WO2015084808A1 - Identification of predictive biomarkers associated with wnt pathway inhibitors - Google Patents
Identification of predictive biomarkers associated with wnt pathway inhibitors Download PDFInfo
- Publication number
- WO2015084808A1 WO2015084808A1 PCT/US2014/068097 US2014068097W WO2015084808A1 WO 2015084808 A1 WO2015084808 A1 WO 2015084808A1 US 2014068097 W US2014068097 W US 2014068097W WO 2015084808 A1 WO2015084808 A1 WO 2015084808A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- tumor
- biomarker
- antibody
- wnt pathway
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to the field of cancer treatment. More particularly, the invention provides methods for identifying tumors that are likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor. In addition, the invention provides methods for identifying, selecting, and/or treating patients with cancer who are likely to respond to treatment with a Wnt pathway inhibitor, either alone or in combination with other therapeutic agents.
- Cancer is one of the leading causes of death in the developed world, with approximately 1.6 million people diagnosed with cancer and over 550,000 deaths per year in the United States alone. Overall it is estimated that more than 1 in 3 people will develop some form of cancer during their lifetime. There are more than 200 different types of cancer, four of which - breast, lung, colorectal, and prostate— account for almost half of all new cases in the United States (Siegel et al., 2012, CA: A Cancer J. for Clin., 62: 10-29).
- Signaling pathways normally connect extracellular signals to the nucleus leading to the expression of genes that directly or indirectly control cell growth, differentiation, survival, and death. However, in a wide variety of cancers signaling pathways are dysregulated and may be linked to tumor initiation and/or progression. Signaling pathways implicated in human oncogenesis include, but are not limited to, the Wnt pathway, the Ras-Raf-MEK-ERK or MAPK pathway, the PI3K-AKT pathway, the CDKN2A/CDK4 pathway, the Bcl-2/TP53 pathway, and the NOTCH pathway.
- the Wnt signaling pathway is one of several critical regulators of embryonic pattern formation, post-embryonic tissue maintenance, and stem cell biology. More specifically, Wnt signaling plays an important role in the generation of cell polarity and cell fate specification including self-renewal by stem cell populations. Unregulated activation of the Wnt pathway is associated with numerous human cancers where it is believed the activation can alter the developmental fate of cells. It is believed that the activation of the Wnt pathway may maintain tumor cells in an undifferentiated state and/or lead to uncontrolled proliferation.
- the Wnt signaling pathway was first elucidated in the Drosophila developmental mutant wingless (wg) and from the murine proto-oncogene int-1, now Wntl (Nusse & Varmus, 1982, Cell, 31 :99-109; Van Ooyen & Nusse, 1984, Cell, 39:233-40; Cabrera et al., 1987, Cell, 50:659-63;
- Wnt genes encode lipid-modified glycoproteins which are secreted and 19 different Wnt proteins have been identified in mammals. These secreted ligands activate a receptor complex consisting of a Frizzled (FZD) receptor family member and low-density lipoprotein (LDL) receptor-related protein 5 or 6 (LRP5/6).
- FZD Frizzled
- LDL low-density lipoprotein
- the FZD receptors are members of the G-protein coupled receptor (GPCR) superfamily and contain seven transmembrane domains and a large extracellular N-terminal ligand binding domain.
- the N-terminal ligand binding domain contains 10 conserved cysteines and is known as a cysteine-rich domain (CRD) or a "Fri domain".
- CRD cysteine-rich domain
- Different FZD CRDs have different binding affinities for specific Wnt proteins (Wu & Nusse, 2002, J. Biol. Chem., 277:41762-9).
- FZD receptors may be grouped into those that activate the canonical ⁇ -catenin pathway and those that activate non-canonical pathways (Miller et al., 1999, Oncogene, 18:7860-72).
- Neoplasia 8: 145-58.
- ⁇ -catenin accumulation implicates activated Wnt signaling in over 50% of carcinomas, and though specific mutations have not been identified, up- regulation of Frizzled receptor expression has been observed (Brennan & Brown, 2004, J. Mammary Gland Biol. Neoplasia, 9: 1 19-31 ; Malovanovic et al., 2004, Int. J. Oncol, 25: 1337-42).
- Activation of the Wnt pathway is also associated with colorectal cancer, lung cancer, pancreatic cancer, and melanoma.
- colorectal cancer Approximately 5- 10% of all colorectal cancers are hereditary with one of the main cancer types being familial adenomatous polyposis (FAP).
- FAP familial adenomatous polyposis
- APC adenomatous polyposis coli
- adenomas are clonal outgrowths of epithelial cells containing a second inactivated allele, and the large number of FAP adenomas inevitably results in the development of adenocarcinomas through additional mutations in oncogenes and/or tumor suppressor genes. Furthermore, activation of the Wnt signaling pathway, including loss-of-function mutations in APC and stabilizing mutations in ⁇ -catenin, can induce hyperplastic development and tumor growth in mouse models (Oshima et al., 1997, Cancer Res., 57: 1644-9; Harada et al., 1999, EMBO J., 18:5931 -42).
- Personalized medicine strategies may include treatment regimens that are based upon cancer biomarkers, including prognostic markers, pharmacodynamic markers, and predictive markers.
- predictive biomarkers assess the likelihood that a tumor or cancer will be responsive to or sensitive to a specific therapeutic agent, and may allow for the identification and/or the selection of patients most likely to benefit from the use of that agent.
- the invention provides the identification of predictive biomarkers associated with the use of Wnt pathway inhibitors in the treatment of cancer. Also provided are methods of using the predictive biomarkers for identifying, selecting, and/or classifying tumors and/or patients with cancer as likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor. Methods for treating patients with a Wnt inhibitor that are predicted to be responsive to treatment are also provided.
- biomarkers for identifying patients likely to respond to treatment with Wnt pathway inhibitors are provided. Additionally provided are methods for identifying tumors and/or patients that are likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor. Further provided are methods of treating cancer in a patient with a Wnt pathway inhibitor, wherein the patient is predicted to be or has been identified as likely to be responsive to the Wnt pathway inhibitor.
- the invention provides a method of identifying a human tumor that is likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor, the method comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CRBP2, WIF1 , and DKK1 ; and (c) identifying the tumor as likely to be responsive or non-responsive to treatment based upon the expression level of the biomarkers.
- a method of identifying a human tumor that is likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CRBP2, WIF1 , and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- standardized and "normalized” may be used interchangeably.
- the method comprises identifying a human tumor that is likely to be responsive or non- responsive to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of classifying a human tumor as likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor, the method comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1 , and DKK1; and (c) classifying the tumor as likely to be responsive or non-responsive to treatment based upon the expression level of the biomarkers.
- a method of classifying a human tumor as likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- the method comprises classifying a human tumor as likely to be responsive or non- responsive to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of determining the responsiveness (or sensitivity) of a human tumor to treatment with a Wnt pathway inhibitor, the method comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the genes FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1; and (c) determining the responsiveness of the tumor to treatment based upon the expression level of the biomarkers.
- a method of determining the responsiveness or sensitivity of a human tumor to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the genes FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to or sensitive to the Wnt pathway inhibitor.
- the method comprises determining the responsiveness or sensitivity of a human tumor to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor, the method comprising: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers.
- a method of identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment with the Wnt pathway inhibitor.
- the method comprises identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of selecting a patient with cancer for treatment with a Wnt pathway inhibitor, the method comprising: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF 1 , and DKKl ; (c) selecting the patient for treatment based upon the expression level of the biomarkers.
- a method of selecting a patient with cancer for treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; and (d) selecting the patient for treatment when their tumor sample has a positive decision value.
- the method comprises selecting a patient with cancer for treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of treating cancer in a patient, comprising: (a) identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (iii) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers; and (b) administering to the patient who is likely to response to treatment an effective amount of the Wnt pathway inhibitor.
- a method of treating cancer in a patient comprises: (a) identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that a patient is predicted to respond to treatment; and (b) administering to the patient who is predicted to response to treatment an effective amount of the Wnt pathway inhibitor.
- the method comprises identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel. In some embodiments, the method comprises administering to the patient the Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method of treating cancer in a patient, comprising: administering an effective amount of a Wnt pathway inhibitor to the patient; wherein the patient is predicted to respond to treatment with a Wnt inhibitor based upon expression levels of a biomarker signature in a patient tumor sample, wherein the signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl .
- a method of treating cancer in a patient comprises: administering an effective amount of a Wnt pathway inhibitor to the patient; wherein the patient is predicted to respond to treatment based upon a positive decision value calculated from the weighted sum of the standardized expression of biomarkers in a biomarker signature in a patient tumor sample, wherein the set of biomarkers comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl , and DKKl .
- the patient is predicted to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the method comprises administering to the patient the Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor, comprising: (a) identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl , and DKKl; and (iii) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers; and (b) administering an effective amount of the Wnt pathway inhibitor to the patient.
- a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprises: (a) identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that a patient is predicted to respond to treatment; and (b) administering an effective amount of the Wnt pathway inhibitor to the patient whose tumor has a positive decision value.
- the method comprises identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel. In some embodiments, the method comprises administering to the patient the Wnt pathway inhibitor in combination with paclitaxel.
- the invention provides a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor, comprising: administering an effective amount of a Wnt pathway inhibitor to a patient; wherein the patient is identified as likely to respond to treatment with a Wnt inhibitor based upon expression levels of a biomarker signature in a patient tumor sample, wherein the signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1.
- a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprises: administering an effective amount of a Wnt pathway inhibitor to a patient; wherein the patient is identified as likely to respond to treatment based upon a positive decision value calculated from the weighted sum of the standardized expression of biomarkers in a biomarker signature in a patient tumor sample, wherein the set of biomarkers comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1.
- the patient is identified as likely to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the method comprises administering to the patient the Wnt pathway inhibitor in combination with paclitaxel.
- the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1 , DKK1, EP300, and CTBP1.
- the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, DKK1, EP300, CTBP1, WNT6, WNT3, FZD2, APC, TLE2, DVL2, PITX2, WISP1, GSK3B, WNT9A, FZD7, and LEF1.
- the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1, and at least one additional biomarker from Table 2.
- the Wnt pathway inhibitor is an antibody.
- the Wnt pathway inhibitor is an antibody that specifically binds at least one Frizzled (FZD) protein or fragment thereof.
- the Wnt pathway inhibitor is an antibody that specifically binds at least one FZD protein selected from the group consisting of: FZD 1 , FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD 8, FZD9, and FZD 10.
- the Wnt pathway inhibitor is an antibody that specifically binds at least one FZD protein selected from the group consisting of: FZD 1, FZD2, FZD5, FZD7, and FZD8.
- the Wnt pathway inhibitor is an antibody which comprises: (a) a heavy chain CDR1 comprising
- GFTFSHYTLS (SEQ ID NO: 1), a heavy chain CDR2 comprising VIS GDGS YTYYAD S VKG (SEQ ID NO:2), and a heavy chain CDR3 comprising NFIKYVFAN (SEQ ID NO:3), and (b) a light chain CDR1 comprising SGDNIGSFYVH (SEQ ID NO:4), a light chain CDR2 comprising DKSNRPSG (SEQ ID NO:5), and a light chain CDR3 comprising QSYANTLSL (SEQ ID NO:6).
- the Wnt pathway inhibitor is an antibody which comprises a heavy chain variable region comprising SEQ ID NO: 7 and a light chain variable region comprising SEQ ID NO: 8. In certain embodiments, the Wnt pathway inhibitor is an antibody which comprises a heavy chain variable region and a light chain variable region encoded by the plasmid deposited with ATCC as PTA-9541. In certain embodiments, the Wnt pathway inhibitor is an antibody which comprises a heavy chain and a light chain encoded by the plasmid deposited with ATCC as PTA-9541. In some embodiments, the Wnt pathway inhibitor is antibody OMP-18R5.
- the Wnt pathway inhibitor is a soluble receptor.
- the Wnt pathway inhibitor comprises the extracellular domain of a FZD receptor protein.
- the Wnt pathway inhibitor comprises a Fri domain of a FZD protein.
- the Wnt pathway inhibitor comprises the Fri domain of FZD8.
- the Wnt pathway inhibitor comprises the Fri domain of FZD 8 and a human Fc domain.
- the Wnt pathway inhibitor is the soluble receptor OMP-54F28.
- the tumor is selected from the group consisting of a breast tumor, lung tumor, a colon tumor, glioma, a gastrointestinal tumor, a renal tumor, an ovarian tumor, a liver tumor, a colorectal tumor, an endometrial tumor, a kidney tumor, a prostate tumor, a thyroid tumor, a neuroblastoma, a pancreatic tumor, a glioblastoma multiforme, a cervical tumor, a stomach tumor, a bladder tumor, a hepatoma, melanoma, and a head and neck tumor.
- the tumor is a breast tumor.
- the cancer is selected from the group consisting of a breast cancer, lung cancer, a colon cancer, glioma, a gastrointestinal cancer, a renal cancer, an ovarian cancer, a liver cancer, a colorectal cancer, an endometrial cancer, a kidney cancer, a prostate cancer, a thyroid cancer, a neuroblastoma, a pancreatic cancer, a glioblastoma multiforme, a cervical cancer, a stomach cancer, a bladder cancer, a hepatoma, melanoma, and a head and neck cancer.
- the cancer is breast cancer.
- the method further comprises administering a second therapeutic agent to the patient.
- the second therapeutic agent is a chemotherapeutic agent.
- the second therapeutic agent is paclitaxel.
- the sample includes, but is not limited to, any clinically relevant tissue sample, such as a tumor biopsy, a core biopsy tissue sample, a fine needle aspirate, a hair follicle, or a sample of bodily fluid, such as blood, plasma, serum, lymph, ascitic fluid, cystic fluid, or urine.
- the sample is taken from a patient having a tumor or cancer.
- the sample is a primary tumor.
- the sample is a metastasis.
- the sample is a tissue sample.
- the sample is a tumor sample.
- the sample is a fresh frozen (FF) tissue sample.
- FF fresh frozen
- the sample is a formalin-fixed paraffin embedded (FFPE) tissue sample.
- FFPE formalin-fixed paraffin embedded
- the sample is whole blood, plasma, or serum.
- the sample is cells.
- the sample is circulating tumor cells (CTCs).
- the expression level of a biomarker is determined using PCR-based methods, such as but not limited to, reverse transcription PCR (RT-PCR), quantitative RT-PCR (qPCR), TaqManTM, or TaqManTM low density array (TLDA).
- RT-PCR reverse transcription PCR
- qPCR quantitative RT-PCR
- TLDA TaqManTM low density array
- the expression level of a biomarker is determined using a microarray.
- the standardized expression of each biomarker is determined by measuring an expression level for each biomarker and multiplying it by a
- the decision value is calculated according to the equation:
- the expression level of a biomarker is measured or determined by a PCR-based assay.
- the expression levels of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 are measured using polynucleotides selected from the group consisting of SEQ ID NOs:62-79.
- the expression levels of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 are measured using (a) a forward primer of SEQ ID NO:62, a reverse primer of SEQ ID NO:63, and a probe comprising SEQ ID NO:64; (b) a forward primer of SEQ ID NO:65, a reverse primer of SEQ ID NO:66, and a probe comprising SEQ ID NO:67; (c) a forward primer of SEQ ID NO:68, a reverse primer of SEQ ID NO:69, and a probe comprising SEQ ID NO:70; (d) a forward primer of SEQ ID NO:71, a reverse primer of SEQ ID NO:72, and a probe comprising SEQ ID NO:73; (e) a forward primer of SEQ ID NO:74, a reverse primer of SEQ ID NO:75, and a probe comprising SEQ ID NO:76; and (f) a forward primer of SEQ ID NO:77, a reverse primer
- the expression level of a biomarker is measured or determined by multi-analyte profile testing, radioimmunoassay (RIA), Western blot assay, immunofluorescent assay, enzyme immunoassay, enzyme linked immunosorbent assay (ELISA), immunoprecipitation assay, chemiluminescent assay, immunohistochemical assay, dot blot assay, or slot blot assay.
- RIA radioimmunoassay
- Western blot assay immunofluorescent assay
- enzyme immunoassay enzyme linked immunosorbent assay
- immunoprecipitation assay chemiluminescent assay
- immunohistochemical assay immunohistochemical assay
- dot blot assay dot blot assay
- slot blot assay the expression level of a biomarker is measured or determined by multi-analyte profile testing, radioimmunoassay (RIA), Western blot assay, immunofluorescent assay, enzyme immunoas
- the label is selected from the group consisting of an immunofluorescent label, a chemiluminescent label, a phosphorescent label, an enzyme label, a radiolabel, an avidin/biotin label, colloidal gold particles, colored particles, and magnetic particles.
- the invention also provides a kit comprising a container, wherein the container contains at least one reagent for specifically detecting the expression of at least one biomarker of the invention.
- the reagent is an antibody or nucleic acid probe that binds a biomarker of the invention.
- a kit comprises polynucleotides selected from the group consisting of SEQ ID NOs:62-79.
- a kit comprises (a) a forward primer of SEQ ID NO:62, a reverse primer of SEQ ID NO:63, and a probe comprising SEQ ID NO:64; (b) a forward primer of SEQ ID NO:65, a reverse primer of SEQ ID NO:66, and a probe comprising SEQ ID NO:67; (c) a forward primer of SEQ ID NO:68, a reverse primer of SEQ ID NO:69, and a probe comprising SEQ ID NO:70; (d) a forward primer of SEQ ID NO:71, a reverse primer of SEQ ID NO:72, and a probe comprising SEQ ID NO:73; (e) a forward primer of SEQ ID NO:74, a reverse primer of SEQ ID NO:75, and a probe comprising SEQ ID NO:76; and (f) a forward primer of
- the present invention encompasses not only the entire group listed as a whole, but also each member of the group individually and all possible subgroups of the main group, and also the main group absent one or more of the group members.
- the present invention also envisages the explicit exclusion of one or more of any of the group members in the claimed invention.
- FIG. 1 A- 1H Classification of responsive or non-responsive breast tumors.
- Figure 1 A Breast tumor OMP-B34 cells were injected subcutaneously into NOD/SCID mice.
- Figure IB Breast tumor OMP-B39 cells were injected subcutaneously into NOD/SCID mice.
- Figure 1C Breast tumor OMP-B44 cells were injected subcutaneously into NOD/SCID mice.
- Figure ID Breast tumor OMP- B59 cells were injected subcutaneously into NOD/SCID mice.
- Breast tumor OMP-B60 cells were injected subcutaneously into NOD/SCID mice.
- Figure IF Breast tumor UM-T01 cells were injected subcutaneously into NOD/SCID mice.
- Figure 1G Breast tumor UM-T01 cells were injected subcutaneously into NOD/SCID mice.
- FIG. 1H Breast tumor UM-T03 cells were injected subcutaneously into NOD/SCID mice.
- Figure 1H Breast tumor UM-PE13 cells were injected subcutaneously into NOD/SCID mice.
- mice were treated with OMP- 18R5 antibody (- ⁇ -), taxol (- A-), a combination of OMP-18R5 and taxol (- ⁇ -), or a control antibody (- ⁇ -).
- Data is shown as tumor volume (mm 3 ) over days post-treatment.
- Figure 5 Prediction of tumor responsiveness based upon classification probability analysis.
- T tumor used in training set for establishment of 6-gene signature.
- Figures 6A-6F In vivo validation of predictive biomarkers.
- Figure 6A Breast tumor OMP- B29 cells were injected subcutaneously into NOD/SCID mice.
- Figure 6B Breast tumor OMP-B71 cells were injected subcutaneously into NOD/SCID mice.
- Figure 6C Breast tumor OMP-B84 cells were injected subcutaneously into NOD/SCID mice.
- Figure 6D Breast tumor OMP-B90 cells were injected subcutaneously into NOD/SCID mice.
- Figure 6E Breast tumor UM-T02 cells were injected subcutaneously into NOD/SCID mice.
- Figure 6F Breast tumor UM-T02 cells were injected subcutaneously into NOD/SCID mice.
- Figure 7 Population prevalence estimation of the 6-gene biomarker signature using three public datasets.
- biomarker may include but is not limited to, nucleic acids and proteins, and variants and fragments thereof.
- a biomarker may include DNA comprising the entire or partial nucleic acid sequence encoding the biomarker, or the complement of such a sequence.
- Biomarker nucleic acids useful in the invention are considered to include both DNA and RNA comprising the entire or partial sequence of any of the nucleic acid sequences of interest.
- Biomarker proteins are considered to comprise the entire or partial amino acid sequence of any of the biomarker proteins or polypeptides.
- antibody refers to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing, through at least one antigen-binding site within the variable region of the immunoglobulin molecule.
- the term encompasses intact polyclonal antibodies, intact monoclonal antibodies, single chain antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single chain Fv (scFv) antibodies, multispecific antibodies such as bispecific antibodies, monospecific antibodies, monovalent antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen-binding site of an antibody, and any other modified immunoglobulin molecule comprising an antigen-binding site as long as the antibodies exhibit the desired biological activity.
- antibody fragments such as Fab, Fab', F(ab')2, and Fv fragments
- scFv single chain Fv antibodies
- multispecific antibodies such as bispecific antibodies, monospecific antibodies, monovalent antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen-binding site of an antibody, and any other modified immunoglobulin molecule comprising an antigen-binding site as long as the antibodies exhibit the desired biological activity.
- An antibody can be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2), based on the identity of their heavy chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively.
- the different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations.
- Antibodies can be naked or conjugated to other molecules, including but not limited to, toxins and radioisotopes.
- antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
- antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.
- Antibody fragment as used herein comprises at least one antigen-binding site or epitope-binding site.
- variable region of an antibody refers to the variable region of an antibody light chain, or the variable region of an antibody heavy chain, either alone or in combination.
- the variable region of a heavy chain or a light chain generally consists of four framework regions (FR) connected by three complementarity determining regions (CDRs), also known as “hypervariable regions”.
- FR framework regions
- CDRs complementarity determining regions
- the CDRs in each chain are held together in close proximity by the framework regions and contribute to the formation of the antigen-binding site(s) of the antibody.
- CDRs There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Edition, National Institutes of Health, Bethesda, MD), and (2) an approach based on crystallographic studies of antigen-antibody complexes (Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948). In addition, combinations of these two approaches are sometimes used in the art to determine CDRs.
- the term "monoclonal antibody” as used herein refers to a homogeneous antibody population involved in the highly specific recognition and binding of a single antigenic determinant or epitope. This is in contrast to polyclonal antibodies that typically include a mixture of different antibodies directed against a variety of different antigenic determinants.
- the term “monoclonal antibody” encompasses both intact and full-length monoclonal antibodies as well as antibody fragments (e.g., Fab, Fab', F(ab')2, Fv), single chain (scFv) antibodies, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen-binding site.
- “monoclonal antibody” refers to such antibodies made by any number of techniques, including but not limited to, hybridoma production, phage selection, recombinant expression, and transgenic animals.
- humanized antibody refers to antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non- human sequences. Methods used to generate humanized antibodies are well known in the art.
- human antibody refers to an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human.
- a human antibody may be made using any of the techniques known in the art.
- chimeric antibody refers to an antibody wherein the amino acid sequence of the immunoglobulin molecule is derived from two or more species.
- the variable regions of the light chain and the heavy chain correspond to the variable regions of an antibody derived from one species of mammals (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and/or binding capability, while the constant regions correspond to sequences from an antibody derived from another species (usually human).
