin C1 beads (Life Technologies) for the biotinylated SpA. Selected sequences are eluted from the bead-bound targets with 80 ⁇ 40 mM NaOH,
• DNA reassociation kinetic analysis of selected DNA from rounds 3 through 8 is used for the assessment of sequence convergence during the later rounds, indicating increased abundance of some sequences or sequence families.
• SOMAmer pools that demonstrate good affinity (Kd ⁇ 10 nM) in solution binding radioassays (see below) are cloned and the sequences of 48 clones per pool are determined. Individual SOMAmers are chosen based on sequence patterns and diversity and prepared enzymatically for further characterization. Synthetic SOMAmers are prepared as 48-50-mers at 1 pmol scale via standard phosphoramidite chemistry and HPLC purified.
• They contain a 5'biotin-dA or 5'fluorescein-biotin-dA, and an inverted dT nucleotide at the 3' end (3'idT) for added stability to 3' to 5' exonucleases.
• SOMAmers are properly folded via heating for 5 min at 95°C, followed by cooling to room temperature over a 10-15 min period, prior to binding assays.
• Kd's are determined in equilibrium solution binding assays of radiolabeled SOMAmers (10-20 pM) with serially diluted proteins
• the SOMAmers pools Prior to cloning, the SOMAmers pools are also tested for specific binding to S. aureus, using S. epidermidis, S. hemolyticus, S. pyogenes, E. faecalis, E. coli, and P. aeruginosa as controls in 2 h equilibrium binding assays.
• Cell densities range from 10 5 - 10 8 CFU/mL, and 0.1 mM dextran sulfate and 0.35 M NaCI is added to the binding buffer to reduce non-specific background.
• individual nucleic acid aptamers are screened for binding to eight different S. aureus strains belonging to different lineages, including NRS382, NRS383, NRS384, NRS123, NRS385, NRS386, NRS103 (NARSA), and ATCC 29213 (ATCC).
• Pool affinity assays confirm the successful selection of SOMAmers for a total of 22 pools obtained with BndU, NapdU, or TrpU modified ssDNA, with pool affinities in the range of 0.13-8.90 nM. Specific binding to S. aureus cells, but no binding to S. epidermidis, S. hemolyticus, S. pyogenes, E. faecalis, E. coli, or P. aeruginosa is observed. Alignment of sequences determined for 48 clones from each pool show multi-copy clones and families that share common sequence patterns.
• Table 2 SOMAmer reagents for S. aureus cell surface proteins, with affinity (Kd) shown for the original full-length sequences obtained in SELEX.
• SpA 4531 -56 SEQ ID NO: 1 GCTCGAGTTAATTCGGGATCGGGCTCCGGCTTTT
• SpA 4520-3 SEQ ID NO:2 CCGGCTTCGGGTACCTATTATCGGTTTAGCCCAGT
• SpA 4520-8 SEQ ID NO:3 TCGGCTTCGGGTACCTATTATCGGTTTAGCCCAGT
• SpA 4520-20 SEQ ID NO:4 GCGGCTTCGG GTAC CTATTATC G GTTTAG CC C AGT
• SpA 4520-27 SEQ ID N0:6 GCGGCTTCGGGTACCTATTATCGGTTTAGCCCTGT
• SpA 4520-42 SEQ ID N0:8 TCGGCTTCGGGTACCTATTATCGGTTTAGCCCAGT
• SpA 4520-44 SEQ ID N0:9 ACGGCTTCGGGTACCTATTATCGGTTTAGCCA- GTCAGAA
• ClfA 4503-66 SEQ ID ATCTGGTTCAAAGTGACGATTGGGCATCTGGTTTT
• SOMAmers that target the SpA protein are NapdUTP (or NapdU)
• nucleotides, and the "T" nucleotide for the SOMAmers that target the ClfA protein are BndUTP (or BndU) nucleotide.
• the motif (4520) for the aptamer sequence that binds the SpA protein is represented by the following sequence:
• GGCVWCGGGWACCWAWWAWNGGWWWAGCC(N)nGWC (SEQ ID NO: 15), wherein the "W” in the sequence represents a position that may be occupied by a C-5 modified pyrimidine, and "N” represents a position that may be occupied by any unmodified or modified nucleotide, and n is from 0 to 2 (or 0, 1 or 2).
• the C-5 modified pyrimidine is a
• the C-5 modified pyrimidine is a
• the motif (4503) for the aptamer sequence that binds the ClfA protein is represented by the following sequence:
• AWCWGGWC(N)nAWCWGGWVVWWWAAG SEQ ID NO: 16
• W in the sequence represents a position that may be occupied by a C-5 modified pyrimidine
• N represents a position that may be occupied by any unmodified or modified nucleotide.
• n may be a number from 1 to 30 (or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or ), or from 2 to 20 ( or 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20), or from 5 to 18 (or 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 7 or 18), or from 10 to 16 (or 10, 1 1 , 12, 13, 14, 15 or 16).
• n is 16.
• the C-5 modified pyrimidine is a NapdU or a BndU. More preferably, the C-5 modified pyrimidine is a BndU.
• Example 4 Detection of Staphylococcus aureus cells by flow
