WO2015083173A1 - Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 - Google Patents
Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 Download PDFInfo
- Publication number
- WO2015083173A1 WO2015083173A1 PCT/IL2014/051067 IL2014051067W WO2015083173A1 WO 2015083173 A1 WO2015083173 A1 WO 2015083173A1 IL 2014051067 W IL2014051067 W IL 2014051067W WO 2015083173 A1 WO2015083173 A1 WO 2015083173A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- isolated peptide
- pharmaceutical composition
- seq
- peptide
- denoted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present disclosure generally relates to a method of treating inflammatory diseases and symptoms associated therewith.
- the present disclosure relates to the use of short peptides that inhibit signaling through CD28.
- Inflammation is a protective response that is intended to eliminate the initial cause of cell injury, as well as any necrotic cells and tissues resulting from the original insult, and to initiate the process of repair. Chronic inflammation might lead to a host of diseases, and is therefore normally closely regulated.
- TNF-ot tumor necrosis factor
- IFN- ⁇ interferon- ⁇
- IL2 interleukin-2
- GI gastrointestinal
- the inflammatory cytokine signal relies not only on antigenic presentation but is fully dependent on costimulatory signaling, in which Cluster of differentiation 28 (CD28) has a key function.
- CD28 Cluster of differentiation 28
- the CD28 antigen is expressed on T cells and is required for their activation as well as the survival and expansion of the peripheral blood T cells. Stimulation through CD28 can provide a potent co-stimulatory signal to T cells for the production of multitude of pro-inflammatory mediators, including IL-6 and fibrinogen, both involved in the progression of tissue injury. It has been reported that short peptides can prevent CD28 signaling induced by superantigen toxins (2, 3 and 8) or streptococcal infection (4).
- a member of the above short peptides namely the peptide p2TA, an octapeptide mimetic of the CD28 homodimer, prevents the engagement of CD28 by superantigens in vivo, thus averting T cell activation leading to protection from lethal toxic shock caused by an excessive inflammatory response (3, 5).
- p2TA leaves the Th2-cytokine based humoral immune response intact (3, 4).
- the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28 and functional fragments and derivatives thereof, or a pharmaceutical composition comprising the same, for use in a method for the treatment of a non-pathogen associated inflammatory disorder.
- the said isolated peptide has a binding affinity for the crystallographic homodimer interface of CD28 characterized by KD lower than 30 micromolar, more specifically KD of from about 0.1 to about 30 micromolar.
- the said isolated peptide inhibits non-pathogen induced inflammatory response, as determined by a reduction in the level of at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor-a (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox-2) and/or by a decrease in the number of F4/80-positive cells.
- the said isolated peptide can have an amino acid sequence that corresponds to a region of from 6 to 14 consecutive amino acid residues within human CD28 (SEQ ID NO: 1) or within human CTLA4 (SEQ ID NO: 2), which region harbors one or more amino acid residues of the crystallographic homodimer interface of human CD28, respectively human CTLA4, and said peptide and its functional fragments and derivatives maintain the ability to bind to said crystallographic homodimer interface of CD28 at a binding affinity characterized by a K D lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar, and to inhibit non-pathogen induced inflammatory response, as determined by a reduction in the level of at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor- ⁇ (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox-2) and/or by a decrease in the number of F4/80-positive
- peptides in accordance with the present disclosure are peptides consisting of the amino acid sequences His Val Lys Gly Lys His Leu Cys Pro (denoted by SEQ ID NO: 3), Ser Pro Met Leu Val Ala Tyr Asp (denoted by SEQ ID NO: 4), His Lys Gly Leu Asp Ser Ala Val (denoted by SEQ ID NO: 5), Tyr Val Asn Gin Thr Asp He Tyr (denoted by SEQ ID NO:6), Asn Gly Thr lie He His Val Lys Gly (denoted by SEQ ID NO: 7), Tyr Val He Asp Pro Glu Pro Cys Pro (denoted by SEQ ID NO: 8), Pro Ala Val Val Leu Ala Ser Ser (denoted by SEQ ID NO: 9), and their functional derivatives.
- peptides selected from the group consisting of the amino acid sequences Tyr Asn Lys Lys Lys Ala Thr Val Gin Glu Leu Asp (denoted by SEQ ID NO: 10), Val Gin Tyr Asn Lys Lys Lys Ala Thr Val Gin Glu Leu Asp (denoted by SEQ ID NO: 11), Ser His Phe Thr His Asn Arg His Gly His Ser Thr (denoted by SEQ ID NO: 12), Phe His Lys His Lys Asn Pro Gly Ser Pro He He (denoted by SEQ ID NO: 14) and Trp His Ala His Pro His Lys Lys Pro Val Val Ala (denoted by SEQ ID NO: 13) and functional derivatives thereof.
- the isolated peptide comprises the amino acid sequence Ser Pro Met Leu Val Ala Tyr Asp denoted by SEQ ID NO. 4 or the amino acid sequence (D-Ala) Ser Pro Met Leu Val Ala Tyr Asp (D-Ala) denoted by SEQ ID NO. 47.
- the said peptide comprises the amino acid sequence Pro Ala Val Val Leu Ala Ser Ser (denoted by SEQ ID NO: 9), (D- Ala)PAVVLASS(D-Ala) (denoted by SEQ ID NO: 48) and (palmitoyl-lysine) Pro Ala Val Val Leu Ala Ser Ser (D-Ala) (denoted by SEQ ID NO: 50).
- Still further peptides in accordance with the present disclosure comprise the amino acid sequence Ser His Phe Thr His Asn Arg His Gly His Ser Thr (denoted by SEQ ID NO: 12), the amino acid sequence (D-Ala) Ser His Phe Thr His Asn Arg His Gly His Ser Thr (D-Ala) (denoted by SEQ ID NO: 49) and the amino acid sequence (palmitoyl-lysine) Ser His Phe Thr His Asn Arg His Gly His Ser Thr D-Ala) (denoted by SEQ ID NO: 51).
- the said inflammatory disorder to be treated by peptides in accordance with the present disclosure or pharmaceutical compositions comprising the same is any one of radiation-induced inflammation, inflammatory bowel disease (IBD), radiation-induced gastroenteritis, drug-induced inflammation, arthritis, rheumatoid arthritis, osteoarthritis, lupus, myasthenia gravis, multiple sclerosis, adult respiratory distress syndrome (ARDS), asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis, appendicitis, bursitis, colitis, cystitis, dermatitis, phlebitis, vasculitis, acne vulgaris, and pelvic inflammatory disease.
- IBD inflammatory bowel disease
- ARDS adult respiratory distress syndrome
- asthma rhinitis, id
- the said drug-induced inflammation is any one of drug-induced hepatitis, drug-induced ocular inflammation, drug-induced gastrointestinal damage, drug-induced acute ulcers, drug-induced renal failure, drug-induced pancreatitis, drug-induced nephritis, chemotherapy-induced inflammation in the gastrointestinal tract and seborrheic keratosis.
- the said inflammatory disease or condition is radiation- induced inflammation, which can be systemic and/or at the irradiated site.
- the said radiation-induced inflammation can be associated with at least one of gastrointestinal tract and spleen inflammation.
- the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28, or a pharmaceutical composition comprising said isolated peptide, for use in a method for the treatment of radiation-induced inflammation.
- the isolated peptide or pharmaceutical composition for use according to the present disclosure can be administered by a route selected from the group consisting of intravenous, intramuscular or intraperitoneal administration, intrathecal or subcutaneous injection, oral, intrarectal, intranasal ocular and topical administration.
- isolated peptide can be administered at an amount of from about 0.05 mg to about 5.0 mg peptide/kg body weight of a subject in need thereof.
- the said isolated peptide or pharmaceutical composition comprising the same is administered at one or more identical or different treatment periods of one, two, three or four weeks of once daily, once every three days, once every five days or once weekly administrations of said isolated peptide, wherein said treatment periods are consecutive or are set apart from each other by non-treatment intervals of 1 or several days, or 1 or several weeks or 1 or more months.
- the isolated peptide or pharmaceutical composition comprising the same can be administered at a single dose.
- the said isolated peptide or pharmaceutical composition comprising the same said administration can be at one or more treatment periods of one, two, three or four weeks of once daily administrations of a therapeutically effective amount of said isolated peptide.
- said isolated peptide or pharmaceutical composition is for chronic administration.
- the said isolated peptide or pharmaceutical composition comprising the same can be administered once daily, once every three days, once every five days or once weekly.
- the said isolated peptide or pharmaceutical composition can be administered to at a suitable time prior to and/or post irradiation.
