WO2015115690A1 - 누난 증후군의 유도-만능 줄기세포 모델 및 이의 용도 - Google Patents
누난 증후군의 유도-만능 줄기세포 모델 및 이의 용도 Download PDFInfo
- Publication number
- WO2015115690A1 WO2015115690A1 PCT/KR2014/000880 KR2014000880W WO2015115690A1 WO 2015115690 A1 WO2015115690 A1 WO 2015115690A1 KR 2014000880 W KR2014000880 W KR 2014000880W WO 2015115690 A1 WO2015115690 A1 WO 2015115690A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ipsc
- syndrome
- differentiation
- noonan syndrome
- model
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5073—Stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5026—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on cell morphology
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5058—Neurological cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1307—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/38—Pediatrics
- G01N2800/385—Congenital anomalies
Definitions
- the present invention relates to an induction of noonan syndrome-induced pluripotent stem cel ls (iPSC) model, a method for preparing the same, and a use of the iPSC model hununan syndrome for use in the study and screening of the therapeutic agent will be.
- iPSC noonan syndrome-induced pluripotent stem cel ls
- Noonan syndrome is a hereditary disease caused by excessive activity of the Ras-MAPK signaling system, which was published by J.A.Nunan in 1983. Nuran's syndrome was initially disturbed due to an external symptom similar to Turner syndrome, but unlike Turner syndrome, it showed a normal karyotype and was identified as a separate disease by the onset in both men and women.
- Symptoms and physical findings in patients with Nuranan Syndrome vary greatly in the severity and extent of the symptoms, and are characterized by characteristic appearance, growth and developmental disorders, and may indicate intellectual or developmental disorders in patients with normal living conditions. The degree varies from patient to patient.
- the main symptoms of reported Nuran syndrome are shown in [Table 1] below, and are mainly reported in body parts related to ectoderm and mesoderm rather than endoderm.
- Prominent mass and wrinkled skin oi Deep weight, wide upper lip (95%), arched palate (45W and small jaw (25%) Parental pterygium. Cystic lymphangioma, short neck growth and developmental adolescent short stature (5070%)
- Musculoskeletal and thoracic malformations (903 ⁇ 4), scoliosis (10-1), erectile malformations (10-15, lateral outgrowth of tooth development disorders (5), cervical fusion (2%), and dental malocclusion disorders (103 ⁇ 4) , Decreased myotonic dysfunction, joint flexion, rarely malformation of the cranial nervous system Heart abnormality ECG abnormality (90%), congenital heart malformation (68%) ,
- the main cause of pulmonary valve related malformations (20-50%) and hypertrophic cardiomyopathy (2-30%) of Nuran syndrome is known as the PTPN11 gene located on chromosome 12.
- the PTPN11 gene encodes Src-homology domain 2 containing tyrosine phosphatase (SHP-2), which includes tyrosine phosphatase, which binds ligands to receptors such as FGFR, EGFR, HGFR, and MET.
- SHP-2 tyrosine phosphatase
- Ras-MAPK Activated by Ras-MAPK, through GRB2 and S0S1 or by independently activating Ras to induce phosphorylation in ERK (Yoko Aoki et al., (2008) ) Human mutation, 29 (8), 992-1006).
- the Ras-MAPK signaling system includes cell proliferation, migration, survival, cell fate determination, skeletal muscle rearrangement, metabolism, and metabolism. It exhibits various biological control functions such as senescence. It has also been reported to be involved in morphological decisions, organogenesis, and nerve growth processes in individuals.
- Activation of the Ras-MAPK signaling system is associated with cytokine and growth factors (Article 26 of the Rules).
- cytokine and growth factors Article 26 of the Rules.
- a ligand such as a factor or a hormone
- a mutation is induced in a gene of a medium constituting the Ras-MAPK signaling system
- abnormal activation occurs even when the ligand does not bind to the receptor. It affects the development and differentiation of normal cells, accompanied by functional abnormalities.
- studies In order to study the onset of Nurnan syndrome and to screen for therapeutic agents, studies have been conducted to reproduce Nurnan syndrome as a mouse model. However, there is no known analysis of specific developmental mechanisms of Nunan syndrome. Or research on therapies is also scarce, so patient-specific pathogenesis and.
- Stem cell is a cell before the differentiation of each cell constituting the tissue, which can be obtained from each tissue of the embryo, fetus and adult, and has the ability to proliferate indefinitely in undifferentiated state and to stimulate specific differentiation
- stem cells are differentiated into specific cells due to differentiation stimulation (environment), and unlike differentiated cells in which cell division is stopped, they can proliferate because they can self-renewal by cell division. It is characterized by having plasticity in differentiation because it can be differentiated into other cells by different environment or differentiation stimulus.
- hPSCs Human pluripotent stem cells
- iPSCs induced pluripotent stem cells
- hPSCs Human pluripotent stem cells
- iPSCs induced pluripotent stem cells
- iPSCs derived from patients with various genetic diseases show disease-specific phenotypes when directly differentiated into disease-related cell types (Park, IH et. al. Cell 134, 877-886 (2008); Tiscornia, G. et al. Nature medicine 17, 1570-1576 (2011)).
- These disease-specific iPSCs can be differentiated into cell types associated with the disease, and therefore, it is considered that they may be useful for specific mechanisms of disease or screening for therapeutic agents.
- the present inventors have tried to establish a stem cell model for studying Nuran syndrome, and as a result, the induced pluri potent stem cells (iPSC) derived from the fibroblasts of patients with Nuran syndrome, The induction and differentiation of embryo id body (EB) and neural rosettes were induced, and it was confirmed that iPSCs derived from Nuran's syndrome exhibited the morphology and differentiation ability of normal iPSCs.
- EB embryo id body
- iPSCs derived from Nuran's syndrome exhibited the morphology and differentiation ability of normal iPSCs.
- EB embryo id body
- iPSCs derived from Nuran's syndrome exhibited the morphology and differentiation ability of normal iPSCs.
- iPSC induced pluri potent stem cells
- An object of the present invention is to replace the same paper as cells of patients with noonan syndrome (rule 26) By providing new induced pluripotent stem cells (iPSCs) that maintain their properties, we will use them to study the development of Nuran's syndrome and to screen for drug candidate screening methods.
- iPSCs induced pluripotent stem cells
- iPSCs inducing fibroblasts isolated from patients with Noonan syndrome in vitro (TV?) to induced pluripotent stem cells (iPSCs);
- ii) obtaining a iPSC model in vitro, comprising the step of obtaining the iPSC induced in step i).
- the present invention also provides a Nunan syndrome iPSC model prepared by the above method.
- ii) providing a method of using iPSC as a model of Nunan syndrome, comprising analyzing the characteristics of the embryoid body or neurons induced in step i).
- the present invention provides a method of using iPSC as a model of Nunan syndrome, comprising analyzing the characteristics of the embryoid body or neurons induced in step i).
- step i) treating the necrosis compound or test composition to the iPSC model, embryoid body or neuron of step i):
- iv a method of screening a candidate agent for treatment of nunan syndrome, comprising comparing the analyzed result of step iii) with an untreated control group.
- the present invention is to replace the use of the Nunan syndrome iPSC model produced by the above method (Article 26 of the Rule) to provide.
- iPSCs induced pluri otent stem cells
- Figure 1 shows the morphology of induced pluri potent stem cells (iPSCs) cells generated from fibroblasts from patients with Noonan syndrome.
- iPSCs induced pluri potent stem cells
- Figure 2 shows the identification of mutations in the Nuran strata cause gene in iPSCs (NS-iPSC) from patients with Nuran syndrome.
- FIG. 3 shows bisulfite sequencing analysis in NS-iPSC which is in an undifferentiated state to confirm DNA demethylation.
- Figure 4 shows the confirmation that the normal karyotype in NS-iPSC.
- Figure 5 shows the confirmation of alkaline phosphatase staining (Alkaline phosphatase staining, AP staining) of NSPS iPSC to determine whether undifferentiated.
- FIG. 6 shows the identification of pluripotency marker gene expression to confirm multipotency of NS-iPSC.
- Alternative Site (Article 26)
- Figure 7 shows the expression confirmation of stem cell markers 0CT4, NANOG, S0X2, SSEA4, Tra-1-81 and Tra-1-60 protein in NS-iPSC # 4, iPSC derived from Nunan syndrome.
- Figure 8 shows the expression confirmation of stem cell markers 0CT4, NANOG, S0X2, SSEA4, Tra-1-81 and Tra-1-60 protein in NS-iPSC # 5, iPSC derived from Nunan syndrome. '
- FIG. 9 shows teratoma format ion for confirming differentiation potential in vivo in NS-iPSC # 4, iPSC derived from Nunan syndrome.
- FIG. 10 shows teratoma formation to confirm the differentiation potential in vivo in NS-iPSC # 5, iPSC derived from Nunan syndrome.
- FIG. 11 schematically shows the process of induction of differentiation from NS-iPSC to embryoid bodies (EB) and neural rosettes (neuroectoderm, neural rosettes).
- Figure 12 shows the cell morphology of embryonic and neural rosettes induced differentiation from NS-iPSC.
- FIG. 13 shows reduced expression of stem cell related genes in embryonic bodies induced differentiation from NS-iPSCs.
- FIG. 14 shows changes in expression level of signaling factor genes in embryonic bodies induced differentiation from NS-iPSCs.
- FIG. 15 shows an increase in the level of phosphoryllatation of signaling factor proteins in embryonic bodies induced differentiation from NS-iPSCs.
- 16 shows a decrease in neuronal marker gene expression levels in neural rosettes induced differentiation from NS-iPSC.
- Figure 17 shows quantitatively the reduction of neuronal marker gene expression levels in neural rosettes induced differentiation from NS-iPSC.
- 18 is a schematic diagram illustrating the process of inducing chemical differentiation from NS-iPSC to embryoid bodies and neural rosettes.
- Figure 19 shows the replacement paper of the embryonic body and neural rosette chemically induced from NS-iPSC (Article 26) Cell morphology. ⁇
- FIG. 20 shows the cell morphology of embryoid bodies, neural rosettes, neural precursors and neural eel Is chemically induced from differentiation from NS-iPSC.
- FIG. 21 shows confirmation of expression of ectoderm, neural rosette and neuronal genes in neural rosettes induced chemical differentiation from NS-iPSC.
- Figure 22 shows quantitatively the reduction of NR2F1 gene expression in chemical differentiation-induced neural rosettes from NS-iPSC.
- the present invention provides a method of inducing fibroblasts isolated from patients with Noonan syndrome in ' 0 in vitro wn?)-Induced pluri potent stem cells (iPSCs); And
- ii) providing a method for producing an Nurnan syndrome iPSC model in vitro, comprising the step of obtaining iPSC induced in step i).
- Induction of the step i) is preferably used, but not limited to, ectopic expression of a pluri potent marker including 0CT4, S0X2, KLF4 and c-MYC.
- a pluri potent marker including 0CT4, S0X2, KLF4 and c-MYC.
- the present inventors confirmed the clinical symptoms of patients with Noonan syndrome and the mutation of the PTPN11 gene which is the causative gene in fibroblasts derived from the patients (Table 2 and Table 3). Induced the development of Nuran syndrome-derived iPSC (NS-iPSC) from the fibroblasts (see FIG. 1).
- the NS-iPSC shows a normal karyotype while maintaining the gene of Nuranan syndrome (see FIG. 2) (FIG. 4 Alternative paper (Article 26 of the Rule) And undifferentiated state (see FIGS. 3 and 5).
- the present inventors confirmed that the differentiation capacity of the NS-iPSC, NS-iPSC significantly expresses the multipotency marker gene and protein (see FIGS. 6 to 8), teratoma formation in vivo (teratoma formation ) (See FIGS. 9 and 10), it was confirmed to have a multipotent.
- the iPSCs model derived from Nuranan syndrome of the present invention exhibits the same pluripotency as the genetic variation of the Nuranan syndrome patient, and thus, the method of preparing the iPSCs model can be usefully used in the method used for analytical research for Nunan syndrome. have.
- the present invention also provides a Nunan syndrome iPSCs model prepared by the above method.
- the iPSC is preferably one or more of the following i) to iii), but is not limited thereto.
- iii) Expression of at least one stem cell marker protein selected from the group consisting of 0CT4, S0X2, NANOG, SSEA4, Tra-1-81 and Tra-1-60.
- the iPSCs model derived from Nunan syndrome of the present invention exhibits the same mutation as that of the genetic variation of the Nunan syndrome patient, the iPSCs model can be usefully used in a method used for analytical research for Nunan syndrome.
- the present invention
- the induction is either one of natural induction or direct induction due to the addition of chemically induced chemicals, but is not limited thereto.
- the chemical inducing substance is preferably an inducing substance used by those skilled in the art for differentiating stem cells into neurons, such as dorsomorphin and SB431542, and more specifically, either or both of dosomorphine or SB431542.
- the present invention is not limited thereto.
- the dosomorphine and SB431542 may be added to the medium simultaneously or sequentially upon induction of differentiation.
- the characteristics of the embryonic body is preferably any one or more of the following i) to vi), but is not limited thereto.
- the nerve cell is preferably one or more of the following i) to ii), but is not limited thereto.
- the inventors of the present invention provide a non-nanan replacement paper (Rule 26). W
- the present inventors have induced chemical differentiation through the sequential treatment of dorsomorphin and SB431542 to obtain embryoid bodies and neural rosettes from iPSCs derived from patients with Nuran syndrome (see FIG. 18). Normal cell morphology of the induced embryoid body and neural rosette is restored (see FIGS. 19 and 20), and the expression of ectoderm, neural rosette and neuronal marker genes is expressed at a level similar to that of the normal control but is one of the neural rosette genes. It was confirmed that only the expression of the NR2F1 gene, an Orphan nuc lear receptor, in which Ligand was not identified was reduced (see FIGS. 21 and 22). The gene has not been found to have been studied so far in relation to disease, and since its role in early development is not well known, it may be considered necessary to study it.
- the iPSCs model derived from Nuranan syndrome of the present invention can be differentiated into embryoid bodies and neurons, the cell model can be usefully used for analytical studies for mechanism analysis studies and therapeutic drug screening methods of Nunan syndrome.
- the present invention can be usefully used for analytical studies for mechanism analysis studies and therapeutic drug screening methods of Nunan syndrome.
- step ii) treating the test compound or test composition to the iPSC model, embryoid body or neuron of step i): paper to paper (rule 26) W 201
- iv a method of screening a candidate agent for treatment of nunan syndrome, comprising comparing the analysis result of step iii) with an untreated control group.
- the induction is either natural induction or direct induction due to the addition of a chemical inducing substance, but is not limited thereto.
- the chemical inducing substance is preferably an inducing substance used by those skilled in the art to differentiate stem cells into neurons, such as dosomorphine and SB431542, and more specifically, one or both of dosomorphine or SB431542, It is not limited.
- the dosomorphine and SB431542 may be added to the medium simultaneously or sequentially upon induction of differentiation.
- the characteristics of the embryonic body is preferably any one or more of the following i) to vi), but is not limited thereto.
- the nerve cell is preferably one or more of the following i) to ii), but is not limited thereto.