- affinity-matured antibody refers to an antibody with one or more alterations in one or more CDRs thereof that result in an improvement in the affinity of the antibody for antigen, compared to a parent antibody that does not possess those alterations(s).
- the definition also includes alterations in non-CDR residues made in conjunction with alterations to CDR residues.
- Preferred affinity-matured antibodies will have nanomolar or even picomolar affinities for the target antigen.
- Affinity-matured antibodies are produced by procedures known in the art. For example, techniques may include affinity maturation by VH and VL domain shuffling, random mutagenesis of CDR and/or framework residues, and site-directed mutagenesis.
- epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids (also referred to as linear epitopes) are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding (also referred to as conformational epitopes) are typically lost upon protein denaturing.
- An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
- the terms “selectively binds” or “specifically binds” mean that a binding agent or an antibody reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to the epitope, protein, or target molecule than with alternative substances, including unrelated or related proteins.
- “specifically binds” means, for instance, that an antibody binds a protein with a K D of about 0. lmM or less, but more usually less than about 1 ⁇ .
- “specifically binds” means that an antibody binds a target at times with a K D of at least about 0.1 ⁇ or less, at other times at least about 0.01 ⁇ or less, and at other times at least about lnM or less. Because of the sequence identity between homologous proteins in different species, specific binding can include an antibody that recognizes a protein in more than one species (e.g., human FZD and mouse FZD). Likewise, because of homology within certain regions of polypeptide sequences of different proteins, specific binding can include an antibody (or other polypeptide or binding agent) that recognizes more than one protein (e.g., human FZD1 and human FZD7). It is understood that, in certain embodiments, an antibody or binding agent that specifically binds a first target may or may not specifically bind a second target. As such, “specific binding” does not necessarily require (although it can include) exclusive binding, i.e.
- a binding agent may, in certain embodiments, specifically bind more than one target.
- multiple targets may be bound by the same binding site on the agent or antibody.
- an antibody may, in certain instances, comprise two identical antigen-binding sites, each of which specifically binds the same epitope on two or more proteins.
- an antibody may be bispecific or multispecific and comprise at least two antigen-binding sites with differing specificities.
- a bispecific agent may comprise one binding site that recognizes a target on one protein (e.g., human FZD) and further comprise a second, different binding site that recognizes a different target on a second protein (e.g., a human WNT protein).
- a target on one protein e.g., human FZD
- a second protein e.g., a human WNT protein
- reference to binding means specific binding.
- polypeptide and “peptide” and “protein” are used interchangeably herein and refer to polymers of amino acids of any length.
- the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
- polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids
- the polypeptides of this invention may be based upon antibodies, in certain embodiments, the polypeptides can occur as single chains or associated chains (e.g., dimers).
- polynucleotide and “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides of any length, and include DNA and RNA.
- the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.
- Constants of high stringency may be identified by conditions that: (1) employ low ionic strength and high temperature for washing, for example 15mM sodium chloride/ 1.5mM sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1%) Ficoh70.1%> polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 in 5x SSC (0.75M NaCl, 75mM sodium citrate) at 42°C; or (3) employ during hybridization 50% formamide in 5x SSC, 50mM sodium phosphate (pH 6.8), 0.1%> sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (5( ⁇ g/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in
- nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity.
- the percent identity may be measured using sequence comparison software or algorithms or by visual inspection.
- Various algorithms and software that may be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof.
- two nucleic acids or polypeptides of the invention are substantially identical, meaning they have at least 70%, at least 75%, at least 80%>, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.
- identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 40-60 residues, at least about 60-80 residues in length or any integral value therebetween.
- identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence.
- a "conservative amino acid substitution” is one in which one amino acid residue is replaced with another amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- basic side chains
- substitution of a phenylalanine for a tyrosine is a conservative substitution.
- conservative substitutions in the sequences of the polypeptides and antibodies of the invention do not abrogate the binding of the polypeptide or antibody containing the amino acid sequence, to the antigen to which the polypeptide or antibody binds.
- Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate antigen binding are well-known in the art.
- vector means a construct, which is capable of delivering, and usually expressing, one or more gene(s) or sequence(s) of interest in a host cell.
- vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, and DNA or RNA expression vectors encapsulated in liposomes.
- soluble receptor refers to an extracellular domain (or a fragment thereof) of a receptor protein preceding the first transmembrane domain of the receptor that can be secreted from a cell in soluble form. Generally this is the N-terminal portion of the receptor protein.
- FZD soluble receptor or "soluble FZD receptor” refers to an N- terminal extracellular fragment of a FZD receptor protein preceding the first transmembrane domain of the receptor that can be secreted from a cell in soluble form. FZD soluble receptors comprising the entire N-terminal extracellular domain (ECD) as well as smaller fragments are encompassed by the term. Thus, FZD soluble receptors comprising a FZD Fri domain are also included in this term.
- a polypeptide, antibody, polynucleotide, vector, cell, or composition which is "isolated” is a polypeptide, antibody, polynucleotide, vector, cell, or composition which is in a form not found in nature.
- Isolated polypeptides, antibodies, polynucleotides, vectors, cells, or compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature.
- a polypeptide, antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure.
- substantially pure refers to material which is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.
- cancer and “cancerous” as used herein refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth.
- examples of cancer include, but are not limited to, carcinoma, blastoma, sarcoma, and hematologic cancers such as lymphoma and leukemia.
- tumor and "neoplasm” as used herein refer to any mass of tissue that results from excessive cell growth or proliferation, either benign (non-cancerous) or malignant (cancerous) including pre -cancerous lesions.
- metalastasis refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at a new location.
- a “metastatic” or “metastasizing” cell is one that loses adhesive contacts with neighboring cells and migrates (e.g., via the bloodstream or lymph) from the primary site of disease to secondary sites.
- cancer stem cell and “CSC” and “tumor stem cell” and “tumor initiating cell” are used interchangeably herein and refer to cells from a cancer or tumor that: (1) have extensive proliferative capacity; 2) are capable of asymmetric cell division to generate one or more types of differentiated cell progeny wherein the differentiated cells have reduced and/or limited proliferative or developmental potential; and (3) are capable of symmetric cell divisions for self-renewal or self- maintenance.
- CSC cancer stem cell
- tumor stem cell undergo self-renewal versus differentiation in a chaotic manner to form tumors with abnormal cell types that can change over time as mutations occur.
- cancer cell and “tumor cell” refer to the total population of cells derived from a cancer or tumor or pre -cancerous lesion, including both non-tumorigenic cells, which comprise the bulk of the cancer cell population, and tumorigenic stem cells (cancer stem cells).
- cancer stem cells tumorigenic stem cells
- tumorigenic refers to the functional features of a cancer stem cell including the properties of self-renewal (giving rise to additional tumorigenic cancer stem cells) and proliferation to generate all other tumor cells (giving rise to differentiated and thus non-tumorigenic tumor cells).
- tumorigenicity refers to the ability of a random sample of cells from the tumor to form palpable tumors upon serial transplantation into immunocompromised hosts (e.g., mice). This definition also includes enriched and/or isolated populations of cancer stem cells that form palpable tumors upon serial transplantation into immunocompromised hosts (e.g., mice).
- patient refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment.
- patient and “subject” are used interchangeably herein in reference to a human patient.
- pharmaceutically acceptable refers to a product or compound approved (or approvable) by a regulatory agency of the Federal government or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans.
- pharmaceutically acceptable excipient, carrier or adjuvant refers to an excipient, carrier, or adjuvant that can be administered to a subject, together with at least one agent (e.g., an antibody) of the present disclosure, and which does not destroy the activity of the agent.
- agent e.g., an antibody
- the excipient, carrier, or adjuvant should be non-toxic when administered with an agent in doses sufficient to deliver a therapeutic effect.
- an effective amount or “therapeutically effective amount” or “therapeutic effect” refer to an amount of a binding agent, an antibody, polypeptide, polynucleotide, small organic molecule, or other drug effective to "treat” a disease or disorder in a subject or mammal.
- the therapeutically effective amount of a drug has a therapeutic effect and as such can reduce the number of cancer cells; decrease tumorigenicity, tumorigenic frequency, or tumorigenic capacity; reduce the number or frequency of cancer stem cells; reduce the tumor size; reduce the cancer cell population; inhibit and/or stop cancer cell infiltration into peripheral organs including, for example, the spread of cancer into soft tissue and bone; inhibit and/or stop tumor or cancer cell metastasis; inhibit and/or stop tumor or cancer cell growth; relieve to some extent one or more of the symptoms associated with the cancer; reduce morbidity and mortality; improve quality of life; or a combination of such effects.
- the agent for example an antibody, prevents growth and/or kills existing cancer cells, it can be referred to as cytostatic and/or cytotoxic.
- treating or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder.
- prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder.
- a subject is successfully "treated” according to the methods of the present invention if the patient shows one or more of the following: a reduction in the number of and/or complete absence of cancer cells; a reduction in the tumor size; an inhibition of tumor growth; inhibition of and/or an absence of cancer cell infiltration into peripheral organs including the spread of cancer cells into soft tissue and bone; inhibition of and/or an absence of tumor or cancer cell metastasis; inhibition and/or an absence of cancer growth; relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; improvement in quality of life; reduction in tumorigenicity; reduction in the number or frequency of cancer stem cells; or some combination of such effects.
- identifying, classifying, and/or selecting tumors and/or patients with cancer that are likely to be responsive ("sensitive”) or non-responsive ("resistant”) to treatment with a Wnt pathway inhibitor are provided herein.
- methods for treating patients with cancer who are likely to respond to treatment are predicted to respond to treatment, and/or have been identified to respond to treatment with a Wnt pathway inhibitor.
- a method of identifying a human tumor that is likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CRBP2, WIF1 , and DKK1 ; and (c) identifying the tumor as likely to be responsive or non-responsive to treatment based upon the expression level of the biomarkers.
- a method of identifying a human tumor that is likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CRBP2, WIF1, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- a method of classifying a human tumor as likely to be responsive or non- responsive to treatment with a Wnt pathway inhibitor comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) classifying the tumor as likely to be responsive or non-responsive to treatment based upon the expression level of the biomarkers.
- a method of classifying a human tumor as likely to be responsive or non-responsive to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- a method of determining the responsiveness (or sensitivity) of a human tumor to treatment with a Wnt pathway inhibitor comprising: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the genes FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) determining the responsiveness of the tumor to treatment based upon the expression level of the biomarkers.
- a method of determining the responsiveness or sensitivity of a human tumor to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the genes FBXW2, CCND2, RHOU, CTBP2, WIF1 , and DKKl; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor.
- a method of identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor comprising: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers.
- a method of identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment with the Wnt pathway inhibitor.
- the method further comprises selecting the patient for treatment when their tumor sample has a positive decision value.
- the method further comprises administering a therapeutically effective amount of the Wnt pathway inhibitor to the patient.
- a method of selecting a patient with cancer for treatment with a Wnt pathway inhibitor comprising: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; (c) selecting the patient for treatment based upon the expression level of the biomarkers.
- a method of selecting a patient with cancer for treatment with a Wnt pathway inhibitor comprises: (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; and (d) selecting the patient for treatment when their tumor sample has a positive decision value.
- the method further comprises administering a therapeutically effective amount of the Wnt pathway inhibitor to the patient.
- a method of treating cancer in a patient comprising: (a) identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers; and (b) administering to the patient who is likely to response to treatment an effective amount of the Wnt pathway inhibitor.
- a method of treating cancer in a patient comprises: (a) identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering to the patient who is predicted to response to treatment an effective amount of the Wnt pathway inhibitor.
- the invention provides a method of treating cancer in a patient, comprising: administering an effective amount of a Wnt pathway inhibitor to the patient; wherein the patient is predicted to respond to treatment with a Wnt inhibitor based upon expression levels of a biomarker signature in a patient tumor sample, wherein the signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl .
- a method of treating cancer in a patient comprises: administering an effective amount of a Wnt pathway inhibitor to the patient; wherein the patient is predicted to respond to treatment based upon a positive decision value calculated from the weighted sum of the standardized expression of biomarkers in a biomarker signature in a patient tumor sample, wherein the set of biomarkers comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl , and DKKl .
- a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprising: (a) identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) identifying the patient who is likely to respond to treatment based upon the expression level of the biomarkers; and (b) administering an effective amount of the Wnt pathway inhibitor to the patient.
- a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprises: (a) identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering an effective amount of the Wnt pathway inhibitor to the patient whose tumor has a positive decision value.
- the invention provides a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor, comprising: administering an effective amount of a Wnt pathway inhibitor to a patient; wherein the patient is identified as likely to respond to treatment with a Wnt inhibitor based upon expression levels of a biomarker signature in a patient tumor sample, wherein the signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl .
- a method for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprises: administering an effective amount of a Wnt pathway inhibitor to a patient; wherein the patient is identified as likely to respond to treatment based upon a positive decision value calculated from the weighted sum of the standardized expression of biomarkers in a biomarker signature in a patient tumor sample, wherein the set of biomarkers comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1.
- the patient is identified as likely to respond to treatment with a Wnt pathway inhibitor in combination with paclitaxel.
- the method comprises administering to the patient the Wnt pathway inhibitor in combination with paclitaxel.
- a use for identifying a human tumor that is likely to be responsive or non- responsive to treatment with a Wnt pathway inhibitor comprises (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CRBP2, WIF1 , and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- a use for classifying a human tumor as likely to be responsive or non- responsive to treatment with a Wnt pathway inhibitor comprises (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor and a negative decision value indicates the tumor is predicted to be non-responsive to the Wnt pathway inhibitor.
- a use for determining the sensitivity of a human tumor to treatment with a Wnt pathway inhibitor comprises (a) obtaining a sample of the human tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the genes FBXW2, CCND2, RHOU, CTBP2, WIF 1 , and DKK1; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the tumor is predicted to be responsive to the Wnt pathway inhibitor.
- a use for identifying a patient with cancer who is likely to respond to treatment with a Wnt pathway inhibitor comprises (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment with the Wnt pathway inhibitor.
- the use further comprises selecting the patient for treatment when their tumor sample has a positive decision value.
- the use further comprises administering a therapeutically effective amount of the Wnt pathway inhibitor to the patient.
- a use for selecting a patient with cancer for treatment with a Wnt pathway inhibitor comprises (a) obtaining a sample of the patient's tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; and (d) selecting the patient for treatment when their tumor sample has a positive decision value.
- the use further comprises administering a therapeutically effective amount of the Wnt pathway inhibitor to the patient.
- a Wnt pathway inhibitor for use in treating cancer in a patient, the use comprising: (a) identifying if the patient is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering to the patient who is predicted to response to treatment an effective amount of the Wnt pathway inhibitor.
- a use for increasing the likelihood of effective treatment with a Wnt pathway inhibitor comprising: (a) identifying if a patient has a tumor that is likely to respond to treatment with a Wnt pathway inhibitor, wherein the identification comprises: (i) obtaining a sample of the patient's cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering an effective amount of the Wnt pathway inhibitor to the patient whose tumor has a positive decision value.
- a Wnt pathway inhibitor for use in treating cancer in a patient identified to likely to respond to treatment with a Wnt pathway inhibitor wherein the identification of the patient comprises: (i) measuring the expression level of each biomarker of a biomarker signature in the cancer sample obtained from the patient, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl; and (ii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment.
- a Wnt pathway inhibitor for use in treating cancer in a patient, wherein the patient is one for whom a positive decision value is calculated based upon the standardized expression of each biomarker of the biomarker signature in a cancer sample of the patient, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature comprises two or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl . In some embodiments, the biomarker signature comprises three or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl . In some embodiments, the biomarker signature comprises four or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl . In some
- the biomarker signature comprises five or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature comprises FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature consists of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature comprises one or more additional biomarkers, in addition to at least one of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl.
- the biomarker signature comprises one or more additional biomarkers selected from the genes listed in Table 2, in addition to at least one of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature comprises one or more of the biomarkers EP300, CTBP1, WNT6, WNT9A, SNT3, FZD2, FZD7, APC, TLE2, DVL2, PITX2, WISP1, GSK3B, and LEF1, in addition to at least one of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl .
- the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, DKKl, EP300, and CTBP1.
- the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, DKKl, EP300, CTBP1, WNT6, WNT3, FZD2, APC, TLE2, DVL2, PITX2, WISP1, GSK3B, WNT9A, FZD7, and LEF1.
- the biomarker signature comprises FBXW2. In some embodiments, the biomarker signature comprises CCND2. In some embodiments, the biomarker signature comprises RHOU. In some embodiments, the biomarker signature comprises CTBP2. In some embodiments, the biomarker signature comprises WIF1. In some embodiments, the biomarker signature comprises DKKl .
- the biomarker signature comprises FBXW2 and CCND2. In some embodiments, the biomarker signature comprises FBXW2 and RHOU. In some embodiments, the biomarker signature comprises FBXW2 and CTBP2. In some embodiments, the biomarker signature comprises FBXW2 and WIF1. In some embodiments, the biomarker signature comprises FBXW2 and DKKl . In some embodiments, the biomarker signature comprises CCND2 and RHOU. In some embodiments, the biomarker signature comprises CCND2 and CTBP2. In some embodiments, the biomarker signature comprises CCND2 and WIFl .
- the biomarker signature comprises CCND2 and DKKl . In some embodiments, the biomarker signature comprises RHOU and CTBP2. In some embodiments, the biomarker signature comprises RHOU and WIF 1. In some embodiments, the biomarker signature comprises RHOU and DKKl . In some embodiments, the biomarker signature comprises CTBP2 and WIFl . In some embodiments, the biomarker signature comprises CTBP2 and DKKl. In some embodiments, the biomarker signature comprises WIF 1 and DKKl .
- the biomarker signature comprises FBXW2, CCND2, and RHOU. In some embodiments, the biomarker signature comprises FBXW2, CCND2, and CTBP2. In some embodiments, the biomarker signature comprises FBXW2, CCND2, and WIFl . In some embodiments, the biomarker signature comprises FBXW2, CCND2, and DKKl . In some embodiments, the biomarker signature comprises FBXW2, RHOU, and CTBP2. In some embodiments, the biomarker signature comprises FBXW2, RHOU, and WIFl . In some embodiments, the biomarker signature comprises FBXW2, RHOU, and DKKl .
- the biomarker signature comprises FBXW2, CTBP2, and WIFl . In some embodiments, the biomarker signature comprises FBXW2, CTBP2, and DKKl . In some embodiments, the biomarker signature comprises FBXW2, WIFl, and DKKl . In some embodiments, the biomarker signature comprises CCND2, RHOU, and CTBP2. In some embodiments, the biomarker signature comprises CCND2, RHOU, and WIFl . In some embodiments, the biomarker signature comprises CCND2, RHOU, and DKKl . In some embodiments, the biomarker signature comprises CCND2, CTBP2, and WIFl .
- the biomarker signature comprises CCND2, CTBP2, and DKKl . In some embodiments, the biomarker signature comprises CCND2, WIFl , and DKKl . In some embodiments, the biomarker signature comprises RHOU, CTBP2, and WIFl . In some embodiments, the biomarker signature comprises RHOU, CTBP2, and DKKl . In some embodiments, the biomarker signature comprises RHOU, WIFl, and DKKl . In some embodiments, the biomarker signature comprises CTBP2, WIFl, and DKKl .
- the biomarker signature comprises FBXW2, CCND2, RHOU, and CTBP2. In some embodiments, the biomarker signature comprises FBXW2, CCND2, RHOU, and WIFl . In some embodiments, the biomarker signature comprises FBXW2, CCND2, RHOU, and DKKl . In some embodiments, the biomarker signature comprises FBXW2, RHOU, CTBP2, and WIFl . In some embodiments, the biomarker signature comprises FBXW2, RHOU, CTBP2, and DKKl . In some embodiments, the biomarker signature comprises FBXW2, CTBP2, WIFl, and DKKl .
- the biomarker signature comprises CCND2, RHOU, CTBP2, and WIFl. In some embodiments, the biomarker signature comprises CCND2, RHOU, CTBP2, and DKKl. In some embodiments, the biomarker signature comprises CCND2, CTBP2, WIFl, and DKKl . In some embodiments, the biomarker signature comprises RHOU, CTBP2, WIFl, and DKKl . In some embodiments, any of these signatures may comprise one or more additional biomarkers.
- the biomarker signature comprises FBXW2, CCND2, RHOU, CTBP2, and WIFl .
- the biomarker signature comprises FBXW2, CCND2, RHOU, CTBP2, and DKKl .
- the biomarker signature comprises FBXW2, CCND2, CTBP2, WIFl, and DKKl .
- the biomarker signature comprises FBXW2, CCND2, RHOU, WIFl, and DKKl .
- the biomarker signature comprises FBXW2, RHOU, CTBP2, WIFl, and DKKl .
- the biomarker signature comprises CCND2, RHOU, CTBP2, WIFl, and DKKl .
- the biomarker signature comprises CCND2, RHOU, CTBP2, WIFl, and DKKl .
- the sample includes, but is not limited to, any clinically relevant tissue sample, such as a tumor biopsy, a core biopsy tissue sample, a fine needle aspirate, a hair follicle, or a sample of bodily fluid, such as blood, plasma, serum, lymph, ascitic fluid, cystic fluid, or urine.
- the sample is taken from a patient having a tumor or cancer.
- the sample is a primary tumor.
- the sample is a metastasis.
- the sample may be taken from a human, or from non-human mammals such as, mice, rats, non-human primates, canines, felines, ruminants, swine, or sheep.
- samples are taken from a subject at multiple time points, for example, before treatment, during treatment, and/or after treatment.
- samples are taken from different locations in the subject, for example, a sample from a primary tumor and a sample from a metastasis in a distant location.
- the sample is a paraffin-embedded fixed tissue sample.
- the sample is a formalin-fixed paraffin embedded (FFPE) tissue sample.
- the sample is a fresh tissue (e.g., tumor) sample.
- the sample is a frozen tissue sample.
- the sample is a fresh frozen (FF) tissue (e.g., tumor) sample.
- the sample is a cell isolated from a fluid.
- the sample comprises circulating tumor cells (CTCs).
- the sample is an archival tissue sample.
- the sample is an archival tissue sample with known diagnosis, treatment, and/or outcome history.
- the sample is a block of tissue. In some embodiments, the sample is dispersed cells. In some embodiments, the sample size is from about 1 cell to about 1 x 10 6 cells or more. In some embodiments, the sample size is about 10 cells to about 1 x 10 5 cells. In some embodiments, the sample size is about 10 cells to about 10,000 cells. In some embodiments, the sample size is about 10 cells to about 1,000 cells. In some embodiments, the sample size is about 10 cells to about 100 cells. In some embodiments, the sample size is about 1 cell to about 10 cells. In some embodiments, the sample size is a single cell.
- the sample is processed to DNA or RNA.
- RNA is isolated from the sample.
- mRNA is isolated from the sample.
- RNA is isolated from cells by procedures that involve cell lysis and denaturation of the proteins contained therein.
- DNase is added to remove DNA.
- RNase inhibitors are added to the lysis buffer.
- a protein denaturation/digestion step is added to the protocol. Methods for preparing total and mRNA are well known in the art and RNA isolation kits are commercially available (e.g., RNeasy mini kit, Qiagen, USA).
- the RNA is amplified by PCR-based techniques.