- the said isolated peptide or pharmaceutical composition can be administered to the subject in need thereof from about 30 minutes to about 60 or 90 minutes, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 36, 48, 60 or 72 hours, 4, 5, 6, 7, 14, 32 or 28 days following exposure to said radiation.
- the said isolated peptide or pharmaceutical composition can be administered to said subject within about 24 hours following exposure to said radiation.
- the said isolated peptide or pharmaceutical composition comprising the same can be administered in combination with at least one additional therapeutically active agent.
- the said additional therapeutically active agent can be a steroid, a nonsteroidal antiinflammatory agent or an immunosupressive agent.
- the said isolated peptide or pharmaceutical composition comprising the same and said at least one additional therapeutically active agent can be administered simultaneously, or at different time points, in identical or different frequencies.
- the said isolated peptide or pharmaceutical composition comprising the same can be administered prior to or after administration of said at least one additional therapeutically active agent.
- the said isolated peptide or pharmaceutical composition comprising the same and said at least one additional therapeutically active agent can be administered for different durations of time.
- said additional therapeutically active agent can be any one of Abatacept, a TNF blocker, an IL-1 blocker, an IL-6 blocker and an Anti CD20 agent or a combination thereof.
- said additional therapeutically active agent can be any one of interferon- ⁇ , Copaxone and Tysabri or a combination thereof.
- said at least one additional therapeutically active agent can be a chemotherapeutic agent.
- Fig. 1A-1B The peptides do not inhibit signaling through CD3.
- the levels of IL2 (Fig. 1A) and TNF-a (Fig. IB) secreted into the culture medium were determined by ELISA (mean + SEM).
- Fig. 2A-2D The peptides inhibit signaling through CD28.
- the levels of IFN- ⁇ (Fig. 2A, Fig. 2B), IL2 (Fig. 2C) and TNF-ot (Fig. 2D) secreted into the culture medium were determined by ELISA (mean + SEM).
- Fig. 3A-3C The peptides do not induce a significant Thl cytokine response.
- the levels of IFN- ⁇ (Fig. 3A), IL2 (Fig. 3B) and TNF-a (Fig. 3C) secreted into the culture medium were determined by ELISA.
- Fig. 4A-4C Binding of peptides to CD28.
- Graphs showing representative SPR responses for binding of CD28-Fc to immobilized (D-Ala)-p27A-(D-Ala) 700 resonance units (rU), Fig. 4A), p273 ⁇ 4 (660 rU, Fig. 4B) and pe!2 (1 ,260 rU, Fig. 4C).
- Analyte concentrations increased in twofold increments from 0.2 ⁇ (Fig. 4A, Fig. 4B) and 0.125 ⁇ (Fig. 4C).
- Fig. 5A-5C The peptides do not bind significantly to IgG.
- Analyte concentrations increased in twofold increments from 0.2 ⁇ (Fig. 5A, Fig. 5B) and 0.125 ⁇ (Fig. 5C).
- Fig. 6A-6H CD28 dimer interface mimetic peptide ⁇ 2 ⁇ inhibits synapse formation between the co-stimulatory receptors B7-2 and CD28.
- Fig. 6A Effect of ⁇ 2 ⁇ on binding of B7-2 to cell-surface CD28.
- a western blot analysis (upper panel) and the quantification thereof (lower bar graph) of HEK293T cells transfected to express cell-surface CD28 or an empty vector (EV) that were incubated with soluble B7-2 in the absence or in the presence of (D-Ala)-p27A-(D-Ala) at the indicated concentrations (error bars, s.e.m. ; n 3).
- the right panel is a schematic outline of the experimental design.
- Fig. 6B Effect of ⁇ 2 ⁇ on binding of CD28 to cell-surface B7-2.
- a western blot analysis (upper panel) and the quantification thereof (lower bar graph) of HEK293T cells transfected to express cell-surface B7-2 or an empty vector that were incubated with soluble CD28 in the absence or presence of p2TA at the indiated concentrations (error bars, s.e.m. ; n 3).
- the right panel is a schematic outline of the experimental design.
- Fig. 6C p2TA attenuates intercellular B7-2/CD28 synapse formation.
- a bar graph showing intercellular B7-2/CD28 synapse formation scored using flow cytometry to quantitate the percentage of doubly labeled cells (error bars, s.e.m.; n 3) in an assay performed with HEK293T cells transfected to express CD28/GFP fusion protein (green label) incubated with HEK293T cells transfected to express B7-2/Cherry fusion protein (red label), in the absence or in the presence of (D-Ala)-p2JA-(D-Ala) at the indicated concentrations.
- B7-2C/Cherry which lacks the ability to bind CD28.
- the right panel is a schematic outline of the experimental design.
- FIG. 6D - Fig. 6H Contour plots for representative experiments.
- Figure 6C upon incubation of cells expressing CD28/GFP with cells expressing B7-2/Cherry (d-g) or B7-2C/Cherry (h). Incubation was in the absence (d,h) or presence of p2TA at 0.1 (e), 0.3 (f) or 1 ⁇ g ml "1 (g). Per cent doubly labeled cells in upper right quadrant is denoted.
- Fig. 7 Random scrambling of p2TA sequence abrogates its ability to inhibit the B7-2/CD28 interaction.
- DEXA Dexamethasone
- Fig. 10A-10B The peptides reduce symptoms of collagen-induced arthritis.
- Graphs showing arthritic score of arthritis induced in mice (n 10 per group) by injecting bovine Type II collagen in complete Freund's adjuvant on days 0 and 21. Symptoms were observed from day 25, scoring 16 joints on 4 legs (e)(mean + SEM) and the mice were treated by (Fig. 10A) Dexamethasone (DEXA) at 100 ⁇ g ( ⁇ ), PBS (A) or 10 ⁇ g p2TA (A) injected daily from disease onset (days 25-34) or 100 ⁇ g p2TB ( ⁇ ) or p27B-pal (o) injected once every 3 days starting on day 25.
- DEXA Dexamethasone
- mice were treated by (Fig. 10B) Dexamethasone (DEXA) at 100 ⁇ g ( ⁇ ) injected once every 2 days from disease onset; PBS (A) or 150 ⁇ g pei2-pal ( ⁇ ) injected once every 3 days from disease onset; or 200 ⁇ g pei2-pal (A) injected once every 5 days from disease onset. Values are shown for days 25-35 (mean + SEM).
- P 0.002
- Fig. 11A-11D The peptides reduce symptoms of experimental autoimmune encephalitis (EAE). Graphs showing encephalitic score in mice induced with EAE.
- PBS (A) or peptide was injected from day 1, according to the following regime.
- Fig. 11A shows encephalitic score for mice subjected to daily injections of 50 Dg ⁇ 27 ⁇
- Fig. 11-B-Fig. 11-D show encephalitic score for mice subjected to daily injections of 50 ⁇ g ⁇ 27 ⁇ ( ⁇ ) (Fig. 11B), 10 ⁇ g p27B-pal ( ⁇ ) or 50 ⁇ g p273 ⁇ 4-pal (A) (Fig. 11C) or 100 ⁇ g pei2-pal ( ⁇ ) (Fig. 11D).
- FIG. 12A-12B Effect of p2TA peptide on systemic inflammatory mediators. Bar graphs of plasma levels of IL-6 (Fig. 12A), or fibrinogen (Fig. 12B) measured in mice on day 7 after irradiation are shown.
- C sham-irradiated mice
- P sham- irradiated mice that received 5 mg/kg of the p(D-Ala)-p233 ⁇ 4-(D-Ala) peptide
- R 8Gy- irradiated mice
- RP 8Gy-irradiated mice that received 5 mg kg of the p2TA peptide 24 hours after irradiation.
- Bars represent the means + SEM of 4-5 mice.
- An asterisk (*) denotes statistically significant difference between the R and RP groups (P ⁇ 0.05).
- Fig. 13A-13B Effect of p2TA peptide on jejunal crypts. Bar graphs showing the number of surviving crypts (Fig. 13 A) and villous height (Fig. 13B) measured in jejunal tissues that were collected from mice 7 days after irradiation, embedded in paraffin, fixed and processed by staining cross sections with hematoxylin and eosin. Bars represent the means + SEM of 4 cross-sections for each mouse, and 4-5 mice in each group. An asterisk (*) denotes statistically significant difference between R and RP groups (PO.05).
- Fig. 14A-14H The effect of p2TA peptide on Cyclin Dl expression in mouse intestine jejunal crypts. Micrographs showing jejunal tissues that were collected from BALB/c (Fig. 14A- Fig. 14D) and A/J (Fig. 14E - Fig. 14H) mice 7 days after irradiation, embedded in paraffin, fixed and processed by staining cross sections with hematoxylin and eosin.