- the candidate drug for the treatment of Nuranan syndrome may be selected as a substance which exhibits similar levels of toxins as in the normal control group in analyzing the characteristics of the embryoid body or neurons differentiated from the iPSC model of the present invention or P.
- a substance that increases the expression level of NP2F1 gene in a differentiation-induced neuron from the iPSC moselle of the present invention to a level similar to a normal control is most preferred, but is not limited thereto.
- Naturally differentiated goblet and neurons from the iPSCs model derived from the Nuran syndrome of the present invention reproduce the abnormal cell morphology and gene expression in the Nuran syndrome.
- the iPSC model can be usefully used for the screening method of a candidate drug for Nunan syndrome because it shows normal cell morphology and expression of neuronal marker genes.
- the present invention also provides the use of the Nunan syndrome iPSC model prepared by the above method. .
- iPSC inducing differentiation from said iPSC into embryoid bodies or neurons; And ii) analyzing the characteristics of the embryoid body or cells induced in step i).
- Naturally differentiated goblet and neurons from the iPSCs model derived from the Nuran syndrome of the present invention reproduce the abnormal cell morphology and expression of genes in the Nunan syndrome.
- the iPSC model can be usefully used for the screening method of a candidate drug for Nunan syndrome because it shows normal cell morphology and expression of neuronal marker genes.
- Alternative Site (Article 26)
- the present invention will be described in detail by way of examples.
- the patients with Nuranan Syndrome were selected and confirmed.
- the sequence of the PTPN11 gene which is known as a Nunan syndrome related gene, was identified from fibroblasts (f i br ob 1 as t) of Nuran's syndrome patients.
- Example ⁇ 1-1> Skin tissue biopsy was performed to obtain dermal f ibroblast tissue of Nunan syndrome.
- fibroblasts were isolated from the dermal tissue obtained above, and 10% fetal bovine serum (FBS; GIBCO, USA), 1% penicillin (penici 11 in; GIBCO, USA) and 1% MEM- Incubated in Dulbecco's modified Eagle's medium (Dulbecco's modi f ied Eaglet medium, DMEM; Welgene, Korea) containing NEAA solution (MEM Non-Essential Amino acids Solut ion; GIBCO, USA). Then, genome DNMgenomic DNA (gDNA) was extracted from the obtained fibroblasts, and the nucleotide sequence of the ⁇ 1 ⁇ gene was confirmed.
- FBS fetal bovine serum
- penicillin penici 11 in
- MEM- Incubated in Dulbecco's modified Eagle's medium Dulbecco's modi f ied Eaglet medium, DMEM; Welgene, Korea
- NEAA solution MEM Non-Es
- an ectopic expression method using reprogramming factors 0CT4, S0X2, C-MYC and KLF4 (Takahashi, K et al, Cel l 131 (5) ): 861-872, 2007) induced the development of iPSC (NS-iPSC) from Nuranan syndrome.
- fetal bovine serum (FBS; GIBCO Co., USA) was substituted for fibroblasts of the Nuranan syndrome patient obtained in Example ⁇ 1-2> (Rule Article 26) Cultured in DMEM medium containing. Then, after infecting a retrovirus expressing 0CT4, S0X2, c-MYC and KLF4 factors, the infected cells were treated with mitomycin C mitomycin C; DMEM / containing 2W serum replacement (serum replacement; GAIBC0, USA) and 10 g / i bFGF (R & D systems, USA) on mouse embryonic fibroblast (MEF) treated with AG scientific After co-culture in F12 medium (GAIBC0, USA) for 10 to 15 days, subcultured to induce the generation of NS-iPSC, and then the induced NS ⁇ iPSCs were subjected to phase-contrast.
- FBS fetal bovine serum
- iPSCs derived from human skin fibroblasts were induced by inducing iPSC generation in the same manner as above from human skin fibroblasts (CRL-2097; American Type Culture Collection (ATCC), USA). (CRL-12) was prepared (Kim et. Al, BBRC 424 (2012) 331-337; same as iPSCs # 2 cells in reference).
- FIG. 1 two NS-iPCS cell lines generated from fibroblasts derived from Nuranan syndrome patients were obtained (NS-iPCS # 4 and NS-iPSC # 5), which showed iPSC morphology of normal cells. It was confirmed (FIG. 1).
- NS-iPSC which induced generation by the same method as in Example ⁇ 2-1> was extracted, genomic DNA (gDNA) of NS-iPSC was extracted, and the nucleotide sequence of PTPN11 gene was confirmed. It was compared with fibroblasts (NS-fibroblast) derived from Nunan syndrome.
- the A922G mutation which is a PTPN11 gene mutation in fibroblasts derived from Noonan syndrome, was also observed in NS-iPSC, and the replacement paper indicated by amino acid variation of N308D in the protein produced therefrom (Rule 26). It was confirmed (Fig. 2).
- EZ DNA methylation-gold kit (EZ DNA methylat ion-Gold Ki t; Zymo
- sulfite-treated DNA was amplified by PCR as a template .
- the amplified PCR product was purified using AccuPrep plasmid Mini extract ion Kit (Bioneer, Korea) and subcloned into pGEM-T EASY vector (Promega, USA). Inserted. Then, the inserted vector was obtained from the Nuan syndrome-derived fibroblasts obtained in Example ⁇ 1_2> and clones transformed into NS-iPSCs that induced development in Examples ⁇ 2-1>. Sequences were identified using SP6, T7 and M13 primers and analyzed using Chromas231 program from Solgent (Sequence Analyst, Korea).
- NS-iPSC # 4 and NS-iPSC # 5 which induced generation in the same manner as in Example ⁇ 2-1>, were obtained and then commissioned by Zendix Corporation (Korea) for karyotype of the NS-iPSC. The analysis was performed.
- alkaline-phosphatase staining AP staining
- NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing generation by performing the same method as in Example ⁇ 2-1> were prepared. Then, using an AP staining kit (Alkaline phosphatase kit, Sigma Aldrich, USA), a mixture of citric acid solution 1 i, acetone 2.6 mi and 37% formaldehyde (Sigma Aldrich, USA) 320 was mixed. A fixed solution was prepared. In addition, it is mixed with 100 ⁇ sodium nitrate solution and FRV-alkaline solution 100 and left for 2 minutes, followed by 4.5 ⁇ sterile water and Naphthol AS-BI alkaline solution 100 ⁇ . It was added and wrapped in foil to block light.
- AP staining kit Alkaline phosphatase kit, Sigma Aldrich, USA
- the prepared iPSC was washed once with PBS, and the prepared fixed solution was added thereto and left at room temperature for 15 minutes in the dark. After standing, AP stained cells were washed twice with water or PBS twice for 2 minutes and observed with a phase contrast microscope (Olympus, Japan).
- NS-iPSC is in an undifferentiated state as shown in FIG. 5 (FIG. 5).
- NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing generation by performing the same method as in Example ⁇ 2-1> were suspended in Easy Blue (Easy-biue; Intron, Korea).
- the total RNA of NS-iPSC was extracted according to the manufacturer's protocol.
- the entire cDNA was synthesized by using the extracted RNA 1 [M-MLV reverse transcriptase (Moloney-mur ine leukemia virus reverse transcriptase; Enzynomics ⁇ , Korea)).
- the synthesized total cDNA was amplified together with the forward primer and the reverse primer described in Table 4 below to confirm the expression of the gene at the mRNA level by electrophoresis.
- H9 cell line H9 hESC
- NS-i ibroblast fibroblasts
- GAPDH GAPDH_F CTOGCTCTCTGCTCCTCCT SEQ ID NO: 17
- GAPDH-RT GAPDH ⁇ R GTTAAAAGCAGCCCTGGTGA SEQ ID NO: 18.
- pluripotency marker genes 0CT4, S0X2, NANOG, c-MYC, REX1, ECAT15, GDF3 and TERT does not appear in the fibroblasts derived from Nuran syndrome, NS-iPSC It was confirmed that all of the pluripotency marker genes were expressed in the same manner as the H9 cell line (FIG. 6).
- stem cell marker sternness maker
- NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing the development by performing the same method as in Example ⁇ 2-1> (Formal in solution 10% neutral buffered, sigma aklrich) , US) fixed at room temperature for 30 minutes, PBS-T (phosphate buffered saline, PBS, GIBC0, USA) containing 0.1% Twen-20 (Tween-20, Sigma aldrich, USA) The treatment was washed three times for 10 minutes at room temperature. After washing, PBS containing 0.1% triton X-100 was treated for 30 minutes in silver to impart permeability to the cell membrane.
- PBS-T phosphate buffered saline
- Twen-20 Teween-20, Sigma aldrich, USA
- the treated cells were blocked with 3% bovine serum albumin (Bovine serum albumin, BSA, Sigma aldrich, USA) at room temperature for 1 hour, and then the anti-0CT4 antibody (1: 200) was used as the primary antibody. Dilution, Santa Cruz, USA), anti-S0X2 rabbit antibody (1: 200 dilution, Cell signaling technology, USA), anti-NAN0G antibody (1: 200 dilution, Cell signaling technology, USA), alternative paper (rules) Article 26) W 201
- Bovine serum albumin Bovine serum albumin, BSA, Sigma aldrich, USA
- anti-SSEA-4 antibody (1: 200 dilution, R & D Systems, USA), anti -Tra- 1-60 antibody (1: 200 dilution Millipore, USA) or anti-Tra-1-81 antibody (1: 200 dilution, Millipore Co., USA) was treated and incubated overnight at 4 ° C, washed several times with PBS-T. After washing, treated with a secondary antibody bound to Alexa Fluor 488 (Alexa Fluor 488, Invitrogen, USA) or Alexa Fluor 594 (Invitrogen, USA) and incubated for 1 hour at room temperature to NS-iPSC Immunofluorescence staining was performed.
- Alexa Fluor 488 Alexa Fluor 488, Invitrogen, USA
- Alexa Fluor 594 Alexa Fluor 594
- teratoma format ion of NS-iPSCs was performed in immunocompromised nude mice.
- NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing generation by performing the same method as in Example ⁇ 2-1> were prepared.
- the prepared cells were collected in a 60mni cell culture dish and collected 5 sheets each and mixed with Matrigel (Matrigel, BD biosciences, USA) to prepare a sample pole.
- the prepared samples were inoculated with 18G syringes between chest flanks of 4 week-old nude mice (CAnN.Cg-Foxnl nu / crljOri, female, Orient Bio, Korea), and were bred while maintaining sterile conditions in the SPF animal room. After breeding for 40 days, it was isolated from mice with teratoma and washed 2-3 times in PBS. Terminated species are 4% replacement paper (Rule 26) W 201
- the stained tissue was subjected to phase contrast microscopy (Olympus, Japan) to determine the ectoderm, the neural tissue, the endoderm, the secretory gland, and the mesoderm, the smooth muscle and the adipose tissue. ) was observed.
- ectoderm As a result, as shown in Figs. 9 and 10, it was confirmed that the ectoderm, the neuroectoderm tissue, the mesoderm, the secretory gland, and the endoderm, the smooth muscle and the adipose tissue were formed by the pi uri potency of NS-iPSC. It was confirmed that iPSC has an effective pluripotency (FIG. 9 and FIG. 10).
- colonies of NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing development by performing the same method as in Example ⁇ 2-1> were divided into 4 parts using a 1 n insulin syringe. .
- the quartered NB-iPSC is sprayed on an ultra-low attachment dish and the 10% serum replacement (regulation paper) (Rule 26) SR; Resuspended in 4 m of embryoid body differentiation medium (DMry / F12) (Invi trogen, USA) containing SPL li fe sciences Co., Ltd, Korea).
- the resuspended NB-iPSCs were cultured for 4 days to induce differentiation into the NS-iPSC-derived goblet (NS- goblet).
- the differentiation-induced NS-ploids were obtained, and a medium in which 20 ng / m «bFGF (FGF2, R & D systems, USA) was added to DMEM / F12 containing N2 and B27 additives, which are neuronal differentiators.
- the obtained NS-embryonic body was attached and cultured to a dish coated with Matrigel (1: 50 dilution, Matr igel, BD Biosciences, USA) to which phosphorus neural embryonic medium (Neural roset te medi a) was added. Incubated for 5 days.
- the neural rosette (NS-negative rosette) derived from the formed Nunan syndrome was selectively obtained and transferred to a dish coated with fibronectin (Fibronect in, BD biosciences, USA) for 4-5 days. Cultured in sieve medium.
- H9 cell line (H9 hESC) which is a normal human embryonic stem cell line
- iPSC (CRL12) derived from human dermal fibroblasts
- Example ⁇ 5-1> the same method as in Example ⁇ 5-1> was carried out to induce spontaneous differentiation of the NS-embryonic body, while replacing the respective NS-twitch bodies at the start of induction 2, 3 and 4 (Rule 26) article) Obtained. Then, the obtained NS-embryoform is suspended in EasyBlue and extracted the total RNA of NS-iPSC according to the manufacturer's protocol, and the extracted RNA 1 / g M-MLV reverse transcription. Synthetic enzymes were used to synthesize whole cDNA.
- the forward primer and the reverse primer described in the above [Table 4] were each 10 pmole, and the Biochlard CFX manager (SybrGreen, Invi trogen, USA) was used.
- Biochlard CFX manager SybrGreen, Invi trogen, USA
- quantitative real-time PCR q-PCR was performed to confirm expression of 0CT4, S0X2, NAN0G and c-MYC genes at the mRNA level.
- q-PCR quantitative real-time PCR
- H9-ES embryoid body derived from H9 cell line, which is a normal human embryonic stem cell line, was used to confirm expression of 0CT4, S0X2, NAN0G and c-MYC genes. And, it was expressed as the expression of 3 ⁇ 4 change (fold change) calculated by the following Equation 1 by comparing the expression level of the gene of the NS-embryoform, respectively.
- CACt ACt value of each gene in H9-ES.
- Example ⁇ 5-1> the same method as in Example ⁇ 5-1> was performed to induce spontaneous differentiation of the NS-embryonic body, and each NS-tissue was obtained at the start of induction 2, 3 and 4 days. Then, the obtained NS-transformant was subjected to the same method as in Example ⁇ 5-2>, and the signal transduction factors of Idl and Id2, which are downstream genes of the BMP signal transduction system, and the TGF- ⁇ signaling system. Expression levels of SMAD2 and SMAD3 genes were identified at mRNA levels. For confirmation, the forward primer and the reverse primer described in Table 5 below were used. NS-iPSC was used as the experimental group, and H9 cell line (H9-ES), which is a normal human embryonic stem cell line, was used as a normal control group.
- H9 cell line H9 cell line
- Example ⁇ 5-1> the same method as in Example ⁇ 5-1> was performed to induce spontaneous differentiation of NS-embryonic bodies # 4 and # 5 with H9 hESCs and CRL12 iPSCs (control), which are normal controls, induction initiation 2 and On day 4 each NS-embryos were obtained. Then, the NS-embryonic body cells were re-suspended in RIPA cell fusion complete solution lX (R4100-100, GenDEP0T, USA) containing EDTA. The re-suspended cells were disrupted by vortexing three to four times every 10 minutes on ice and centrifuged at 4 ° C. and 13000 rpm for 30 minutes.