- Determination of biomarker expression levels may be performed by any suitable method including, but are not limited to, methods based on analyses of polynucleotide expression, sequencing of polynucleotides, and/or analyses of protein expression.
- determination of biomarker expression levels may be performed by detecting the expression of mRNA expressed from the genes of interest, and/or by detecting the expression of a polypeptide encoded by the genes.
- RNAse protection assays include Southern blot analysis, Northern blot analysis, and in situ hybridization, RNAse protection assays, and polymerase chain reaction (PCR)-based methods, such as reverse transcription polymerase chain reaction (RT-PCR), quantitative PCR (qPCR) as known as real-time PCR, TaqManTM, TaqManTM low density array (TLDA), anchored PCR, competitive PCR, rapid amplification of cDNA ends (RACE), and microarray analyses.
- RT-PCR is a quantitative method that can be used to compare mRNA levels in different samples to examine gene expression profiles.
- RT-PCR is real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (e.g., TaqManTM probe).
- dual-labeled fluorigenic probe e.g., TaqManTM probe.
- PCR-based techniques including but not limited to, differential display, amplified fragment length polymorphism, BeadArrayTM technology, high coverage expression profiling (HiCEP) and digital PCR.
- SAGE Serial Analysis of Gene Expression
- MPSS Massively Parallel Signature Sequencing
- NexGen sequencing analysis including mRNA sequencing.
- the biomarker expression is determined using a qPCR assay.
- total RNA is extracted from a fresh frozen (FF) tissue sample or total RNA is extracted from a macro-dissected formalin-fixed paraffin embedded (FFPE) tissue sample.
- FFPE formalin-fixed paraffin embedded
- the quantity and quality of the total RNA is assessed by standard spectrophotometry and/or any other appropriate method (e.g., an Agilent Bioanalyzer).
- the RNA sample is reverse transcribed using standard methods and/or a commercially available cDNA synthesis kit (e.g., Roche Transcriptor First Strand cDNA synthesis kit).
- the resultant cDNA is pre-amplified using, for example, an ABI pre- amplification kit.
- Biomarker(s) e.g., FBXW2, CCND2, RHOU, CTBP2, WIF1 , and/or DKK1
- a Roche Lightcycler 480 system e.g., Roche Diagnostics
- ABI TaqMan Gene Expression Mastermix e.g., Roche Lightcycler 480 system
- qPCR reactions are performed in triplicate.
- RT-neg control reverse transcription
- control samples run without template.
- a universal human reference RNA sample is included on each plate to act as a positive control.
- Suitable reference genes are identified from a standard panel of reference genes. Candidate reference genes are selected with different cellular functions to eliminate risk of co-regulation.
- the most suitable reference genes are evaluated and selected using specific software and algorithms (e.g., Genex software; GeNorm and Normfinder algorithms).
- the expression level of each biomarker is normalized using the selected optimum reference genes. In some embodiments, these normalized (or standardized) expression values for each biomarker are used to calculate the decision value of the sample. In some embodiments, these normalized (or standardized) expression values for each biomarker are used to calculate an expression level.
- biomarker expression is determined using a PCR-based assay comprising specific primers and/or probes for each biomarker (e.g., FBXW2, CCND2, RHOU, CTBP2, WIF1, and/or DKK1).
- probe refers to any molecule that is capable of selectively binding a specifically intended target biomolecule. Probes can be synthesized by one of skill in the art using known techniques, or derived from biological preparations. Probes may include but are not limited to, RNA, DNA, proteins, peptides, aptamers, antibodies, and organic molecules.
- probe encompasses oligonucleotides that have a sequence of a specific SEQ ID NO or oligonucleotides that have a sequence complementary to a specific SEQ ID NO.
- the probe is modified.
- the probe is modified with a quencher.
- the probe is labeled. Labels can include, but are not limited to, colorimetric, fluorescent, chemiluminescent, or bioluminescent labels.
- biomarker expression of each biomarker is determined using a specific primer set and probe.
- a specific primer set consists of a forward primer and a reverse primer.
- CCND2 expression is determined using a polynucleotide comprising the sequence of GCTGTCTCTGATCCGCAAGC (SEQ ID NO: 62), a polynucleotide comprising the sequence of GACGGTGGGTACATGGCAAAC (SEQ ID NO: 63), and a
- CCND2 expression is determined using a forward primer of sequence GCTGTCTCTGATCCGCAAGC (SEQ ID NO:62) and a reverse primer of sequence GACGGTGGGTACATGGCAAAC (SEQ ID NO:63). In some embodiments, CCND2 expression is determined using a probe of sequence CCTTCATTGCTCTGTGTGCCACCGAC (SEQ ID NO:64).
- CTBP2 expression is determined using isolated a polynucleotide comprising the sequence of ATCCGTGGGGAGACGCTG (SEQ ID NO: 65), a polynucleotide comprising the sequence of CTCGAACTGCAACCGCCTG (SEQ ID NO:66), and a polynucleotide comprising the sequence of CCCGTGCGACCAAAGCCAATGAGG (SEQ ID NO:67), or complements thereof.
- CTBP2 expression is determined using a forward primer of sequence ATCCGTGGGGAGACGCTG (SEQ ID NO:65) and a reverse primer of sequence of CTCGAACTGCAACCGCCTG (SEQ ID NO:66).
- CTBP2 expression is determined using a probe of sequence CCCGTGCGACCAAAGCCAATGAGG (SEQ ID NO:67).
- DKK1 expression is determined using isolated a polynucleotide comprising the sequence of GACCATTGACAACTACCAGCCGTA (SEQ ID NO:68), a
- DKK1 expression is determined using a forward primer of sequence GACCATTGACAACTACCAGCCGTA (SEQ ID NO:68) and a reverse primer of sequence of TGGGACTAGCGCAGTACTCATC (SEQ ID NO:69). In some embodiments, DKK1 expression is determined using a probe of sequence TGCCGCACTCCTCGTCCTCTG (SEQ ID NO:70).
- FBXW2 expression is determined using a polynucleotide comprising the sequence of GCCAGTTATGATATTCTCAGGGTCA (SEQ ID NO:71), a polynucleotide comprising the sequence of AGCAGGGCAAAGATATCTCCAAA (SEQ ID NO:72), and a polynucleotide comprising the sequence of AGACTCCTGAGATAGCAAACTTGGCCT (SEQ ID NO: 73), or complements thereof.
- FBXW2 expression is determined using a forward primer of sequence GCCAGTTATGATATTCTCAGGGTCA (SEQ ID NO:71) and a reverse primer of sequence AGCAGGGCAAAGATATCTCCAAA (SEQ ID NO:72). In some embodiments, FBXW2 expression is determined using a probe of sequence
- RHOUl expression is determined using a polynucleotide comprising the sequence of CCCACCGAGTACATCCCTACTG (SEQ ID NO:74), a polynucleotide comprising the sequence of CAGTGTCACAGAGTTGGAGTCTCA (SEQ ID NO:75), and a polynucleotide comprising the sequence of CGCCCATCCACAGACACCACCG (SEQ ID NO:76), or complements thereof.
- RHOUl expression is determined using a forward primer of sequence CCCACCGAGTACATCCCTACTG (SEQ ID NO:74) and a reverse primer of sequence
- RHOUl expression is determined using a probe of sequence CGCCCATCCACAGACACCACCG (SEQ ID NO:76).
- WIF1 expression is determined using a polynucleotide comprising the sequence of GTTCCAAAGGTTACCAGGGAGAC (SEQ ID NO:77), a polynucleotide comprising the sequence of GTTGGGTTCATGGCAGGTTCC (SEQ ID NO:78), and a polynucleotide comprising the sequence of CCAGGCTCGCAGACAGGCTTTGAAC (SEQ ID NO:79), or complements thereof.
- WIF1 expression is determined using a forward primer of sequence GTTCCAAAGGTTACCAGGGAGAC (SEQ ID NO:77) and a reverse primer of sequence GTTGGGTTCATGGCAGGTTCC (SEQ ID NO:78).
- WIF1 expression is determined using a probe of sequence CCAGGCTCGCAGACAGGCTTTGAAC (SEQ ID NO:79).
- the expression levels of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 are measured using polynucleotides selected from the group consisting of SEQ ID NOs:62-79.
- the expression levels of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 are measured using (a) a forward primer of SEQ ID NO:62, a reverse primer of SEQ ID NO:63, and a probe comprising SEQ ID NO:64; (b) a forward primer of SEQ ID NO:65, a reverse primer of SEQ ID NO:66, and a probe comprising SEQ ID NO:67; (c) a forward primer of SEQ ID NO:68, a reverse primer of SEQ ID NO:69, and a probe comprising SEQ ID NO:70; (d) a forward primer of SEQ ID NO:71, a reverse primer of SEQ ID NO:72, and a probe comprising SEQ ID NO:73; (e) a forward primer of SEQ ID NO:74, a reverse primer of SEQ ID NO:75, and a probe comprising SEQ ID NO:76; and (f) a forward primer of SEQ ID NO:
- the expression level of each biomarker is determined in a separate assay (e.g., 6 assays).
- the reference gene(s) and normalization methods for each assay are the same for all 6 assays.
- the expression levels of several biomarkers are detected in a single multiplex assay.
- biomarker expression levels may be determined by amplifying complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA and analyzing it using a microarray.
- cDNA complementary DNA
- cRNA complementary RNA
- microarray technology allows for simultaneous analysis of the expression of thousands of genes. A number of different array configurations and methods for their production are known to those skilled in the art.
- microarrays are commercially available (e.g., Affymetrix GeneChips) or can be custom-produced.
- Microarrays currently in wide use include cDNA arrays and oligonucleotide arrays.
- polynucleotides of interest e.g., probes or probe sets
- probes to at least 10, 25, 50, 100, 500, 1000, 5000, 10,000, 20,000, or 25,000 or more genes are immobilized on an array substrate.
- the substrate may be a porous or nonporous support, such as a glass, plastic or gel surface.
- the probes can include DNA, RNA, copolymer sequences of DNA and RNA, DNA and/or RNA analogues, or combinations thereof.
- a microarray includes a support with an ordered array of binding sites for each individual gene.
- the microarrays can be addressable arrays or positionally addressable arrays, e.g., each probe of the array is located at a known, predetermined position on the solid support such that the identity of each probe can be determined from its position of the array.
- Each probe on the microarray can be between 10-50,000 nucleotides in length.
- the probes of the microarray can consist of nucleotide sequences with lengths of less than about 1,000 nucleotides, less than about 750 nucleotides, less than about 500 nucleotides, less than about 250 nucleotides, less than about 100 nucleotides, or less than about 50 nucleotides in length.
- an array includes positive control probes and negative control probes.
- the biomarker expression is determined using a microarray.
- RNA is extracted from a fresh frozen (FF) tissue sample or total RNA is extracted from a macro-dissected formalin-fixed paraffin embedded (FFPE) tissue sample.
- FFPE formalin-fixed paraffin embedded
- the quantity and quality of the total RNA is assessed by standard spectrophotometry and/or any other appropriate technology (e.g., an Agilent Bioanalyzer).
- the RNA sample is amplified using standard methods and/or a commercially available amplification system (e.g., NuGEN Ovation RNA Amplification System V2).
- the amplified cDNA is fragmented, labeled, and hybridized to a microarray (e.g., using NuGEN Encore Biotin Module and Affymetrix GeneChip array) following standard procedures.
- the array is washed, stained, and scanned in accordance with the instructions for the microarray.
- the microarray data is pre-processed, the probe-level intensity measurements are background corrected, normalized, and summarized as expression measurements using the Robust Multichip algorithm (RMA).
- the probe level data is summarized to get the expression level of each biomarker (e.g., FBXW2, CCND2, RHOU, CTBP2, WIFl, and/or DKKl).
- a combination of quality parameter threshold and data reduction techniques e.g., principal component analysis
- These normalized (or standardized) expression values for each biomarker are used to calculate the decision value of the sample.
- biomarker expression is analyzed by studying the protein expression of the gene or genes of interest.
- Commonly used methods for the analysis of protein expression include but are not limited to, immunohistochemistry (IHC)-based, antibody-based, and mass spectrometry-based methods.
- Antibodies generally monoclonal antibodies, may be used to detect expression of a gene product (e.g., protein).
- the antibodies can be detected by direct labeling of the antibodies themselves.
- an unlabeled primary antibody is used in conjunction with a labeled secondary antibody. Immunohistochemistry methods and/or kits are well known in the art and are commercially available.
- biomarker expression is determined by an assay known to those of skill in the art, including but not limited to, multi-analyte profile test, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, Western blot assay, immunofluorescent assay, enzyme immunoassay, immunoprecipitation assay, chemiluminescent assay, immunohistochemical assay, dot blot assay or slot blot assay.
- an antibody is used in the assay the antibody is detectably labeled.
- the antibody labels may include, but are not limited to,
- immunofluorescent label chemiluminescent label, phosphorescent label, enzyme label, radiolabel, avidin/biotin, colloidal gold particles, colored particles and magnetic particles.
- a proteomic method comprises the following steps: (1) separation of individual proteins in a sample by 2-D electrophoresis (2-D PAGE), (2) identification of individual proteins recovered from the gel (e.g., by mass spectrometry or N-terminal sequencing), and (3) analysis of the data using bioinformatics.
- a proteomic method comprises using a tissue microarray (TMA). Tissue arrays may be constructed according to a variety of techniques known to one of skill in the art.
- a manual tissue arrayer is used to remove a "core" from a paraffin block prepared from a tissue sample. The core is then inserted into a separate paraffin block in a designated location on a grid. Cores from as many as about 400 samples can be inserted into a single recipient block. The resulting tissue array may be processed into thin sections for analysis.
- a proteomic method comprises an antibody microarray.
- a proteomic method comprises using mass spectrometry, including but not limited to, SELDI, MALDI, electro spray, and surface plasmon resonance methods.
- a proteomic method comprises bead-based technology, including but not limited to, antibodies on beads in an array format.
- the proteomic method comprises a reverse phase protein microarray (RPPM).
- the proteomic method comprises multiplexed protein profiling, including but not limited to, the Global Proteome Survey (GPS) method.
- GPS Global Proteome Survey
- the biomarker signature is identified by differential gene expression between two samples. In some embodiments, the biomarker signature is identified by differential gene expression between two samples which comprise genes differentially expressed in cancer cells as compared to normal cells. In some embodiments, the biomarker signature comprises genes differentially expressed in tumorigenic cancer stem cells as compared to non-tumorigenic cancer cells. In some embodiments, the biomarker signature comprises genes differentially expressed in cells from a tumor which is responsive to a specific treatment as compared to cells from a tumor which is non- responsive to the same treatment.
- expression profiles are determined using microarray analysis.
- the microarray data identifies gene profiles comprising similarly and differentially expressed genes between two samples.
- the expression profiles are refined, filtered, and/or subdivided into biomarker signatures based on fold expression change.
- all genes above a certain fold expression change are included in the biomarker signature.
- the fold expression change may be elevated, reduced or both elevated and reduced.
- all genes with a 2-fold or more expression change are included in the biomarker signature.
- all genes with a 2.5-fold or more expression change are included in the biomarker signature.
- all genes with a 3-fold or more expression change are included in the biomarker signature.
- all genes with a 3.5-fold or more expression change are included in the biomarker signature.
- all genes with a 4-fold or more expression change are included in the biomarker signature.
- the gene expression profiles are refined, filtered, and/or subdivided into biomarker signatures based on statistical analyses.
- the statistical methods may include, but are not limited to, cluster analysis, supported vector machines (SVM) analysis, supported vector machines - recursive feature elimination (SVM-RFE) analysis, Piatt scaling, neural networks, and other algorithms.
- the gene expression profiles are analyzed using a t-test analysis.
- the gene expression profiles are analyzed using paired-sample empirical Baysian analysis.
- a combination of statistical analyses is used.
- SVM models are used to obtain decision values based on the training data.
- the decision values are calculated by a weighted sum of the standardized expression of a set of biomarkers.
- a positive decision value indicates a tumor predicted to be a responder while a negative decision value indicates a tumor predicted to be a non-responder.
- classification probabilities for responders and non-responders are obtained using Piatt scaling (Piatt, 1999, Advances in Large Margin Classifiers, pp. 61-74, MIT Press). Piatt scaling may comprise fitting a logistic distribution using maximum likelihood to decision values obtained, for example, by SVM models.
- tumors associated with probabilities higher than 0.5 would be predicted to be a responder while tumors with probabilities lower than 0.5 would be predicted to be a non-responder.
- classification probabilities of a tumor are obtained based on the decision values.
- the probabilities are obtained by fitting a logistic regression on the decision values.
- tumors associated with probabilities higher than 0.5 are predicted to be a responder while tumors with probabilities lower than 0.5 are predicted to be a non-responder.
- a biomarker signature is obtained by a series of analytical steps. For example, expression data from a training set of samples are obtained from microarray analyses. The data are preprocessed to get an expression matrix with specific genes. Genes with near zero variance are removed, as are genes with expression values below a pre-determined level. The remaining genes are ranked using SVM-RFE analysis. Leave-one-out cross-validation (LOOCV) methods are used to identify and select the best predictive genes and also to measure positive predictive value (PPV), negative predictive value (NPV), sensitivity, and specificity.
- LOOCV Leave-one-out cross-validation
- all genes with elevated expression, reduced expression, or both, with a P value across samples of 0.01 or less are included in the biomarker signature. In some embodiments, all genes with elevated expression, reduced expression or both, with a P value across samples of 0.005 or less are included in the biomarker signature. In some embodiments, all genes with elevated expression, reduced expression or both, with a P value across samples of 0.001 or less are included in the biomarker signature. In some embodiments, all genes with elevated expression, reduced expression or both, with a FDR (False Discovery Rate) of 0.25 or less are included in the biomarker signature.
- FDR Fe Discovery Rate
- all genes with elevated expression, reduced expression or both, with a FDR of 0.1 or less, 0.01 or less, or 0.001 or less are included in the biomarker signature.
- the gene expression profiles and/or biomarker signatures are refined, filtered, and/or subdivided based on statistical models. In some embodiments, the gene expression profiles and/or biomarker signatures are refined, filtered, and/or subdivided based on survival analysis models.
- These models may include, but are not limited to, Kaplan-Meier survival models, Cox proportional models, Cox proportional hazard models, chi-square analysis, univariate logistic regression models, multivariate competing risk models, linear discriminate analysis models, parametric regression models and correlation analysis models.
- the gene expression profiles and/or biomarker signatures are refined, filtered, subdivided and/or tested using gene expression array datasets that have associated clinical outcomes.
- gene expression array datasets that have associated clinical outcomes.
- GEO Gene Expression Omnibus
- ArrayExpress ArrayExpress
- the gene expression profiles and/or biomarker signatures are refined using biological function parameters, and/or gene sets.
- gene expression profiles, and/or biomarker signatures are refined using Gene Set Enrichment Analysis (GSEA) (Subramanian et al., 2005, PNAS, 102: 15545-15550).
- GSEA Gene Set Enrichment Analysis
- the gene expression profiles are refined based on their ability to predict clinical outcome.
- the Wnt pathway inhibitor is an anti-FZD antibody as described herein.
- the Wnt pathway inhibitor is an antibody that specifically binds at least one Frizzled (FZD) protein or portion thereof.
- the anti-FZD antibody specifically binds at least one FZD protein selected from the group consisting of: FZD1, FZD2, FZD5, FZD7, and FZD8.
- the anti-FZD antibody comprises: (a) a heavy chain CDR1 comprising GFTFSHYTLS (SEQ ID NO: l), a heavy chain CDR2 comprising VISGDGSYTYYADSVKG (SEQ ID NO:2), and a heavy chain CDR3 comprising NFIKYVFAN (SEQ ID NO:3), and (b) a light chain CDR1 comprising SGDNIGSFYVH (SEQ ID NO:4), a light chain CDR2 comprising DKSNRPSG (SEQ ID NO:5), and a light chain CDR3 comprising QSYANTLSL (SEQ ID NO:6).
- the anti-FZD antibody comprises a heavy chain variable region comprising the amino acids of SEQ ID NO:7. In some embodiments, the anti-FZD antibody comprises a light chain variable region comprising the amino acids of SEQ ID NO:8. In some embodiments, the anti-FZD antibody comprises a heavy chain variable region comprising the amino acids of SEQ ID NO:7 and a light chain variable region comprising the amino acids of SEQ ID NO:8. In some embodiments, the anti- FZD antibody is antibody OMP-18R5. In some embodiments, the anti-FZD antibody is encoded by the plasmid having ATCC deposit no. PTA-9541. In other embodiments, the anti-FZD antibody competes for specific binding to at least one human FZD protein with an antibody encoded by the plasmid deposited with ATCC having deposit no. PTA-9541.
- the tumor is selected from the group consisting of a breast tumor, lung tumor, a colon tumor, glioma, a gastrointestinal tumor, a renal tumor, an ovarian tumor, a liver tumor, a colorectal tumor, an endometrial tumor, a kidney tumor, a prostate tumor, a thyroid tumor, a neuroblastoma, a pancreatic tumor, a glioblastoma multiforme, a cervical tumor, a stomach tumor, a bladder tumor, a hepatoma, melanoma, and a head and neck tumor.
- the tumor is a breast tumor.
- the tumor is a HER2- negative breast tumor.
- the tumor is a triple negative breast cancer (TNBC) tumor.
- TNBC triple negative breast cancer
- the cancer is selected from the group consisting of a breast cancer, lung cancer, a colon cancer, glioma, a gastrointestinal cancer, a renal cancer, an ovarian cancer, a liver cancer, a colorectal cancer, an endometrial cancer, a kidney cancer, a prostate cancer, a thyroid cancer, a neuroblastoma, a pancreatic cancer, a glioblastoma multiforme, a cervical cancer, a stomach cancer, a bladder cancer, a hepatoma, melanoma, and a head and neck cancer.
- the cancer is breast cancer.
- the cancer is a HER2 -negative breast cancer.
- the cancer is a triple negative breast cancer (TNBC).
- the method comprises treating a patient with a Wnt pathway inhibitor described herein (e.g., an anti-FZD antibody), particularly after the patient has been identified as being responsive to treatment with the Wnt pathway inhibitor.
- the treatment comprises administering at least one additional therapeutic agent in combination with the Wnt pathway inhibitor.
- An additional therapeutic agent can be administered prior to, concurrently with, and/or subsequently to, administration of the Wnt pathway inhibitor.
- the at least one additional therapeutic agent comprises 1, 2, 3, or more additional therapeutic agents.
- Useful classes of therapeutic agents include, for example, antitubulin agents, auristatins, DNA minor groove binders, DNA replication inhibitors, alkylating agents (e.g., platinum complexes such as cisplatin, mono(platinum), bis(platinum) and tri-nuclear platinum complexes and carboplatin), anthracyclines, antibiotics, antifolates, antimetabolites, chemotherapy sensitizers, duocarmycins, etoposides, fluorinated pyrimidines, ionophores, lexitropsins, nitrosoureas, platinols, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes, topoisomerase inhibitors, vinca alkaloids, or the like.
- the second therapeutic agent is an alkylating agent, an antimetabolite, an antimitotic, a topoisomerase inhibitor, or an angiogenesis inhibitor.
- Therapeutic agents that may be administered in combination with the Wnt pathway inhibitors include chemotherapeutic agents.
- the method or treatment involves the administration of a Wnt pathway inhibitor of the present invention in combination with a
- chemotherapeutic agent or cocktail of multiple different chemotherapeutic agents.