- C sham-irradiated mice
- P sham-irradiated mice that received 5 mg/kg of (D-Ala)-p2Z4-(D-Ala) peptide
- R 8Gy-irradiated mice
- RP 8Gy-irradiated mice that received 5 mg/kg of p2TA peptide 24 hours after irradiation.
- Fig. 15A-15H Immunohistochemistry of jejunum tissue. Cross-sections from jejunum tissues that were immune-stained with COX-2 antibody are shown. Tissues were collected from BALB/c (Fig. 15A - Fig. 15D) and A/J (Fig. 15E - Fig. 15H) mice 7 days after irradiation and embedded in paraffin for immunohistochemistry staining.
- C sham-irradiated mice
- P mice that received 5 mg/kg of the (D-Ala)-p2 i 4-(D-Ala) peptide
- R 8Gy-irradiated mice
- RP 8Gy-irradiated mice that received 5 mg/kg of the p2TA peptide 24 hours after irradiation.
- Fig. 16A-16H Immunohistochemistry of spleen tissue. Cross-sections from spleen tissue that were immune-stained with COX-2 antibody are shown. Tissues were collected from BALB/c (Fig. 16A - Fig. 16D) and A/J (Fig. 16E - Fig.
- mice 7 days after irradiation and embedded in paraffin for immunohistochemistry staining were 7 days after irradiation and embedded in paraffin for immunohistochemistry staining.
- Fig. 17 Immunohistochemistry of activated macrophage marker F4/80 in mouse jejunum.
- a bar diagram showing the F4/80 positive cells per mm in jejunal tissues Abbreviations: C, sham-irradiated mice; P, mice that received 5 mg/kg of the (D-Ala)- p27A-(D-Ala) peptide; R, 8Gy-irradiated mice; RP: 8Gy-irradiated mice that received 5 mg/kg of the p27A peptide 24 hours after irradiation. Bars represent the means ⁇ SEMs for tissue sections of mice in each group. *Statistically significant differences between R and RP groups (P ⁇ 0.05).
- the present disclosure is based on the finding that short peptides, for example about 8 amino acid residues in length, which can specifically bind to the homodimer interface of the costimulatory receptor CD28 with high binding affinity, are capable of inhibiting signaling through CD28 and reduce symptoms of inflammatory disease in various animal models ranging from adjuvant arthritis and collagen-induced arthritis to experimental autoimmune encephalitis.
- These peptides are generally derived from regions in the amino acid sequence of CD28 that harbor at least one amino acid residue of the residues forming homodimeric contacts (as described, for example, in Figure 2 of Evans et al. (11) - pale blue coloured residues, and Fig. 4A of Arad et al. 2011 (3), blue coloured residues.
- the residues forming homodimer contacts are (position in sequence ID NO: 1 is in brackets) Pro at (9), Met at (10), Leu at (41), Val at (86), Thr at (89), He at (91), Asn at (111), Gly at (112), He at (114) and His at (116) of the amino acid sequence of human CD28 (SEQ ID NO: 1), and define the crystallographic homodimer interface of human CD28.
- Regions in the human CD28 amino acid sequence from which peptides used in the present invention are derived are, for example, amino acids 10-15 and 116-121 of SEQ ID NO: 1, but also disclosed are peptides not specifically derived from these regions, but which comprise one or more amino acid residues of those amino acid residues which form homodimeric contacts.
- Amino acid residues which form homodimeric contacts as shown (filled circles and blue) in Figure 2C of Schwartz et al. (12) and also in Figure 4A of Arad et al 2011 (3).
- Regions in the human CTLA4 amino acid sequence from which peptides used in the present invention are derived are, for example, amino acids 10-15 and 115-120 of SEQ ID NO: 2, generally, peptides which comprise amino acid residues of those residues which form
- compositions and methods thereof are peptides selected by phage display for their affinity for the extracellular domain of CD28, which are not homologous or derived to the CD28 sequence or CTLA4 molecule, or regions therein which comprise amino acids of their crystallographic dimer interface as defined above, but rather are different peptides that show a high binding affinity for the crystallographic dimer interface of CD28 and exhibits biological activity in inhibiting non-pathogen induced inflammatory response.
- peptides will be described and exemplified in more detailed below.
- the above peptides bind directly to CD28, and are effective in reducing disease symptoms in these animal models.
- the present disclosure is based on the surprising effect of the CD28 mimetic peptides, specifically the exemplified p2TA (SEQ ID NO: 47) on radiation-induced inflammatory injuries.
- This effect was examined in a mouse model subjected to whole- body irradiation, followed by administration of the CD28 mimetic peptide 24 hours post-radiation and evaluation of gastrointestinal tissue damage by analysis of jejunum histopathology and immunohistochemistry for cell proliferation (cyclin Dl) and inflammation (COX-2).
- the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28, or a pharmaceutical composition comprising said isolated peptide, for use in a method for the treatment of a non-pathogen associated inflammatory disorder.
- peptide refers to a molecular chain of amino acid residues, which, if required, can be modified at each one of its amino acid residues, for example by manosylation, glycosylation, amidation (for example C-terminal amides), carboxylation or phosphorylation.
- the peptide may be obtained synthetically, through genetic engineering methods, expression in a host cell, or through any other suitable means. Methods for producing peptides are well known in the art.
- isolated refers to molecules, such as amino acid sequences or peptides that are removed from their natural environment, isolated or separated.
- amino acid refers to naturally occurring and synthetic amino acid residues, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
- amino acid also encompasses D-amino acids, which are mirror images of L-amino acids, where the chirality at carbon alpha has been inverted.
- amino acid sequence or "peptide sequence” also relate to the order in which amino acid residues, connected by peptide bonds, lie in the chain in peptides and proteins. The sequence is generally reported from the N-terminal end containing free amino group to the C-terminal end containing free carboxyl group.
- isolated peptide refers to an isolated peptide, i.e. a peptide of definite length or definite number of consecutive amino acid residues, which is not part of a longer amino acid sequence.
- the "peptides for use” in the present disclosure, and their functional derivatives and fragments are isolated peptides which specifically bind to the crystallographic homodimer interface of human CD28.
- the crystallographic homodimer interface of CD28 is determined by the amino acids Pro at (9), Met at (10), Leu at (41), Val at (86), Thr at (89), He at (91), Asn at (111), Gly at (112), He at (114) and His at (116) of the amino acid sequence of human CD28 (SEQ ID NO: 1).
- Such peptides can be corresponding to a region of from 6 to 14 consecutive amino acid residues within human CD28, which region harbors one or more amino acid residues of the of the crystallographic homodimer interface (as listed above).
- regions within human CD28 are region comprising the amino acid residues 10-15 (peptide p2TA) or 116-121 (peptide plTA) of SEQ ID NO: 1.
- Other peptides used in the present disclosure are derived from other such region in human CD28 (SEQ ID NO: 1) such as p3TA, p4TA and p5TA (3).
- peptides used in the methods and composition of the present disclosure are isolated peptides which specifically bind to the crystallographic homodimer interface of human CD28 and correspond to a region within human CTLA4 (SEQ ID NO: 2) of from 6 to 14 consecutive amino acid residues within human CTLA4, which region harbors one or more amino acid residues of the of the crystallographic homodimer interface of CTLA4. (as listed below). Examples of such regions are amino acid residues 10-15 (peptide p2TB) or 115-120 (peptide plTB) of SEQ ID NO: 2.
- peptides for use in the methods and compositions disclosed herein are various peptides that do not necessarily have homology to human CD28 or human CTLA4, but do bind to the crystallographic homodimer interface of human CD28 with high affinity, and inhibit non-pathogen induced inflammatory response.
- corresponding to or “derived from” a reference amino acid sequence as used herein is meant that the corresponding/derived amino acid is essentially identical to the reference amino acid sequence, but can include variations, as herein defined for “derivatives” and “fragments ".
- the isolated peptides for use according to the present invention have a binding affinity to the homodimer interface of human CD28 that is characterized by a K D lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar.
- K D of (D-Ala)-p2rA-(D-Ala) binding is 2 micromolar.
- the isolated peptide for use as herein defined is characterized by at least one of (i) specific binding to the crystallographic homodimer interface of human CD28 with a K D lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar, and (ii) being able to inhibit non-pathogen induced inflammatory response as determined by a reduction in the level of at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor-a (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox- 2) and/or by a decrease in the number of F4/80- positive cells.
- IFN- ⁇ interferon- ⁇
- TNF-a tumor necrosis factor-a
- cox- 2 cyclooxygenase 2
- Other biological parameters indicating severity of inflammation may be used.