- RIPA cell fusion complete solution lX R4100-100, GenDEP0T, USA
- the supernatant containing the protein of the cell was obtained, and the concentration of the protein along with the reference protein and the standard curve was confirmed by BCA protein assay kit (BCA protein assay kit, Thermo scientific, USA).
- BCA protein assay kit BCA protein assay kit, Thermo scientific, USA.
- the supernatant obtained from each cell was then purified by 25% glycerol, 2% sodium dodecyl sulfate (SDS), 14.4 mM -mercaptoethanol and 0.1% bromophenol. Dilute with 60 mM Tris-HCl buffer (pH 6.8) containing bromophenol blue and heat for 3 minutes at 10 C.
- the heated protein is a protein with a molecular weight of 30 to 100 kDa or higher
- BSA bovine serum albumin
- P-ERKl / 2 (l: 1000, # 4370S, Cell signaling, USA), ERK1 / 2 (1: 1000, # 9102, Cell signaling, USA), SMAD2 as primary antibody to the membrane (membrane) [S465 / 467] (1: 500, # 3108, Cell signaling company, USA), p-SDMA2 / 3 (1: 500, # 3102, Cell signaling company, USA), p-SMADl / 5/8 (1: 500, # 9511S, Cell signaling company, USA), p-AKT [S473] (1: 1000, # 405 IS, Cell signaling company, USA), AKT (1: 1000, # 9272, Cell signaling company, USA) Land substitute for 0CT4 (N-19, l: 1000, Santa Cruz, USA) (Rule 26) Treated and incubated overnight at 4 ° C., washed three times with TBS-T and bound to anti-rabbit IgG (H + L) 2 bound with horseradi sh peroxida
- H9 cell line H9 hESC
- iPSC CTL12
- Actin act in-HRP conjugate, Santacruz, USA
- Example ⁇ 5-1> was performed to obtain a neural rosette (NS-NR) derived from Nuranan Syndrome induced differentiation, and the same method as in Example ⁇ 5-2> was performed.
- CDNAs such as PAX6, S0X2, ZIC1, 0TX2, and NESTIN genes are synthesized, and amplified and replaced by electrophoresis (Article 26 of the Rule) Expression was confirmed at the mRNA level.
- GAPDH gene was confirmed by performing the same method as described above, and the ACt value of each gene was the difference between the Ct value of GAPDH and each gene.
- H9-NR and CRL12-NR neuronal rosettes induced natural differentiation in the same manner as in Example ⁇ 5-1> from H9 cell line, which is a normal human embryonic stem cell line, and CRL12, an iPSC derived from a normal human fibroblast cell line.
- H9 cell line which is a normal human embryonic stem cell line
- CRL12 an iPSC derived from a normal human fibroblast cell line.
- NS-iPSC # 4 and NS-iPSC # 5 obtained by inducing the development by performing the same method as in Example ⁇ 2-1> were obtained by using a 1. mi insulin syringe. Divided into equal parts.
- the quartered NB-iPSC is an ultra-low adhesive substitute (Article 26) Reimbursement with DMED / F12 medium (Invitrogen, USA) containing 10% serum replacement (SR; GIBCO, USA) sprayed on medium (ultra-low attachment dish, SPL life sciences Co., Ltd, Korea) Re-suspended in body differentiation media 4 1.
- Incubation for 4 days induces differentiation into an embryoid body (NS-embryonic body) derived from NS-iPSC.
- FGF2 20 ng / mi bFGF
- F12 20 ng / mi bFGF
- DMEM DMEM / F12 containing N2 and B27 additives that promote neuronal differentiation.
- Incubate for 4-5 days by attaching and incubating the obtained NS-tetragester to a plate coated with Matrigel (1:50 dilution, Matrigel, BD Sciences, USA) with neural rosette media It was.
- the neural rosette (NS-negative rosette) derived from the Nuonan syndrome formed was selectively obtained and transferred to a dish coated with fibronectin (Fibronectin, BD Sciences, USA) for 4-5 days. Incubate in.
- H9 cell line H9 ESC
- iPSC CTL12
- chemically differentiated NS—ectoderm genes PAX6, ZICl, NESTIN and VIMENTIN MRNA levels of the neuronal rosette genes PLZF, NR2F1, HES5 and DACH1, and neuronal genes TUJl, ASCL1 and NF1 genes were identified.
- Example ⁇ 6-1> by performing the same method as in Example ⁇ 6-1> to obtain a neural rosette derived from NS-iPSC that induced chemical differentiation, by performing the same method as in Example ⁇ 5-2>, NS- Total RNA of iPSC was extracted, and cDNA was synthesized using M-MLV reverse transcriptase (Enzynomics, Korea). Synthesizing cDNAs of ectoderm genes PAX6, ZICl, NESTIN and VIMENTIN, neural rosette genes PLZF, NR2F1, HES5 and DACH1, and neuronal genes TUJl, ASCL1 and NF1 genes, respectively, using the primer sequences shown below.
- the expression of the gene was confirmed at the mRNA level through RT-PCR.
- the neuronal rosette derived from H9 cell line and CRL12 which induced chemical differentiation in the above ⁇ 6-1> were used.
- HES5 HES5-F CATCCTGGAGATGGCTGTCA SEQ ID NO: 41
- the expression level was confirmed by performing the same method as above for the GAPDH gene, and the ACt value of each of the genes was substituted for the Ct value of the GAPDH and NR2F1 genes (Article 26) Calculated as the difference.
- a control group a H9 cell line and a CRL12-derived neural rosette, which induced chemical differentiation, were used in Example ⁇ 6-1> and compared with the expression levels of the genes of the NS-nerve rosette, respectively. Expressed as multiples of expression.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Food Science & Technology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Developmental Biology & Embryology (AREA)
- General Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Transplantation (AREA)
- Physiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 누난 증후군(noonan syndrome)의 유도-만능 줄기세포(induced pluripotent stem cells; iPSC) 모델, 이의 제조 방법, 및 상기 iPSC 모델을 누난 증후군의 발병 연구 및 치료제 스크리닝 방법에 이용하는 용도에 관한 것으로, 구체적으로 누난 증후군 환자의 섬유아세포로부터 누난 증후군 유래의 유도-만능 줄기세포(induced pluripotent stem cells; iPSC), 배상체(embryoid body, EB) 및 신경 로제트(neural rosettes)의 발생 및 분화를 유도하였으며, 상기 누난 증후군 유래의 iPSC는 정상적인 iPSC의 형태 및 분화능을 나타내는 것을 확인하였고, 누난 증후군 유래의 iPSC로부터 배상체 및 신경 로제트로 분화하기 위해 자연분화 및 화학적 분화를 유도한 결과, 화학적 분화를 통해 유도된 배상체 및 신경 로제트는 정상 세포와 유사한 세포 형태를 나타내며, 외배엽, 신경로제트 및 신경세포 마커 유전자를 유의적으로 발현하므로, 상기 세포 모델은 누난 증후군의 기전 분석 연구 및 치료제 스크리닝 방법을 위한 분석 연구에 유용하게 사용될 수 있다.
Description
[명세서】
[발명의 명칭]
누난 증후군의 유도 -만능 줄기세포 모델 및 이의 용도 【기술분야】
본 발명은 누난 증후군 (noonan syndrome)의 유도 -만능 줄기세포 ( induced plur ipotent stem cel l s ; iPSC)모델, 이의 제조 방법 , 및 상기 iPSC모델흘 누난 증후군의 발병 연구 및 치료제 스크리닝 방법에 이용하는 용도에 관한 것이다. [배경기술】
누난 증후군 (noonan syndrome)은 Ras-MAPK 신호전달 체제의 과도한 활성으로 유발되는 유전병으로서, 1983 년 J .A.누난에 의해 발표되었다. 누난 증후군은 초반에 터너 증후군 (Turner syndrome)과 유사한 외형적 증상으로 인하여 흔란을 가져왔으나, 터너 증후군과는 달리 정상적 핵형을 나타내며, 남녀에서 모두 발병하는 것을 통해 별개의 질병으로 확인되었다.
누난 증후군 환자에게서 나타나는 증상 및 신체 소견은 개인마다 증상의 심각한 정도와 범위가 매우 다양하며, 주로 특징적 외모, 성장 및 발달 장애 등의 증상을 나타내어, 정상적인 생활이 가능한 환자로부터 지적 장애 또는 발달 장애를 나타내는 환자까지 정도가 다양하다. 보고된 누난 증후군의 주요 증상은 하기 [표 1]에 나타난 바와 같으며, 주로 내배엽 (endoderm)에 의한 증상보다는 외배엽 (ectoderm)과 중배엽 (mesoderm)에 관련된 신체부위에 나타나는 것으로 보고되고 있다.
【표 1】
누난 증후군의 주요 증상 외모 특징 머리가 길고 좁으며 위가 뾰족한 세모형의 얼굴,
. 두드러진 인중 및 주름진 피부
oi 깊은 인중, 넓은 윗입술 (95%), 아치형 구개 (45W 및 작은 턱 (25%) 모 익상경 . 낭성 림프관종, 짧은 목 성장 및 발달 사춘기 저신장 (5070%)
장애
영유아 발달장애 (40%), 발달지연 (26%), 학습장애 (15%),
언어발달지연 (20¾ 및 경미한 지적 장애 (35%) 혈액, 림프계 장애 손,발 림프부종 (신생아 시기), 혈액 웅고 지연, 백혈병 비뇨 생식기계 장애 잠복고환 (60~80¾), 콩팔기형 (10%)
안과적 증상 안검하수 (95%), 사시 (50-60%), 양안격리,
근시 및 원시 (60~70%) 및 안구진탕 (10%)
근 골격격계 및 흉곽기형 (90¾), 척추측만증 (10~1 ), 발 기형 (10~15고 치아발달 장애 외반주 (5 ), 경추융합 (2%) 및 치아 부정교합 신경계 장애 경련 (10¾), 근긴장도 저하, 관절 유연, 드물게 뇌신경계의 기형 심장 기형 심전도도 이상 (90%), 선천성 심장기형 (68%),
폐동맥판막 연관 기형 (20~50%) 및 비후성 심근증 (2으 30%) 누난 증후군의 주요 원인이 되는 유전자는 12번 염색체 (chromosome)에 위치하는 PTPN11 유전자로 알려져 있다. 상기 PTPN11 유전자는 티로신 포스파타아제를 포함하는 Src-상동성 도메인 2(Src-homology domain 2 containing tyrosine phosphatase, SHP-2)를 암호화하며, 이는 FGFR, EGFR, HGFR, MET와 같은 수용체에 리간드가 결합하여 활성화되면, GRB2와 S0S1을 통하거나 혹은 독립적으로 Ras를 활성화하여 ERK에 인산화 (phosphorylation)를 유도하는 과정을 통해, Ras-MAPK에 중점적으로 관여하는 것으로 알려져 있다 (Yoko Aoki et al. , (2008) Human mutation, 29(8), 992-1006) . 상기 Ras-MAPK 신호전달 체제는 세포의 증식 (prol iferation), 이주 (migration), 생존 (survival ), 세포 운명 결정 (cell fate determination) , 골격근 재배열 (cytoskeletal rearrangement), 대사과정 (metabol ism) 및 노화 (senescence) 등 다양한 생물학적 조절 기능을 나타낸다. 또한, 개체 내에서 형태학 (morphology)적 결정, 기관 형성 (organogenesis) 및 신경의 성장 과정에 관여하는 것으로 보고된 바 있다.
Ras-MAPK 신호전달 체제의 활성화는 사이토카인, 성장 인자 (growth 대체용지 (규칙 제 26조)
factor) 또는 호르몬과 같은 리간드 (ligand)가 수용체에 결합하면서 나타나며, Ras-MAPK신호전달 체제를 구성하는 매개체의 유전자에 변이가 유발되면, 상기 리간드가 수용체에 결합하지 않아도 비정상적인 활성화가 일어나ᅳ 그 결과 정상적인 세포의 발달 및 분화에 영향을 미쳐 기능적인 이상이 동반되어 나타난다. 누난 증후군에 대한 발병 연구 및 치료제 스크리닝을 위하여, 마우스 모델로서 누난 증후군을 재현하고자 하는 연구가 진행되고 있으나, 현재 누난 증후군의 구체적인 발생학적 기전의 분석에 대하여 알려진 바가 없으며, 이에 따라 누난 증후군에 대한 치료제 또는 치료법에 대한 연구 또한 부족한 상황이므로, 환자 특이적인 발병 기전 및. 이에 대한 치료제의 개발이 요구되고 있다. 줄기세포 (stem ceH)는 조직을 구성하는 각 세포로 분화되기 전단계의 세포로서, 배아, 태아 및 성체의 각조직에서 얻을 수 있올 수 있으며, 미분화 상태에서 무한 증식이 가능한 자가증식능 및 특정 분화 자극에 의해 다양한 조직의 세포로 분화될 수 있는 잠재적 가능성인 다분화능 (pluripotency)을 가진 세포를 말한다. 줄기세포는 분화 자극 (환경)에 의하여 특정 세포로 분화가 진행되며, 세포분열이 정지된 분화된 세포와는 달리 세포분열에 의해 자신과 동일한 세포를 생산 (self-renewal)할 수 있어 증식 (proliferation, expansion)하는 특성이 있으며, 다른 환경 또는 다른 분화 자극에 의해 다른 세포로도 분화될 수 있어 분화에 유연성 (plasticity)을 가지고 있는 것아 특징이다.
유도만능줄기세포 (induced pluripotent stem cells; iPSCs)를 포함하는 인간 다능성 줄기세포 (Human pluripotent stem cells; hPSCs)는 다양한 특정 세포 종류로 분화할 수 있는 능력을 가져, iPSC를 시험관 내의 분화 시스템을 사용하였을 때 , 면역 거부반웅의 낮은 위험도와 같은 치료 가능성 (therapeutic potential)뿐만 아니라, 기관 형성 (organogenesis)의 초기 발달 동안에 복합적 대체용지 (규칙 제 26조)
질병의 메커니즘을 이해하는데 효과적인 평가자로 알려져 있다 Muotri, A. R.
(2009) Epilepsy Behav 14 Sup l 1: 81-85; Marchetto, M. C. , B. Winner, et al .
(2010) Hum Mol Genet 19(R1): R71-76) .
현재까지, 다양한 유전적 질병을 가지는 환자로부터 유래된 iPSC가 질병과-관련있는 세포 종류로 직접 분화되었올 때 질병-특이적인 표현형 (phenotypes)을 나타내는 것에 관련되어 보고된 바 있다 (Park, I. H. et al. Cell 134, 877-886 (2008); Tiscornia, G. et al. Nature medicine 17, 1570-1576 (2011)). 이러한 질병 특이적인 iPSC는 질병과 관련있는 세포 종류로 분화될 수 있으며, 이에 따라 질병의 구체적인 기작 또는 치료제 스크리닝 방법에 유용하게 사용될 수 있을 것으로 여겨지고 있다.