- Treatment with a Wnt pathway inhibitor e.g, an anti-FZD antibody
- Combined administration can include coadministration, either in a single pharmaceutical formulation or using separate formulations, or consecutive administration in either order but generally within a time period such that all active agents can exert their biological activities simultaneously.
- Preparation and dosing schedules for such chemotherapeutic agents can be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in The Chemotherapy Source Book, 4th Edition, 2008, M. C. Perry, Editor, Lippincott, Williams & Wilkins, Philadelphia, PA.
- Chemotherapeutic agents useful in the instant invention include, but are not limited to, alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamime; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil
- aldophosphamide glycoside aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK; razoxane; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol;
- paclitaxel TAXOL
- docetaxel TXOTERE
- chlorambucil gemcitabine
- 6- thioguanine mercaptopurine
- platinum analogs such as cisplatin and carboplatin
- vinblastine vinblastine
- navelbine novantrone; teniposide; daunomycin; aminopterin; ibandronate; CPT1 1; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoic acid; esperamicins; capecitabine (XELODA); and pharmaceutically acceptable salts, acids or derivatives of any of the above.
- DMFO difluoromethylornithine
- XELODA capecitabine
- Chemotherapeutic agents also include anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY1 17018, onapristone, and toremifene (FARESTON); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
- the additional therapeutic agent is paclitaxel (taxol).
- the chemotherapeutic agent is a topoisomerase inhibitor.
- Topoisomerase inhibitors are chemotherapy agents that interfere with the action of a topoisomerase enzyme (e.g., topoisomerase I or II).
- Topoisomerase inhibitors include, but are not limited to, doxorubicin HC1, daunorubicin citrate, mitoxantrone HC1, actinomycin D, etoposide, topotecan HC1, teniposide (VM-26), and irinotecan, as well as pharmaceutically acceptable salts, acids, or derivatives of any of these.
- the chemotherapeutic agent is an anti-metabolite.
- An anti-metabolite is a chemical with a structure that is similar to a metabolite required for normal biochemical reactions, yet different enough to interfere with one or more normal functions of cells, such as cell division.
- Anti-metabolites include, but are not limited to, gemcitabine, fluorouracil, capecitabine, methotrexate sodium, ralitrexed, pemetrexed, tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6- mercaptopurine, azathioprine, 6-thioguanine, pentostatin, fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable salts, acids, or derivatives of any of these.
- the chemotherapeutic agent is an antimitotic agent, including, but not limited to, agents that bind tubulin.
- the agent is a taxane.
- the agent is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel.
- the agent is paclitaxel (TAXOL), docetaxel (TAXOTERE), albumin-bound paclitaxel (nab-paclitaxel; ABRAXANE), DHA-paclitaxel, or PG-paclitaxel.
- the antimitotic agent comprises a vinca alkaloid, such as vincristine, binblastine, vinorelbine, or vindesine, or pharmaceutically acceptable salts, acids, or derivatives thereof.
- the antimitotic agent is an inhibitor of kinesin Eg5 or an inhibitor of a mitotic kinase such as Aurora A or Plkl .
- the chemotherapeutic agent administered in combination with a Wnt pathway inhibitor is an anti-mitotic agent
- the cancer or tumor being treated is breast cancer or a breast tumor.
- the additional therapeutic agent is paclitaxel (taxol) or albumin-bound paclitaxel.
- an additional therapeutic agent comprises an agent such as a small molecule.
- treatment can involve the combined administration of a Wnt pathway inhibitor of the present invention with a small molecule that acts as an inhibitor against additional tumor-associated antigens including, but not limited to, EGFR, ErbB2, HER2, and/or VEGF.
- the additional therapeutic agent is a small molecule that inhibits a cancer stem cell pathway.
- the additional therapeutic agent is an inhibitor of the Notch pathway.
- the additional therapeutic agent is an inhibitor of the Wnt pathway.
- the additional therapeutic agent is an inhibitor of the BMP pathway.
- Certain embodiments of the present invention comprise a method of identifying a human breast tumor that is likely to be responsive to or non-responsive to treatment with an antibody that specifically binds at least one human frizzled (FZD) selected from the group consisting of FZD 1 , FZD2, FZD5, FZD7, and FZD8, the method comprising (a) obtaining a sample of the human breast tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast tumor is predicted to be responsive to treatment with the antibody and a negative decision value indicates the tumor is predicted to be non-responsive to treatment with the antibody.
- FZD human frizzled
- Some embodiments comprise a method of identifying a patient with breast cancer that is likely to be responsive to treatment with an antibody that specifically binds at least one human frizzled (FZD) selected from the group consisting of FZD 1, FZD2, FZD5, FZD7, and FZD8, the method comprising: (a) obtaining a sample of the breast cancer; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl , and DKKl; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast cancer is predicted to be responsive to treatment with the antibody.
- FZD human frizzled
- Some embodiments comprise a method of selecting a patient with breast cancer for treatment with an antibody that specifically binds at least one human frizzled (FZD) selected from the group consisting of FZD 1, FZD2, FZD5, FZD7, and FZD8, the method comprising: (a) obtaining a sample of the breast cancer; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast cancer is predicted to be responsive to treatment with the antibody; and selecting the patient for treatment when their tumor sample has a positive decision value.
- FZD human frizzled
- Some embodiments of the present invention comprise a method of treating breast cancer in a patient, comprising: (a) identifying if the patient is likely to respond to treatment with an antibody that specifically binds at least one human frizzled (FZD) selected from the group consisting of FZD 1 , FZD2, FZD5, FZD7, and FZD8, wherein the identification comprises: (i) obtaining a sample of the patient's breast cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises one or more of the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIFl, and DKKl ; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering to the patient who is predicted to response to treatment an effective amount of the antibody.
- FZD human frizzle
- Certain embodiments of the present invention comprise a method of identifying a human breast tumor that is likely to be responsive to or non-responsive to treatment with anti-FZD antibody OMP-18R5 in combination with paclitaxel, the method comprising (a) obtaining a sample of the human breast tumor; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast tumor is predicted to be responsive to treatment and a negative decision value indicates the tumor is predicted to be non-responsive to treatment.
- Some embodiments comprise a method of identifying a patient with breast cancer that is likely to be responsive to treatment with the anti-FZD antibody OMP-18R5 in combination with paclitaxel, the method comprising: (a) obtaining a sample of the breast cancer; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl ; and (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast cancer is predicted to be responsive to treatment.
- Some embodiments comprise a method of selecting a patient with breast cancer for treatment with the anti-FZD antibody OMP-18R5 in combination with paclitaxel, the method comprising: (a) obtaining a sample of the breast cancer; (b) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKKl; (c) calculating a decision value based upon the standardized expression of the biomarkers in the biomarker signature; wherein a positive decision value indicates the breast cancer is predicted to be responsive to treatment; and selecting the patient for treatment when their tumor sample has a positive decision value.
- Some embodiments of the present invention comprise a method of treating breast cancer in a patient, comprising: (a) identifying if the patient is likely to respond to treatment with the anti-FZD antibody OMP-18R5 in combination with paclitaxel, wherein the identification comprises: (i) obtaining a sample of the patient's breast cancer; (ii) measuring the expression level of each biomarker of a biomarker signature in the sample, wherein the biomarker signature comprises the biomarkers FBXW2, CCND2, RHOU, CTBP2, WIF1 , and DKKl; and (iii) calculating a decision value based upon the standardized expression of the biomarkers in the signature; wherein a positive decision value indicates that the patient is predicted to respond to treatment; and (b) administering to the patient who is predicted to response to treatment an effective amount of the antibody and paclitaxel.
- the identification comprises: (i) obtaining a sample of the patient's breast cancer; (ii) measuring the expression level of each biomarker
- Wnt pathway inhibitor includes, but is not limited to, Frizzled (FZD) binding agents and Wnt-binding agents.
- FZD-binding agents may include antibodies that specifically bind to FZD proteins.
- Wnt-binding agents may include antibodies that specifically bind to Wnt proteins as well as soluble FZD receptors that bind to Wnt proteins.
- the Wnt pathway inhibitors are agents that bind one or more human FZD proteins.
- the FZD-binding agents specifically bind one, two, three, four, five, six, seven, eight, nine, or ten FZD proteins.
- the FZD-binding agent binds one or more FZD proteins selected from the group consisting of FZD 1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9, and FZD 10.
- FZD-binding agent binds one or more FZD proteins comprising FZD 1, FZD2, FZD5, FZD7, and/or FZD8. In certain embodiments, FZD-binding agent binds FZD7. In certain embodiments, FZD-binding agent binds FZD5 and/or FZD8. In certain embodiments, the FZD-binding agent specifically binds FZD1, FZD2, FZD5, FZD7, and FZD8. Non-limiting examples of FZD-binding agents can be found in U.S. Patent No. 7,982,013.
- the FZD-binding agent is a FZD antagonist. In certain embodiments, the FZD-binding agent is a Wnt pathway antagonist. In certain embodiments, the FZD-binding agent inhibits Wnt signaling. In some embodiments, the FZD-binding agent inhibits canonical Wnt signaling.
- the FZD-binding agents are antibodies. In some embodiments, the FZD-binding agents are polypeptides. In certain embodiments, the FZD-binding agent is an antibody or a polypeptide comprising an antigen-binding site. In certain embodiments, an antigen-binding site of a FZD-binding antibody or polypeptide described herein is capable of binding (or binds) one, two, three, four, five, or more human FZD proteins.
- an antigen-binding site of the FZD-binding antibody or polypeptide is capable of specifically binding one, two, three, four, or five human FZD proteins selected from the group consisting of FZD 1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9 and FZD 10.
- FZD-binding agent when the FZD-binding agent is an antibody that binds more than one FZD protein, it may be referred to as a "pan-FZD antibody".
- the FZD-binding agent e.g., antibody
- the FZD-binding agent specifically binds the extracellular domain (ECD) of the one or more human FZD proteins to which it binds.
- the FZD-binding agent specifically binds within the Fri domain (also known as the cysteine-rich domain (CRD)) of the human FZD protein to which it binds.
- Sequences of the Fri domain of each of the human FZD proteins are known in the art and are provided as SEQ ID NO: 13 (FZD 1), SEQ ID NO: 14 (FZD2), SEQ ID NO: 15 (FZD3), SEQ ID NO: 16 (FZD4), SEQ ID NO: 17 (FZD5), SEQ ID NO: 18 (FZD6), SEQ ID NO: 19 (FZD7), SEQ ID NO:20 (FZD), SEQ ID N0:21 (FZD9), and SEQ ID NO:22 (FZD 10).
- the FZD-binding agent binds one, two, three, four, five, or more FZD proteins. In some embodiments, the FZD-binding agent specifically binds one, two, three, four, or five FZD proteins selected from the group consisting of FZD 1, FZD2, FZD5, FZD7, and FZD8. In some embodiments, the FZD-binding agent specifically binds at least FZD5 and FZD8.
- the FZD-binding agent binds at least one human FZD protein with a dissociation constant (K D ) of about luM or less, about lOOnM or less, about 40nM or less, about 20nM or less, about lOnM or less, about InM or less, or about O. lnM or less.
- K D dissociation constant
- a FZD-binding agent binds at least one FZD protein with a K D of about lOnM or less.
- a FZD-binding agent binds at least one FZD protein with a K D of about InM or less.
- a FZD-binding agent binds at least one FZD protein with a K D of about O. lnM or less. In certain embodiments, a FZD-binding agent binds each of one or more (e.g., 1, 2, 3, 4, or 5) of FZD1, FZD2, FZD5, FZD7, and FZD8 with a K D of about 40nM or less. In certain embodiments, the FZD-binding agent binds to each of one or more of FZD 1, FZD2, FZD5, FZD7, and FZD8 with a K D of about lOnM or less.
- the FZD-binding agent binds each of FZD 1, FZD2, FZD5, FZD7, and FZD8 with a K D of about lOnM.
- the K D of the binding agent (e.g., an antibody) to a FZD protein is the K D determined using a FZD-Fc fusion protein comprising at least a portion of the FZD extracellular domain or FZD-Fri domain immobilized on a Biacore chip.
- the FZD-binding agent binds one or more (for example, two or more, three or more, or four or more) human FZD proteins with an EC 50 of about ⁇ or less, about lOOnM or less, about 40nM or less, about 20nM or less, about lOnM or less, or about InM or less.
- a FZD-binding agent binds to more than one FZD protein with an EC 5 o of about 40nM or less, about 20nM or less, or about lOnM or less.
- the FZD-binding agent has an EC 5 o of about 20nM or less with respect to one or more (e.g., 1, 2, 3, 4, or 5) of the following FZD proteins: FZD1, FZD2, FZD5, FZD7, and FZD8. In certain embodiments, the FZD-binding agent has an EC 5 o of about lOnM or less with respect to one or more (e.g., 1, 2, 3, 4, or 5) of the following FZD proteins: FZD1, FZD2, FZD5, FZD7, and FZD8. In certain embodiments, the FZD- binding agent has an EC 5 o of about 40nM or less or 20nM or less with respect to binding of FZD5 and/or FZD 8.
- the Wnt pathway inhibitor is a FZD-binding agent which is an antibody.
- the antibody is a recombinant antibody.
- the antibody is a monoclonal antibody.
- the antibody is a chimeric antibody.
- the antibody is a humanized antibody.
- the antibody is a human antibody.
- the antibody is an IgGl antibody.
- the antibody is an IgG2 antibody.
- the antibody is an antibody fragment comprising an antigen-binding site.
- the antibody is monovalent, monospecific, or bivalent.
- the antibody is a bispecific antibody or a multispecific antibody.
- the antibody is conjugated to a cytotoxic moiety.
- the antibody is isolated.
- the antibody is substantially pure.
- the FZD-binding agents (e.g., antibodies) of the present invention can be assayed for specific binding by any method known in the art.
- the immunoassays which can be used include, but are not limited to, competitive and non-competitive assay systems using techniques such as Biacore analysis, FACS analysis, immunofluorescence, immunocytochemistry, Western blot analysis,
- radioimmunoassays ELISA, "sandwich” immunoassays, immunoprecipitation assays, precipitation reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays.
- assays are routine and well-known in the art (see, e.g., Ausubel et al., Editors, 1994-present, Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York, NY).
- the invention provides a Wnt pathway inhibitor which is a FZD- binding agent (e.g., an antibody) that comprises a heavy chain CDR1 comprising GFTFSHYTLS (SEQ ID NO: l), a heavy chain CDR2 comprising VISGDGSYTYYADSVKG (SEQ ID NO:2), and a heavy chain CDR3 comprising NFIKYVFAN (SEQ ID NO:3).
- a FZD- binding agent e.g., an antibody
- a heavy chain CDR1 comprising GFTFSHYTLS (SEQ ID NO: l)
- a heavy chain CDR2 comprising VISGDGSYTYYADSVKG
- NFIKYVFAN SEQ ID NO:3
- the FZD- binding agent further comprises a light chain CDR1 comprising SGDNIGSFYVH (SEQ ID NO:4), a light chain CDR2 comprising DKSNRPSG (SEQ ID NO:5), and a light chain CDR3 comprising QSYANTLSL (SEQ ID NO:6).
- the FZD-binding agent comprises a light chain CDR1 comprising SGDNIGSFYVH (SEQ ID NO:4), a light chain CDR2 comprising
- the FZD-binding agent comprises: (a) a heavy chain CDR1 comprising
- GFTFSHYTLS (SEQ ID NO: 1), a heavy chain CDR2 comprising VISGDGSYTYYADSVKG (SEQ ID NO:2), and a heavy chain CDR3 comprising NFIKYVFAN (SEQ ID NO:3), and (b) a light chain CDR1 comprising SGDNIGSFYVH (SEQ ID NO:4), a light chain CDR2 comprising DKSNRPSG (SEQ ID NO:5), and a light chain CDR3 comprising QSYANTLSL (SEQ ID NO:6).
- the invention provides a FZD-binding agent (e.g., an antibody) that comprises: (a) a heavy chain CDR1 comprising GFTFSHYTLS (SEQ ID NO: 1), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (b) a heavy chain CDR2 comprising
- VISGDGSYTYYADSVKG (SEQ ID NO:2), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions
- a heavy chain CDR3 comprising NFIKYVFAN (SEQ ID NO:3), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions
- a light chain CDR1 comprising
- SGDNIGSFYVH (SEQ ID NO:4), or a variant thereof comprising 1, 2, 3, or 4 amino acid
- substitutions (e) a light chain CDR2 comprising DKSNRPSG (SEQ ID NO:5), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; and (f) a light chain CDR3 comprising QSYANTLSL (SEQ ID NO:6), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions.
- the amino acid substitutions are conservative substitutions.
- the invention provides a FZD-binding agent (e.g., an antibody) that comprises a heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:7, and/or a light chain variable region having at least 80%> sequence identity to SEQ ID NO:8.
- the FZD-binding agent comprises a heavy chain variable region having at least about 85%o, at least about 90%>, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:7.
- the FZD-binding agent comprises a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:8. In certain embodiments, the FZD-binding agent comprises a heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:7, and/or a light chain variable region having at least about 95% sequence identity to SEQ ID NO: 8. In certain embodiments, the FZD-binding agent comprises a heavy chain variable region comprising SEQ ID NO:7 and/or a light chain variable region comprising SEQ ID NO:8.
- the FZD-binding agent comprises a heavy chain variable region comprising SEQ ID NO:7 and a light chain variable region comprising SEQ ID NO:8. In certain embodiments, the FZD- binding agent comprises a heavy chain variable region consisting essentially of SEQ ID NO:7 and a light chain variable region consisting essentially of SEQ ID NO: 8.
- the invention provides a FZD-binding agent (e.g., an antibody) that comprises: (a) a heavy chain having at least 90% sequence identity to SEQ ID NO:9 (with or without the signal sequence) or SEQ ID NO: l 1 ; and/or (b) a light chain having at least 90% sequence identity to SEQ ID NO: 10 (with or without the signal sequence) or SEQ ID NO: 12.
- a FZD-binding agent e.g., an antibody
- the FZD-binding agent comprises: (a) a heavy chain having at least 95% sequence identity to SEQ ID NO:9 (with or without the signal sequence) or SEQ ID NO: 1 1 ; and/or (b) a light chain having at least 95%) sequence identity to SEQ ID NO: 10 (with or without the signal sequence) or SEQ ID NO: 12.
- the FZD-binding agent comprises a heavy chain comprising SEQ ID NO:9 (with or without the signal sequence) or SEQ ID NO: 1 1 , and/or a light chain comprising SEQ ID NO: 10 (with or without the signal sequence) or SEQ ID NO: 12.
- the FZD-binding agent comprises a heavy chain comprising SEQ ID NO: 1 1 and a light chain comprising SEQ ID NO: 12. In some embodiments, the FZD-binding agent comprises a heavy chain consisting essentially of amino acids 20-463 of SEQ ID NO:9 and a light chain consisting essentially of amino acids 20-232 of SEQ ID NO: 10. In some embodiments, the FZD-binding agent comprises a heavy chain consisting essentially of SEQ ID NO: 1 1 and a light chain consisting essentially of SEQ ID NO: 12.
- the invention provides a Wnt pathway inhibitor which is a FZD- binding agent (e.g., an antibody) that specifically binds at least one of FZD1, FZD2, FZD5, FZD7, and/or FZD8, wherein the FZD-binding agent (e.g., an antibody) comprises one, two, three, four, five, and/or six of the CDRs of antibody OMP-18R5.
- Antibody OMP-18R5 also known as 18R5 and vantictumab
- other FZD-binding agents has been previously described in U.S. Patent No. 7,982,013.
- the FZD-binding agent comprises one or more of the CDRs of OMP- 18R5, two or more of the CDRs of OMP- 18R5, three or more of the CDRs of OMP-18R5, four or more of the CDRs of OMP-18R5, five or more of the CDRs of OMP-18R5, or all six of the CDRs of OMP-18R5.
- the invention provides polypeptides which are Wnt pathway inhibitors.
- the polypeptides include, but are not limited to, antibodies that specifically bind human FZD proteins.
- a polypeptide binds one or more FZD proteins selected from the group consisting of FZDl, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD 8, FZD9, and FZD10.
- a polypeptide binds FZDl, FZD2, FZD5, FZD7, and/or FZD8.
- a polypeptide binds FZDl, FZD2, FZD5, FZD7, and FZD 8.
- a polypeptide comprises one, two, three, four, five, and/or six of the CDRs of antibody OMP-18R5. In some embodiments, a polypeptide comprises CDRs with up to four (i.e., 0, 1, 2, 3, or 4) amino acid substitutions per CDR. In certain embodiments, the heavy chain CDR(s) are contained within a heavy chain variable region. In certain embodiments, the light chain CDR(s) are contained within a light chain variable region.
- the invention provides a polypeptide that specifically binds one or more human FZD proteins, wherein the polypeptide comprises an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:7, and/or an amino acid sequence having at least about 80%) sequence identity to SEQ ID NO:8.
- the polypeptide comprises an amino acid sequence having at least about 85%, at least about 90%>, at least about 95%, at least about 97%), or at least about 99% sequence identity to SEQ ID NO:7.
- the polypeptide comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%), at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 8.
- the polypeptide comprises an amino acid sequence having at least about 95% sequence identity to SEQ ID NO: 7, and/or an amino acid sequence having at least about 95% sequence identity to SEQ ID NO:8. In certain embodiments, the polypeptide comprises an amino acid sequence comprising SEQ ID NO:7, and/or an amino acid sequence comprising SEQ ID NO:8.
- a FZD-binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 1 1, and SEQ ID NO: 12.
- a FZD-binding agent comprises the heavy chain variable region and light chain variable region of the OMP-18R5 antibody. In certain embodiments, a FZD-binding agent comprises the heavy chain and light chain of the OMP- 18R5 antibody (with or without the leader sequence). [00171] In certain embodiments, a FZD-binding agent comprises, consists essentially of, or consists of, the antibody OMP-18R5.
- a FZD-binding agent (e.g., antibody) competes for specific binding to one or more human FZD proteins with an antibody that comprises a heavy chain variable region comprising SEQ ID NO:7 and a light chain variable region comprising SEQ ID NO:8.
- a FZD-binding agent (e.g., antibody) competes for specific binding to one or more human FZD proteins with an antibody that comprises a heavy chain comprising SEQ ID NO: 9 (with or without the signal sequence) and a light chain comprising SEQ ID NO: 10 (with or without the signal sequence).
- a FZD-binding agent (e.g., antibody) competes for specific binding to one or more human FZD proteins with an antibody that comprises a heavy chain comprising SEQ ID NO: 1 1 and a light chain comprising SEQ ID NO: 12.
- a FZD-binding agent competes with antibody OMP- 18R5 for specific binding to one or more human FZD proteins.
- a FZD-binding agent or antibody competes for specific binding to one or more human FZD proteins in an in vitro competitive binding assay.
- a FZD-binding agent binds the same epitope, or essentially the same epitope, on one or more human FZD proteins as an antibody of the invention.
- a FZD-binding agent is an antibody that binds an epitope on one or more human FZD proteins that overlaps with the epitope on a FZD protein bound by an antibody of the invention.
- a FZD-binding agent binds the same epitope, or essentially the same epitope, on one or more FZD proteins as antibody OMP-18R5.
- the FZD-binding agent is an antibody that binds an epitope on one or more human FZD proteins that overlaps with the epitope on a FZD protein bound by antibody OMP-18R5.