- the binding affinity of the peptides used in the present invention for the CD28 homodimer interface is thus characterized by KD lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar, for example K D of from about 0.1, 0.2, 0.3, 04, 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 10, 15, 20 or 25 to about 30 micromolar.
- the isolated peptide for use according to the invention is a functional fragment or derivative of said the above defined peptides, which functional fragments or derivatives maintain the ability to bind to said homodimer interface of human CD28 at a binding affinity lower than 30 micromolar.
- Alignment of human and mouse CD28 shows that within the p2TA domain [amino acid residues 8-15 of SEQ ID NO: 1] there is extensive sequence variation, with 4 out of 8 amino acids differing (SPMLVAYD vs. SPLLVVDS), yet the human peptide reduced symptoms of pathology in different rodent models of arthritis.
- the hydrophobic nature of this domain (5 out of 8 amino acids) is conserved between human and mouse CD28.
- pel2 SEQ ID NO: 49
- p2TB SEQ ID NO: 48
- the similarly hydrophobic sequence of p2TB may account for its interaction with CD28, be it human ( Figure 2B) or murine.
- the isolated peptide which specifically binds to the homodimer interface of CD28 according to the invention is (i) derived from a region in human CD28 that comprises amino acid residues forming homodimeric contacts, for example from the sequence of amino acid residues 10-15 or 116-121 of SEQ ID NO: 1 or (ii) derived from a region in human CTLA4 that comprises amino acid residues forming homodimeric contacts, for example amino acid residues 10-15 or 115-120 of SEQ ID NO: 2.
- a peptide derived from human CD28 consisting of the amino acid sequence HVKGKHLCP as denoted by SEQ ID NO: 3, also termed herein p 1 TA or consisting of the amino acid sequence SPMLVAYD as denoted by SEQ ID NO: 4, also termed herein ⁇ 2 ⁇ or consisting of the amino acid sequence HKGLDSAV (SEQ ID NO: 5) also termed herein ⁇ 3 ⁇ , or consisting of the amino acid sequence YVNQTDIY (SEQ ID NO: 6), also termed herein p4 TA, or consisting of the amino acid sequence NGTIIHVKG (SEQ ID NO: 7), also termed herein p5TA;
- pl2A as denoted by SEQ ID NO: 10
- pl2B as denoted by SEQ ID NO: 11
- pel2 SEQ ID NO: 12
- pel2-D-Ala as denoted by SEQ ID NO: 49
- pal-pel2-(D-Ala) as denoted by SEQ ID NO: 51
- pd7 as denoted by SEQ ID NO: 13
- pc3 as denoted by SEQ ID NO: 14
- pa2 as denoted by SEQ ID NO: 15
- pb4 as denoted by SEQ ID NO: 16
- pel l as denoted by SEQ ID NO: 17
- pfl l as denoted by SEQ ID NO: 18
- pg3 as denoted by SEQ ID NO: 19
- pbl2 as denoted by SEQ ID NO: 20
- inflammatory response as determined by at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor- ⁇ (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox-2) and/or by a decrease in the number of F4/80-positive cells; or
- (d) a dimer or multimer of (a), (b) or (c), wherein the resultant peptide of (d) maintains the ability to specifically bind to the said human CD28 homodimer interface at a binding affinity characterized by K D of lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar, and inhibit an inflammatory response as determined by at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor-a (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox-2) and/or by a decrease in the number of F4/80-positive cells.
- IL2 interferon- ⁇
- TNF-a tumor necrosis factor-a
- fragments or derivatives of the isolated peptides as herein defined are also encompassed by the present invention.
- the terms fragments or derivatives are meant to include peptides which differ in one or more amino acids in the overall sequence, namely, which have deletions, substitutions (e.g. replacement of at least one amino acid by another amino acid by conservative substitution), inversions or additions. This term also encompasses the replacement of at least one amino acid residue in the overall sequence by its respective D amino acid residue.
- Amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements.
- Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, each of the following eight groups contains amino acids that are conservative substitutions for one another:
- fragment refers to any peptide which is at least one amino acid shorter than the isolated peptide in accordance with the invention, obtained by deletion of at least one amino acid residue from the peptide in accordance with the invention.
- the peptides can be coupled through their N-terminus to a lauryl- cysteine (LC) residue and/or through their C-terminus to a cysteine (C) residue, or to other residue/s suitable for linking the peptide to adjuvant/s for immunization.
- LC lauryl- cysteine
- C cysteine
- the peptides of the present disclosure may all be positively charged, negatively charged or neutral.
- they may be in the form of a dimer, a multimer or in a constrained conformation, which can be attained by internal bridges, short-range cyclizations, extension or other chemical modifications.
- the peptides may be extended at the N- terminus and/or C-terminus thereof with various identical or different amino acid residues.
- the peptide may be extended at the N-terminus and/or C-terminus thereof with identical or different hydrophobic amino acid residue/s which may be naturally occurring or synthetic amino acid residue/s.
- a preferred synthetic amino acid residue is D-alanine.
- An additional example for such an extension may be provided by peptides extended both at the N-terminus and/or C-terminus thereof with a cysteine residue. Naturally, such an extension may lead to a constrained conformation due to Cys-Cys cyclization resulting from the formation of a disulfide bond.
- Another example may be the incorporation of an N-terminal palmitoyl-lysine tail, the lysine serving as linker and the palmitic acid as a hydrophobic anchor.
- the peptides may be extended by aromatic amino acid residue/s, which may be naturally occurring or synthetic amino acid residue/s, for example a specific aromatic amino acid residue may be tryptophan.
- the peptides may be extended at the N-terminus and/or C-terminus thereof with one or more amino acids present in corresponding adjacent positions of the amino acid sequence of the naturally occurring human CD28 or human CTLA4, for example one, two or three consecutive amino acid residues of the naturally occurring sequence.
- the peptides may be extended at the N-terminus and/or C-terminus thereof with various identical or different organic moieties which are not a naturally occurring or synthetic amino acids.
- the peptide may be extended at the N- terminus and/or C- terminus thereof with an N-acetyl group.
- this invention includes the corresponding retro-inverse sequence wherein the direction of the peptide chain has been inverted and wherein all the amino acids belong to the D-series.
- biological activity characteristics when referring to the isolated peptides of the invention encompasses peptides that inhibit an inflammatory response as determined by at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor- a (TNF-a) and/or by reduction in the level of cyclooxygenase 2 (cox-2) and/or by a decrease in the number of F4/80-positive cells, and any other suitable parameters.
- IL2 interferon- ⁇
- TNF-a tumor necrosis factor- a
- one or more assays can be carried out, such as for example the determination of at least one of the inflammatory cytokines IL2, interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor-a (TNF-a) and/or of reduction in the level of cyclooxygenase 2 (cox-2) and/or of the decrease in the number of F4/80-positive cells, for example, in the manner described in the Examples below.
- IFN- ⁇ interferon- ⁇
- TNF-a tumor necrosis factor-a
- cox-2 cyclooxygenase 2
- the isolated peptide consists of the amino acid sequence SPMLVAYD denoted by SEQ ID NO. 4 (peptide p2TA) or the amino acid sequence (D-A)SPMLVAYD(D-A) denoted by SEQ ID NO. 47 (peptide (D-A)-p2TA-(D-A).
- SEQ ID NO. 4 amino acid sequence SPMLVAYD denoted by SEQ ID NO. 4
- D-A amino acid sequence (D-A)SPMLVAYD(D-A) denoted by SEQ ID NO. 47
- the name p2TA (as well as all other arbitrary peptide names) can sometimes be used herein to designate both the core sequence (SEQ ID NO. 4) or its D- Ala abutted derivative (ID NO. 47).
- peptides are a peptide consisting of the amino acid sequence as denoted by SEQ ID NO: 5, designated p3TA, a peptide consisting of the amino acid sequence as denoted by SEQ ID NO: 6, designated p4TA, and a peptide consisting of the amino acid sequence as denoted by SEQ ID NO: 7, designated p5TA. These peptides exhibit biological activity similar to that of p2TA (Arad 2011 , (3)).
- D-Ala derivatives and palmitoyl-lysine derivatives are also encompassed hereby.
- the isolated peptide consists of the amino acid sequence PAVVLASS (denoted by SEQ ID NO: 9, peptide p2TB), (D-A)PAVVLASS(D-A) (denoted by SEQ ID NO: 48, peptide (D-A)-p2TB-(D-A) and (palmitoyl- lysine)PAVVLASS(D-A) (denoted by SEQ ID NO: 50, (pal)-p2TB-(D-A)).