따라서, 본 발명자들은 누난 증후군을 연구하기 위한 줄기세포 모델을 확립하기 위해 노력한 결과, 누난 증후군 환자의 섬유아세포로부터 누난 증후군 유래의 유도 -만능 줄기세포 (induced pluri potent stem cells; iPSC), 배상체 (embryo id body, EB) 및 신경 로제트 (neural rosettes)의 발생 및 분화를 유도하였으며, 상기 누난 증후군 유래의 iPSC는 정상적인 iPSC의 형태 및 분화능을 나타내는 것올 확인하였고, 누난 증후군 유래의 iPSC로부터 배상체 및 신경 로제트로 분화하기 위해 자연분화 및 화학적 분화를 유도한 결과, 화학적 분화를 통해 유도된 배상체 및 신경 로제트는 정상 세포와 유사한 세포 형태를 나타내며, 외배엽, 신경로제트 및 신경세포 마커 유전자를 유의적으로 발현하므로, 본 발명의 유도 -만능 줄기세포 (induced pluri potent stem cells; iPSC)를 이용한 누난 증후군의 세포 모델링 방법은 누난 증후군의 발병 연구 및 치료제 후보물질 스크리닝 방법에 유용하게 사용될 수 있음을 확인함으로써 본 발명을 완성하였다.
【발명의 상세한 설명】
【기술적 과제】
본 발명의 목적은 누난 증후군 (noonan syndrome) 환자의 세포와 동일한 대체용지 (규칙 제 26조)
특성을 유지하는 새로운 유도—만능 줄기세포 (induced pluripotent stem cells; iPSC)을 제공하여, 이를 누난 증후군의 발병 연구 및 치료제 후보물질 스크리닝 방법을 위한 연구에 이용하는 방법을 제공하는 것이다. 【기술적 해결방법】
상기 목적을 달성하기 위해서 , 본 발명은
i) 시험관 내 (TV? 에서 누난 증후군 (Noonan syndrome) 환자로부터 분리된 섬유아세포 (fibroblast)를 유도 -만능 줄기 세포 (induced pluripotent stem cells; iPSC)로 유도하는 단계; 및
ii) 상기 단계 i)에서 유도된 iPSC를 수득하는 단계를 포함하는, 시험관 내에서 누난 증후군 iPSC 모델의 제조 방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된, 누난 증후군 iPSC 모델을 제공한다.
또한, 본 발명은
i) 상기 iPSC로부터 배상체 (embryoid body, EB) 또는 신경세포로 분화를 유도하는 단계; 및
ii) 상기 단계 i)에서 유도된 배상체 또는 신경세포의 특성을 분석하는 단계를 포함하는, iPSC를 누난 증후군의 모델로 사용하는 방법을 제공한다. 또한, 본 발명은
i) 상기 iPSC 모델, 또는 이로부터 분화된 배상체 또는 신경세포를 수득하는 단계 ;
ii) 상기 단계 i)의 iPSC 모델, 배상체 또는 신경세포에 괴검 화합물 또는 피검 조성물을 처리하는 단계:
iii)상기 단계 Π)의 처리된 iPSC모델, 배상체 또는 신경세포의 특성을 분석하는 단계 ; 및
iv) 상기 단계 iii)의 분석한 결과를 무처리 대조군과 비교하는 단계를 포함하는, 누난 증후군의 치료제 후보물질의 스크리닝 방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된, 누난 증후군 iPSC모델의 용도를 대체용지 (규칙 제 26조)
제공한다.
아을러, 본 발명은
i) 상가 iPSC로부터 배상체 또는 신경.세포로 분화를 유도하는 단계; 및 ii) 상기 단계 i)에서 유도된 배상체 또는 세포의 특성를 분석하는 단계를 포함하는, iPSC를 누난 증후군와 모델로 사용하는 용도를 제공한다.
【유리한 효과】 .
본 발명의 누난 증후군 (Noonan syndrome) 환자의 섬유아세포로부터 유래한 유도 -만능 줄기세포 (induced pluri otent stem cells; iPSCs)를 이용한 줄기 세포 모델은 배상체 및 신경세포로 분화될 수 있으며, 분화된 신경세포는 외배엽, 신경 로제트 및 신경세포 마커 유전자를 유의적으로 발현하나, NR2F1 유전자의 감소를 나타내므로, 상기 세포 모델은 누난 증후군의 기전 분석 연구 및 치료제 스크리닝 방법을 위한 분석 연구에 유용하게 사용될 수 있다. 【도면의 간단한 설명】
도 1은 누난 증후군 (Noonan syndrome) 환자 유래의 섬유아세포 (fibroblast)로부터 발생된 유도 -만능 줄기세포 (induced pluri potent stem cells; iPSCs) 세포의 형태를 나타낸다.
도 2는 누난 증후군 환자 유래의 iPSC(NS-iPSC)에서 누난 층후군 원인 유전자의 변이 확인을 나타낸다.
도 3은 미분화 상태인 NS-iPSC에서 중아황산염 서열 (bisulfite sequencing) 분석을 수행하여 DNA 탈메틸화 (demethylat ion) 여부 확인을 나타낸다.
도 4는 NS-iPSC에서 정상적인 핵형을 나타내는 것을 확인을 나타낸다. 도 5는 미분화 여부를 확인하기 위한 NSᅳ iPSC의 알칼라인 포스파타아제 염색 (Alkaline phosphatase staining, AP staining)을 확인을 나타낸다.
도 6은 NS-iPSC의 다분화능을 확인하기 위한 전분화능 마커 유전자 발현의 확인올 나타낸다. 대체용지 (규칙 제 26조)
도 7은 누난 증후군 유래의 iPSC인 NS-iPSC #4에서 줄기세포성 마커인 0CT4, NANOG, S0X2 , SSEA4, Tra-1-81 및 Tra-1-60 단백질의 발현 확인을 나타낸다.
도 8은 누난 증후군 유래의 iPSC인 NS-iPSC #5에서 줄기세포성 마커인 0CT4, NANOG, S0X2, SSEA4, Tra-1-81 및 Tra-1-60 단백질의 발현 확인을 나타낸다. '
도 9는 누난 증후군 유래의 iPSC인 NS-iPSC #4에서 생체 내에서 분화 가능성을 확인하기 위한 기형종 형성 (teratoma format ion)을 나타낸다.
도 10은 누난 증후군 유래의 iPSC인 NS-iPSC #5에서 생체 내에서 분화 가능성을 확인하기 위한 기형종 형성을 나타낸다.
도 11은 NS-iPSC로부터 배상체 (EB) 및 신경 로제트 (신경외배.엽, neuroectoderm, neural rosettes)로의 자연분화 유도의 과정을 모식도로 나타낸다.
도 12는 NS-iPSC로부터 자연분화 유도된 배상체 및 신경 로제트의 세포 형태를 나타낸다.
도 13은 NS-iPSC로부터 자연분화 유도된 배상체에서 줄기 세포 관련 유전자의 발현 감소를 나타낸다.
도 14는 NS-iPSC로부터 자연분화 유도된 배상체에서 신호전달인자 유전자의 발현 수준 변화를 나타낸다.
도 15는 NS-iPSC로부터 자연분화 유도된 배상체에서 신호전달인자 단백질의 인산화 (phosphorylat ion) 수준 증가를 나타낸다.
도 16은 NS-iPSC로부터 자연분화 유도된 신경 로제트에서 신경세포 마커 유전자 발현 수준의 감소를 나타낸다.
도 17은 NS-iPSC로부터 자연분화 유도된 신경 로제트에서 신경세포 마커 유전자 발현 수준의 감소를 정량적으로 나타낸다.
도 18은 NS-iPSC로부터 배상체 및 신경 로제트로의 화학적 분화 유도의 과정을 모식도로 나타낸다.
도 19는 NS-iPSC로부터 화학적 분화 유도된 배상체 및 신경 로제트의 대체용지 (규칙 제 26조)
세포 형태를 나타낸다. ·
도 20은 NS-iPSC로부터 화학적 분화 유도된 배상체, 신경 로제트, 신경 전구체 (Neural precursors) 및 신경 세포 (neural eel Is)의 세포 형태를 나타낸다.
도 21은 NS-iPSC로부터 화학적 분화 유도된 신경 로제트에서 외배엽 (ectoderm), 신경 로제트 및 신경세포 유전자의 발현 확인을나타낸다. 도 22는 NS-iPSC로부터 화학적 분화 유도된 신경 로제트에서 NR2F1 유전자 발현의 감소를 정량적으로 나타낸다. 【발명의 실시를 위한 최선의 형태】
이하, 본 발명을 상세히 설명한다. 본 발명은 ' 0 시험관 내 w n?)에서 누난 증후군 (Noonan syndrome) 환자로부터 분리된 섬유아세포 (fibroblast)를 유도—만능 줄기 세포 (induced pluri potent stem cells; iPSC)로 유도하는 단계; 및
ii) 상기 단계 i)에서 유도된 iPSC를 수득하는 단계를 포함하는, 시험관 내에서 누난 증후군 iPSC모델의 제조 방법을 제공한다.
상기 단계 i)의 유도는 0CT4, S0X2, KLF4 및 c-MYC를 포함하는 다분화능 마커 (pluri potent marker)의 이소성 발현 (ectopic expression)을 사용하는 것이 바람직하나, 이에 한정되지 않는다. 본 발명의 구체적인 실시예에서, 본 발명자들은 누난 증후군 (Noonan syndrome) 환자의 임상적인 증상 및 상기 환자로부터 유래한 섬유아세포 (fibroblast)에서 원인 유전자인 PTPN11 유전자의 변이를 확인하였으며 (표 2 및 표 3 참조), 상기 섬유아세포로부터 누난 증후군 유래 iPSC(NS-iPSC)의 발생을 유도하였다 (도 1 참조). 또한, 상기 NS-iPSC는 누난 증후군 원인 유전자를 유지하면서 (도 2 참조), 정상적 핵형을 나타내고 (도 4 대체용지 (규칙 제 26조)
참조), 미분화 상태인 것을 확인하였다 (도 3 및 도 5 참조).
또한, 본 발명자들은 상기 NS-iPSC의 분화능올 확인한 결과, NS-iPSC는 다분화능 마커 유전자 및 단백질을 유의적으로 발현하며 (도 6내지 도 8참조), 생체 내에서 기형종을 형성 (teratoma formation)하여 (도 9 및 도 10 참조), 다분화능을 가지는 갓을 확인하였다.
따라서, 본 발명의 누난 증후군 유래의 iPSCs모델은 누난 증후군 환자의 유전자 변이와 동일한 변이를 나타내면서 다분화능을 나타내므로, 상기 iPSCs 모델의 제조 방법은 누난 증후군을 위한 분석 연구에 이용하는 방법에 유용하게 사용될 수 있다. 또한, 본 발명은 상기 방법으로 제조된 누난 증후군 iPSCs 모델을 제공한다.
상기 iPSC는 하기 i)내지 iii)증 어느 하나 이상을 특징으로 하는 것이 바람직하나, 이에 한정되지 않는다.
ί) 정상 세포의 iPSC 형태;
ii) 0CT4, S0X2, NANOG, c-MYC, REX1, ECAT15, GDF3 및 TERT로 구성된 군으로부터 선택된 어느 하나 이상의 다분화능 마커 유전자의 발현; 및
iii) 0CT4, S0X2, NANOG, SSEA4, Tra-1-81 및 Tra-1-60으로 구성된 군으로부터 선택된 어느 하나 이상의 줄기세포성 마커 단백질의 발현.
본 발명의 누난 증후군 유래의 iPSCs 모델은 누난 증후군 환자의 유전자 변이와 동일한 변이를 나타내면서 다분화능을 나타내므로, 상기 iPSCs 모델은 누난 증후군을 위한 분석 연구에 아용하는 방법에 유용하게 사용될 수 있다. 또한, 본 발명은
i) 상기 iPSC로부터 배상체 (embryoid body, EB) 또는 신경세포로 분화를 유도하는 단계 ; 및
ii) 상기 단계 0에서 유도된 배상체 또는 신경세포의 특성을 분석하는 단계를 포함하는 iPSC를 누난 증후군의 모델로 사용하는 방법을 제공한다. 대체용지 (규칙 제 26조)
상기 유도는 자연적인 유도 또는 화학적 유도 물질 (chemical)의 첨가로 인한 직접적 (directed)인 유도 둘 중 어느 하나인 것인 것이 바람직하나, 이에 한정되지 않는다.
상기 화학적 유도 물질은 도소모르핀 (dorsomorphin) 및 SB431542와 같이 줄기세포를 신경세포로 분화하기 위해 당업자에 의해 사용되는 유도 물질인 것이 바람직하고, 구체적으로 도소모르핀 또는 SB431542 중 어느 하나 또는 둘 다인 것이 보다 바람직하나, 이에 한정되지 않는다. 상기 도소모르핀 및 SB431542는 분화 유도 시 동시에 또는 순차적으로 배지에 첨가될 수 있다. 상기 배상체의 특성은 하기 i) 내지 vi) 중 어느 하나 이상인 것이 바람직하나, 이에 한정되지 않는다.
i) 정상 세포의 형태;
ii) 0CT4, S0X2, NAN0G, 및 c-MVS— 구성된 군으로부터 선택된 어느 하나 이상의 다분화능 마커 유전자의 발현;
iii) Idl 또는 Id2 둘 중 하나 이상을 포함하는 BMP 신호 전달 체제 유전자의 증가;
iv) p-SMADl , p-SMAD5및 p-SMAD8로 구성된 군으로부터 선택된 어느 하나 이상의 BMP 신호전달 체제 단백질의 인산화 수준의 증가;
V) SMAD2 또는 SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 유전자의 증가; 및
vi) p-SMAD2 또는 p-SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 단백질의 인산화 수준의 증가.
상기 신경세포의 특성은 하기 i) 내지 ii) 중 어느 하나 이상인 것이 바람직하나, 이에 한정되지 않는다.
i) 정상 세포의 형태; 및
ii) PAX6, ZIC NESTIN, VIMENTIN, PLZF, HES5, DACH1, TUJ1, ASdl
NF1로 구성된 군으로부터 선택된 어느 하나 이상의 신경세포 유전자의 발현. 본 발명의 또 다른 구체적인 실시예에 있어서, 본 발명자들은 누난 대체용지 (규칙 제 26조)
W
11 증후군 환자로부터 유래한 iPSC로부터 배상체 및 신경 로제트를 수득하기 위해 자연적으로 분화를 유도한 결과 (도 11 참조) , 분화 개시 2 일 후의 분화 초기에는 정상적인 세포의 형태를 나타내나, 배상체 및 신경 로제트의 세포 형태가 무너지고 (도 12 참조), 배상체에서는 감소된 전분화능 마커 유전자, 증가하는 BMP 및 TGF- β 신호전달 체제 유전자의 발현 수준 및 증가하는 BMP 신호 전달체제 단백질 인산화 수준을 확인하였다 (도 13 내지 도 15 참조) . 또한, 신경 로제트에서 신경 세포 마커 유전자의 발현이 나타나지 않는 것을 확인하였다 (도 16 및 도 17 참조) .