- the Wnt pathway inhibitors are agents that bind one or more human Wnt proteins. In certain embodiments, the agents specifically bind one, two, three, four, five, six, seven, eight, nine, ten, or more Wnt proteins.
- the Wnt-binding agents bind one or more human Wnt proteins selected from the group consisting of Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, WntlOa, WntlOb, Wntl 1, and Wnt 16.
- a Wnt-binding agent binds one or more (or two or more, three or more, four or more, five or more, etc.) Wnt proteins selected from the group consisting of Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, WntlOa, and WntlOb.
- the one or more (or two or more, three or more, four or more, five or more, etc.) Wnt proteins are selected from the group consisting of Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt8a, Wnt8b, Wntl Oa, and WntlOb.
- the Wnt-binding agent is a Wnt antagonist. In certain embodiments, the Wnt-binding agent is a Wnt pathway antagonist. In certain embodiments, the Wnt-binding agent inhibits Wnt signaling. In some embodiments, the Wnt-binding agent inhibits canonical Wnt signaling. [00176] In some embodiments, the Wnt-binding agent is an antibody. In some embodiments, the Wnt-binding agent is a polypeptide. In certain embodiments, the Wnt-binding agent is an antibody or a polypeptide comprising an antigen-binding site.
- an antigen-binding site of a Wnt-binding antibody or polypeptide described herein is capable of binding (or binds) one, two, three, four, five, or more human Wnt proteins.
- an antigen-binding site of the Wnt-binding antibody or polypeptide is capable of specifically binding one, two, three, four, or five human Wnt proteins selected from the group consisting of Wntl , Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, WntlOa, and WntlOb.
- Wnt-binding agents can be found in International Publication WO 201 1/088127.
- a Wnt-binding agent binds to the C-terminal cysteine rich domain of one or more human Wnt proteins.
- the Wnt-binding agent binds a domain within the one or more Wnt proteins selected from the group consisting of: SEQ ID NO:46 (Wntl), SEQ ID NO:47 (Wnt2), SEQ ID NO:48 (Wnt2b), SEQ ID NO:49 (Wnt3), SEQ ID NO:50 (Wnt3a), SEQ ID NO:51 (Wnt7a), SEQ ID NO:52 (Wnt7b), SEQ ID NO:53 (Wnt8a), SEQ ID NO:54 (Wnt8b), SEQ ID NO:55 (Wntl Oa), and SEQ ID NO:56 (WntlOb).
- the Wnt-binding agent binds one or more (e.g., two or more, three or more, or four or more) Wnt proteins with a K D of about l uM or less, about ⁇ or less, about 40nM or less, about 20nM or less, or about ⁇ or less.
- a Wnt-binding agent described herein that binds more than one Wnt protein binds those Wnt proteins with a K D of about lOOnM or less, about 20nM or less, or about ⁇ or less.
- the Wnt-binding agent binds each of one or more (e.g., 1, 2, 3, 4, or 5) Wnt proteins with a K D of about 40nM or less, wherein the Wnt proteins are selected from the group consisting of: Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, WntlOa, and Wntl Ob.
- Wntl Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, WntlOa, and Wntl Ob.
- the K D of the binding agent (e.g., an antibody) to a Wnt protein is the K D determined using a Wnt fusion protein comprising at least a portion of the Wnt C-terminal cysteine rich domain immobilized on a Biacore chip.
- the Wnt-binding agent binds one or more (for example, two or more, three or more, or four or more) human Wnt proteins with an EC 5 o of about ⁇ or less, about lOOnM or less, about 40nM or less, about 20nM or less, about ⁇ or less, or about InM or less.
- a Wnt-binding agent binds to more than one Wnt with an EC 5 o of about 40nM or less, about 20nM or less, or about lOnM or less.
- the Wnt-binding agent has an EC 5 o of about 20nM or less with respect to one or more (e.g., 1, 2, 3, 4, or 5) of Wnt proteins Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, WntlOa, WntlOb, Wntl 1, and/or Wntl6.
- Wntl Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, WntlOa, WntlOb, Wnt
- the Wnt-binding agent has an EC 50 of about lOnM or less with respect to one or more (e.g., 1, 2, 3, 4, or 5) of the following Wnt proteins Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt8a, Wnt8b, WntlOa, and/or WntlOb.
- the Wnt pathway inhibitor is a Wnt-binding agent which is an antibody.
- the antibody is a recombinant antibody.
- the antibody is a monoclonal antibody.
- the antibody is a chimeric antibody.
- the antibody is a humanized antibody. In some embodiments, the antibody is a human antibody. In certain embodiments, the antibody is an IgGl antibody. In certain embodiments, the antibody is an IgG2 antibody. In certain embodiments, the antibody is an antibody fragment comprising an antigen-binding site. In some embodiments, the antibody is monovalent, monospecific, or bivalent. In some embodiments, the antibody is a bispecific antibody or a multispecific antibody. In some embodiments, the antibody is conjugated to a cytotoxic moiety. In some embodiments, the antibody is isolated. In some embodiments, the antibody is substantially pure.
- Wnt-binding agents e.g., antibodies
- the Wnt-binding agents (e.g., antibodies) of the present invention can be assayed for specific binding by any method known in the art as described herein for FZD-binding agents.
- the Wnt-binding agent is a soluble receptor. In certain embodiments, the Wnt-binding agent comprises the extracellular domain of a FZD receptor protein. In some embodiments, the Wnt-binding agent comprises a Fri domain of a FZD protein. In some
- a soluble receptor comprising a FZD Fri domain can demonstrate altered biological activity (e.g., increased protein half-life) compared to a soluble receptor comprising the entire FZD ECD. Protein half-life can be further modified (i.e., increased) by covalent modification with polyethylene glycol (PEG) or polyethylene oxide (PEO).
- the FZD protein is a human FZD protein.
- the human FZD protein is FZD1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD 8, FZD9, or FZD10.
- Non- limiting examples of soluble FZD receptors can be found in U.S. Patent Nos. 7,723,477 and 7,947,277 and U.S. Patent Publication No. 2013/0034551.
- the predicted Fri domains for each of the human FZD 1 -10 proteins are provided as SEQ ID NOs: 13-22.
- the predicted minimal Fri domains for each of the human FZDl-10 proteins are provided as SEQ ID NOs:23-32.
- Those of skill in the art may differ in their understanding of the exact amino acids corresponding to the various Fri domains.
- the N-terminus and/or C-terminus of the domains outlined above and herein may extend or be shortened by 1, 2, 3, 4, 5, 6, 7, 8, 9, or even 10 amino acids.
- the Wnt-binding agent comprises a Fri domain of a human FZD protein, or a fragment or variant of the Fri domain that binds one or more human Wnt proteins.
- the human FZD protein is FZD1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9, or FZD 10.
- the human FZD protein is FZD4.
- the human FZD protein is FZD5.
- the human FZD protein is FZD8.
- the human FZD protein is FZD10.
- the FZD protein is FZD4 and the Wnt-binding agent comprises SEQ ID NO: 16. In certain embodiments, the FZD protein is FZD5 and the Wnt-binding agent comprises SEQ ID NO: 17. In certain embodiments, the FZD protein is FZD7 and the Wnt-binding agent comprises SEQ ID NO: 19. In certain embodiments, the FZD protein is FZD8 and the Wnt-binding agent comprises SEQ ID NO:20. In certain embodiments, the FZD protein is FZD10 and the Wnt-binding agent comprises SEQ ID NO:22. In certain embodiments, the FZD protein is FZD8 and the Wnt-binding agent comprises SEQ ID NO:33.
- the Wnt-binding agent comprises a Fri domain comprising the minimal Fri domain of FZD 1 (SEQ ID NO:23), the minimal Fri domain of FZD2 (SEQ ID NO:24), the minimal Fri domain of FZD3 (SEQ ID NO:25), the minimal Fri domain of FZD4 (SEQ ID NO:26), the minimal Fri domain of FZD5 (SEQ ID NO:27), the minimal Fri domain of FZD6 (SEQ ID NO:28), the minimal Fri domain of FZD7 (SEQ ID NO:29), the minimal Fri domain of FZD8 (SEQ ID NO:30), the minimal Fri domain of FZD9 (SEQ ID NO:31), or the minimal Fri domain of FZD10 (SEQ ID NO:32).
- the Wnt-binding agent comprises a Fri domain comprising the minimal Fri domain of FZD8 (SEQ ID NO:30).
- the Wnt-binding agent comprises a Fri domain consisting essentially of the Fri domain of FZD 1, the Fri domain of FZD2, the Fri domain of FZD3, the Fri domain of FZD4, the Fri domain of FZD5, the Fri domain of FZD6, the Fri domain of FZD7, the Fri domain of FZD8, the Fri domain of FZD9, or the Fri domain of FZD10.
- the Wnt-binding agent comprises a Fri domain consisting essentially of the Fri domain of FZD8.
- the Wnt-binding agent comprises a sequence selected from the group consisting of: SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33.
- the Wnt- binding agent comprises a Fri domain consisting essentially of SEQ ID NO:20.
- the Wnt-binding agent comprises a Fri domain consisting essentially of SEQ ID NO:33.
- the Wnt-binding agent comprises a variant of any one of the aforementioned FZD Fri domain sequences that comprises one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, etc.) conservative substitutions and is capable of binding Wnt protein(s).
- a Wnt-binding agent such as an agent comprising a Fri domain of a human FZD receptor, further comprises a non-FZD polypeptide.
- a FZD soluble receptor may include FZD ECD or Fri domains linked to other non-FZD functional and structural polypeptides including, but not limited to, a human Fc region, protein tags (e.g., myc, FLAG, GST), other endogenous proteins or protein fragments, or any other useful protein sequence including any linker region between a FZD ECD or Fri domain and a second polypeptide.
- the non-FZD polypeptide comprises a human Fc region.
- the Fc region can be obtained from any of the classes of immunoglobulin, IgG, IgA, IgM, IgD and IgE.
- the Fc region is a human IgGl Fc region.
- the Fc region is a human IgG2 Fc region.
- the Fc region is a wild-type Fc region.
- the Fc region is a mutated Fc region.
- the Fc region is truncated at the N-terminal end by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, (e.g., in the hinge domain). In some embodiments, an amino acid in the hinge domain is changed to hinder undesirable disulfide bond formation.
- a cysteine is replaced with a serine to hinder or block undesirable disulfide bond formation.
- the Fc region is truncated at the C-terminal end by 1, 2, 3, or more amino acids. In some embodiments, the Fc region is truncated at the C-terminal end by 1 amino acid.
- the non-FZD polypeptide comprises SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the non-FZD polypeptide consists essentially of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In certain embodiments, the non-FZD polypeptide consists essentially of SEQ ID NO:36 or SEQ ID NO:37.
- a Wnt-binding agent is a fusion protein comprising at least a minimal Fri domain of a FZD receptor and a Fc region.
- a "fusion protein” is a hybrid protein expressed by a nucleic acid molecule comprising nucleotide sequences of at least two genes.
- the C-terminus of the first polypeptide is linked to the N-terminus of the
- the first polypeptide e.g., a FZD Fri domain
- the Fc region is directly linked to the Fc region (i.e. without an intervening linker).
- the first polypeptide is linked to the Fc region via a linker.
- linker refers to a linker inserted between a first polypeptide (e.g., a FZD component) and a second polypeptide (e.g., a Fc region).
- the linker is a peptide linker.
- Linkers should not adversely affect the expression, secretion, or bioactivity of the polypeptide. Linkers should not be antigenic and should not elicit an immune response. Suitable linkers are known to those of skill in the art and often include mixtures of glycine and serine residues and often include amino acids that are sterically unhindered. Other amino acids that can be incorporated into useful linkers include threonine and alanine residues.
- Linkers can range in length, for example from 1 -50 amino acids in length, 1-22 amino acids in length, 1-10 amino acids in length, 1 -5 amino acids in length, or 1 -3 amino acids in length.
- Linkers may include, but are not limited to, SerGly, GGSG, GSGS, GGGS, S(GGS)n where n is 1-7, GRA, poly(Gly), poly(Ala), ESGGGGVT (SEQ ID NO:57), LESGGGGVT (SEQ ID NO:58), GRAQVT (SEQ ID NO:59), WRAQVT (SEQ ID NO:60), and ARGRAQVT (SEQ ID NO:61).
- a "linker” is an intervening peptide sequence that does not include amino acid residues from either the C-terminus of the first polypeptide (e.g., a FZD Fri domain) or the N-terminus of the second polypeptide (e.g., the Fc region).
- the Wnt-binding agent comprises a FZD Fri domain, a Fc region, and a linker connecting the FZD Fri domain to the Fc region.
- the FZD Fri domain comprises SEQ ID NO:20, SEQ ID NO:30, or SEQ ID NO:33.
- the linker comprises ESGGGGVT (SEQ ID NO:57) or LESGGGGVT (SEQ ID NO:58).
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33; and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38, wherein the first polypeptide is directly linked to the second polypeptide.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt- binding agent comprises a first polypeptide comprising SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:36 or SEQ ID NO:37. In some embodiments, the Wnt-binding agent comprises a first polypeptide consisting essentially of SEQ ID NO:20 and a second polypeptide consisting essentially of SEQ ID NO:36 or SEQ ID NO:37.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:30 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:30 and a second polypeptide comprising SEQ ID NO:36 or SEQ ID NO:37.
- the Wnt- binding agent comprises a first polypeptide comprising SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO: 36, SEQ ID NO: 37, or SEQ ID NO:35.
- the Wnt-binding agent comprises a first polypeptide consisting essentially of SEQ ID NO:33 and a second polypeptide consisting essentially of SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:35.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33; and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38, wherein the first polypeptide is connected to the second polypeptide by a linker.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:36 or SEQ ID NO:37. In some embodiments, the Wnt- binding agent comprises a first polypeptide consisting essentially of SEQ ID NO:20 and a second polypeptide consisting essentially of SEQ ID NO:36 or SEQ ID NO:37. In some embodiments, the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:30 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt-binding agent comprises a first polypeptide comprising SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO: 36, SEQ ID NO: 37, or SEQ ID NO: 35.
- the Wnt-binding agent comprises a first polypeptide consisting essentially of SEQ ID NO:33 and a second polypeptide consisting essentially of SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:35.
- the Wnt-binding agent comprises a first polypeptide that is at least 95% identical to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33; and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38, wherein the first polypeptide is directly linked to the second polypeptide.
- the Wnt-binding agent comprises a first polypeptide that is at least 95% identical to SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt-binding agent comprises a first polypeptide that is at least 95% identical to SEQ ID NO:30 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the Wnt-binding agent comprises a first polypeptide that is at least 95%> identical to SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the Wnt-binding agent comprises a first polypeptide that is at least 95% identical to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33; and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38, wherein the first polypeptide is connected to the second polypeptide by a linker.
- the Wnt-binding agent comprises a first polypeptide that is at least 95%> identical to SEQ ID NO:20 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38. In some embodiments, the Wnt-binding agent comprises a first polypeptide that is at least 95%> identical to SEQ ID NO:30 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- the Wnt-binding agent comprises a first polypeptide that is at least 95% identical to SEQ ID NO:33 and a second polypeptide comprising SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or SEQ ID NO:38.
- FZD proteins contain a signal sequence that directs the transport of the proteins.
- Signal sequences also referred to as signal peptides or leader sequences
- Signal sequences are located at the N-terminus of nascent polypeptides. They target the polypeptide to the endoplasmic reticulum and the proteins are sorted to their destinations, for example, to the inner space of an organelle, to an interior membrane, to the cell outer membrane, or to the cell exterior via secretion. Most signal sequences are cleaved from the protein by a signal peptidase after the proteins are transported to the endoplasmic reticulum.
- the cleavage of the signal sequence from the polypeptide usually occurs at a specific site in the amino acid sequence and is dependent upon amino acid residues within the signal sequence. Although there is usually one specific cleavage site, more than one cleavage site may be recognized and/or used by a signal peptidase resulting in a non-homogenous N-terminus of the polypeptide. For example, the use of different cleavage sites within a signal sequence can result in a polypeptide expressed with different N-terminal amino acids. Accordingly, in some embodiments, the polypeptides described herein may comprise a mixture of polypeptides with different N-termini. In some embodiments, the N-termini differ in length by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acids.
- the N-termini differ in length by 1, 2, 3, 4, or 5 amino acids.
- the polypeptide is substantially homogeneous, i.e., the polypeptides have the same N-terminus.
- the signal sequence of the polypeptide comprises one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, etc.) amino acid substitutions and/or deletions.
- the signal sequence of the polypeptide comprises amino acid substitutions and/or deletions that allow one cleavage site to be dominant, thereby resulting in a substantially homogeneous polypeptide with one N-terminus.
- the Wnt-binding agent comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, and SEQ ID NO:45.
- the Wnt-binding agent comprises the sequence of SEQ ID NO:39.
- the agent comprises the sequence of SEQ ID NO:39, comprising one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, etc.) conservative substitutions.
- the agent comprises a sequence having at least about 90%, about 95%, or about 98% sequence identity with SEQ ID NO:39.
- the variants of SEQ ID NO:39 maintain the ability to bind one or more human Wnt proteins.
- the Wnt-binding agent comprises the sequence of SEQ ID NO:40.
- the Wnt-binding agent is SEQ ID NO:40.
- the agent comprises the sequence of SEQ ID NO:40, comprising one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, etc.) conservative substitutions.
- the agent comprises a sequence having at least about 90%, about 95%, or about 98% sequence identity with SEQ ID NO:40.
- the variants of SEQ ID NO:40 maintain the ability to bind one or more human Wnt proteins.
- the Wnt-binding agent comprises the sequence of SEQ ID NO:41.
- the Wnt-binding agent is SEQ ID NO:41.
- the agent comprises the sequence of SEQ ID NO:41, comprising one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, etc.) conservative substitutions.
- the agent comprises a sequence having at least about 90%, about 95%, or about 98% sequence identity with SEQ ID NO:41.
- the variants of SEQ ID NO:41 maintain the ability to bind one or more human Wnt proteins.
- the Wnt-binding agent is OMP-54F28.
- a Wnt-binding agent is a polypeptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, and SEQ ID NO:45.
- the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41.
- a polypeptide consists essentially of an amino acid sequence selected from the group consisting of: SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41.
- the polypeptide comprises the amino acid sequence of SEQ ID NO: 39. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:40. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:41. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:42. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:43. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:44. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:45.
- the polypeptide is a substantially purified polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41. In some embodiments, the polypeptide is a substantially purified polypeptide comprising SEQ ID NO:41. In certain embodiments, the substantially purified polypeptide consists of at least 90% of a polypeptide that has an N-terminal sequence of ASA. In some embodiments, the nascent polypeptide comprises a signal sequence that results in a substantially homogeneous polypeptide product with one N-terminal sequence.
- a Wnt-binding agent comprises a Fc region of an immunoglobulin.
- the binding agents of this invention will comprise fusion proteins in which at least a portion of the Fc region has been deleted or otherwise altered so as to provide desired biochemical characteristics, such as increased cancer cell localization, increased tumor penetration, reduced serum half-life, or increased serum half-life, when compared with a fusion protein of approximately the same immunogenicity comprising a native or unaltered constant region.
- Modifications to the Fc region may include additions, deletions, or substitutions of one or more amino acids in one or more domains.
- the modified fusion proteins disclosed herein may comprise alterations or modifications to one or more of the two heavy chain constant domains (CH2 or CH3) or to the hinge region. In other embodiments, the entire CH2 domain may be removed ( ⁇ 2
- the omitted constant region domain is replaced by a short amino acid spacer (e.g., 10 aa residues) that provides some of the molecular flexibility typically imparted by the absent constant region domain.
- a short amino acid spacer e.g. 10 aa residues
- the modified fusion proteins are engineered to link the CH3 domain directly to the hinge region.
- a peptide spacer is inserted between the hinge region and the modified CH2 and/or CH3 domains.
- constructs may be expressed wherein the CH2 domain has been deleted and the remaining CH3 domain (modified or unmodified) is joined to the hinge region with a 5-20 amino acid spacer.
- a spacer may be added to ensure that the regulatory elements of the constant domain remain free and accessible or that the hinge region remains flexible.
- amino acid spacers may, in some cases, prove to be immunogenic and elicit an unwanted immune response against the construct. Accordingly, in certain embodiments, any spacer added to the construct will be relatively non-immunogenic so as to maintain the desired biological qualities of the fusion protein.
- the modified fusion proteins may have only a partial deletion of a constant domain or substitution of a few or even a single amino acid.
- the mutation of a single amino acid in selected areas of the CH2 domain may be enough to substantially reduce Fc binding and thereby increase cancer cell localization and/or tumor penetration.
- Such partial deletions of the constant regions may improve selected characteristics of the binding agent (e.g., serum half-life) while leaving other desirable functions associated with the subject constant region domain intact.
- the constant regions of the disclosed fusion proteins may be modified through the mutation or substitution of one or more amino acids that enhances the profile of the resulting construct.
- the modified fusion proteins comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as decreasing or increasing effector function, or provide for more cytotoxin or carbohydrate attachment sites.
- the constant region mediates several effector functions. For example, binding of the CI component of complement to the Fc region of IgG or IgM antibodies (bound to antigen) activates the complement system. Activation of complement is important in the opsonization and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and can also be involved in autoimmune hypersensitivity.
- the Fc region of an immunoglobulin can bind to a cell expressing a Fc receptor (FcR).
- Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells, release of inflammatory mediators, placental transfer, and control of immunoglobulin production.
- IgG gamma receptors
- IgE epsilon receptors
- IgA alpha receptors
- IgM mi receptors
- the modified fusion proteins provide for altered effector functions that, in turn, affect the biological profile of the administered agent.
- the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating modified agent, thereby increasing cancer cell localization and/or tumor penetration.
- the constant region modifications increase or reduce the serum half-life of the agent.
- the constant region is modified to eliminate disulfide linkages or oligosaccharide moieties.
- a modified fusion protein does not have one or more effector functions normally associated with an Fc region.
- the agent has no antibody- dependent cell-mediated cytotoxicity (ADCC) activity, and/or no complement-dependent cytotoxicity (CDC) activity.
- ADCC antibody- dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- the agent does not bind to the Fc receptor and/or complement factors.
- the agent has no effector function.
- the Wnt-binding agent e.g., a soluble receptor
- the Wnt-binding agent is modified to reduce immunogenicity.
- immune responses against completely normal human proteins are rare when these proteins are used as therapeutics.
- fusion proteins comprise polypeptides sequences that are the same as the sequences found in nature, several therapeutic fusion proteins have been shown to be immunogenic in mammals.
- a fusion protein comprising a linker has been found to be more immunogenic than a fusion protein that does not contain a linker.
- the polypeptides of the invention are analyzed by computation methods to predict immunogenicity.
- the polypeptides of the invention are analyzed by computation methods to predict immunogenicity.
- the polypeptides of the invention are analyzed by computation methods to predict immunogenicity.
- polypeptides are analyzed for the presence of T-cell and/or B-cell epitopes. If any T-cell or B-cell epitopes are identified and/or predicted, modifications to these regions (e.g., amino acid substitutions) may be made to disrupt or destroy the epitopes.
- modifications to these regions e.g., amino acid substitutions
- Various algorithms and software that can be used to predict T-cell and/or B-cell epitopes are known in the art. For example, the software programs SYFPEITHI, HLA Bind, PEPVAC, RANKPEP, DiscoTope, ElliPro, and Antibody Epitope
- a cell producing any of the Wnt-binding agents (e.g., soluble receptors) or polypeptides described herein is provided.