- the isolated consists of the amino acid sequence SHFTHNRHGHST (denoted by SEQ ID NO: 12, peptide pel2), (D- A)SHFTHNRHGHST(D-A) (denoted by SEQ ID NO: 49, peptide pel2-(D-A)) and (palmitoyl-lysine)SHFTHNRHGHST(D-A) (denoted by SEQ ID NO: 51 , peptide penpal).
- the present disclosure is based on the finding that short peptides, for example of about 8 amino acid residues in length (e.g. the peptide termed herein p2TA), which can specifically bind to the crystallographic homodimer interface of the costimulatory receptor CD28 with high binding affinity, are capable of inhibiting signaling through CD28 and thereby reduce symptoms of inflammatory disease in various animal models ranging from adjuvant arthritis and collagen-induced arthritis to experimental autoimmune encephalitis (as detailed in Examples 4-6).
- p2TA short peptides, for example of about 8 amino acid residues in length
- non-pathogen associated inflammatory disorders The common feature of all of these inflammatory disorders or diseases is the fact that they are not associated with an invading pathogen, namely they can be defined as “non- pathogen associated inflammatory disorders ".
- the terms “non-pathogen associated inflammatory disorders ", “non-pathogen induced inflammatory disorders ", “non- pathogen related inflammatory disorders'” may be used herein interchangingly. Therefore, as indicated above, the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28, or a pharmaceutical composition comprising said isolated peptide, for use in a method for the treatment of a non-pathogen associated inflammatory disorder.
- treat or forms thereof, and the terms “alleviating” and “mitigating” mean to at least partially ameliorate or cure the patient's disease or condition as defined herein.
- the “treaf as used herein is also to be taken to mean adding supportive therapy to the treatment by the peptide disclosed herein. For example, in case of radiation induced inflammation, radiation supportive therapy may be added.
- non-pathogen associated inflammatory disorder refers to an inflammatory disease, disorder or condition that is not associated with a pathogen.
- Pathogens can be any one of bacterial toxins, bacteria, viruses, fungi, worms, plants and other living organisms capable of infecting humans.
- pathogens may be Gram-positive bacteria, Gram-negative bacteria, mixtures thereof leading to polymicrobial infection, bacterial toxins and other toxic bacterial components such as exotoxins, endotoxins, superantigen toxins, pathogen associated molecular patterns (PAMPs), Damage Associated Molecular Pattern molecules (DAMPs), lipopolysaccharides, peptidoglycans or toxic components thereof, molecules that are associated with groups of pathogens that are recognized by cells of the innate immune system and molecules that are associated with groups of pathogens that are recognized by Toll-like receptors (TLRs).
- PAMPs pathogen associated molecular patterns
- DAMPs Damage Associated Molecular Pattern molecules
- TLRs Toll-like receptors
- the inflammatory disorder is any one of radiation-induced inflammation, inflammatory bowel disease (IBD), radiation-induced gastroenteritis, drug-induced inflammation, arthritis, rheumatoid arthritis, osteoarthritis, lupus, myasthenia gravis, multiple sclerosis, adult respiratory distress syndrome (ARDS), asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis, appendicitis, bursitis, colitis, cystitis, dermatitis, phlebitis, vasculitis, acne vulgaris, and pelvic inflammatory disease.
- the inflammatory disease or condition is radiation-induced inflammation.
- radiation-induced inflammation refers to inflammation associated or resulting from radiation therapy. It has been reported that effects of ionizing radiation, characteristically associated with the consequences of energy deposition in the cell nucleus, arise at the site of the irradiated cells as well as in non- irradiated cells, consistent with a known delayed and long-lived tissue reaction to radiation injury characteristic of an inflammatory response with the potential for persisting damage. An important implication of these findings is that contrary to conventional radiobiological dogma and interpretation of epidemiologically-based risk estimates, ionizing radiation may contribute to further malignancy.
- the levels of the pro-inflammatory cytokine IL-6 increased significantly in mouse plasma 7 days after radiation exposure.
- administration of the p2TA peptide significantly reduced the elevation of IL-6 and the radiation-induced production of fibrinogen.
- the examples below demonstrate that the irradiated R group had significantly fewer intestinal crypt cells and shorter villi compared to the control C group.
- the p2TA peptide had a protective effect on radiation-induced intestinal injury, inducing improved morphology of villi and crypts, increased cyclin Dl expression and decreased COX-2 staining.
- the term "radiation” or “ionizing radiation” refers to radiation therapy (or “radiotherapy”), which is the medical use of ionizing radiation, generally as part of cancer treatment to control or kill malignant cells. Radiation therapy may be used as palliative treatment or as therapeutic treatment. Most common cancer types can be treated with radiation therapy in some way, and various types of radiation treatments are used. For example, “total body irradiation” (TBI) is a radiation therapy technique used to prepare the body to receive a bone marrow transplant.
- TBI total body irradiation
- Radiation therapy has also several applications in non-malignant (non-cancerous) conditions, such as the treatment of trigeminal neuralgia, acoustic neuromas, severe thyroid eye disease, pterygium, pigmented viUonodular synovitis, and prevention of keloid scar growth, vascular restenosis, and heterotopic ossification.
- non-malignant non-cancerous
- the use of radiation therapy in non-malignant conditions is limited partly by worries about the risk of radiation-induced cancers.
- radiation therapy may be used in the treatment of a variety of disorders. Special care is taken by radiation oncologists to minimize exposure to radiation. Nonetheless, radiation therapy may cause injury to the body at the site of irradiation as well as at remote sites even at low levels. For example, symptoms of radiation injury to the colon and rectum include acute inflammation, decreased mucus production, and accumulation of fluid beneath the intestinal lining.
- CD28-mimetic peptide p2TA mitigates many of the effects of ionizing radiation in vivo, both in the systemic circulation and in several tissues including the gastrointestinal (GI) tract. It is known that radiation-induced inflammation of the GI tract is considered to be one of the critical causes for systemic complications following radiation exposure, and may mediate some effects that lead to multiple organ failure.
- GI gastrointestinal
- apoptosis levels in crypt cells increase dramatically at 3 to 6 hours after exposure to as little as 1 Gy of gamma-rays; where an 8 Gy exposure leads to prolonged apoptosis observed as late as 60 hours following exposure, although its peak occurs at earlier time points.
- apoptosis of endothelial cells from the GI microvasculature is also considered critical for radiation caused GI toxicity.
- the radiation-induced inflammation is systemic and/or at the irradiated site.
- the radiation-induced inflammation encompassed by the present invention may be systemic, namely may affect all the body and/or at the irradiated site, namely at the specific location of radiation.
- the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28 and functional derivative thereof, or a pharmaceutical composition comprising the same, for use in a method for the treatment of a non-pathogen associated inflammatory disorder.
- the said isolated peptide and its functional derivatives have a binding affinity for the crystallographic homodimer interface of CD28 characterized by a K D lower than 30 micromolar, more specifically K D of from about 0.1 to about 30 micromolar.
- the said isolated peptide can have an amino acid sequence derived from a region of human CD28 harboring one or more amino acid residues forming homodimeric contacts or from a region of CTLA4 harboring one or more amino acid residues forming homodimeric contacts, and any functional fragments and derivatives of said peptide, wherein said functional fragments or derivatives maintain the ability to bind to said crystallographic homodimer interface of CD28 at a binding affinity characterized by a KD lower than 30 micromolar, more specifically KD of from about 0.1 to about 30 micromolar.
- the amino acid residues in human CD28 and CTLA4 forming homodimeric contacts are listed above.
- the present disclosure provides an isolated peptide which comprises the amino acid sequence SPMLVAYD denoted by SEQ ID NO: 4 (peptide p2TA) or the amino acid sequence (D-A)SPMLVAYD(D-A) denoted by SEQ ID NO: 47 (peptide (D-A)-p2TA-(D-A)), for use in a method for the treatment of radiation- induced inflammation.
- the radiation-induced inflammation is associated with at least one of gastrointestinal tract and spleen inflammation.
- Gastrointestinal toxicity can occur following irradiation of thoracic, abdominal, or pelvic malignancies whenever normal gastrointestinal structures are located within the radiation therapy (RT) field. Importantly, these toxicities can limit the maximum dose of RT and chemotherapy, and thus may limit the efficacy of treatment.
- the gastrointestinal side effects of RT include early (acute) toxicity, such as diarrhea and nausea that are experienced during or shortly after the completion of a course of therapy.
- late effects may be observed months to years after RT. These late reactions include ulceration, stricture formation, and bowel obstruction.
- the inflammatory disorder is radiation-induced gastroenteritis.