또한, 본 발명자들은 누난 증후군 환자로부터 유래한 iPSC로부터 배상체 및 신경 로제트를 수득하기 위해 도소모르핀 (dorsomorphin) 및 SB431542의 순차적 처리를 통해 화학적으로 분화를 유도한 결과 (도 18 참조), 화학적으로 분화 유도된 배상체 및 신경 로제트의 정상 세포 형태가 회복되며 (도 19 및 도 20 참조), 외배엽, 신경 로제트 및 신경세포 마커 유전자의 발현이 정상 대조군과 유사한 수준으로 발현되나 신경 로제트 유전자중 하나이고 아직 라이간드 (Ligand)가 밝혀지지 않은 Orphan nuc lear receptor인 NR2F1유전자의 발현만 감소하는 것을 확인하였다 (도 21 및 도 22 참조) . 상기 유전자는 현재까지 질병과 연관되어 연구된 것으로 밝혀진 바가 없으며, 초기 발생상에서의 역할이 많이 알려지지 않았으므로, 이에 대한 연구가 필요하다고 볼 수 있다.
따라서, 본 발명의 누난 증후군 유래의 iPSCs 모델은 배상체 및 신경세포로 분화될 수 있으므로, 상기 세포 모델은 누난 증후군의 기전 분석 연구 및 치료제 스크리닝 방법을 위한 분석 연구에 유용하게 사용될 수 있다. 또한, 본 발명은
i ) 상기 iPSC 모델, 또는 이로부터 분화된 배상체 또는 신경세포를 수득하는 단계 ;
i i ) 상기 단계 i )의 iPSC 모델, 배상체 또는 신경세포에 피검 화합물 또는 피검 조성물을 처리하는 단계: 대 1용지 (규칙 제 26조)
W 201
12 iii)상기 단계 ii)의 처리된 iPSC모델, 배상체 또는 신경세포와특성을 분석하는 단계; 및
iv) 상기 단계 iii)의 분석한 결과를 무처리 대조군과 비교하는 단계를 포함하는, 누난 증후군의 치료제 후보물질의 스크리닝 방법을 제공한다.
상기 유도는 자연적인 유도 또는 화학적 유도 물질의 첨가로 인한 직접적인 유도 둘 중 어느 하나인 것인 것이 바람직하나, 이에 한정되지 않는다.
상기 화학적 유도 물질은 도소모르핀 및 SB431542와 같이 줄기세포를 신경세포로 분화하기 위해 당업자에 와해 사용되는 유도 물질인 것이 바람직하고, 구체적으로 도소모르핀 또는 SB431542 중 어느 하나또는 둘 다인 것이 보다 바람직하나, 이에 한정되지 않는다. 상기 도소모르핀 및 SB431542는 분화 유도 시 동시에 또는 순차적으로 배지에 첨가될 수 있다. 상기 배상체의 특성은 하기 i) 내지 vi) 중 어느 하나 이상인 것이 바람직하나, 이에 한정되지 않는다.
i) 정상 세포의 형태;
ii) 0CT4, SOX2, NANOG, 및 로 구성된 군으로부터 선택된 어느 하나 이상의 다분화능 마커 유전자의 발현;
iii) Idl 또는 Id2 둘 중 하나 이상을 포함하는 BMP 신호 전달 체제 유전자의 증가;
iv) p-SMADl, p-SMAD5및 p-SMAD8로 구성된 군으로부터 선택된 어느 하나 이상의 BMP 신호전달 체제 단백질의 인산화 수준의 증가;
V) SMAD2 또는 SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 유전자의 증가; 및
vi) P-SMAD2 또는 p-SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 단백질의 인산화 수준의 증가.
상기 신경세포의 특성은 하기 i) 내지 ii) 중 어느 하나 이상인 것이 바람직하나, 이에 한정되지 않는다.
i) 정상 세포의 형태; 및 대체용지 (규칙 제 26조)
i i ) PAX6, ZICl, NESTIN, VIMENTIN, NP2F1, PLZF, HES5, DACHl, TUJl, ASCII 및 WI — 구성된 군으로부터 선택된 어느 하나 이상의 신경세포 유전자의 발현.
상기 누난 증후군의 치료제 후보물질은, 본 발명의 iPSC 모델, 또는 Pᅵ로부터 분화된 배상체 또는 신경세포의 특징을 분석함에 있어서 정상 대조군과 유사한 수준의 톡성을 나타내도록 하는 물질로서 선별될 수 있으며, 구체적으로 본 발명의 iPSC 모젤로부터 분화 유도된 신경세포에서 NP2F1 유전자의 발현 수준을 정상 대조군과 유사한 수준으로 증가하도록 하는 물질이 가장 바람직하나, 이에 한정되지 않는다.
본 발명의 누난 증후군 유래의 iPSCs 모델로부터 자연 분화된 배상체 및 신경세포는 누난 증후군에서 나타나는 비정상적인 세포의 형태 및 유전자의 발현을 재현하며, 화학적 유도를 통해 분화된 배상체 및 신경세포는 누난 증후군의 정상적인 세포 형태 및 신경세포 마커 유전자의 발현을 나타내므로, 상기 iPSC 모델은 누난 증후군의 치료제 후보물질의 스크리닝 방법에 유용하게 사용될 수 있다. 또한, 본 발명은 상기 방법으로 제조된, 누난 증후군 iPSC모델의 용도를 제공한다. . 아울러, 본 발명은
i ) 상기 iPSC로부터 배상체 또는 신경세포로 분화를 유도하는 단계; 및 i i ) 상기 단계 i )에서 유도된 배상체 또는 세포의 특성를 분석하는 단계를 포함하는, iPSC를 누난 증후군의 모델로 사용하는 용도를 제공한다. 본 발명의 누난 증후군 유래의 iPSCs 모델로부터 자연 분화된 배상체 및 신경세포는 누난 증후군에서 나타나는 비정상적인 세포의 형태 및 유전자의 발현을 재현하며, 화학적 유도를 통해 분화된 배상체 및 신경세포는 누난 증후군의 정상적인 세포 형태 및 신경세포 마커 유전자의 발현을 나타내므로, 상기 iPSC 모델은 누난 증후군의 치료제 후보물질의 스크리닝 방법에 유용하게 사용될 수 있다. 대체용지 (규칙 제 26조)
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
<실시예 1> 누난 증후군 (Noonan syndrome)의 임상적 증상 및 원인 유전자 변이의 확인
<1-1>누난증후군의 임상적 중상의 확인
누난 증후군 환자의 임상적인 증상을 확인하기 위하여, 누난 증후군 환자를 선별하여 임상적 증상을 확인하였다.
구체적으로, 서을 아산병원 (Asan medi cal center , 한국)에서 누난 증후군 환자 (B. S.Y , 남성)가 연결되었으며, 하기 [표 2]에서 나타난 바와 같은 누난 증후군의 대표적 증상이 나타나는 것을 확인하였다 (표 2) . 【표 2】
누난 증후군 환자의 임상적 증상 확인
<1-2>누난증후군환자와원인 유전자 변이 확인
누난 증후군의 원인이 되는 유전자 변이를 확인하기 위하여, 누난 증후군 관련 유전자로 알려져 있는 PTPN11 유전자의 서열을 누난 증후군 환자의 섬유아세포 ( f i br ob 1 as t )로부터 확인하였다.
대체용지 (규칙 제 26조)
W
15 구체적으로, 병원의 임상연구 윤리 심의위원회의 심사를 통과한 후, 상기 실시예 <1-1>에서 선별한 누난 증후군로부터, 환자와 법적 대리인의 동의를 얻어 국소 마취 후 편치 생검법 (punch biopsy method)으로 피부 조직 생검을 수행하여 누난 증후군의 진피 (dermal f ibroblast ) 조직을 수득하였다. 그런 다음,상기 수득한 진피 조직에서 섬유아세포를 분리하여 10%소태아혈청 ( fetal bovine serum, FBS; GIBCO사, 미국) , 1%페니실린 (penici 11 in; GIBCO사, 미국)과 1% MEM-NEAA용액 (MEM Non-Essent ial Amino acids Solut ion; GIBCO사, 미국)을 포함하는 둘베코 변이된 이글 배지 (Dulbecco ' s modi f ied Eaglet medium, DMEM; Welgene사, 한국)에서 배양하였다. 그런 다음, 상기 수득한 섬유아세포로부터 유전체 DNMgenomic DNA, gDNA)를 추출하고, ΡΤΡΝ1Γ유전자의 염기 서열을 확인하였다.
그 결과, 하기 [표 3]과 같이 누난 증후군 환자는 PTPN11 유전자에서 A922GCN308D) 변이를 나타내는 것을 확인하였다 (표 3) .
【표 3】
누난 증후군 환자의 원인 유전자 변이의 확인
<실시예 2>누난증후군 유래의 유도 -만능 줄기세포 (induced pluripotent stem cel ls; iPSC)의 제조
<2-l>누난증후군환자유래의 iPSC발생의 유도
본 발명의 실시예를 수행하기 위하여, 리프로그래밍 인자 (reprogra隱 ing factor)인 0CT4, S0X2 , C-MYC 및 KLF4를 이용한 이소성 발현 (ectopic expression) 방법 (Takahashi , K et al , Cel l 131(5): 861-872 , 2007)을 통해 누난 증후군 유래의 iPSC(NS-iPSC)의 발생을 유도하였다.
구체적으로, 상기 실시예 <1-2>에서 수득한 누난 증후군 환자의 섬유아세포를 10% 소태아혈청 (fetal bovine serum, FBS; GIBCO 사, 미국)을 대체용지 (규칙 제 26조)
포함하는 DMEM 배지에 배양하였다. 그런 다음, 0CT4, S0X2, c-MYC 및 KLF4 인자를 발현하는 레트로바이러스 (retrovirus)를 감염 ( infect ion)한 후, 상기 감염된 세포를 미토마이신 C mitomycin C; AG scientific 사)를 처리한 마우스 배아 섬유아세포 (mouse embryonic fibroblast, MEF) 위에 올려서 2W 혈청 대체물 (serum replacement; GAIBC0사, 미국) 및 10 g/ i bFGF(R&D systems사, 미국)를 포함하는 DMEM/F12 배지 (GAIBC0 사, 미국)에서 10 내지 15 일 동안 공동 -배양 (co-culture)한 후 계대 배양하여 NS-iPSC의 발생을 유도한 후, 상기 유도된 NS一 iPSCs를 위상차 현미경 (phase-contrast microscopy, 이卿 us사, 일본)으로 확인하였다. 정상 대조군으로 사용하기 위하여, 인간 피부 섬유아세포 (CRL-2097; 미국 세포주 은행 (American Type Culture Collection; ATCC), 미국)로부터 상기와 동일한 방법으로 iPSC의 발생을 유도하여, 인간 피부 섬유아세포 유래의 iPSC(CRL-12)를 제조하였다 (Kim et . al, BBRC 424 (2012) 331-337; 참고문헌 상의 iPSCs #2 세포와 동일함).
그 결과, 도 1에서 나타난 바와 같이 누난 증후군 환자 유래의 섬유아세포로부터 발생된 NS-iPCS 세포주를 두 개 수득하였으며 (NS-iPCS #4 및 NS-iPSC #5), 정상 세포의 iPSC 형태를 나타내는 것을 확인하였다 (도 1).
<2-2>누난증후군유래 iPSC의 누난증후군 원인 유전자변이의 확인 누난 증후군으로부터 유래된 iPSC가 누난 증후군 환자가 나타내는 유전자 변이를 유지하여 나타내는지 확인하기 위하여, NS-iPSC의 유전자에서 누난 증후군 원인 유전자의 변이 유무를 확인하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법으로 발생을 유도한 NS-iPSC을 수득하고, NS-iPSC의 유전체 DNA( genomic DNA, gDNA)를 추출한 다음, PTPN11 유전자의 염기 서열을 확인하여 누난 증후군 유래의 섬유아세포 (NS-fibroblast)와 비교하였다.
그 결과 도 2에서 나타난 바와 같이 누난 증후군 유래의 섬유아세포에서 나타나는 PTPN11 유전자 변이인 A922G 변이가 NS-iPSC에서도 나타나, 이로부터 만들어진 단백질에서 N308D의 아미노산 변이가 나타내는 대체용지 (규칙 제 26조)
것을 확인하였다 (도 2) .
<실시예 3>누난증후군 유래 iPSC의 특징 확인
<3-1>미분화 NS-iPSC에서 리프로그래밍 과정 진행의 확인
발생 후 미분화 상태인 NS-iPSC에서 리프로그래밍 과정이 진행되었는지 여부를 확인하기 위하여, 중아황산염 서열 (bisul f ite sequencing) 분석을 수행하여 NS-iPSC의 0CT4, REX1 및 NAN0G유전자 프로모터 부위에서 CpG위치의 DNA 탈메틸화 (demethylat ion) 여부를 CT 전환법 (CT conversion)을 통해 확인하였다 (Park, S. W. et al . (2010) Blood 116, 5762-5772) .
구체적으로, EZ DNA 메틸화-금 키트 (EZ DNA methylat ion-Gold Ki t; Zymo
Research사, 미국)를 사용하여, 제조사에서 제공하는 프로토콜에 따라 유전체 DNA에 아황산수소나트륨 (sodium bi sul f i te) 처리하여, 25 내지 50 ng의 아황산-처리된 DNA를 주형으로 PCR을 통해 증폭하였다. 증폭된 PCR 산물은 AccuPrep 들라스미드 미니 추출 키트 (AccuPrep plasmid Mini extract ion Ki t ; 바이오니어 사, 한국)를 사용하여 정제하고, pGEM-T EASY백터 (프로메가 사 미국)에 서브클로닝 (subcloning)하여 삽입하였다. 그런 다음, 삽입한 백터를 상기 실시예 <1_2>에서 수득한 누난 증후군 유래 섬유아세포 및 상기 실시예 <2— 1〉에서 발생을 유도한 NS-iPSC에 형질전환한 클론 (clone)을 수득하고, SP6, T7 및 M13 프라이머를 사용하여 서열을 확인한 후, 솔젠트 (서열 분석사, 한국)로부터 Chromas231 프로그램을 사용하여 분석하였다.
그 결과, 도 3에서 나타난 바와 같이 발생 후의 미분화 상태인 NS-iPSC에서, 섬유아세포 단계에 비하여 각 유전자의 프로모터 영역에서 메틸화가 풀려있는 것을 통해, iPSC에서 리프로그래밍이 이루어졌음을 활인하였다 (도 3) .
<3-2>누난증후군 유래 iPSC의 핵형 분석
누난 증후군 환자 유래의 iPSC의 염색체 형성에서 이상 유무를 확인하기 위하여, NS-iPSC의 핵형 분석을 수행하여 염색체 (chromosome)의 삽입, 전이 대체용지 (규칙 제 26조)
또는 삭제 여부를 확인하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법으로 발생을 유도한 NS-iPSC #4 및 NS-iPSC #5를 수득한 다음, 젠딕스 사 (한국)에 의뢰하여 상기 NS-iPSC의 핵형 분석을 수행하였다.
그 결과, 도 4에서 나타난 바와 같이 누난 증후군 유래의 iPSC는 정상적인 핵형을 나타내는 것을 확인하였다 (도 4).