- a composition comprising any of the Wnt-binding agents (e.g., soluble receptors) or polypeptides described herein is provided.
- the composition comprises a polypeptide wherein at least 80%, 90%, 95%, 97%, 98%, or 99% of the polypeptide has an N-terminal sequence of ASA.
- the composition comprises a polypeptide wherein 100%> of the polypeptide has an N- terminal sequence of ASA.
- the composition comprises a polypeptide wherein at least 80%> of the polypeptide has an N-terminal sequence of ASA. In some embodiments, the composition comprises a polypeptide wherein at least 90%> of the polypeptide has an N-terminal sequence of ASA. In some embodiments, the composition comprises a polypeptide wherein at least 95% of the polypeptide has an N-terminal sequence of ASA.
- polypeptides described herein can be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. It will be recognized in the art that some amino acid sequences of the invention can be varied without significant effect on the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity. Thus, the invention further includes variations of the polypeptides which show substantial activity or which include regions of FZD proteins, such as the protein portions discussed herein. Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
- the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. In certain embodiments, the number of substitutions for any given soluble receptor polypeptide will not be more than 50, 40, 30, 25, 20, 15, 10, 5 or 3.
- fragments or portions of the polypeptides of the present invention can be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments can be employed as intermediates for producing the full-length polypeptides.
- These fragments or portion of the polypeptides can also be referred to as "protein fragments" or "polypeptide fragments”.
- a "protein fragment" of this invention is a portion or all of a protein which is capable of binding to one or more human Wnt proteins or one or more human FZD proteins. In some embodiments, the fragment has a high affinity for one or more human Wnt proteins. In some embodiments, the fragment has a high affinity for one or more human FZD proteins.
- Some fragments of Wnt-binding agents described herein are protein fragments comprising at least part of the extracellular portion of a FZD protein linked to at least part of a constant region of an
- the binding affinity of the protein fragment can be in the range of about l O - 11 to 10 12 M, although the affinity can vary considerably with fragments of different sizes, ranging from 10 _7 to 10 13 M.
- the fragment is about 100 to about 200 amino acids in length and comprises a binding domain linked to at least part of a constant region of an immunoglobulin.
- the Wnt pathway inhibitors are polyclonal antibodies.
- Polyclonal antibodies can be prepared by any known method.
- polyclonal antibodies are raised by immunizing an animal (e.g., a rabbit, rat, mouse, goat, donkey) by multiple subcutaneous or intraperitoneal injections of an antigen of interest (e.g., a purified peptide fragment, full-length recombinant protein, or fusion protein).
- the antigen can be optionally conjugated to a carrier such as keyhole limpet hemocyanin (KLH) or serum albumin.
- KLH keyhole limpet hemocyanin
- the antigen (with or without a carrier protein) is diluted in sterile saline and usually combined with an adjuvant (e.g., Complete or Incomplete Freund's Adjuvant) to form a stable emulsion.
- an adjuvant e.g., Complete or Incomplete Freund's Adjuvant
- polyclonal antibodies are recovered from blood and/or ascites of the immunized animal.
- the polyclonal antibodies can be purified from serum or ascites according to standard methods in the art including, but not limited to, affinity chromatography, ion-exchange chromatography, gel electrophoresis, and dialysis.
- the Wnt pathway inhibitors are monoclonal antibodies.
- Monoclonal antibodies can be prepared using hybridoma methods known to one of skill in the art (see e.g., Kohler and Milstein, 1975, Nature, 256:495-497).
- a mouse, hamster, or other appropriate host animal is immunized as described above to elicit from lymphocytes the production of antibodies that will specifically bind the immunizing antigen.
- lymphocytes can be immunized in vitro.
- the immunizing antigen can be a human protein or a portion thereof.
- the immunizing antigen can be a mouse protein or a portion thereof.
- lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol, to form hybridoma cells that can then be selected away from unfused lymphocytes and myeloma cells.
- Hybridomas that produce monoclonal antibodies directed specifically against a chosen antigen may be identified by a variety of methods including, but not limited to, immunoprecipitation, immunoblotting, and in vitro binding assay (e.g., flow cytometry, FACS, ELISA, and radioimmunoassay).
- the hybridomas can be propagated either in in vitro culture using standard methods (J. W.
- the monoclonal antibodies can be purified from the culture medium or ascites fluid according to standard methods in the art including, but not limited to, affinity chromatography, ion-exchange chromatography, gel electrophoresis, and dialysis.
- monoclonal antibodies can be made using recombinant DNA techniques as known to one skilled in the art.
- the polynucleotides encoding a monoclonal antibody are isolated from mature B-cells or hybridoma cells, such as by RT-PCR using oligonucleotide primers that specifically amplify the genes encoding the heavy and light chains of the antibody, and their sequence is determined using conventional techniques.
- the isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors which produce the monoclonal antibodies when transfected into host cells such as E.
- recombinant monoclonal antibodies, or fragments thereof can be isolated from phage display libraries.
- the polynucleotide(s) encoding a monoclonal antibody can further be modified in a number of different manners using recombinant DNA technology to generate alternative antibodies.
- the constant domains of the light and heavy chains of, for example, a mouse monoclonal antibody can be substituted for those regions of, for example, a human antibody to generate a chimeric antibody, or for a non-immunoglobulin polypeptide to generate a fusion antibody.
- the constant regions are truncated or removed to generate the desired antibody fragment of a monoclonal antibody. Site-directed or high-density mutagenesis of the variable region can be used to optimize specificity, affinity, etc. of a monoclonal antibody.
- the Wnt pathway inhibitor is a humanized antibody.
- humanized antibodies are human immunoglobulins in which amino acid residues of the CDRs are replaced by amino acid residues of a CDR from an immunoglobulin of a non-human species (e.g., mouse, rat, rabbit, hamster, etc.) that have the desired specificity, affinity, and/or binding capability using methods known to one skilled in the art.
- Fv framework region amino acid residues of a human immunoglobulin are replaced with corresponding amino acid residues from an antibody of a non-human species that has the desired specificity, affinity, and/or binding capability.
- the humanized antibody can be further modified by the substitution of additional amino acid residues either in the Fv framework region and/or within the replaced non- human amino acid residues to refine and optimize antibody specificity, affinity, and/or capability.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domain regions containing all, or substantially all, of the CDRs that correspond to the non- human immunoglobulin whereas all, or substantially all, of the framework regions are those of a human immunoglobulin sequence.
- the humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin.
- Fc immunoglobulin constant region or domain
- such humanized antibodies are used therapeutically because they may reduce antigenicity and HAMA (human anti-mouse antibody) responses when administered to a human subject. Methods used to generate humanized antibodies are well known in the art.
- the Wnt pathway inhibitor is a human antibody.
- Human antibodies can be directly prepared using various techniques known in the art.
- immortalized human B lymphocytes immunized in vitro or isolated from an immunized individual that produces an antibody directed against a target antigen can be generated.
- the human antibody can be selected from a phage library, where that phage library expresses human antibodies.
- phage display technology can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable domain gene repertoires from
- Affinity maturation strategies including, but not limited to, chain shuffling (Marks et al., 1992, Bio/Technology, 10:779-783) and site-directed mutagenesis, are known in the art and may be employed to generate high affinity human antibodies.
- human antibodies can be made in transgenic mice that contain human immunoglobulin loci. These mice are capable, upon immunization, of producing the full repertoire of human antibodies in the absence of endogenous immunoglobulin production. This approach is described in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; and 5,661,016.
- This invention also encompasses bispecific antibodies that specifically recognize at least one human FZD protein or at least one Wnt protein.
- Bispecific antibodies are capable of specifically recognizing and binding at least two different epitopes.
- the different epitopes can either be within the same molecule (e.g., two different epitopes on human FZD5) or on different molecules (e.g., one epitope on FZD5 and a different epitope on a second protein).
- the bispecific antibodies are monoclonal human or humanized antibodies.
- the antibodies can specifically recognize and bind a first antigen target, (e.g., a FZD protein) as well as a second antigen target, such as an effector molecule on a leukocyte (e.g., CD2, CD3, CD28, CD80, or CD86) or a Fc receptor (e.g., CD64, CD32, or CD 16) so as to focus cellular defense mechanisms to the cell expressing the first antigen target.
- the antibodies can be used to direct cytotoxic agents to cells which express a particular target antigen. These antibodies possess an antigen-binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOT A, or TETA.
- Bispecific antibodies can be intact antibodies or antibody fragments. Antibodies with more than two valencies are also contemplated. For example, trispecific antibodies can be prepared (Tutt et al., 1991, J. Immunol, 147:60). Thus, in certain embodiments the antibodies are multispecific.
- the antibodies (or other polypeptides) described herein may be monospecific.
- each of the one or more antigen-binding sites that an antibody contains is capable of binding (or binds) a homologous epitope on different proteins.
- an antigen-binding site of a monospecific antibody described herein is capable of binding (or binds), for example, FZD5 and FZD7 (i.e., the same epitope is found on both FZD5 and FZD7 proteins).
- the Wnt pathway inhibitor is an antibody fragment comprising an antigen-binding site.
- Antibody fragments may have different functions or capabilities than intact antibodies; for example, antibody fragments can have increased tumor penetration.
- Various techniques are known for the production of antibody fragments including, but not limited to, proteolytic digestion of intact antibodies.
- antibody fragments include a F(ab')2 fragment produced by pepsin digestion of an antibody molecule.
- antibody fragments include a Fab fragment generated by reducing the disulfide bridges of an F(ab')2 fragment.
- antibody fragments include a Fab fragment generated by the treatment of the antibody molecule with papain and a reducing agent.
- antibody fragments are produced recombinantly.
- antibody fragments include Fv or single chain Fv (scFv) fragments.
- Fab, Fv, and scFv antibody fragments can be expressed in and secreted from E. coli or other host cells, allowing for the production of large amounts of these fragments.
- antibody fragments are isolated from antibody phage libraries as discussed herein. For example, methods can be used for the construction of Fab expression libraries to allow rapid and effective identification of monoclonal Fab fragments with the desired specificity for a FZD or Wnt protein or derivatives, fragments, analogs or homologs thereof.
- antibody fragments are linear antibody fragments.
- antibody fragments are
- the Wnt pathway inhibitor is a scFv.
- Various techniques can be used for the production of single-chain antibodies specific to one or more human FZD proteins or one or more human Wnt proteins.
- an antibody in order to increase its serum half-life. This can be achieved, for example, by incorporation of a salvage receptor binding epitope into the antibody fragment by mutation of the appropriate region in the antibody fragment or by incorporating the epitope into a peptide tag that is then fused to the antibody fragment at either end or in the middle (e.g., by DNA or peptide synthesis).
- an antibody is modified to decrease its serum half-life.
- Heteroconjugate antibodies are also within the scope of the present invention.
- Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune cells to unwanted cells. It is also contemplated that the heteroconjugate antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
- modified antibodies can comprise any type of variable region that provides for the association of the antibody with the target (i.e., a human FZD protein or a human Wnt protein).
- the variable region may comprise or be derived from any type of mammal that can be induced to mount a humoral response and generate immunoglobulins against the desired tumor-associated antigen.
- the variable region of the modified antibodies can be, for example, of human, murine, non-human primate (e.g. cynomolgus monkeys, macaques, etc.) or rabbit origin.
- both the variable and constant regions of the modified immunoglobulins are human.
- variable regions of compatible antibodies can be engineered or specifically tailored to improve the binding properties or reduce the immunogenicity of the molecule.
- variable regions useful in the present invention can be humanized or otherwise altered through the inclusion of imported amino acid sequences.
- variable domains in both the heavy and light chains are altered by at least partial replacement of one or more CDRs and, if necessary, by partial framework region replacement and sequence modification and/or alteration.
- the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived preferably from an antibody from a different species. It may not be necessary to replace all of the CDRs with all of the CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity of the antigen-binding site.
- the modified antibodies of this invention will comprise antibodies (e.g., full-length antibodies or immunoreactive fragments thereof) in which at least a fraction of one or more of the constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as increased tumor localization and/or increased serum half- life when compared with an antibody of approximately the same immunogenicity comprising a native or unaltered constant region.
- the constant region of the modified antibodies will comprise a human constant region.
- Modifications to the constant region compatible with this invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains.
- the modified antibodies disclosed herein may comprise alterations or modifications to one or more of the three heavy chain constant domains (CHI, CH2 or CH3) and/or to the light chain constant domain (CL).
- one or more domains are partially or entirely deleted from the constant regions of the modified antibodies.
- the modified antibodies will comprise domain deleted constructs or variants wherein the entire CH2 domain has been removed (ACH2 constructs).
- the omitted constant region domain is replaced by a short amino acid spacer (e.g., 10 amino acid residues) that provides some of the molecular flexibility typically imparted by the absent constant region.
- the modified antibodies are engineered to fuse the CH3 domain directly to the hinge region of the antibody.
- a peptide spacer is inserted between the hinge region and the modified CH2 and/or CH3 domains.
- constructs may be expressed wherein the CH2 domain has been deleted and the remaining CH3 domain (modified or unmodified) is joined to the hinge region with a 5-20 amino acid spacer.
- a spacer may be added to ensure that the regulatory elements of the constant domain remain free and accessible or that the hinge region remains flexible.
- amino acid spacers may, in some cases, prove to be immunogenic and elicit an unwanted immune response against the construct. Accordingly, in certain embodiments, any spacer added to the construct will be relatively non- immunogenic so as to maintain the desired biological qualities of the modified antibodies.
- the modified antibodies may have only a partial deletion of a constant domain or substitution of a few or even a single amino acid.
- the mutation of a single amino acid in selected areas of the CH2 domain may be enough to substantially reduce Fc binding and thereby increase cancer cell localization and/or tumor penetration.
- Such partial deletions of the constant regions may improve selected characteristics of the antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact.
- the constant regions of the disclosed antibodies may be modified through the mutation or substitution of one or more amino acids that enhances the profile of the resulting construct.
- the modified antibodies comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as decreasing or increasing effector function or provide for more cytotoxin or carbohydrate attachment sites.
- the constant region mediates several effector functions. For example, binding of the CI component of complement to the Fc region of IgG or IgM antibodies (bound to antigen) activates the complement system. Activation of complement is important in the opsonization and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and can also be involved in autoimmune hypersensitivity.
- the Fc region of an antibody can bind a cell expressing a Fc receptor (FcR).
- Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells, release of inflammatory mediators, placental transfer, and control of immunoglobulin production.
- IgG gamma receptors
- IgE epsilon receptors
- IgA alpha receptors
- IgM mi receptors
- the Wnt pathway inhibitors are antibodies that provide for altered effector functions. These altered effector functions may affect the biological profile of the administered antibody.
- the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating modified antibody (e.g., anti-FZD antibody) thereby increasing cancer cell localization and/or tumor penetration.
- the constant region modifications increase or reduce the serum half-life of the antibody.
- the constant region is modified to eliminate disulfide linkages or oligosaccharide moieties. Modifications to the constant region in accordance with this invention may easily be made using well known biochemical or molecular engineering techniques well within the purview of the skilled artisan.
- a Wnt pathway inhibitor is an antibody does not have one or more effector functions.
- the antibody has no ADCC activity, and/or no CDC activity.
- the antibody does not bind an Fc receptor, and/or complement factors.
- the antibody has no effector function.
- the present invention further embraces variants and equivalents which are substantially homologous to the chimeric, humanized, and human antibodies, or antibody fragments thereof, set forth herein.
- These can contain, for example, conservative substitution mutations, i.e. the substitution of one or more amino acids by similar amino acids.
- conservative substitution refers to the substitution of an amino acid with another within the same general class such as, for example, one acidic amino acid with another acidic amino acid, one basic amino acid with another basic amino acid or one neutral amino acid by another neutral amino acid. What is intended by a conservative amino acid substitution is well known in the art and described herein.
- the antibodies described herein are isolated. In certain embodiments, the antibodies described herein are substantially pure.
- the Wnt pathway inhibitors are polypeptides.
- the polypeptides can be recombinant polypeptides, natural polypeptides, or synthetic polypeptides comprising an antibody, or fragment thereof, that bind at least one human FZD protein or at least one Wnt protein. It will be recognized in the art that some amino acid sequences of the invention can be varied without significant effect on the structure or function of the protein.
- the invention further includes variations of the polypeptides which show substantial activity or which include regions of an antibody, or fragment thereof, against a human FZD protein or a Wnt protein.
- amino acid sequence variations of FZD-binding polypeptides or Wnt-binding polypeptides include deletions, insertions, inversions, repeats, and/or other types of substitutions.
- the polypeptides, analogs and variants thereof, can be further modified to contain additional chemical moieties not normally part of the polypeptide.
- the derivatized moieties can improve the solubility, the biological half-life, and/or absorption of the polypeptide.
- the moieties can also reduce or eliminate any undesirable side effects of the polypeptides and variants.
- An overview for chemical moieties can be found in Remington: The Science and Practice of Pharmacy, 22st Edition, 2012, Pharmaceutical Press, London.
- the isolated polypeptides that can be used in the methods described herein can be produced by any suitable method known in the art. Such methods range from direct protein synthesis methods to constructing a DNA sequence encoding polypeptide sequences and expressing those sequences in a suitable host.
- a DNA sequence is constructed using recombinant technology by isolating or synthesizing a DNA sequence encoding a wild-type protein of interest.
- the sequence can be mutagenized by site-specific mutagenesis to provide functional analogs thereof.
- a DNA sequence encoding a polypeptide of interest may be constructed by chemical synthesis using an oligonucleotide synthesizer. Oligonucleotides can be designed based on the amino acid sequence of the desired polypeptide and selecting those codons that are favored in the host cell in which the recombinant polypeptide of interest will be produced.
- Standard methods can be applied to synthesize a polynucleotide sequence encoding an isolated polypeptide of interest. For example, a complete amino acid sequence can be used to construct a back-translated gene. Further, a DNA oligomer containing a nucleotide sequence coding for the particular isolated polypeptide can be synthesized. For example, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. The individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
- the polynucleotide sequences encoding a particular polypeptide of interest can be inserted into an expression vector and operatively linked to an expression control sequence appropriate for expression of the protein in a desired host. Proper assembly can be confirmed by nucleotide sequencing, restriction enzyme mapping, and/or expression of a biologically active polypeptide in a suitable host. As is well-known in the art, in order to obtain high expression levels of a transfected gene in a host, the gene must be operatively linked to transcriptional and translational expression control sequences that are functional in the chosen expression host.
- recombinant expression vectors are used to amplify and express DNA encoding binding agents (e.g., antibodies or soluble receptors), or fragments thereof, against a human FZD protein or a Wnt protein.
- binding agents e.g., antibodies or soluble receptors
- recombinant expression vectors can be replicable DNA constructs which have synthetic or cDNA-derived DNA fragments encoding a polypeptide chain of a FZD-binding agent, a Wnt-binding agent, an anti-FZD antibody or fragment thereof, an anti-Wnt antibody or fragment thereof, or a FZD-Fc soluble receptor operatively linked to suitable transcriptional and/or translational regulatory elements derived from mammalian, microbial, viral or insect genes.
- a transcriptional unit generally comprises an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, transcriptional promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (3) appropriate transcription and translation initiation and termination sequences.
- DNA regions are "operatively linked" when they are functionally related to each other.
- DNA for a signal peptide secretory leader
- a promoter is operatively linked to a coding sequence if it controls the transcription of the sequence
- a ribosome binding site is operatively linked to a coding sequence if it is positioned so as to permit translation.
- structural elements intended for use in yeast expression systems include a leader sequence enabling extracellular secretion of translated protein by a host cell.
- recombinant protein when expressed without a leader or transport sequence, it can include an N-terminal methionine residue. This residue can optionally be subsequently cleaved from the expressed recombinant protein to provide a final product.
- Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus, and cytomegalovirus.
- Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E. coli, including pCRl, pBR322, pMB9 and their derivatives, and wider host range plasmids, such as Ml 3 and other filamentous single-stranded DNA phages.
- Suitable host cells for expression of a FZD-binding or Wnt-binding agent include prokaryotes, yeast cells, insect cells, or higher eukaryotic cells under the control of appropriate promoters.
- Prokaryotes include gram-negative or gram-positive organisms, for example E. coli or Bacillus.
- Higher eukaryotic cells include established cell lines of mammalian origin as described below. Cell- free translation systems may also be employed.
- Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are well- known in the art. Additional information regarding methods of protein production, including antibody production, can be found, e.g., in U.S. Patent Publication No. 2008/0187954, U.S. Patent Nos.
- mammalian host cell lines include COS-7 (monkey kidney-derived), L-929 (murine fibroblast- derived), CI 27 (murine mammary tumor-derived), 3T3 (murine fibroblast-derived), CHO (Chinese hamster ovary-derived), HeLa (human cervical cancer-derived), BHK (hamster kidney fibroblast- derived), HEK-293 (human embryonic kidney-derived) cell lines and variants thereof.
- Mammalian expression vectors can comprise non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking non-transcribed sequences, and 5' or 3' non-translated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
- non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking non-transcribed sequences, and 5' or 3' non-translated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
- Baculovirus systems for production of heterologous proteins in insect cells are well-known to those of skill in the art (see, e.g., Luckow and Summers, 1988, Bio/Technology, 6:47).
- the present invention provides cells comprising the FZD-binding agents or the Wnt- binding agents described herein.
- the cells produce the binding agents (e.g., antibodies or soluble receptors) described herein.
- the cells produce an antibody.
- the cells produce antibody OMP-18R5.
- the cells produce a soluble receptor.
- the cells produce a FZD-Fc soluble receptor.
- the cells produce a FZD8-Fc soluble receptor.
- the cells produce FZD8-Fc soluble receptor 54F28.
- the proteins produced by a transformed host can be purified according to any suitable method.
- Standard methods include chromatography (e.g., ion exchange, affinity, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for protein purification.
- Affinity tags such as hexa-histidine, maltose binding domain, influenza coat sequence, and glutathione-S-transferase can be attached to the protein to allow easy purification by passage over an appropriate affinity column.
- Isolated proteins can also be physically characterized using such techniques as proteolysis, mass spectrometry (MS), nuclear magnetic resonance (NMR), high performance liquid chromatography (HPLC), and x-ray crystallography.
- supernatants from expression systems which secrete recombinant protein into culture media can be first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable purification matrix.
- a suitable purification matrix for example, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups.
- the matrices can be acrylamide, agarose, dextran, cellulose, or other types commonly employed in protein purification.
- a cation exchange step can be employed.
- Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups.
- a hydroxyapatite media can be employed, including but not limited to, ceramic hydroxyapatite (CHT).
- CHT ceramic hydroxyapatite
- one or more reverse-phase HPLC steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups can be employed to further purify a binding agent.
- hydrophobic RP-HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
- Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein.
- recombinant protein produced in bacterial culture can be isolated, for example, by initial extraction from cell pellets, followed by one or more concentration, salting-out, aqueous ion exchange, or size exclusion chromatography steps. HPLC can be employed for final purification steps.
- Microbial cells employed in expression of a recombinant protein can be disrupted by any convenient method, including freeze -thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
- Methods known in the art for purifying antibodies and other proteins also include, for example, those described in U.S. Patent Publication Nos. 2008/0312425, 2008/0177048, and
- the Wnt-binding agent or the FZD-binding agent is a polypeptide that is not an antibody.