- radiation-induced gastroenteritis or “radiation enteritis” as herein defined refers to swelling and inflammation of the lining of the small intestine induced by radiation therapy applied in cancer treatments. Radiation enteritis is usually more severe in patients suffering from diabetes, atherosclerosis, or a history for prior abdominal surgery. The symptoms of radiation enteritis include, but are not limited to, anorexia, diarrhea, nausea, vomiting and weight loss.
- the present disclosure provides an isolated peptide which specifically binds to the crystallographic homodimer interface of human CD28, or a pharmaceutical composition comprising said isolated peptide, for use in a method of reducing radiation-induced thrombotic risk.
- Radiation-induced inflammation may be detected and monitored using any marker and methods known in the art, for example as exemplified herein, namely by tissue analysis for cell proliferation (cyclin Dl) and inflammation (COX-2) markers as well as by monitoring the morphology of the irradiated tissue (e.g. monitoring the morphology of villi and crypts in an irradiated intestinal tissue).
- tissue analysis for cell proliferation cyclin Dl
- COX-2 inflammation
- specific plasma markers of inflammation may be used, for example, but not limited to the cytokines interleukin 6 (IL-6), tumor necrosis factor, interferon-gamma, IL-1, and fibrinogen.
- the peptide (D-Ala)-p2 4-(D-Ala) (SEQ ID NO: 47) was given to irradiated mice 24 hours after being exposed to IR in order to investigate which of the features associated with IR exposure may be modulated in its presence.
- apoptosis of crypt stem cells has already reached its peak.
- in response to treatment with the peptide p2TA statistically significant differences in the quantity of IL-6 and fibrinogen were noted, as well as a significant decrease in jejunal crypt toxicity induced by IR.
- a decrease in COX-2 expression was found in all three tissues tested and an increase in Cyclin Dl was observed in crypt cells.
- Cyclin Dl expressing- crypt cells produce anti-inflammatory glucocorticoids, which may lead to the development of a GI protective anti-inflammatory feedback loop.
- the isolated peptide or any functional derivatives or fragments thereof or a pharmaceutical composition comprising said isolated peptide as herein defined is administered to said subject at any suitable time prior to and/or post irradiation.
- the isolated peptide or pharmaceutical composition for use according to the present disclosure is for administration to said subject in need thereof immediately following, or within from about 30 minutes up to any time at which the radiation-induced inflammation persists, whether while the subject is still undergoing radiation therapy, in between radiation therapy treatments or thereafter.
- the isolated peptide or pharmaceutical composition for use according to the present disclosure is for administration to a subject in need thereof from about 30 minutes to about 60 or 90 minutes, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 36, 48, 60 or 72 hours, 4, 5, 6, 7, 14, 32 or 28 days following exposure to said radiation.
- the isolated peptide or pharmaceutical composition for use according to the invention is for administration to said subject within about 24 hours following exposure to said radiation.
- the present disclosure is based on the finding that short peptides, for example p2TA, are capable of reducing the symptoms of inflammatory disease in various animal models ranging from adjuvant arthritis and collagen-induced arthritis to experimental autoimmune encephalitis (as detailed in Examples 4-6).
- the inflammatory disorder as herein defined is any one of rheumatoid arthritis, multiple sclerosis and myasthenia gravis as well as inflammatory bowel disease (IBD)
- rheumatoid arthritis refers to a chronic, systemic inflammatory disorder that primarily affects joints. It may result in deformed and painful joints, which can lead to loss of function. The disease may also have signs and symptoms in organs other than joints.
- multiple sclerosis' also known as disseminated sclerosis or encephalomyelitis disseminata as herein defined refers to an inflammatory disease in which the insulating covers of nerve cells in the brain and spinal cord are damaged. This damage disrupts the ability of parts of the nervous system to communicate, resulting in a wide range of signs and symptoms, including physical, mental, and psychiatric.
- muscle weakness refers to either autoimmune or congenital neuromuscular disease that leads to fluctuating muscle weakness and fatigue. In the most common cases, muscle weakness is caused by circulating antibodies that block acetylcholine receptors at the postsynaptic neuromuscular junction, inhibiting the excitatory effects of the neurotransmitter acetylcholine on nicotinic receptors at neuromuscular junctions.
- the inflammatory disorder is drug-induced inflammation.
- the drug-induced inflammation is any one of drug- induced hepatitis, drug-induced ocular inflammation, drug-induced gastrointestinal damage, drug-induced acute ulcers, drug-induced renal failure, drug-induced pancreatitis, drug-induced nephritis, chemotherapy-induced inflammation in the gastrointestinal tract and seborrheic keratosis.
- isolated peptide or any functional derivatives or fragments thereof or a pharmaceutical composition comprising said isolated peptide as herein defined may be administered in any route of administration.
- the isolated peptide or any functional derivatives or fragments thereof or the pharmaceutical composition is administered by a route selected from the group consisting of intravenous, intramuscular or intraperitoneal administration, intrathecal or subcutaneous injection, oral, intrarectal, intranasal ocular and topical administration.
- Calculating the "therapeutically effective amount" of the isolated peptide or any functional derivatives or fragments thereof for purposes herein defined is determined by such considerations as are known in the art in order to inhibit, arrest or alleviate inflammation and possibly other side effects induced by or resulting from exposure to ionized radiation.
- mice were injected with the p2TA peptide by a single administration of 5 mg/kg, with a human equivalent dose of 0.4 mg/kg.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use as herein defined is wherein said isolated peptide is administered at an amount of from about 0.05 mg to about 5.0 mg peptide/kg body weight of a subject in need thereof, for example 0.05, 0.1, o.15, 0.2, 0.25, 0.3, 0.4, 0.5, 1.0, 2.0, 3.0, 4.0 or 5.0 mg peptide/kg body weight of the subject.
- subject in need thereof means warm-blooded animals, such as for example rats, mice, dogs, cats, guinea pigs, primates and humans suffering from a non-pathogen associated inflammatory disorder as herein defined.
- subject in need thereof also relates to subjects prior to and/or after being exposed to at least one dose of ionizing radiation.
- subject in need thereof as herein defined also encompasses any subject already suffering from radiation-induced side effects, in order to improve the quality of life of the subject.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use according to present disclosure is administered at one or more identical or different treatment periods of one, two, three or four weeks of once daily, once every three days, once every five days or once weekly administrations of said isolated peptide, wherein said treatment periods are consecutive or are set apart from each other by non-treatment intervals of 1 or several days such as 2, 3, 4, 5 or 6 days, or 1 or several weeks such as 1, 2, 3 or 4 weeks or 1, 2, 3 or more months.
- the isolated peptide or any functional derivatives or fragments thereof or the pharmaceutical composition for use according to the present disclosure is administered at a single dose.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use according to the present disclosure is administered at one or more treatment periods of one, two, three or four weeks of once daily administrations of a therapeutically effective amount of said isolated peptide.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use according to the present disclosure is for chronic administration.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use according to the present disclosure is wherein said administration is once daily, once every three days, once every five days or once weekly.
- the isolated peptide or any functional derivatives or fragments thereof or pharmaceutical composition for use according to the present disclosure is for administration in combination with at least one additional therapeutically active agent.
- additional therapeutically active agent refers to an additional standard of care agent administered to a subject in need suffering from any of the non-pathogen associated inflammatory disorders as herein defined.
- an additional therapeutically active agent may be but is not limited to chemotherapy and anti-inflammatory agents (e.g. steroids and non-steroidal anti- inflammatory drugs).
- anti-inflammatory agents e.g. steroids and non-steroidal anti- inflammatory drugs.
- the additional therapeutically active agent may include, but is not limited to ondansetron, loperamide, diphenoxylate and atropine, cholestyramine, sucralfate, and topical corticosteroids (hydrocortisone) .
- the additional therapeutically active agent as herein defined is a steroid, a nonsteroidal anti-inflammatory agent or an immunosupressive agent.
- the isolated peptide or pharmaceutical composition according to the present disclosure and said at least one additional therapeutically active agent are administered simultaneously, or at different time points, in identical or different frequencies.
- the isolated peptide or pharmaceutical composition according to the present disclosure is administered prior to or after administration of said at least one additional therapeutically active agent.
- isolated peptide or pharmaceutical composition according to the present disclosure and the at least one additional therapeutically active agent as herein defined are administered for different durations of time.
- the isolated peptide or pharmaceutical composition for use according to the present disclosure is wherein said inflammatory disease or condition is rheumatoid arthritis and wherein said additional therapeutically active agent is selected from Abatacept, a TNF blocker, an IL-1 blocker, an IL-6 blocker and an Anti CD20 agent or a combination thereof.
- the isolated peptide or pharmaceutical composition for use according to the present disclosure is wherein said inflammatory disease or condition is multiple sclerosis and wherein said additional therapeutically active agent is selected from interferon- ⁇ , Copaxone and Tysabri or a combination thereof.