<3-3> NS-iPSC의 미분화상태 확인
누난 증후군 환자로부터 유래한 NS-iPSC가 미분화 상태인지 여부를 확인하기 위하여, NS-iPSC를 알칼라인 포스파타아제 염색 (Alkaline phosphatase staining, AP staining)하여 미분화 여부를 확인하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS-iPSC #4및 NS-iPSC #5를 준비하였다. 그런 다음, AP염색 키트 (Alkaline phosphatase kit, Sigma Aldrich사, 미국)를 사용하여 구연산 용액 (citrate solution) 1 i, 아세톤 2.6 mi 및 37% 포름알데하이드 (Formaldehyde; Sigma Aldrich사, 미국) 320 를 흔합하여 고정 용액 (fixative solution)을 제조하였다. 또한, 질산나트륨 용액 (sodium nitrate solution) 100 μί 및 FRV-알칼린 용액 (FRV-alkaline solution) 100 과 흔합하여 2 분 동안 방치한 다음, 4.5 ^의 멸균수 및 Naphthol AS-BI 알칼리 용액 100 ^을 첨가하여 호일로 감싸 빛을 차단하여 보관하였다. 상기 준비한 iPSC를 PBS로 1회 세척한 후,상기 제조한 고정 용액을 가하여 어둠 속에서 15 분 동안 상온에 방치하였다. 방치 후에는, 물 또는 PBS로 2 분씩 2 회 세척하여 AP 염색된 세포를 · 위상차 현미경 (Phase contrast microscope; Olympus사, 일본)으로 관찰하였다ᅳ
그 결과, 도 5에서 나타난 바와 같이 NS-iPSC는 미분화 상태인 것을 확인하였다 (도 5).
<실시예 4>누난증후군유래 iPSC의 전분화능 (pluripotency)확인 대체용지 (규칙 제 26조)
<4-l> NS-iPSC의 다분화능유전자의 발현 확인
누난 증후군.환자로부터 유래된 미분화 상태의 NS-iPSC가 다분화능을 나타내는지 확인하기 위하여, NS-iPSC에서 다분화능 마커 유전자의 발현을 확인하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS-iPSC #4 및 NS-iPSC #5를 이지블루 (Easy-biue ; Intron사, 한국)에 현탁하고 제조사의 프로토콜에 따라 NS-iPSC의 전체 RNA를 추출하였다. 그런 다음, 상기 추출한 RNA 1 [ 을 M-MLV 역전사 합성효소 (Moloney-mur ine leukemia virus reverse transcriptase ; Enzynomics \ , 한국)暑 용하여 전체 cDNA를 합성하였다. 상기 합성한 전체 cDNA는 하기 [표 4]에 기재된 정방향 프라이머 및 역방향 프라이머와 함께 증폭하여 전기영동 (electrophoresis)로 상기 유전자의 발현을 mRNA 수준에서 확인하였다. 정상 대조군으로 사용하기 위하여 , 정상 인간배아줄기세포주인 H9 세포주 (H9 hESC)를 사용하고, 음성 대조군으로는 누난 증후군 환자 유래의 섬유아세포 (NS-i ibroblast )를 사용하여, 상기와 동일한 방법을 통해 정상 줄기세포주에서 0CT4 , S0X2 , NANOG, c-MYC, ' KLF4, REX1 , ECAT15, GDF3 및 TERT 유전자의 발현을 확인하였고, 발현 수준을 보정하기 위한 대조군으로는 GAPDH 유전자를 상기와 동일한 방법을 수행하여 발현량을 확인하였다.
【표 4】
다분화능 마커 유전자의 발현 확인을 위한 프라이머 서열
대체용지 (규칙 제 26조)
hREXl hREXl-RT-U CAGATCCTAAACAGCTCGCAGAAT 서열번호 11 hREXl-RT hREXl-RT-L GCGTACGCAAATTAAAGTCCAGA 서열번호 12 hECAT15-l hECAT15-l-S532 GGAGCCGCCTGCCCTGGAAMTTC 서열번호 13 hECAT15-l hECAT15— 1ᅳ AS916 mTTCCTGATATTCTAnCCCAT 서열번호 14 hTERT hTERT-F-3012 TGTGCACCAACATCTACAAG 서열번호 15 hTERT hTERT-R-3177 GCGTTCTTGGCTTTCAGGAT 서열번호 16
GAPDH GAPDH_F CTOGCTCTCTGCTCCTCCT 서열번호 17
GAPDH-RT GAPDHᅳ R GTTAAAAGCAGCCCTGGTGA 서열번호 18 . 그 결과, 도 6에서 나타난 바와 같이, 누난 증후군 유래의 섬유아세포에서는 전분화능 마커 유전자인 0CT4, S0X2, NANOG, c-MYC, REX1, ECAT15, GDF3 및 TERT의 발현이 나타나지 않는 반면, NS-iPSC는 H9 세포주와 동일하게 전분화능 마커 유전자를 모두 나타내는 것을 확인하였다 (도 6).
<4-2> NS-iPSC의 다분화능마커 단백질의 발현 확인
누난 증후군 환자로부터 유래된 미분화 상태의 NS-iPSC가 다분화능을 나타내는지 확인하기 위하여, NS-iPSC에서 줄기세포성 마커 (sternness maker) 단백질의 발현을 확인하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS-iPSC #4및 NS-iPSC #5를 4%포르말린 (Formal in solution 10% neutral buffered, sigma aklrich사, 미국)로 실온에서 30분간 고정하고, 0.1% 트원 -20(Tween-20, Sigma aldrich 사, 미국)을 포함하는 인산완충식염수 (phosphate buffered saline, PBS, GIBC0사, 미국)인 PBS-T를 처리하여 실온에서 10 분씩 3번 세척하였다. 세척 후, 0.1% 트리톤 X-100(tritonX-100)을 포함하는 PBS를 상은에서 30분 동안 처리하여 세포막에 투과성 (Permeability)을 부여하였다. 상기 처리한 세포를 3% 소 혈청 알부민 (Bovine serum albumin, BSA, Sigma aldrich사, 미국)을 첨가하여 1시간 동안 상온에서 차단 (blocking)한 다음, 1차 항체로 항 -0CT4 항체 (1:200 희석, Santa Cruz사, 미국),항 -S0X2토끼 항체 (1:200희석 , Cell signaling technology 사, 미국), 항 -NAN0G항체 (1:200 희석, Cell signaling technology사, 미국), 대체용지 (규칙 제 26조)
W 201
21 항 -SSEA-4항체 ( 1: 200희석, R&D Systems사, 미국), 항 -Tra- 1-60항체 ( 1: 200희석 Millipore사, 미국)또는 항 -Tra-1-81항체 (1:200희석, Millipore사, 미국)를 각각 처리하여 4°C에서 밤새 배양하고, PBS-T로 수회 세척하였다. 세척 후, 알렉사 플루오르 488(Alexa Fluor 488,. Invitrogen사, 미국) 또는 알렉사 플루오르 594(Alexa Fluor 594, Invitrogen사, 미국)가 결합된 2차 항체를 처리하여 실온에서 1 시간 동안 배양하여 NS-iPSC를 면역형광염색을 수행하였다. 형광 현미경 (fluorescence microscope; Olympus, 일본)으로 관찰하여 0CT4, S0X2, NAN0G, SSEA-4, Tra- 1-60 및 Tra-1-81 단백질의 발현을 확인하였다. 단백질의 발현이 세포의 내부와 외부에서 정확하게 나타나는지 확인하기 위해, 세포의 핵을 염색하는
4'6-디아미디노 -2-페닐인돌 (4'6-diamidino-2-phenylindole, DAPI, Sigma aldrich사 , 미국)을 처리하여 비교하였다.
그 결과, 도 7 및 도 8에서 나타난 바와 같이, NS-iPSC에서 줄기세포성 마커인 0CT4, S0X2, NAN0G, SSEA-4, Tra- 1-60 및 Tra-1-81단백질이 유의적으로 발현하는 것을 확인하였다 (도 7 및 도 8).
<4-3>누난증후군유래 iPSC의 분화가능성 확인
누난 증후군 유래의 iPSC가 생체 내에서 전분화 (pluripotent) 가능성을 나타내는지 확인하기 위해, 면역력 저하 누드마우스에서 NS-iPSC의 기형종 형성 (teratoma format ion)을 수행하였다.
구체적으로, 상기 실시예 <2-1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS-iPSC #4및 NS-iPSC #5를 준비하였다. 준비한 세포는 60mni 세포 배양 디쉬에 올려져 있는 상태로 5 장씩을 모아 마트리겔 (Matrigel, BD biosciences사, 미국)과 섞어 샘폴을 제조하였다. 제조된 샘플은 각각 생후 4 주령 누드 마우스 (CAnN.Cg-Foxnl nu/crljOri, female,오리엔트바이오, 한국)의 가슴광 옆구리 사이에 18G 주사기로 주입하여 SPF 동물실에서 멸균 상태를 유지하며 사육하였다. 40 일간 사육한 다음, 기형종이 형성된 마우스로부터 이를 분리하여, PBS에서 2 내지 3 회 세척하였다. 세척한 기형종은 4% 대체용지 (규칙 제 26조)
W 201
22 포름알데하이드를 가하고 4°C에서 밤새 고정하였다. 고정 후, 기형종을 조직용 플라스틱 카세트 (cassette)에 넣어, 흐르는 물에서 6 내지 8 시간동안 세척하여 고정액을 제거하였다. 저농도에서 고농도의 알코올로 조직의 수분을 제거한 후, 파라핀 침윤 (paraffin infiltration) 하여 조직 내를 고정시키고, 박음 (embedding) 과정을 수행하여 상기 고정된 조직을 부분화 (sect ion)하여 슬라이드글라스 위에 위치하였다. 그런 다음, 파라핀을 제거하고 고농도에서 저농도의 알코올로 수화 (hydration)하고, 해리스 해마토실린 (Harris hematoxylin) 및 에오신 (Eosin)을 처리하여 H&E 염색 (Hematoxylin & Eos in staining)을 수행하였다. 염색된 조직은 위상차 현미경 (Phase contrast microscopy, Olympus사, 일본)을 통해서 외배엽인 신경외배엽 조직 (neural tissue), 내배엽인 분비선 (secretory gland), 및 중배엽인 평활근 (smooth muscle) 및 지방조직 (adipose tissue)이 형성되어 있음을 관찰하였다.
그 결과, 도 9및 도 10에서 나타난 바와 같이 외배엽인 신경외배엽 조직 중배엽인 분비선, 및 내배엽인 평활근 및 지방조직이 NS-iPSC의 전분화능 (pi uri potency)에 의해 형성되는 것을 확인하여, NS— iPSC이 효과적인 전분화능을 가지는 것을 확인하였다 (도 9 및 도 10).
<실시예 5> 누난 증후군 환자 유래의 배상체 (embryoid body, EB) 및 신경 로제트 (ne\iral rosettes)의 자연 분화유도
<5-1> NS-iPSC로부터 배상체 및 신경 로제트의 자연 분화유도
시험관 내 (in vitro)에서 NS-iPSC로부터 신경 세포로의 분화능을 확인하기 위하여, 도 11에서 나타난 모식도의 과정을 따라 NSᅳ iPSC로부터 배상체 (EB) 및 신경 로제트 (신경외배엽, neuroectoderm, neural rosettes)를 형성하도록 자연 분화를 유도하였다 (도 11).
구체적으로, 상기 실시예 <2-1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS-iPSC #4 및 NS-iPSC #5의 집락 (colony)을 1 n 인슐린 주사기를 사용하여 4 등분하였다. 상기 4 등분한 NB-iPSC는 초-저 부착 배지 (ultra-low attachment dish)에 뿌려 10% 혈청 대체물 (serum replacement, 대체용지 (규칙 제 26조)
SR; SPL l i fe sciences Co ., Ltd, 한국)을 포함하는 DMED/F12배지 ( Invi trogen사, 미국)인 배상체 분화 배지 (embryoid body di fferent i at ion medi a) 4 m에 재-현탁하였다. 상기 재ᅳ현탁한 NB-iPSC는 4 일간 배양하여 NS-iPSC 유래의 배상체 (NS-배상체)로 분화를 유도하였다. 그런 다음, 상기 분화를 유도한 NS-배상체를 수득하여, 신경분화촉진물질인 N2 및 B27 첨가제를 포함하는 DMEM/F12에 20 ng/m« bFGF(FGF2 , R&D systems , 미국)를 첨가한 배지인 신경 배상체 배지 (Neural roset te medi a)를 첨가한 매트리겔 ( 1 : 50희석 , Matr igel , BD biosciences사, 미국)이 코팅된 디쉬에 상기 수득한 NS-배상체를 부착 배양하여 4-5일 동안 배양하였다. 형성된 누난 증후군 유래의 신경 로제트 (NS-신경 로제트)를 선택적으로 수득하여, 다시 파이브로넥틴 (Fibronect in, BD biosciences사, 미국)을 코팅한 디쉬 (di sh)에 옮겨 4~5일 동안 신경 배상체 배지에서 배양하였다. 정상대조군으로, 정상 인간배아줄기세포주인 H9 세포주 (H9 hESC) 및 인간 피부 섬유아세포 유래의 iPSC(CRL12)를 사용하여, 상기와 동일한 방법을 수행하여 배상체로 분화를 유도하였다.
그 걸과, 도 12에서 나타난 바와 같이, NS-iPSC로부터 NS-배상체로의 분화 유도 2일에는 H9세포주와 유사하게 정상 세포의 배상체 형태를 나타내나: 분화 유도 4 일 후에는 정상 세포의 배상체 형태인 동그란 형태가 무너지는 것을 확인하였다. 또한, 이 시기에 수득한 배상체를 매트리겔이 코팅된 디쉬 위에 올려 NS-신경 로제트로 분화를 유도하였을 때, NS-신경 로제트로의 형태가 보이지 않고 정상적인 분화가 일어나지 않는 것을 확인하였다 (도 12) .
<5-2>누난증후군유래 배상체의 전분화능마커 유전자발현 확인 정상 세포의 배상체 형태를 나타내지 않는 NS-배상체에서 전분화능이 감소하는지 확인하기 위하여, NS-배상체에서 전분화능 마커 유전자의 발현을 확인하였다.
구체적으로, 상기 실시예 <5-1>과 동일한 방법을 수행하여 NS-배상체의 자연 분화를 유도하면서, 유도 개시 2, 3 및 4 일에 각각의 NS-배상체를 대체용지 (규칙 제 26조)
수득하였다. 그런 다음, 상기 수득한 NS-배상체를 이지블루에 현탁하고 제조사의 프로토콜에 따라 NS-iPSC의 전체 RNA를 추출하고, 추출한 RNA 1 /g을 M-MLV 역전사. 합성효소를 사용하여 전체 cDNA를 합성하였다. 합성한 cDNA를 주형으로 하여, 상기 [표 4]에 기재된 정방향 프라이머 및 역방향 프라이머를 각각 10 pmole의 농도로 하여, 사이버그린 (SybrGreen, Invi trogen사, 미국)을 사용하는 바이오ᅳ라드 CFX매니저 (B )-Rad CFX manager ; Bio-Rad Laborator ies사, 미국)로, 정량적인 실시간 PCR(real-t ime PCR; q-PCR)를 수행하여 0CT4 , S0X2 , NAN0G 및 c-MYC 유전자의 발현을 mRNA 수준에서 확인하였다. 발현 수준을 보정하기 위한 대조군으로 GAPDH 유전자를 상기와 동일한 방법을 수행하여 발현량을 확인하였으며, 상기 유전자 각각의 값은 GAPDH 및 각각의 유전자의 Ct값의 차이로 계산하였다,
실험군으로는 NS-iPSC를 사용하고, 정상 대조군으로는 정상 인간배아줄기세포주인 H9세포주 유래의 배상체 (H9-ES)를 사용하여, 0CT4 , S0X2 , NAN0G 및 c-MYC 유전자의 발현을 확인하고, 이를 NS-배상체의 유전자의 발현량과 각각 비교하여 하기 [수학식 1]로 계산되 ¾ 발현 배수 ( fold change)로 표현하였다.