• Trypcase Soy Broth (TSB; bioMerieux, Craponne, France) is inoculated with a frozen-preserved culture of Staphylococcus aureus DSM 1 104 (or ATCC 25923) and incubated overnight at 32.5X with shaking. Overnight culture is then subcultured in fresh TSB at 32.5°C with shaking until the working culture reaches an OD600 of 0.8 (approximately 10 8 bacteria ml "1 ) and divided into aliquots of approximately 10 7 cells per tube. Bacteria are harvested by centrifugation at 10 OOOg for 2 min.
• Pellets are resuspended in 100 ⁇ of PBS / 25 mmol MgC containing the SOMAmers in a range of concentrations (0.07 - 7 ⁇ I "1 ). After incubation at room temperature for 5, 15 or 30 min, the bacteria are centrifuged at 10 OOOg for 2 min and the pellets are resuspended with PBS / 25 mmol I "1 MgCl2. This washing step is repeated twice. Controls of unstained bacteria are included by following the same protocol without adding the SOMAmers. Unstained and stained bacteria are then analyzed by flow cytometry. All experiments are performed with a FACSCaliburTM flow cytometer (Becton Dickinson).
• Data from the FACSCaliburTM are analyzed using the BD CellQuestTM software (Becton Dickinson Biosciences).
• Fluorescence-labeled SpA SOMAmers 4520-8 (SEQ ID NO:3) and 4531 -56 (SEQ ID NO:1) are used to assess their efficiency for the detection of S. aureus by flow cytometry. Both SOMAmers perform well in staining whole S. aureus cells.
• SOMAmers to ensure a precise discrimination by flow cytometry between the negative populations (unstained cells) and the positive populations (stained cells) can be set up at 0.07 pmol I "1 ( Figure 1 b).
• aureus by flow cytometry is achieved in a simple one-step procedure using a low reagent concentration (0.7 pmol I "1 ) and a short binding time (15 min).
• DNA aptamers have already been reported for the flow cytometry-based detection of S. aureus using single or combined aptamers (Cao et al. 2009) or for the detection of Salmonella typhimurium using aptamers generated by whole-cell SELEX (Dwivedi et al. 2013).
• the percentages of aptamer-labeled cells obtained in these studies did not approach 100% and the fluorescence intensities were weaker compared to the fluorescence intensities obtained with the SOMAmers of the present invention.
• the DNA aptamers are manufactured by Integrated DNA Technologies.
• the protocol for both the inventive aptamers and the standard aptamers is the same as the one described in Example 4 (exception for standard aptamers: no heating of the aptamers before the assay; PBS is used as the binding buffer).
• the percentage of stained cells obtained with 159 ⁇ I "1 of standard aptamers doesn't reach 100% after a 60-min binding time. Whereas with 0.7 pmol I "1 of SOMAmers according to the present invention, 100% of cells are stained in only 5 minutes. This result demonstrates that the binding efficiency of the SOMAmers according to the present invention is better than standard DNA aptamers even with a 200 times lower concentration.
• n is a, c, g, or t
• n is a, c, g, or t
• n is a, c, g, or t

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Analytical Chemistry (AREA)
• Organic Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Immunology (AREA)
• Physics & Mathematics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• Genetics & Genomics (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Optics & Photonics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Dispersion Chemistry (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Apparatus Associated With Microorganisms And Enzymes (AREA)

Priority Applications (5)

Applications Claiming Priority (4)

Publications (1)

Family

ID=52577818

Family Applications (1)

Country Status (6)

Cited By (2)

Families Citing this family (2)

Citations (1)

Family Cites Families (3)

• 2015
  • 2015-02-20 EP EP15706159.9A patent/EP3108007B1/en active Active
  • 2015-02-20 CN CN201580009181.7A patent/CN106164292B/zh active Active
  • 2015-02-20 US US15/119,987 patent/US10526663B2/en active Active
  • 2015-02-20 JP JP2016570171A patent/JP2017506912A/ja active Pending
  • 2015-02-20 ES ES15706159T patent/ES2736474T3/es active Active
  • 2015-02-20 WO PCT/EP2015/000393 patent/WO2015124315A1/en not_active Ceased
• 2019
  • 2019-12-23 JP JP2019231099A patent/JP6989585B2/ja active Active

Patent Citations (1)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events