- said isolated peptide or pharmaceutical composition for use according to the present disclosure is wherein said inflammatory disease or condition is radiation-induced gastroenteritis and wherein said at least one additional therapeutically active agent is a chemotherapeutic agent.
- composition or “pharmaceutical composition” as herein defined generally comprises an active agent being a peptide in accordance with the present disclosure and at least one of a buffering agent, an agent which adjusts the osmolarity thereof, and optionally, one or more pharmaceutically acceptable carriers, excipients and/or additives as known in the art. Supplementary active ingredients can also be incorporated into the compositions.
- the carrier can be solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Protease inhibitors may also be added.
- the pharmaceutical composition for use according to the present disclosure comprises at least one physiologically compatible additive, carrier, diluent and excipient.
- the present disclosure provides a method of treating a non-pathogen associated inflammatory disorder in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of an isolated peptide which specifically binds to the crystallographic homodimer interface of CD28 or a functional derivative thereof, or a pharmaceutical composition comprising the same.
- the said peptide can be any one of the peptides disclosed herein and their functional derivatives as herein defined.
- Specific peptides are p2TA (SEQ ID NO: 4), (D-Ala)-p2TA-(D-Ala) (SEQ ID NO: 47), p2TB (SEQ ID NO: 9), (D-Ala)-p2TB-(D-Ala) (SEQ ID NO: 48), pel2 (SEQ ID NO: 12), (D-Ala)-pel2-(D-Ala) (SEQ ID NO: 49), and pal-pel 2-(D- Ala) (SEQ ID NO: 51).
- the method disclosed is intended for the treatment of radiation- induced inflammation, inflammatory bowel disease (IBD), radiation-induced gastroenteritis, drug-induced inflammation, arthritis, rheumatoid arthritis, osteoarthritis, lupus, myasthenia gravis, multiple sclerosis, adult respiratory distress syndrome (ARDS), asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis, appendicitis, bursitis, colitis, cystitis, dermatitis, phlebitis, vasculitis, acne vulgaris, and pelvic inflammatory disease.
- IBD inflammatory bowel disease
- ARDS adult respiratory distress syndrome
- asthma rhinitis, idiopathic pulmonary fibrosis, peritonitis
- cardiovascular inflammation myocardial
- the said drug-induced inflammation is any one of drug-induced hepatitis, drug-induced ocular inflammation, drug-induced gastrointestinal damage, drug-induced acute ulcers, drug-induced renal failure, drug-induced pancreatitis, drug-induced nephritis, chemotherapy-induced inflammation in the gastrointestinal tract and seborrheic keratosis.
- a specific condition treated by the method of the invention is radiation-induced inflammation, which can be systemic and/or at the irradiated site.
- the radiation-induced inflammation can be associated with at least one of gastrointestinal tract and spleen inflammation.
- Administration of the isolated peptide or composition comprising the same can be by a route selected from the group consisting of intravenous, intramuscular or intraperitoneal administration, intrathecal or subcutaneous injection, oral, intrarectal, intranasal ocular and topical administration.
- the isolated peptide is administered at an amount of from about 0.05 mg to about 5.0 mg, for example 0.05, 0.1, o.l5, 0.2, 0.25, 0.3, 0.4, 0.5, 1.0, 2.0, 3.0, 4.0 or 5.0 mg peptide/kg body weight of the subject in need thereof.
- the said peptide can administered at one or more identical or different treatment periods of one, two, three or four weeks of once daily, once every three days, once every five days or once weekly administrations of said isolated peptide, wherein said treatment periods are consecutive or are set apart from each other by non-treatment intervals of 1 or several days, or 1 or several weeks or 1 or more months.
- the said peptide can also be administered at a single dose.
- Treatment can be by administration of the peptide to said subject in need at one or more treatment periods of one, two, three or four weeks of once daily administrations of a therapeutically effective amount of said isolated peptide.
- the disclosed method is suitable not only for treatment of acute inflammatory conditions, but also for chronic administration.
- administration of the peptide or pharmaceutical composition comprising the same can be once daily, once every three days, once every five days or once weekly.
- the peptide or pharmaceutical composition comprising the same can be administered to said subject at a suitable time prior to and/or post irradiation.
- the said peptide or pharmaceutical composition comprising the same can be administered to said subject immediately following, or within from about 30 minutes up to any time at which the radiation-induced inflammation persists, whether while the subject is still undergoing radiation therapy, in between radiation therapy treatments or thereafter.
- the peptide or pharmaceutical composition comprising the same can be administered to said subject in need from about 30 minutes to about 60 or 90 minutes, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 36, 48, 60 or 72 hours, 4, 5, 6, 7, 14, 32 or 28 days following exposure to said radiation. Specifically, administration to said subject within about 24 hours following exposure to said radiation.
- the disclosed peptides or pharmaceutical composition comprising the same can also be administered in combination with at least one additional therapeutically active agent.
- the additional therapeutically active agent can be at least one of a steroid, a nonsteroidal anti-inflammatory agent or an immunosupressive agent.
- the said peptide or pharmaceutical composition and said at least one additional therapeutically active agent can be administered simultaneously, or at different time points, in identical or different frequencies.
- said additional therapeutically active agent is selected from Abatacept, a TNF blocker, an IL-1 blocker, an IL-6 blocker and an Anti CD20 agent or a combination thereof.
- said additional therapeutically active agent is selected from interferon- ⁇ , Copaxone and Tysabri or a combination thereof.
- said at least one additional therapeutically active agent is a chemotherapeutic agent.
- the peptides described herein were synthesized using fluoronyl-methoxycarbonyl chemistry, cleaved and the side chain deprotected with triflouroacetic acid. Peptides were >95 pure by high-pressure liquid chromatography and their molecular weight was verified by MALDI-TOF mass spectrometry. The peptides were abutted with D- Alanine (D-Ala) at both termini for greater protease resistance in biological assays (5, 6) and with Cysteine (Cys) for surface plasmon resonance spectroscopy. Where indicated, palmitoyl-lysine (pal) was linked to the N-terminus of the peptide instead of D-Ala.
- D-Ala D- Alanine
- Cysteine Cysteine
- CD28 affinity selection of pel2 the PhD-12 combinatorial phage display library of M13KE (New England Biolabs) was panned on immobilized CD28- Fc following the manufacturer's instructions. After 4 rounds of panning, phages were immobilized on nitrocellulose membranes and incubated with 0.5 Dg/ml horseradish peroxidase-conjugated CD28-Fc (R&D Systems); >10 of selected phages tightly bound CD28-FC.
- the peptide having the amino acid sequence of SPMLVAYD (denoted by SEQ ID NO. 4), corresponding to residues 8-15 of the extracellular domain of CD28, was abutted by D-Ala amino acid residues at both its termini, as described above and is denoted herein by SEQ ID NO. 47 and termed herein "p2TA”.
- the peptide having the amino acid sequence of PAVVLASS (denoted by SEQ ID NO. 9), corresponding to residues 8-15 of the extracellular domain of CTLA-4 homodimer interface was abutted by D-Ala amino acid residues at both its termini and is denoted herein by SEQ ID NO. 48 and termed herein "p2TB”.
- the peptide having the amino acid sequence SHFTHNRHGHST was selected from a 12-mer phage display library for affinity for the extracellular domain of CD28, as detailed above.
- This peptide was abutted by D-Ala amino acid residues at both its termini and is denoted herein by SEQ ID NO. 49 and termed herein "pel 2".
- Various of the peptides were also abutted by palmitoyl-lysine (pal) instead of D-Ala at their N-terminus.
- SEQ ID NO. 50 and SEQ ID NO. 51 denotes palmitoyl-lysine at the N-termini of the peptides p2TB and pel2, respectively and these peptides are termed herein p273 ⁇ 4-pal and pel2-pal, respectively.
- PBMC Peripheral blood mononuclear cells
- otCD3 mouse anti-human monoclonal antibodies otCD3 (clone UCHT1 ; 100 ng/ml) and otCD28 (clone 37407; 2.5 ⁇ g/ml) (both from R&D Systems) were used as inducers. Cytokines in culture medium were determined with Quantikine ELISA kits (R&D Systems) according to the manufacturer's instructions.
- Peptides were diluted to 10-200 ⁇ g/ml in 10 mM Sodium (Na) acetate pH 4.0 and immobilized on a CM5 sensor chip (BIAcore) using an amine-thiol coupling kit (BIAcore), respectively; the immobilized amounts were 500-1,000 resonance units.
- Analytes were injected at 20 ⁇ /min in 25 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% surfactant P20 under conditions showing no mass transport limitation. Regeneration was with 50 mM phosphoric acid.