【수학식 1】
발현배수 = (S A Ct"c Act)
SACt : NS-배상체에서 각각의 유전자의 ᅀ Ct 값; 및
CACt : H9-ES에서 각각의 유전자의 ACt 값.
그 결과, 도 13에서 나타난 바와 같이, 정상 대조군과 비교하였을 때, NS-배상체의 자연 분화 유도 동안 줄기 세포 관련의 유전자 발현이 감소하여 분화능이 감소하는 것을 확인하였다 (도 13) . <5-3>누난증후군환자유래의 배상체에서 BMP및 GF-β 신호전달 체제 유전자발현수준의 확인
누난 증후군 환자로부터 자연 분화를 유도한 NS-배상체에서
대체용지 (규칙 제 26조)
신호전달인자의 발현 수준 변화를 확인하기 위해, 자연 분화로 유도한
NS-배상체에서 BMP신호 전달 체제의 하류 (downstream)유전자인 Idl및 Id2 , 및 TGF- β 신호전달 체제의 신호 전달인자인 SMAD2및 SMAD3유전자의 발현 수준을 확인하였다.
구체적으로, 상기 실시예 <5-1>과 동일한 방법을 수행하여 NS-배상체의 자연 분화를 유도하면서, 유도 개시 2, 3 및 4 일에 각각의 NS-배상체를 수득하였다. 그런 다음, 상기 수득한 NS-배상체를 상기 실시예 <5-2>와 동일한 방법을 수행하여, BMP 신호 전달 체제의 하류유전자인 Idl 및 Id2 , 및 TGF-β 신호전달체제의 신호 전달인자인 SMAD2 및 SMAD3 유전자의 발현 수준 mRNA 레벨에서 확인하였다. 확인을 위하여, 하기 [표 5]에 기재된 정방향 프라이머 및 역방향 프라이머를 사용하였다. 실험군으로는 NS- iPSC를 사용하고, 정상 대조군으로는 정상 인간배아줄기세포주인 H9 세포주 (H9-ES)를 사용하였다.
【표 5】
NS-배상체에서 신호전달 인자의 발현 수준 변화 확인을 위한 프라이머 서열
그 결과, 도 14에사 나타난 바와 같이 정상 대조군과 비교하였을 때, NS-배상체의 자연 분화 유도 동안 신호전달 인자 유전자 발현이 현저히 증가하는 것을 확인하였다 (도 14) · <5-4>누난증후군환자유래의 배상체에서 BMP신호 전달체제 단백질의 인산화수준 확인 대체용지 (규칙 제 26초)
누난 증후군 환자로부터 자연 분화를 유도한 NS-배상체에서 신호전달인자의 발현 수준 변화를 확인하기 위해, 자연 분화로 유도한 NS-배상체에서 BMP 신호 전달 체제의 신호 전달인자인 SMAD1/5/8, 및 TGF-β 신호전달체제의 신호 전달인자인 SMAD2/3 단백질의 인산화 ( phosphorylation) 수준을 확인하였다.
구체적으로, 상기 실시예 <5-1>과 동일한 방법을 수행하여 정상 대조군인 H9 hESCs, CRL12 iPSCs(control )와 함께 NS-배상체 #4와 #5의 자연 분화를 유도하면서, 유도 개시 2 및 4 일에 각각의 NS-배상체를 수득하였다. 그런 다음, EDTA를 포함하는 RIPA세포 융해 완층용액 lX(R4100-100,GenDEP0T사, 미국)에 상기 NS-배상체 세포를 재 -현탁 (re-suspension)하였다. 상기 재-현탁한 세포는 얼음 위에서 10분마다 3 내지 4회 블텍싱 (vortexing)하여 파쇄하고, 4°C 및 13000 rpm에서 30 분간 원심 분리하였다. 세포의 단백질을 포함하는 상층액을 수득하고, 기준 단백질와 커브 (Standard curve)와 함께 상기 단백질의 농도를 BCA 단백질 분석 (BCA protein assay kit, Thermo scientific, 미국)로 확인하였다. 그런 다음, 각각의 세포로부터 수득한 상층액을 25% 글리세를 (glycerol), 2%도데실 황산나트륨 (sodium dodecyl sulfate, SDS), 14.4 mM -머캅토에탄올 (i3-mercaptoethanol) 및 0.1%브로모페놀 블루 (bromophenol blue)를 포함하는 60 mM 트리스 -염산 완충용액 (Tris-HCl buffer; pH 6.8)로 희석하여 10( C에서 3분간 가열하였다. 가열한단백질은 30내지 100kDa이하 및 이상의 분자량을 나타내는 단백질을 1OT SDS-PAGE 겔에서 분리하고, 니트로셀를로오즈 막 (nitrocellulose membrane)으로 이동시켜 4% 스킴 밀크 (skim mi lk)또는 5%소혈청알부민 (bovine serum albumin, BSA)로 차단하였다. 차단 후, 상기 막 (membrane)에 1차 항체로 p-ERKl/2(l: 1000,#4370S, Cell signaling 사, 미국), ERK1/2(1: 1000, #9102, Cell signaling 사, 미국), SMAD2[S465/467] (1:500, #3108, Cell signaling 사, 미국), p-SDMA2/3( 1:500, #3102, Cell signaling사, 미국), p-SMADl/5/8( 1:500, #9511S, Cell signaling 사, 미국), p-AKT[S473] (1:1000, #405 IS, Cell signaling사, 미국), AKT(1:1000, #9272, Cell signaling사, 미국), 0CT4(N-19, l:1000,Santacruz사, 미국)를 각각 대체용지 (규칙 제 26조)
처리하여 4°C에서 밤새 배양하고, TBS-T로 3 회 세척하여, 염소 (goat )로부터 유래한 겨자무과산화효소 (horseradi sh peroxidase, HRP)가 결합된 항 -토끼 IgG (H+L) 2차 항체 (Goat ant i -Rabbi t IgG (H+L) Secondary Ant i body , HRP conjugate ; Santacruz 사, 미국,), 항-쥐 IgG (H+L) 2차 항체 (Goat ant i -Rabbi t IgG (H+L) Secondary Ant i body , HRP conjugate; Santacruz사, 미국), 당나귀 (Donkey)로부터 유래한 겨자무과산화효소 (horseradish peroxidase, HRP)가 결합된 항 -염소 IgG (H+L) 2차 항체 (Goat ant i -Rabbi t IgG (H+L) Secondary Ant i body, HRP conjugate; Santacruz사, 미국)를 2차 항체로 하여 4%스킴밀크 (skim mi lk, BD sciences사, 미국)를 포함하는 TBS-T와 함께 막에 처리하여 한 시간 동안 처리하였다. TBS-T로 3회한 후, LAS-4000 후지필름, 일본)으로 밴드를 확인하였다. 대조군으로, 정상 인간배아줄기세포주인 H9 세포주 (H9 hESC)를 사용하고, 정상 대조군으로는 인간 피부 섬유아세포 유래의 iPSC(CRL12)를 사용하여, 상기와 동일한 방법을 수행하여 배상체로 분화를 유도하였으며, 발현을 보정하기 위한 housekeeping단백질로 액틴 (act in-HRP conjugate, Santacruz사, 미국)단백질을 사용하였다.
그 결과, 도 15에서 나타난 바와 같이 BMP 신호전달 체제의 p-SMADl/5/8 및 TGF-β 신호전달 체제의 P-SMAD2/3의 발현이 정상 대조군에 비하여 2일 및 4일에서 증가하는 양상을 나타내는 갓을 확인하였다 (도 15) . <5-5>누난증후군유래 신경 로제트의 신경세포마커 유전자발현 확인 누난 증후군 유래의 배상체로부터 자연 분화된 신경 로제트가 신경 세포로의 특징을 나타내는지 확인하기 위하여, NS-iPSC에서 자연 분화된 NS-배상체로부터 신경 로제트로 분화하여 PAX6, S0X2 , ZIC1 , 0TX2 및 NESTIN 유전자의 mRNA 발현 수준을 확인하였다.
구체적으로, 상기 실시예 <5-1>와 동일한 방법올 수행하여 분화를 유도한 누난 증후군 유래의 신경 로제트 (NS-NR)를 수득하여, 상기 실시예 <5-2>와 동일한 방법을 수행하여 PAX6 , S0X2, ZIC1 , 0TX2 및 NESTIN 유전자 등의 cDNA를 각각 합성하고, 이를 증폭하여 전기영동으로 상기 유전자의 대체용지 (규칙 제 26조)
발현을 mRNA 수준에서 확인하였다. RT-PCR과 qPCR에서 상기 유전자들의 발현 수준을 보정하기 위한 대조군으로 GAPDH 유전자를 상기와 동일한 방법을 수행하여 발현량을 확인하였으며, 상기 유전자 각각의 ACt 값은 GAPDH 및 각각의 유전자의 Ct값의 차이로 계산하였다. 대조군으로는 정상 인간 배아줄기세포주인 H9 세포주 및 정상 인간 섬유아세포주 유래 iPSC인 CRL12로부터 상기 실시예 <5-1>와 동일한 방법으로 자연 분화를 유도한 신경 로제트 (H9-NR 및 CRL12-NR)를 사용하였으며, 이를 NS-신경로제트 (NS-NR)의 유전자의 발현량과 각각 비교하여 상기 [수학식 1]로 계산되는 발현 배수로 표현하였다.
그 결과, 도 16 및 도 17에서 나타난 바와 같이, 누난 증후군 유래의 iPSC로부터 신경 로제트 및 신경관 (neural tube)의 형성이 이루어지지 않는 것을 확인하였다. 또한, 이와 관련한 유전자인 S0X2의 발현이 유의적으로 감소하였고, PAX6 , 0TX2 및 ZIC1 유전자의 발현이 거의 나타나지 않는 것을 확인하였다. 반면, NESTIN은 발현의 차이가 없었음을 확인하였다 (도 16 및 도 17) .
<실시예 6> 누난 증후군 환자 유래의 배상체 (embryoid body, EB) 및 신경 로제트 (neural rosettes)의 화학적 분화유도
<6-1> NS-iPSC로부터 배상체 및 신경 로제트의 화학적 분화유도 누난 증후군에서 나타나는 신호전달 체제의 이상으로 인해
NS-iPSC로부터 자연 분화 유도되어 형성된 배상체. 및 신경 로제트가 정상적인 분화를 나타내지 않으므로 이를 극복하기 위하여, 도 18에서 나타난 모식도의 과정을 따라 NSᅳ iPSC로부터 배상체 및 신경 로제트를 형성하도록 화학적 약물인 도소모르핀 (dorsomorphin, DM) 및 SB431542를 사용하여 , 화학적 분화를 유도하였다 (도 18 및 표 6) .
구체적으로, 상기 실시예 <2ᅳ1>과 동일한 방법을 수행하여 발생을 유도하여 수득한 NS- iPSC #4 및 NS-iPSC #5의 집락 (colony)을 1. mi 인술린 주사기를 사용하여 4 등분하였다. 상기 4 등분한 NB-iPSC는 초-저 부착 대체용지 (규칙 제 26조)
배지 (ultra-low attachment dish, SPL life sciences Co. , Ltd, 한국)에 뿌려 10% 혈청 대체물 (serum replacement, SR; GIBCO 사, 미국)을 포함하는 DMED/F12 배지 (Invitrogen사, 미국)인 배상체 분화 배지 (embryoid body differentiation media) 4 1 에 재-현탁하였다. 4 일간 배양하여 NS-iPSC 유래의 배상체 (NS-배상체)로 분화를 유도하였다. 그런 다음, 상기 분화를 유도한 NS-배상체를 수득하여, 신경분화촉진물질인 N2 및 B27 첨가제를 포함하는 DMEM/F12에 20 ng/mi bFGF(FGF2, R&D systems, 미국)를 첨가한 배지인 신경 배상체 배지 (Neural rosette media)를 첨가한 매트리겔 (1:50희석, Matrigel, BD sciences사, 미국)이 코팅된 디쉬에 상기 수득한 NS-배상체를 부착 배양하여 4-5일 동안 배양하였다. 형성된 누난 증후군 유래의 신경 로제트 (NS-신경 로제트)를 선택적으로 수득하여, 다시 파이브로넥틴 (Fibronectin, BD sciences사, 미국)을 코팅한 디쉬 (dish)에 옮겨 4~5일 동안 신경 배상체 배지에서 배양한다. 정상대조군으로, 정상 인간배아줄기세포주인 H9세포주 (H9 ESC)및 인간 피부 섬유아세포 유래의 iPSC(CRL12)를 사용하여, 상기와 동알한 방법을 수행하여 배상체로 분화를 유도하였다.
【표 6】
화학적 분화 유도를 위한 배상체 분화 배지의 조성 변화
* SR: 혈청 대체물 (serum re lacement)
** N2 배지는 매트리겔이 코팅된 디쉬에 첨가하여 사용하였다.
그 결과, 도 19 및 도 20에서 나타난 바와 같이, 자연분화로 유도되어 형성된 NS-배상체 및 NS-신경 로제트에 비하여, 화학적 분화로 유도되어 형성된 NS-배상체 및 NS-신경 로제트에서 정상 대조군에서 나타나는 세포의 형태와 유사하게 회복되어 신경 로제트 및 신경관의 형성을 나타내는 것을 확인하였다 (도 19 및 도 20). 대체용지 (규칙 제 26조)
<6-2>화학적 분화유도된 NS-iPSC유래의 신경 로제트의 신경세포 마커 유전자발현 확인
누난 증후군 유래의 iPSC로부터 화학적으로 분화 유도된 신경 로제트에서 신경세포로서의 마커 유전자를 정상적으로 발현하는자 확인하기 위하여, 화학적 분화 유도된 NS—배상체에서 외배엽 (ectoderm) 유전자인 PAX6 , ZICl , NESTIN 및 VIMENTIN, 신경 로제트 유전자인 PLZF , NR2F1 , HES5 및 DACH1 , 및 신경세포 유전자인 TUJl, ASCL1 및 NF1 유전자의 mRNA 발현 수준을 확인하였다.
구체적으로, 상기 실시예 <6-1>과 동일한 방법을 수행하여 화학적 분화를 유도한 NS-iPSC 유래의 신경 로제트를 수득하여, 상기 실시예 <5-2〉와 동일한 방법을 수행하여, NS-iPSC의 전체 RNA를 추출하고, 추출한 RNA 1 을 M-MLV 역전사 합성효소 (Enzynomics사, 한국)를 사용하여 cDNA를 각각 합성하였다. 외배엽 유전자인 PAX6, ZICl , NESTIN 및 VIMENTIN, 신경 로제트 유전자인 PLZF, NR2F1 , HES5및 DACH1 ,및 신경세포 유전자인 TUJl , ASCL1및 NF1 유전자의 cDNA를 각각 합성하고, 하기 [표 기의 프라이머 서열을 사용하여 이를 증폭하여 전기영동으로 상기 유전자의 발현을 RT-PCR을 통해 mRNA 수준에서 확인하였다. 정상 대조군으로는, 상기 실시예 <6-1>에서 화학적 분화를 유도한 H9 세포주 및 CRL12 유래의 신경 로제트를 사용하였다.