- polypeptides that bind with high affinity to a protein target are known in the art. See, e.g., Skerra, 2007, Curr. Opin. Biotechnol., 18:295-304; Hosse et al., 2006, Protein Science, 15: 14-27; Gill et al., 2006, Curr. Opin. Biotechnol, 17:653-658; Nygren, 2008, FEBSJ., 275:2668-76; and Skerra, 2008, FEBSJ., 275:2677-83.
- phage display technology may be used to produce and/or identify a FZD-binding or Wnt-binding polypeptide.
- the polypeptide comprises a protein scaffold of a type selected from the group consisting of protein A, protein G, a lipocalin, a fibronectin domain, an ankyrin consensus repeat domain, and thioredoxin.
- the binding agents can be used in any one of a number of conjugated (i.e. an immunoconjugate or radioconjugate) or non-conjugated forms.
- conjugated i.e. an immunoconjugate or radioconjugate
- non-conjugated forms i.e. antibodies can be used in a non-conjugated form to harness the subject's natural defense mechanisms including complement-dependent cytotoxicity and antibody dependent cellular toxicity to eliminate the malignant or cancer cells.
- the binding agent is conjugated to a cytotoxic agent.
- the cytotoxic agent is a chemotherapeutic agent including, but not limited to, methotrexate, adriamicin, doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents.
- the cytotoxic agent is an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof, including, but not limited to, diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain, ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor, curcin, crotin, Sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
- the cytotoxic agent is a radioisotope to produce a
- radioconjugate or a radioconjugated antibody A variety of radionuclides are available for the production of radioconjugated antibodies including, but not limited to, Y, I, I, I, In, In, 105 Rh, 153 Sm, 67 Cu, 67 Ga, 166 Ho, 177 Lu, 186 Re, 188 Re and 212 Bi.
- conjugates of an antibody and one or more small molecule toxins such as a calicheamicin, maytansinoids, a trichothene, and CC1065, and the derivatives of these toxins that have toxin activity, can be produced.
- conjugates of an antibody and a cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyidithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p- diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2,4-dinitrobenzene).
- SPDP N-succinimidyl
- the Wnt pathway inhibitor (e.g., antibody or soluble receptor) is an antagonist of at least one Wnt protein (i.e., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 Wnt proteins).
- the Wnt pathway inhibitor inhibits activity of the Wnt protein(s) to which it binds.
- the Wnt pathway inhibitor inhibits at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100% of the activity of the human Wnt protein(s) to which it binds.
- the Wnt pathway inhibitor (e.g., antibody or soluble receptor) inhibits binding of at least one human Wnt to an appropriate receptor. In certain embodiments, the Wnt pathway inhibitor inhibits binding of at least one human Wnt protein to one or more human FZD proteins.
- the at least one Wnt protein is selected from the group consisting of: Wntl , Wnt2, Wnt2b/13, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wntl Oa, Wntl Ob, Wntl 1 , and Wntl 6.
- the one or more human FZD proteins are selected from the group consisting of: FZD 1 , FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9, and FZD 10.
- the Wnt pathway inhibitor inhibits binding of one or more Wnt proteins to FZD 1 , FZD2, FZD4, FZD5, FZD7, and/or FZD8. In certain embodiments, the Wnt pathway inhibitor inhibits binding of one or more Wnt proteins to FZD8.
- the inhibition of binding of a particular Wnt to a FZD protein by a Wnt pathway inhibitor is at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%), or at least about 95%.
- an agent that inhibits binding of a Wnt to a FZD protein also inhibits Wnt pathway signaling.
- a Wnt pathway inhibitor that inhibits human Wnt pathway signaling is an antibody.
- a Wnt pathway inhibitor that inhibits human Wnt pathway signaling is a FZD-Fc soluble receptor.
- a Wnt pathway inhibitor that inhibits human Wnt pathway signaling is a FZD8-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits human Wnt pathway signaling is soluble receptor 54F28.
- the Wnt pathway inhibitors are antagonists of at least one human Wnt protein and inhibit Wnt activity.
- the Wnt pathway inhibitor inhibits Wnt activity by at least about 10%, at least about 20%), at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100%.
- the Wnt pathway inhibitor inhibits activity of one, two, three, four, five or more Wnt proteins.
- the Wnt pathway inhibitor inhibits activity of at least one human Wnt protein selected from the group consisting of: Wntl , Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wntl Oa, Wntl Ob, Wntl 1 , and Wntl 6.
- Wntl Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wntl Oa, Wntl Ob, Wntl 1 , and Wntl 6.
- the Wnt-binding agent binds at least one Wnt protein selected from the group consisting of Wntl , Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, WntlOa, and Wntl Ob.
- the at least one Wnt protein is selected from the group consisting of Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt8a, Wnt8b, Wntl Oa, and Wntl Ob.
- a Wnt pathway inhibitor that inhibits human Wnt activity is an antibody.
- a Wnt pathway inhibitor that inhibits human Wnt activity is a FZD-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits human Wnt activity is a FZD8-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits human Wnt activity is soluble receptor 54F28.
- the Wnt pathway inhibitor described herein is an antagonist of at least one human FZD protein and inhibits FZD activity. In certain embodiments, the Wnt pathway inhibitor inhibits FZD activity by at least about 10%, at least about 20%, at least about 30%, at least about 50%), at least about 75%, at least about 90%>, or about 100%. In some embodiments, the Wnt pathway inhibitor inhibits activity of one, two, three, four, five or more FZD proteins.
- the Wnt pathway inhibitor inhibits activity of at least one human FZD protein selected from the group consisting of: FZD 1 , FZD2, FZD3, FZD4, FZD 5, FZD6, FZD7, FZD 8, FZD9, and FZD 10.
- the Wnt pathway inhibitor inhibits activity of FZD 1 , FZD2, FZD4, FZD5, FZD7, and/or FZD8.
- the Wnt pathway inhibitor inhibits activity of FZD8.
- the Wnt pathway inhibitor is an anti-FZD antibody.
- the Wnt pathway inhibitor is anti-FZD antibody OMP- 18R5.
- the Wnt pathway inhibitor described herein is an antagonist of at least one human Wnt protein and inhibits Wnt signaling. In certain embodiments, the Wnt pathway inhibitor inhibits Wnt signaling by at least about 10%>, at least about 20%, at least about 30%>, at least about 50%), at least about 75%, at least about 90%, or about 100%). In some embodiments, the Wnt pathway inhibitor inhibits signaling by one, two, three, four, five or more Wnt proteins.
- the Wnt pathway inhibitor inhibits signaling of at least one Wnt protein selected from the group consisting of Wnt 1 , Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt 10a, and Wntl Ob.
- a Wnt pathway inhibitor that inhibits Wnt signaling is an antibody.
- a Wnt pathway inhibitor that inhibits Wnt signaling is a soluble receptor.
- a Wnt pathway inhibitor that inhibits Wnt signaling is a FZD-Fc soluble receptor.
- a Wnt pathway inhibitor that inhibits Wnt signaling is a FZD8-Fc soluble receptor.
- a Wnt pathway inhibitor that inhibits Wnt signaling is soluble receptor 54F28.
- a Wnt pathway inhibitor described herein is an antagonist of ⁇ - catenin signaling.
- the Wnt pathway inhibitor inhibits ⁇ -catenin signaling by at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100%.
- a Wnt pathway inhibitor that inhibits ⁇ - catenin signaling is an antibody.
- a Wnt pathway inhibitor that inhibits ⁇ - catenin signaling is an anti-FZD antibody.
- a Wnt pathway inhibitor that inhibits ⁇ -catenin signaling is antibody OMP- 18R5.
- a Wnt pathway inhibitor that inhibits ⁇ -catenin signaling is a soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits ⁇ -catenin signaling is a FZD-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits ⁇ -catenin signaling is a FZD8-Fc soluble receptor.
- the Wnt pathway inhibitor described herein inhibits binding of at least one Wnt protein to a receptor. In certain embodiments, the Wnt pathway inhibitor inhibits binding of at least one human Wnt protein to one or more of its receptors. In some embodiments, the Wnt pathway inhibitor inhibits binding of at least one Wnt protein to at least one FZD protein. In some embodiments, the Wnt-binding agent inhibits binding of at least one Wnt protein to FZD 1 , FZD2, FZD3, FZD4, FDZ5, FDZ6, FDZ7, FDZ8, FDZ9, and/or FZD 10.
- the inhibition of binding of at least one Wnt to at least one FZD protein is at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 95%.
- a Wnt pathway inhibitor that inhibits binding of at least one Wnt to at least one FZD protein further inhibits Wnt pathway signaling and/or ⁇ -catenin signaling.
- a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is an antibody.
- a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is an anti-FZD antibody.
- a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is antibody OMP-18R5. In certain embodiments, a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is a soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is a FZD-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is a FZD8-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that inhibits binding of at least one human Wnt to at least one FZD protein is FZD8-Fc soluble receptor 54F28.
- the Wnt pathway inhibitor described herein blocks binding of at least one Wnt to a receptor.
- the Wnt pathway inhibitor blocks binding of at least one human Wnt protein to one or more of its receptors.
- the Wnt pathway inhibitor blocks binding of at least one Wnt to at least one FZD protein.
- the Wnt pathway inhibitor blocks binding of at least one Wnt protein to FZD1, FZD2, FZD3, FZD4, FDZ5, FDZ6, FDZ7, FDZ8, FDZ9, and/or FZD10.
- the blocking of binding of at least one Wnt to at least one FZD protein is at least about 10%, at least about 25%, at least about 50%), at least about 75%, at least about 90%, or at least about 95%.
- a Wnt pathway inhibitor that blocks binding of at least one Wnt protein to at least one FZD protein further inhibits Wnt pathway signaling and/or ⁇ -catenin signaling.
- a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is an antibody.
- a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is an anti-FZD antibody.
- a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is antibody OMP-18R5. In certain embodiments, a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is a soluble receptor. In certain embodiments, a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is a FZD-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is a FZD8-Fc soluble receptor. In certain embodiments, a Wnt pathway inhibitor that blocks binding of at least one human Wnt to at least one FZD protein is soluble receptor 54F28.
- the Wnt pathway inhibitor described herein inhibits Wnt pathway signaling. It is understood that a Wnt pathway inhibitor that inhibits Wnt pathway signaling may, in certain embodiments, inhibit signaling by one or more receptors in the Wnt signaling pathway but not necessarily inhibit signaling by all receptors. In certain alternative embodiments, Wnt pathway signaling by all human receptors may be inhibited. In certain embodiments, Wnt pathway signaling by one or more receptors selected from the group consisting of FZD 1, FZD2, FZD3, FZD4, FDZ5, FDZ6, FDZ7, FDZ8, FDZ9, and FZD 10 is inhibited.
- the inhibition of Wnt pathway signaling by a Wnt pathway inhibitor is a reduction in the level of Wnt pathway signaling of at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 95%.
- a Wnt pathway inhibitor that inhibits Wnt pathway signaling is an antibody.
- a Wnt pathway inhibitor that inhibits Wnt pathway signaling is an anti-FZD antibody.
- a Wnt pathway inhibitor that inhibits Wnt pathway signaling is antibody OMP-18R5.
- a Wnt pathway inhibitor that inhibits Wnt pathway signaling is a soluble receptor.
- a Wnt pathway inhibitor that inhibits Wnt pathway signaling is a FZD-Fc soluble receptor. In some embodiments, a Wnt pathway inhibitor that inhibits Wnt pathway signaling is a FZD8-Fc soluble receptor. In some embodiments, a Wnt pathway inhibitor that inhibits Wnt pathway signaling is soluble receptor 54F28.
- the Wnt pathway inhibitor described herein inhibits activation of ⁇ - catenin. It is understood that a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin may, in certain embodiments, inhibit activation of ⁇ -catenin by one or more receptors, but not necessarily inhibit activation of ⁇ -catenin by all receptors. In certain alternative embodiments, activation of ⁇ - catenin by all human receptors may be inhibited.
- activation of ⁇ -catenin by one or more receptors selected from the group consisting of FZD 1, FZD2, FZD3, FZD4, FDZ5, FDZ6, FDZ7, FDZ8, FDZ9, and FZD 10 is inhibited.
- the inhibition of activation of ⁇ -catenin by a Wnt-binding agent is a reduction in the level of activation of ⁇ -catenin of at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 95%.
- a Wnt pathway inhibitor that inhibits activation of ⁇ - catenin is an antibody.
- a Wnt pathway inhibitor that inhibits activation of ⁇ - catenin is an anti-FZD antibody. In some embodiments, a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin is antibody OMP- 18R5. In some embodiments, a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin is a soluble receptor. In some embodiments, a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin is a FZD-Fc soluble receptor. In some embodiments, a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin is a FZD8-Fc soluble receptor. In some embodiments, a Wnt pathway inhibitor that inhibits activation of ⁇ -catenin is soluble receptor 54F28.
- TCF/Luc reporter vector containing multiple copies of the TCF-binding domain upstream of a firefly luciferase reporter gene may be used to measure ⁇ -catenin signaling levels in vitro (Gazit et al., 1999, Oncogene, 18; 5959-66; TOPflash, Millipore, Billerica MA).
- the level of ⁇ -catenin signaling in the presence of one or more Wnt proteins e.g., Wnt(s) expressed by transfected cells or provided by Wnt- conditioned media
- Wnt proteins e.g., Wnt(s) expressed by transfected cells or provided by Wnt- conditioned media
- the effect of a binding agent (or candidate agent) on ⁇ -catenin signaling may be measured in vitro or in vivo by measuring the effect of the agent on the level of expression of ⁇ -catenin-regulated genes, such as c-myc (He et al., 1998, Science, 281 : 1509-12), cyclin Dl (Tetsu et al., 1999, Nature, 398:422-6), and/or fibronectin (Gradl et al. 1999, Mol. Cell Biol., 19:5576-87).
- c-myc He et al., 1998, Science, 281 : 1509-12
- cyclin Dl Tetsu et al., 1999, Nature, 398:422-66
- fibronectin fibronectin
- the effect of a binding agent on ⁇ - catenin signaling may also be assessed by measuring the effect of the agent on the phosphorylation state of Dishevelled- 1, Dishevelled-2, Dishevelled-3, LRP5, LRP6, and/or ⁇ -catenin.
- a Wnt pathway inhibitor has one or more of the following effects: inhibit proliferation of tumor cells, inhibit tumor growth, reduce the frequency of cancer stem cells in a tumor, reduce the tumorigenicity of a tumor, reduce the tumorigenicity of a tumor by reducing the frequency of cancer stem cells in the tumor, trigger cell death of tumor cells, induce cells in a tumor to differentiate, differentiate tumorigenic cells to a non-tumorigenic state, induce expression of differentiation markers in the tumor cells, prevent metastasis of tumor cells, or decrease survival of tumor cells.
- a Wnt pathway inhibitor is capable of inhibiting tumor growth.
- a Wnt pathway inhibitor is capable of inhibiting tumor growth in vivo (e.g., in a xenograft mouse model, and/or in a human having cancer).
- the tumor is a tumor selected from the group consisting of colorectal tumor, colon tumor, pancreatic tumor, lung tumor, ovarian tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, glioblastoma, and head and neck tumor.
- the tumor is melanoma.
- the tumor is a colorectal tumor.
- the tumor is a pancreatic tumor.
- the tumor is a breast tumor.
- the tumor is a Wnt-dependent tumor.
- a Wnt pathway inhibitor is capable of reducing the tumorigenicity of a tumor.
- a Wnt pathway inhibitor is capable of reducing the tumorigenicity of a tumor comprising cancer stem cells in an animal model, such as a mouse xenograft model.
- the number or frequency of cancer stem cells in a tumor is reduced by at least about two-fold, about three-fold, about five-fold, about ten- fold, about 50-fold, about 100-fold, or about 1000-fold.
- the reduction in the number or frequency of cancer stem cells is determined by limiting dilution assay using an animal model.
- the Wnt pathway inhibitors described herein are active in vivo for at least 1 hour, at least about 2 hours, at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- the Wnt pathway inhibitor is an IgG (e.g., IgGl or IgG2) antibody that is active in vivo for at least 1 hour, at least about 2 hours, at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- the Wnt pathway inhibitor is a fusion protein that is active in vivo for at least 1 hour, at least about 2 hours, at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- the Wnt pathway inhibitors described herein have a circulating half- life in mice, cynomolgus monkeys, or humans of at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- the Wnt pathway inhibitor is an IgG (e.g., IgGl or IgG2) antibody that has a circulating half-life in mice, cynomolgus monkeys, or humans of at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- the Wnt pathway inhibitor is a fusion protein that has a circulating half-life in mice, cynomolgus monkeys, or humans of at least about 5 hours, at least about 10 hours, at least about 24 hours, at least about 2 days, at least about 3 days, at least about 1 week, or at least about 2 weeks.
- Methods of increasing (or decreasing) the half-life of agents such as polypeptides and antibodies are known in the art.
- known methods of increasing the circulating half- life of IgG antibodies include the introduction of mutations in the Fc region which increase the pH-dependent binding of the antibody to the neonatal Fc receptor (FcRn) at pH 6.0 (see, e.g., U.S. Patent Publication Nos. 2005/0276799, 2007/0148164, and 2007/0122403).
- Known methods of increasing the circulating half-life of antibody fragments lacking the Fc region include such techniques as PEGylation.
- Kits for practicing the methods of the invention are further provided.
- kit any manufacture (e.g., a package or a container) comprising at least one reagent, e.g., an antibody, a nucleic acid probe, etc. for specifically detecting the expression of at least one biomarker of the invention.
- the kit may be promoted, distributed, and/or sold as a unit for performing the methods of the present invention.
- the kits may contain a package insert describing the kit and including instructional material for its use.
- a kit comprises reagents for practicing the methods of the invention using microarray technology. In some embodiments, a kit comprises reagents for practicing the methods of the invention using qPCR assays. Positive and/or negative controls may be included in the kits to validate the activity and correct usage of reagents employed in accordance with the invention. Controls may include samples known to be either positive or negative for the presence of the biomarker of interest, or other samples comprising the biomarkers of interest. The design and use of controls is standard and well within the routine capabilities of those in the art.
- a kit comprises polynucleotides selected from the group consisting of SEQ ID NOs:62-79.
- a kit comprises (a) a forward primer of SEQ ID NO:62, a reverse primer of SEQ ID NO:63, and a probe comprising SEQ ID NO:64; (b) a forward primer of SEQ ID NO:65, a reverse primer of SEQ ID NO:66, and a probe comprising SEQ ID NO:67; (c) a forward primer of SEQ ID NO:68, a reverse primer of SEQ ID NO:69, and a probe comprising SEQ ID NO:70; (d) a forward primer of SEQ ID NO:71, a reverse primer of SEQ ID NO:72, and a probe comprising SEQ ID NO:73; (e) a forward primer of SEQ ID NO:74, a reverse primer of SEQ ID NO:75, and a probe comprising SEQ ID NO:76; and (f) a forward primer primer of SEQ ID NO:62, a reverse
- Embodiments of the present disclosure can be further defined by reference to the following non-limiting examples, which describe in detail preparation of certain antibodies of the present disclosure and methods for using antibodies of the present disclosure. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the present disclosure.
- the breast tumor xenograft models OMP-B34, OMP-B39, OMP-B44, OMP-B59, OMP-B60, UM-TOl, UM-T03, and UM-PE13 were established at OncoMed Pharmaceuticals or the University of Michigan from minimally passaged, patient-derived tumor specimens. Six- to 8-week-old
- a tumor was responsive to anti-FZD antibody OMP-18R5
- single agent tumor volume data was compared with the control while combination treatment with OMP-18R5 and taxol was compared with taxol as a single agent.
- a "responder" tumor was defined as a tumor showing significantly greater tumor growth inhibition with the combination of OMP-18R5 and taxol as compared to tumor growth inhibition with taxol as single agent.
- Analyses were performed using genes from several signaling pathways including canonical, planar cell polarity, Wnt/Ca+2, Wnt signaling negative regulation, cell fate, tissue polarity, cell growth and proliferation, cell migration, cell cycle, and cellular homeostasis (see Table 2).
- GSK3A Glycogen synthase kinase-3 alpha
- RhoU Rho-related GTP-binding protein
- Support Vector Machines - Recursive Feature Elimination (SVM-RFE) methods were used to identify genes that could distinguish between the responder and non-responder tumors and Support Vector Machine (SVM) methods (Cortes and Vapnik, 1995, Machine Learning, 20:273-297) were used for classification.
- SVM Support Vector Machine
- a leave-one-out cross- validation (LOOCV) method was used to select the number of genes and also to measure positive predictive value (PPV), negative predictive value (NPV), sensitivity, and specificity of the models.
- PCA principal component analysis
- FIG. 3 shows that the 6-gene biomarker signature resulted in a near perfect separation of the 8 breast tumors.
- RTV ratio of tumor volume
- decision values were determined from the SVM model based on the training data.
- decision values can be calculated by a weighted sum of the standardized expression of the 6 genes: 0.4560427*FBXW2 + 0.3378467*CCND2 - 0.4809354*RHOU +
- a positive decision value indicated a tumor predicted to be a responder while a negative decision value indicated a tumor predicted to be a non-responder.
- classification probabilities can be obtained by fitting a logistic regression on the decision values. Tumors associated with probabilities higher than 0.5 would be predicted to be a responder while tumors with probabilities lower than 0.5 would be predicted to be a non-responder.
- Example 1 Six additional breast cancer tumors were selected from the OncoMed Tumor Bank and microarray analyses were performed as described in Example 1.
- the six breast cancer tumors were OMP-B29, OMP-B71, OMP-B84, OMP-B90, UM-T02, and UM-T06.
- classification probability analysis was used with the 6-gene biomarker signature to predict the response of each of these tumors to treatment with anti-FZD antibody OMP-18R5 in combination with taxol (see Figure 5).
- the six tumors were evaluated in in vivo xenograft models as described in Example 1 (see Figures 6A-F).
- a "responder" in the in vivo models is a tumor showing significantly greater tumor growth inhibition with the combination of OMP-18R5 and taxol as compared to tumor growth inhibition with taxol as single agent.
- the predictions based on classification probabilities were compared to the results of the in vivo xenograft models. The results are summarized in Table 3.
- Prevalence of a biomarker signature can be defined as the proportion of a population predicted to be a responder based upon the biomarker signature.
- the prevalence of the 6-gene biomarker signature in HER2 negative (HER2-) and triple negative breast cancer (TNBC) populations was estimated by applying the 6-gene biomarker signature to three publicly available breast cancer microarray data sets.
- the Cremoux2001 dataset was compiled from Affymetrix U133plus2 microarrays with 226 patients, including 145 HER2- and 81 HER2+, where 51 TNBC were included within the HER2- group.
- the Wang201 1 dataset was compiled from Affymetrix U133plus2 microarrays with 1 15 patients, including 79 HER2- and 36 HER2+, where 28 TNBC were included within the HER2- group.
- the Prat2010 dataset was compiled from Agilent Human 1A microarrays with 333 patients, including 215 HER2- and 1 18 HER2+, where 57 TNBC were included within the HER2- group.
- Pre-processing of the public data included downloading the data, extracting the probe sets mapping to the six genes, and collapsing the probe sets to the six genes.
- Gene level expression data was further standardized by subtracting the mean and dividing by the standard deviation of each gene in the public data.