[표 7】
신경. 로제트의 신경세포 마커 유전자 발현 확인을 위합 프라이머 서열
대체용지 (규칙 제 26조)
VIMENTIN VIMENTIN-F TGCAGGACTCGGTGGACTT 서열번호 35
VIMENTIN- TGGACTCCTGCTTTGCCTG 서열번호 36
PLZF PLZF-F CTATGGGCGAGAGGAGAGTG 서열번호 37
PLZF-R . TCAATACAGCGTCAGCCTTG 서열번호 38
NR2F1 NR2F1-F ACAGGAACTGTCCCATCGAC 서열번호 39
NR2F-R GATGTAGCCGGACAGGTAGC 서열번호 40
HES5 HES5-F CATCCTGGAGATGGCTGTCA 서열번호 41
HES5-R AGCAGCTTCATCTGCGTGT 서열번호 42
DACH1 DACH1-F GTGGAAAACACCCCTCAGAA 서열번호 43
DACH1- CTTGTTCCACATTGCACACC 서열번호 44
TUJ1 TUJ1-F GAACAGCACGGCCATCCAGG 서열번호 45
TUJ1-R . CnGGGGCCCTGGGCCTCCGA 서열번호 46 .
ASCL1 ASCL1-F CATCTCCCCCAACTACTCCA 서열번호 47
ASCL1-R TCGGGGCTGAGCGGGTCGTA 서열번호 48
NF1 NF1-F AGCAGCAG1TTGGCCACTACAA 서열번호 49
NFl-R TTGCAGCACTTTCTGTCAGCTG 서열번호 50
그 결과ᅳ 도 21에서 나타난 바와 같이 대부분의 유전자인 PAX6, ZIC1 , NESTIN, VIMENTIN, PLZF, HES5, DACH1 , TUJ'l , ASCL1 및 NFl 유전자는 정상 대조군과 유사한 수준으로 발현되는 것을 확인하였으나ᅳ NR2F1의 발현은 감소하는 것을 확인하였다 (도 21) .
<6-3> 화학적 분화 유도된 NS-iPSC 유래의 신경 로제트의 NR2F1 유전자 발현의 감소 확인
화학적으로 분화 유도된 누난 증후군 유래의 신경 로제트에서 NR2F1 유전자 발현이 감소되는 것을 확인하기 위해서, 화학적 분화 유도된 NS-신경로제트에서 NR2F1 유전자 발현의 감소를 정량적으로 재확인하였다. 구체적으로, 상기 실시예 <6-1>과 동일한 방법을 수행하여 화학적 분화를 유도한 NS-iPSC 유래의 신경 로제트를 수득하여, 상기 실시예 <5-2>와 동일한 방법으로 NR2F1유전자 cDNA를 각각 합성하고, q-PCR를 수행하여 NR2F1 유전자의 발현을 mRNA 수준에서 확인하였다. 발현 수준을 보정하기 위한 대조군으로 GAPDH 유전자를 상기와 동일한 방법을 수행하여 발현량을 확인하였으며, 상기 유전자 각각의 ACt 값은 GAPDH 및 NR2F1 유전자의 Ct값의 대체용지 (규칙 제 26조)
차이로 계산하였다. 대조군으로는 상기 실시예 <6-1>에서 화학적 분화를 유도한 H9 세포주 및 CRL12 유래의 신경 로제트를 사용하였으며, 이를 NS-신경 로제트의 유전자의 발현량과 각각 비교하여 상기 [수학식 1]로 계산되는 발현 배수로 표현하였다.
그 결과, 도 22에서 나타난 바와 같이 정상 대조군에 비해서 NS-신경 로제트에서 NR2F1 유전자 발현 수준이 현저히 감소하는 것을 확인하였다 (도 22) .
대체용지 (규칙 제 26조)
Claims
【청구항 1】
i) 시험관 내 fro)에서 누난 증후군 (Noonan syndrome) 환자로부터 분리된 섬유아세포 (fibroblast)를 유도 -만능 줄기 세포 (induced pluri otent stem cells; iPSC)로 유도하는 단계; 및
ii) 상기 단계 i)에서 유도된 iPSC를 수득하는 단계를 포함하는, 시험관 내에서 누난 증후군 iPSC 모델의 제조 방법.
【청구항 2】
제 1항에 있어서 , 상기 단계 i)의 유도는 다분화능 마커 (pluripotent marker)의 이소성 발현 (ectopic expression)을 사용하는 것을 특징으로 하는 시험관 내에서 누난 증후군 iPSC 모델의 제조 방법.
【청구항 3】
제 1항의 방법으호 제조된, 누난 증후군 iPSC 모델.
【청구항 4】
제 3항에 있어서, 상기 iPSC는 하기 i) 내지 iii) 중 어느 하나 이상을 특징으로 하는 누난 증후군 iPSC 모델;
i) 정상 세포의 iPSC 형태;
ii) 0CT4, S0X2, NANOG, REXl, ECAT15, ffl 및 로 구성된 군으로부터 선택된 어느 하나 이상의 다분화능 마커 유전자의 발현; 및
iii) 0CT4, NANOG, S0X2, SSEA4, Tra-1-81 및 Tra-1-60으로 구성된 군으로부터 선택된 어느 하나 이상의 줄기세포성 마커 (sternness maeker) 단백질의 발현 .
【청구항 5】
0 제 3항의 iPSC로부터 배상체 (embryo id body, EB) 또는 신경세포로 대체용지 (규칙 제 26조)
분화를 유도하는 단계 ; 및
ii) 상기 단계 i)에서 유도된 배상체 또는 세포의 특성를 분석하는 단계를 포함하는, iPSC를 누난 증후군의 모델로 사용하는 방법.
【청구항 6】
제 5항에 있어서, 상기 유도는 자연적인 유도 또는 화학적 유도 물질 (chemical)의 첨가로 인한 직접적 (directed)인 유도 둘 중 어느 하나인 것을 특징으로 하는, iPSC를 누난 증후군의 모델로 사용하는 방법.
[청구항 7】 - 제 5항에 있어서, 상기 단계 iii)의 iPSC 모델의 특성은 iPSC 모델의 배상체 또는 신경세포로의 분화능을 분석하는 것을 특징으로 하는, iPSC를 누난 증후군의 모델로 사용하는 방법 .
【청구항 8】
제 5항에 있어서, 상기 배상체의 특성은 하기 i) 내지 Vi) 중 어느 하나 이상인 것을 특징으로 하는, iPSC를 누난 증후군의 모델로 사용하는 방법;
i) 정상 세포의 형태;
ii) 0CT4, SOX2, NANOG, c-MYC, 및 KLF4로— 구성된 군으로부터 선택된 어느 하나 이상의 다분화능 마커 유전자의 발현;
iii) Idl 또는 Id2 둘 중 하나 이상을 포함하는 BMP 신호 전달 체제 유전자의 증가;
iv) p-SMADl, p-SMAD5및 p-SMAD8로 구성된 군으로부터 선택된 어느 하나 이상의 BMP신호전달 체제 단백질의 인산화 수준의 증가;
v) SMAD2 또는 SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 유전자의 증가; 및
vi) p-SMAD2 또는 p-SMAD3 둘 중 하나 이상을 포함하는 TGF-β 신호전달 체제 단백질의 인산화 수준의 증가. ― 대체용지 (규칙 제 26조)
【청구항 9】
제 5항에 있어서 상기 신경세포의 특성은 하기 i) 내지 iii) 중 어느 하나 이상인 것을 특징으로 하는, iPSC를 누난 증후군의 모델로 사용하는 방법;
i) 정상 세포의 형태;
ii) PAX6, ZIC1, NESTIN, VIMENTIN, NP2F1, PLZF, HESS, DACH1, TUJ1, ASCII 및 NFl로 구성된 군으로부터 선택된 어느 하나 이상의 신경세포 유전자의 발현; 및
iii) 정상 세포에 비해 NR2F1유전자의 발현 감소.
【청구항 10】 .
i) 제 3항의 iPSC 모델, 또는 이로부터 분화된 배상체 또는 신경세포를 수득하는 단계;
ii) 상기 단계 i)의 iPSC 모델, 배상체 또는 신경세포에 피검 화합물 또는 피검 조성물을 처리하는 단계:
iii)상기 단계 Π)의 처라된 iPSC모델, 배상체 또는 신경세포의 특성을 분석하는 단계; 및
iv) 상기 단계 iii)의 분석한 결과를 무처리 대조군과 비교하는 단계를 포함하는, 누난 증후군의 치료제 후보물질의 스크리닝 방법.
【청구항 11】
제 1항의 방법으로 제조된, 누난 증후군 iPSC 모델의 용도. 【청구항 12】
i) 제 3항의 iPSC로부터 배상체 (embryoid body, EB) 또는 신경세포로 분화를 유도하는 단계; 및
ii) 상기 단계 i)에서 유도된 배상체 또는 세포의 특성를 분석하는 대체용지 (규척 제 26조)
단계를 포함하는, iPSC를 누난 증후군의 모델로사용하는 용도
대체용지 (규칙 제 26조)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/221,217 US20170016886A1 (en) | 2014-01-28 | 2016-07-27 | Induced pluripotent stem cell model of noonan syndrome and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20140010398A KR101490829B1 (ko) | 2014-01-28 | 2014-01-28 | 누난 증후군의 유도-만능 줄기세포 모델 및 이의 용도 |
| KR10-2014-0010398 | 2014-01-28 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/221,217 Continuation US20170016886A1 (en) | 2014-01-28 | 2016-07-27 | Induced pluripotent stem cell model of noonan syndrome and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015115690A1 true WO2015115690A1 (ko) | 2015-08-06 |
Family
ID=52591518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2014/000880 Ceased WO2015115690A1 (ko) | 2014-01-28 | 2014-01-29 | 누난 증후군의 유도-만능 줄기세포 모델 및 이의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20170016886A1 (ko) |
| KR (1) | KR101490829B1 (ko) |
| WO (1) | WO2015115690A1 (ko) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10767164B2 (en) | 2017-03-30 | 2020-09-08 | The Research Foundation For The State University Of New York | Microenvironments for self-assembly of islet organoids from stem cells differentiation |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011130217A1 (en) * | 2010-04-14 | 2011-10-20 | Mount Sinai School Of Medicine | Induced pluripotent stem cells and uses thereof |
| KR101168053B1 (ko) * | 2009-11-06 | 2012-07-24 | 연세대학교 산학협력단 | 효율적이고 보편적인 전분화능 줄기세포의 신경세포 분화 유도방법 |
| KR20130133598A (ko) * | 2012-05-29 | 2013-12-09 | 차의과학대학교 산학협력단 | 헌팅턴병 환자에서 유래한 유도만능줄기세포를 이용하여 헌팅턴병 치료제를 스크리닝하는 방법 |
-
2014
- 2014-01-28 KR KR20140010398A patent/KR101490829B1/ko not_active Expired - Fee Related
- 2014-01-29 WO PCT/KR2014/000880 patent/WO2015115690A1/ko not_active Ceased
-
2016
- 2016-07-27 US US15/221,217 patent/US20170016886A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101168053B1 (ko) * | 2009-11-06 | 2012-07-24 | 연세대학교 산학협력단 | 효율적이고 보편적인 전분화능 줄기세포의 신경세포 분화 유도방법 |
| WO2011130217A1 (en) * | 2010-04-14 | 2011-10-20 | Mount Sinai School Of Medicine | Induced pluripotent stem cells and uses thereof |
| KR20130133598A (ko) * | 2012-05-29 | 2013-12-09 | 차의과학대학교 산학협력단 | 헌팅턴병 환자에서 유래한 유도만능줄기세포를 이용하여 헌팅턴병 치료제를 스크리닝하는 방법 |
Non-Patent Citations (2)
| Title |
|---|
| CARVAJAL-VERGARA, X. ET AL.: "Patient-specific induced pluripotent stem- cell -derived models of LEOPARD syndrome", NATURE, vol. 465, 10 June 2010 (2010-06-10), pages 808 - 812 * |
| RAJAMOHAN, D. ET AL.: "Current status of drug screening and disease modelling in human pluripotent stem cells", BIOESSAYS, vol. 35, no. 3, 2013, pages 281 - 298, XP055215889 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101490829B1 (ko) | 2015-02-09 |
| US20170016886A1 (en) | 2017-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101792757B1 (ko) | 체세포로부터 희소돌기아교 전구세포로의 직접교차분화 유도용 조성물 및 이의 이용 | |
| RU2646099C2 (ru) | Способ получения индуцированных нервных стволовых клеток, перепрограммированных из клеток, не являющихся нервными, с использованием hmga2 | |
| Huang et al. | Directing adult human periodontal ligament–derived stem cells to retinal fate | |
| US20150250824A1 (en) | Methods and compositions for expansion of stem cells and other cells | |
| US10724000B2 (en) | Small molecule based conversion of somatic cells into neural crest cells | |
| US20180306780A1 (en) | Astrocyte differentiation protocol | |
| EP2843041A1 (en) | Stem cell culture medium and method for culturing stem cells using same | |
| WO2011055899A2 (ko) | 효율적이고 보편적인 전분화능 줄기세포의 신경세포 분화 유도방법 | |
| KR20170020724A (ko) | 모발 성장을 조정하기 위한 방법 및 조성물 | |
| US20190322981A1 (en) | Means and methods for the generation of oligodendrocytes | |
| JP7094567B2 (ja) | 神経堤細胞および交感神経細胞の製造方法 | |
| KR101793722B1 (ko) | 성상세포의 생산방법 | |
| JP7205928B2 (ja) | 神経幹細胞の高効率分離培養方法 | |
| KR101490829B1 (ko) | 누난 증후군의 유도-만능 줄기세포 모델 및 이의 용도 | |
| CN104130975B (zh) | 人源脂肪干细胞来源的神经元样细胞及其制备方法和应用 | |
| US20220333070A1 (en) | Induction of functional astrocytes from pluripotent stem cells | |
| WO2023008564A1 (ja) | 高増殖性細胞の製造方法、高増殖性細胞およびその用途 | |
| KR100683199B1 (ko) | 신경전구세포를 콜린성 신경세포로 분화시키는 방법 및그에 사용되는 배지 | |
| US20260027159A1 (en) | Composition for prevention or treatment of neurological disease comprising: schwann cell precursor (scp) or schwann cell (sc) differentiated therefrom; and natural killer (nk) cell | |
| KR101650704B1 (ko) | Cd105- 세포에 역분화 인자가 도입된 유도 만능 줄기세포 및 이의 제조방법 | |
| CA3118637A1 (en) | Use of oligodendrocytes from oral neuroectodermal stem cells in the repair of the nervous system | |
| WO2014163380A1 (ko) | 샤르코-마리-투스 질환 치료제의 스크리닝 방법 및 이에 이용되는 자가분화운동신경세포 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14880867 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14880867 Country of ref document: EP Kind code of ref document: A1 |