- the SVM model built upon the training data was used to classify the public data. Classification probabilities were obtained and the proportion of predicted responders
- qPCR assays were developed to determine the expression levels of FBXW2, CCND2, RHOU, CTBP2, WIF1, and DKK1 in a tumor sample.
- Primers and probes were designed using publicly available niRNA sequences. The primers and probes were generated and used in optimization and validation tests using human fresh frozen (FF) and formalin- fixed paraffin-embedded (FFPE) human tissue samples. The specific primers and probes are listed in Table 4 (all sequences in 5' to 3' direction).
- Four reference genes were used for normalization including TOPI (topoisomerase 1), GUSB (beta-glucuronidase), SDHA (succinate dehydrogenase), and PUM1 (pumilio homolog 1).
- RNA samples were harvested and immediately snap frozen and stored at -80°C prior to RNA isolation.
- Total RNA was extracted using the RNeasy Fibrous Mini Kit (Qiagen, Valencia CA, PN#74704) with TissueLyzer homogenization and DNase I treatment according to the manufacturer's protocol.
- RNAs were visualized on a Bioanalyzer 2100 (Agilent, Santa Clara, CA) and verified to be intact with RIN values > 6.0. All RNAs had A260/A280 ratios > 1.8.
- qPCR was performed in a two-step manner. First, cDNA was synthesized from total RNA using random hexamers as described in Applied Biosystems User Bulletin 2. TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA. Cat # 4304437 and 4326708) was used in subsequent qPCR reactions according to the manufacturer's protocol. Quantities of gene expression were determined using a Ct (cycle threshold) method from triplicate reactions. Cycle threshold is generally considered to be the number of cycles required for a signal to cross the detection threshold. Ct levels are inversely proportional to the amount of target nucleic acid in a sample. Ct of the six genes are normalized using the Ct levels of the four reference genes. Normalized Ct of the 6-gene signature for the 18 xenograft samples is shown in Table 5.
- Decision values can be calculated by a weighted sum of the normalized expression of the 6 genes from data generated from the qPCR assays. These decision values are different than the decision values generated from the analysis based on microarray data, however the predictive capabilities of the two models are very similar.
- OMP-18R5 Light chain variable region amino acid sequence (SEQ ID NO: 8)
- OMP-18R5 Light chain amino acid sequence with predicted signal sequence underlined (SEQ ID NO: 10)
- FZD8-Fc variant 54F03 amino acid sequence (without predicted signal sequence) (SEQ ID NO:39)
- K FZD8-Fc variant 54F16, 54F17, 54F18, 54F23, 54F25, 54F27, 54F29, 54F31, and 54F34 amino acid sequence (without predicted signal sequence) (SEQ ID NO:40)
- FZD8-Fc variant 54F19, 54F20, 54F24, 54F26, 54F28, 54F30, 54F32, 54F34 and 54F35 amino acid sequence (without predicted signal sequence) (SEQ ID NO:41)
- FZD8-Fc variant 54F03 amino acid sequence with signal sequence (SEQ ID NO:42)
- FZD8-Fc variant 54F16 amino acid sequence with signal sequence (SEQ ID NO:43)
- CTBP2 Reverse Primer (SEQ ID NO: 66)
- CTBP2 Probe SEQ ID NO: 67
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2016007066A MX2016007066A (es) | 2013-12-02 | 2014-12-02 | Identificacion de marcadores biologicos predictivos asociados con inhibidores de la via de wnt. |
| US15/101,242 US20160304968A1 (en) | 2013-12-02 | 2014-12-02 | Identification of Predictive Biomarkers Associated With WNT Pathway Inhibitors |
| CA2931975A CA2931975A1 (en) | 2013-12-02 | 2014-12-02 | Identification of predictive biomarkers associated with wnt pathway inhibitors |
| EP14867583.8A EP3077546A4 (en) | 2013-12-02 | 2014-12-02 | Identification of predictive biomarkers associated with wnt pathway inhibitors |
| HK16111927.7A HK1223657A1 (zh) | 2013-12-02 | 2014-12-02 | 與wnt途徑抑制劑有關的預測性生物標記物的鑒別 |
| CN201480065718.7A CN105829547A (zh) | 2013-12-02 | 2014-12-02 | 与Wnt途径抑制剂有关的预测性生物标记物的鉴别 |
| AU2014357354A AU2014357354A1 (en) | 2013-12-02 | 2014-12-02 | Identification of predictive biomarkers associated with Wnt pathway inhibitors |
| JP2016535646A JP2017501137A (ja) | 2013-12-02 | 2014-12-02 | Wnt経路インヒビターに関連する予測バイオマーカーの同定 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361910663P | 2013-12-02 | 2013-12-02 | |
| US61/910,663 | 2013-12-02 | ||
| US201461975339P | 2014-04-04 | 2014-04-04 | |
| US61/975,339 | 2014-04-04 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2015084808A1 true WO2015084808A1 (en) | 2015-06-11 |
| WO2015084808A4 WO2015084808A4 (en) | 2015-08-13 |
Family
ID=53274023
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/068097 Ceased WO2015084808A1 (en) | 2013-12-02 | 2014-12-02 | Identification of predictive biomarkers associated with wnt pathway inhibitors |
Country Status (9)
| Country | Link |
|---|---|
| EP (1) | EP3077546A4 (https=) |
| JP (1) | JP2017501137A (https=) |
| CN (1) | CN105829547A (https=) |
| AU (1) | AU2014357354A1 (https=) |
| CA (1) | CA2931975A1 (https=) |
| HK (1) | HK1223657A1 (https=) |
| MX (1) | MX2016007066A (https=) |
| TW (1) | TW201610168A (https=) |
| WO (1) | WO2015084808A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017023971A1 (en) * | 2015-08-03 | 2017-02-09 | Oncomed Pharmaceuticals, Inc. | Identification of predictive biomarkers associated with wnt pathway inhibitors |
| US9732139B2 (en) | 2005-10-31 | 2017-08-15 | Oncomed Pharmaceuticals, Inc. | Methods of treating cancer by administering a soluble receptor comprising a human Fc domain and the Fri domain from human frizzled receptor |
| US9987357B2 (en) | 2013-02-04 | 2018-06-05 | Oncomed Pharmaceuticals, Inc. | Methods and monitoring of treatment with a WNT pathway inhibitor |
| WO2024189200A1 (en) * | 2023-03-15 | 2024-09-19 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Cancer stratification and treatment |
| US12319730B2 (en) | 2016-10-26 | 2025-06-03 | Leap Therapeutics, Inc. | Use of beta-catenin as a biomarker for treating cancers using anti-Dkk-1 antibody |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2018532720A (ja) * | 2015-09-16 | 2018-11-08 | トビラ セラピューティクス, インコーポレイテッド | 線維症の治療のためのセニクリビロック併用療法 |
| CN106990245B (zh) * | 2017-04-05 | 2018-07-31 | 东南大学 | 检测pitx1表达量的试剂在制备胃癌预后评估试剂盒中的应用 |
| CN110835372B (zh) * | 2019-11-06 | 2020-12-01 | 上海健康医学院 | 一种靶向Frizzled7单克隆抗体及其制备方法与应用 |
| JP7593584B2 (ja) * | 2020-03-10 | 2024-12-03 | 学校法人杏林学園 | 腫瘍細胞マーカー、および腫瘍細胞を検出または回収する方法 |
| CN111735949B (zh) * | 2020-07-17 | 2023-07-21 | 北京信诺卫康科技有限公司 | Wnt7a和CA125联合用作早期卵巢癌生物标志物以及试剂盒 |
| CN115337400A (zh) * | 2021-05-13 | 2022-11-15 | 中国科学院分子细胞科学卓越创新中心 | 诊断和治疗肿瘤的试剂及其用途 |
| CN113293212A (zh) * | 2021-06-17 | 2021-08-24 | 深圳华因康基因科技有限公司 | 一种检测神经母细胞瘤复发转移基因fzd2扩增的引物探针及其应用 |
| JPWO2023113013A1 (https=) * | 2021-12-17 | 2023-06-22 |
Citations (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO2001002568A2 (en) * | 1999-07-02 | 2001-01-11 | Chiron Corporation | Human genes and gene expression products |
| US6413746B1 (en) | 1986-03-14 | 2002-07-02 | Lonza Group, Ag | Production of proteins by cell culture |
| WO2004009823A1 (en) | 2002-07-18 | 2004-01-29 | Lonza Biologics Plc. | Method of expressing recombinant protein in cho cells |
| US20040247593A1 (en) * | 2002-10-04 | 2004-12-09 | Regents Of The University Of California, | Methods for treating cancer by inhibiting Wnt signaling |
| US20050276799A1 (en) | 2002-10-15 | 2005-12-15 | Hinton Paul R | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US20070122403A1 (en) | 2000-12-12 | 2007-05-31 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
| US20070148164A1 (en) | 2003-11-12 | 2007-06-28 | Biogen Idec Ma Inc. | Neonatal Fc receptor (FcRn)-binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
| US20080064049A1 (en) | 2005-10-31 | 2008-03-13 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| WO2008039071A2 (en) * | 2006-09-29 | 2008-04-03 | Agendia B.V. | High-throughput diagnostic testing using arrays |
| WO2008042236A2 (en) | 2006-09-29 | 2008-04-10 | Oncomed Pharmaceuticals, Inc. | Compositions and methods for diagnosing and treating cancer |
| US20080178305A1 (en) | 2000-08-03 | 2008-07-24 | The Regents Of The University Of Michigan | Isolation And Use Of Solid Tumor Stem Cells |
| US20080177048A1 (en) | 2007-01-09 | 2008-07-24 | Bio-Rad Laboratories, Inc. | Enhanced capacity and purification of antibodies by mixed mode chromatography in the presence of aqueous-soluble nonionic organic polymers |
| US20080187954A1 (en) | 2004-03-10 | 2008-08-07 | Lonza Ltd. | Method For Producing Antibodies |
| US20080312425A1 (en) | 2004-08-30 | 2008-12-18 | Lonza Biologics Plc. | Ion Exchange Chromatography and Purification of Antibodies |
| US20090187005A1 (en) | 2008-01-18 | 2009-07-23 | Gagnon Peter S | Enhanced purification of antibodies and antibody fragments by apatite chromatography |
| US7723477B2 (en) | 2005-10-31 | 2010-05-25 | Oncomed Pharmaceuticals, Inc. | Compositions and methods for inhibiting Wnt-dependent solid tumor cell growth |
| US20100169025A1 (en) * | 2008-10-10 | 2010-07-01 | Arthur William T | Methods and gene expression signature for wnt/b-catenin signaling pathway |
| US7947277B2 (en) | 2006-09-08 | 2011-05-24 | Genentech, Inc. | Wnt antagonists and their use in the diagnosis and treatment of Wnt-mediated disorders |
| US7982013B2 (en) | 2008-09-26 | 2011-07-19 | Oncomed Pharmaceuticals, Inc. | Frizzled-binding agents and uses thereof |
| WO2011088127A1 (en) | 2010-01-12 | 2011-07-21 | Oncomed Pharmaceuticals, Inc. | Wnt-binding agents and uses thereof |
| US20130034551A2 (en) | 2010-01-12 | 2013-02-07 | Oncomed Pharmaceuticals, Inc. | Wnt Antagonists and Methods of Treatment and Screening |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120053079A1 (en) * | 2009-03-06 | 2012-03-01 | University Of South Alabama | Methods and compositions for the diagnosis, prognosis and treatment of cancer |
| EP2788378A4 (en) * | 2011-12-09 | 2015-09-09 | Oncomed Pharm Inc | COMBINATION THERAPY FOR CANCER TREATMENT |
-
2014
- 2014-12-02 CA CA2931975A patent/CA2931975A1/en not_active Abandoned
- 2014-12-02 AU AU2014357354A patent/AU2014357354A1/en not_active Abandoned
- 2014-12-02 WO PCT/US2014/068097 patent/WO2015084808A1/en not_active Ceased
- 2014-12-02 HK HK16111927.7A patent/HK1223657A1/zh unknown
- 2014-12-02 TW TW103141799A patent/TW201610168A/zh unknown
- 2014-12-02 EP EP14867583.8A patent/EP3077546A4/en not_active Withdrawn
- 2014-12-02 MX MX2016007066A patent/MX2016007066A/es unknown
- 2014-12-02 CN CN201480065718.7A patent/CN105829547A/zh active Pending
- 2014-12-02 JP JP2016535646A patent/JP2017501137A/ja active Pending
Patent Citations (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6413746B1 (en) | 1986-03-14 | 2002-07-02 | Lonza Group, Ag | Production of proteins by cell culture |
| US6660501B2 (en) | 1986-03-14 | 2003-12-09 | Lonza Group, Ag | Production of proteins by cell culture |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| WO2001002568A2 (en) * | 1999-07-02 | 2001-01-11 | Chiron Corporation | Human genes and gene expression products |
| US20080178305A1 (en) | 2000-08-03 | 2008-07-24 | The Regents Of The University Of Michigan | Isolation And Use Of Solid Tumor Stem Cells |
| US20070122403A1 (en) | 2000-12-12 | 2007-05-31 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
| WO2004009823A1 (en) | 2002-07-18 | 2004-01-29 | Lonza Biologics Plc. | Method of expressing recombinant protein in cho cells |
| US20040247593A1 (en) * | 2002-10-04 | 2004-12-09 | Regents Of The University Of California, | Methods for treating cancer by inhibiting Wnt signaling |
| US20050276799A1 (en) | 2002-10-15 | 2005-12-15 | Hinton Paul R | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US20070148164A1 (en) | 2003-11-12 | 2007-06-28 | Biogen Idec Ma Inc. | Neonatal Fc receptor (FcRn)-binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
| US20080187954A1 (en) | 2004-03-10 | 2008-08-07 | Lonza Ltd. | Method For Producing Antibodies |
| US20080312425A1 (en) | 2004-08-30 | 2008-12-18 | Lonza Biologics Plc. | Ion Exchange Chromatography and Purification of Antibodies |
| US20080064049A1 (en) | 2005-10-31 | 2008-03-13 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| US7723477B2 (en) | 2005-10-31 | 2010-05-25 | Oncomed Pharmaceuticals, Inc. | Compositions and methods for inhibiting Wnt-dependent solid tumor cell growth |
| US7947277B2 (en) | 2006-09-08 | 2011-05-24 | Genentech, Inc. | Wnt antagonists and their use in the diagnosis and treatment of Wnt-mediated disorders |
| WO2008042236A2 (en) | 2006-09-29 | 2008-04-10 | Oncomed Pharmaceuticals, Inc. | Compositions and methods for diagnosing and treating cancer |
| WO2008039071A2 (en) * | 2006-09-29 | 2008-04-03 | Agendia B.V. | High-throughput diagnostic testing using arrays |
| US20080177048A1 (en) | 2007-01-09 | 2008-07-24 | Bio-Rad Laboratories, Inc. | Enhanced capacity and purification of antibodies by mixed mode chromatography in the presence of aqueous-soluble nonionic organic polymers |
| US20090187005A1 (en) | 2008-01-18 | 2009-07-23 | Gagnon Peter S | Enhanced purification of antibodies and antibody fragments by apatite chromatography |
| US7982013B2 (en) | 2008-09-26 | 2011-07-19 | Oncomed Pharmaceuticals, Inc. | Frizzled-binding agents and uses thereof |
| US20100169025A1 (en) * | 2008-10-10 | 2010-07-01 | Arthur William T | Methods and gene expression signature for wnt/b-catenin signaling pathway |
| WO2011088127A1 (en) | 2010-01-12 | 2011-07-21 | Oncomed Pharmaceuticals, Inc. | Wnt-binding agents and uses thereof |
| US20130034551A2 (en) | 2010-01-12 | 2013-02-07 | Oncomed Pharmaceuticals, Inc. | Wnt Antagonists and Methods of Treatment and Screening |
Non-Patent Citations (43)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1994, JOHN WILEY & SONS, INC. |
| "Remington: The Science and Practice of Pharmacy", 2012, PHARMACEUTICAL PRESS |
| "The Chemotherapy Source Book", 2008, LIPPINCOTT, WILLIAMS & WILKINS |
| AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948 |
| BEACHY ET AL., NATURE, vol. 432, 2004, pages 324 - 31 |
| BRENNAN; BROWN, J. MAMMARY GLAND BIOL. NEOPLASIA, vol. 9, 2004, pages 119 - 31 |
| CABRERA ET AL., CELL, vol. 50, 1987, pages 659 - 63 |
| CORTES; VAPNIK, MACHINE LEARNING, vol. 20, 1995, pages 273 - 297 |
| GAZIT ET AL., ONCOGENE, vol. 18, 1999, pages 5959 - 66 |
| GILL ET AL., CURR. OPIN. BIOTECHNOL., vol. 17, 2006, pages 653 - 658 |
| GRADL ET AL., MOL. CELL BIOL., vol. 19, 1999, pages 5576 - 87 |
| GUYON ET AL., MACHINE LEARNING, vol. 46, 2002, pages 389 - 422 |
| HARADA ET AL., EMBOJ., vol. 18, 1999, pages 5931 - 42 |
| HATSELL ET AL., J. MAMMARY GLAND BIOL. NEOPLASIA, vol. 8, 2003, pages 145 - 58 |
| HE ET AL., SCIENCE, vol. 281, 1998, pages 1509 - 12 |
| HOSSE ET AL., PROTEIN SCIENCE, vol. 15, 2006, pages 14 - 27 |
| IMBERT ET AL., J. CELL BIOL., vol. 153, 2001, pages 555 - 68 |
| J.W. GODING: "Monoclonal Antibodies: Principles and Practice", 1996, ACADEMIC PRESS |
| KABACIK, S ET AL.: "Gene Expression Following lonising Radiation: Identification Of Biomarkers For Dose Estimation And Prediction Of Individual Response.", INTERNATIONAL JOURNAL OF RADIATION BIOLOGY., vol. 87, no. 2, February 2011 (2011-02-01), pages 115 - 129, XP008183706 * |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALT |
| KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497 |
| LUCKOW; SUMMERS, BIO/TECHNOLOGY, vol. 6, 1988, pages 47 |
| MALOVANOVIC ET AL., INT. J. ONCOL., vol. 25, 2004, pages 1337 - 42 |
| MARKS ET AL., BIO/TECHNOLOGY, vol. 10, 1992, pages 779 - 783 |
| MICHAELSON; LEDER, ONCOGENE, vol. 20, 2001, pages 5093 - 9 |
| MILLER ET AL., ONCOGENE, vol. 18, 1999, pages 7860 - 72 |
| NUSSE; VARMUS, CELL, vol. 31, 1982, pages 99 - 109 |
| NYGREN, FEBSJ., vol. 275, 2008, pages 2668 - 76 |
| OSHIMA ET AL., CANCER RES., vol. 57, 1997, pages 1644 - 9 |
| PLATT: "Advances in Large Margin Classifiers", 1999, MIT PRESS, pages: 61 - 74 |
| REYA; CLEVERS, NATURE, vol. 434, 2005, pages 843 - 50 |
| RIJSEWIJK ET AL., CELL, vol. 50, 1987, pages 649 - 57 |
| See also references of EP3077546A4 * |
| SIEGEL ET AL., CA: A CANCER J. FOR CLIN., vol. 62, 2012, pages 10 - 29 |
| SKERRA, CURR. OPIN. BIOTECHNOL., vol. 18, 2007, pages 295 - 304 |
| SKERRA, FEBS J., vol. 275, 2008, pages 2677 - 83 |
| SUBRAMANIAN ET AL., PNAS, vol. 102, 2005, pages 15545 - 15550 |
| TEPERA ET AL., J. CELL SCI., vol. 116, 2003, pages 1137 - 49 |
| TETSU ET AL., NATURE, vol. 398, 1999, pages 422 - 6 |
| TUTT ET AL., J. IMMUNOL., vol. 147, 1991, pages 60 |
| VAN OOYEN; NUSSE, CELL, vol. 39, 1984, pages 233 - 40 |
| WU ET AL., J. AMER. STAT. ASSN., vol. 99, 2004, pages 909 - 917 |
| WU; NUSSE, J. BIOL. CHEM., vol. 277, 2002, pages 41762 - 9 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9732139B2 (en) | 2005-10-31 | 2017-08-15 | Oncomed Pharmaceuticals, Inc. | Methods of treating cancer by administering a soluble receptor comprising a human Fc domain and the Fri domain from human frizzled receptor |
| US9987357B2 (en) | 2013-02-04 | 2018-06-05 | Oncomed Pharmaceuticals, Inc. | Methods and monitoring of treatment with a WNT pathway inhibitor |
| WO2017023971A1 (en) * | 2015-08-03 | 2017-02-09 | Oncomed Pharmaceuticals, Inc. | Identification of predictive biomarkers associated with wnt pathway inhibitors |
| US12319730B2 (en) | 2016-10-26 | 2025-06-03 | Leap Therapeutics, Inc. | Use of beta-catenin as a biomarker for treating cancers using anti-Dkk-1 antibody |
| WO2024189200A1 (en) * | 2023-03-15 | 2024-09-19 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Cancer stratification and treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2014357354A1 (en) | 2016-06-09 |
| CN105829547A (zh) | 2016-08-03 |
| TW201610168A (zh) | 2016-03-16 |
| WO2015084808A4 (en) | 2015-08-13 |
| MX2016007066A (es) | 2016-09-08 |
| HK1223657A1 (zh) | 2017-08-04 |
| JP2017501137A (ja) | 2017-01-12 |
| EP3077546A1 (en) | 2016-10-12 |
| EP3077546A4 (en) | 2017-04-26 |
| CA2931975A1 (en) | 2015-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2015084808A1 (en) | Identification of predictive biomarkers associated with wnt pathway inhibitors | |
| RU2579897C2 (ru) | Агенты, связывающие рецептор "frizzled", и их применение | |
| AU2011205409B2 (en) | Wnt-binding agents and uses thereof | |
| US20120027778A1 (en) | Frizzled-Binding Agents and Uses Thereof | |
| US20150132301A1 (en) | Combination Therapy for Treatment of Cancer | |
| WO2014121196A1 (en) | Methods and monitoring of treatment with a wnt pathway inhibitor | |
| WO2014066328A1 (en) | Methods of treating neuroendocrine tumors using wnt pathway-binding agents | |
| KR20090111307A (ko) | 전립선 특이적 전사물 및 전립선암의 치료 및 진단에 사용되는 이의 용도 | |
| US20170023576A1 (en) | Notch3 antibodies and uses thereof | |
| AU2015308854A1 (en) | Combination therapy for treatment of cancer | |
| EP2971146A2 (en) | Methods of treating pancreatic cancer | |
| AU2015227247A1 (en) | Methods for treating cancer with Notch 1 antibodies | |
| US20160304968A1 (en) | Identification of Predictive Biomarkers Associated With WNT Pathway Inhibitors | |
| US20180223372A1 (en) | Identification of predictive biomarkers associated with wnt pathway inhibitors | |
| WO2017095918A2 (en) | Methods for treating cancer using rspo3 antagonists | |
| WO2016201199A1 (en) | Identification of predictive biomarkers associated with wnt pathway inhibitors | |
| EP3180027A1 (en) | Rspo1 binding agents and uses thereof | |
| HK1183435B (zh) | 捲曲蛋白結合藥劑及其應用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14867583 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2931975 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2016/007066 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2016535646 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15101242 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2014357354 Country of ref document: AU Date of ref document: 20141202 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014867583 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014867583 Country of ref document: EP |