- Kinetic analyses were performed at 25°C in a BIAcore 3000 instrument, deducting the signal from the control flow cell from the binding signal.
- a vector expressing B7-2 was generated by cDNA synthesis of human CD86 (NM_175862) from total human PBMC RNA using Verso RT-PCR kit (ABgene).
- CD86 cDNA was generated using KOD polymerase (Novagen) with the phosphorylated PCR primers 5'-GACGTCGACGGAAGGCTTGCACAGGGT (denoted by SEQ ID NO: 53) and 5'-CACGCGGCCGCCCAGGTCATGAGCCATTAAGC (denoted by SEQ ID NO: 54).
- the PCR product was inserted into pEGFP-N3 DNA (Clontech) that had been digested with Salll and Notl and lacked the GFP region, using Fast-Link DNA Ligation Kit (Epicentre).
- Vectors expressing B7-2 fused C-terminally to GFP or Cherry were generated from B7-2 cDNA vector template with phosphorylated PCR primers 5'- TACTCGAGATGGGACTGAGTAACATTC (denoted by SEQ ID NO: 55) and 5'- GTCCGCGGTGAAGCATGTACACTTTTGTCG (denoted by SEQ ID NO: 56), deleting the B7-2 termination codon.
- PCR primers 5'- TACTCGAGATGGGACTGAGTAACATTC (denoted by SEQ ID NO: 55) and 5'- GTCCGCGGTGAAGCATGTACACTTTTGTCG (denoted by SEQ ID NO: 56), deleting the B7-2 termination codon.
- the PCR product was inserted either into pEGFP-N3 DNA or pmCherry-Nl DNA (Clontech).
- B7-2C/Cherry vector was generated from B7-2/Cherry template using primers 5'- GTCTCTCGTCCTTCCGG (denoted by SEQ ID NO: 57) and 5'- CTAACTTCAGTCAACCTG (denoted by SEQ ID NO: 58).
- the above primers are listed in Table 2 below.
- HEK293T cells were transfected to express cell-surface CD28, as described in Arad et al., 2011 (3) or with an empty vector expressing GFP. After 36 hours, the cells were incubated for 45 min with 0.2 ⁇ g/ml soluble B7-2 in the absence or in the presence of (D-A)-p2JA-(D- A). After three washes with cold phosphate-buffered saline, the cells were lysed. Equal amounts of total cell protein (as determined by a Bradford assay) were subjected to 10% PAGE and Western blotting to show binding of B7-2 and expression of CD28 by the cells.
- HEK293T cells separately transfected to express CD28/GFP (green) and B7-2/Cherry or B7-2C/Cherry (red), and upon addition of 10 mM EDTA were co-incubated in the absence or presence of (D-A)-p2JA-(D-A) for 2 hours at room temperature at a concentration of 10 5 cells ml "1 each. Synapse formation between cell populations was analyzed by flow cytometry (Eclipse Flow Cytometry System, Sony), scoring the percentage of events positive for green and red using FlowJo vX.0.6 software.
- B7-2-Fc and CD28-Fc expressed in mouse myeloma NSO cells comprise the extracellular 20-239 and 19-152 amino acid domain, respectively, of the mature human ligands fused to C-terminal human IgGl Fc and are homodimers, disulfide-linked in the Fc domain. Soluble ligands were >95 pure as judged by SDS- PAGE.
- Peptides, phosphate-buffered saline (PBS) or dexamethasone were injected intravenously (IV). Rats were weighed weekly, and overall health status noted. Rats were monitored by daily examination for the onset of disease, which was recorded. Clinical score was determined by swelling of the joints on a scale of 1-4 per limb, with a maximal total score/animal reaching 16.
- mice Male DB1 mice (Harlan, Israel, 8 weeks) were used to elicit collagen- induced arthritis by SC injection on days 0 and 21 of 0.05 ml of a mixture containing 0.5 mg type II collagen from calf joints, dissolved in 0.1 molar acetic acid mixed 1 : 1 with 1.5 mg/ml complete Freund's Adjuvant emulsion into the base of their tail. Peptide, PBS or dexamethasone was administered daily from the disease onset until termination. Mice were weighed weekly, and their overall health status was noted. Mice were monitored by daily examination for the onset of disease, which was recorded. Clinical score was determined by swelling of the joints on a scale of 1-4 per limb, with a maximal total score/animal reaching 16.
- EAE Experimental autoimmune encephalitis
- MOG peptide 35-55 (Sigma) solution was prepared freshly prior to each inoculation session by dissolving the reverse phase high performance liquid chromatography (RP-HPLC)-purified lyophilized powder in PBS to achieve a solution at a final concentration of 2.5 mg/ml mixed with complete Freund's adjuvant suspension, containing killed M. tuberculosis HR37 (DIFCO - Cat.No 231141) at a concentration of 4 mg/ml; 200 ⁇ of this solution was injected SC into the right flank of the mice on day 0 and into the left flank on day 7. Pertussis toxin (200 ng) was injected intraperitoneal (IP) on days 0 and 2.
- RP-HPLC reverse phase high performance liquid chromatography
- Peptide or PBS was injected SC on the back of the mice.
- Solumedrol SOLU-MEDROL 500mg, Pfizer
- Mice were weighed weekly, and their overall health status was noted. Mice were monitored by daily examination for the onset of disease, which was recorded. Encephalitic score was measured by observation of paralysis: score 1, tail paralysis; score 2, back limbs paralysis; score 3, front limbs paralysis; score 4, total body paralysis; score 5, mortality.
- mice of BALB/c and A/J strains Eight weeks old male mice of BALB/c and A/J strains were obtained from Jackson Laboratories (Bar Harbor, ME). Mice received rodent chow (Harlan Teklad, WI) and water ad libitum. Housing and experiments were carried out with institutional Animal Care and Use Committee approval. Two inbred strains of mice, BALB/c ad A/J, were selected for this study because of their innate differences in radiosensitivity. Specifically, the jejunal crypt cells of BALB/c mice were found to be more radiosensitive than those of A/J animals.
- mice Eight animals were exposed to 8 Gy of total- body irradiation, where four of these animals were injected with (D-A)-p2JA-(D-A) peptide 24 hours post irradiation (the group termed "RP") in order to evaluate whether (D-A)-p2JA-(D-A) peptide can mitigate the effects of radiation.
- the group of mice exposed to 8 Gy of total-body irradiation and not treated with the peptide was termed "R”
- sham-irradiated mice (control) were termed "C”
- sham-irradiated mice that received 5 mg/kg of the (D-A)-p2JA-(D-A) peptide were termed "P”.
- mice of each strain were given a single total-body radiation dose of 8 Gy cesium 137 (Cs-137) gamma rays, at a dose rate of 95.7 cGy/min (Best Theratronics, Ottawa, Canada). Sham-irradiated animals were treated in the same manner but were not exposed to the source and served as control animals. Twenty four hours later, half of the sham- and 8Gy-irradiated mice were injected with (D-A)-p2JA-(D-A) peptide (5 mg/kg) via tail vein injection,. Animals were sacrificed by C(3 ⁇ 4 asphyxiation followed by cervical dislocation 7 days after irradiation (namely 6 days after peptide injection).
- IL-6 Interleukin 6
- IL-6 Interleukin 6
- eBioscience eBioscience, San Diego, CA
- Fibrinogen concentration determination in plasma samples diluted 1 :20,000 was performed using a specific ELISA kit (Immunology Consultants Laboratory, Portland, OR). Recombinant mouse IL-6 and fibrinogen were used as standards.
- Intestinal damage was assessed by measurements of villus height and the numbers of surviving crypts in each circumference using H&E-stained jejunal slides.
- Villus height was measured from the bottom of the crypt to the crypt-villus junction.
- the number of surviving crypts was determined using the criteria that a surviving crypt must contain at least 10 epithelial cells, at least one Paneth cell and a lumen.
- Four circumferences were scored per mouse in each group. The viability of surviving crypts was confirmed by immunohistochemical detection of cyclin Dl.
- Horseradish peroxidase-conjugated goat anti-mouse IgG or donkey anti-goat (KPL), mouse monoclonal otCD28 (clone 37407), otCD3 (clone UCHT1), goat polyclonal anti- CD28 and anti-B7-2 (R&D Systems) antibodies were used.
- the peptides obtained are denoted herein by SEQ ID NO. 47 ((D-A)-p2JA-(D-A)), SEQ ID NO. 48 ((D-A)- p273 ⁇ 4-(D-A)) and SEQ ID NO. 49 ((D-A)-pei2-(D-A)).
- the peptides ⁇ 2 ⁇ , p273 ⁇ 4 and pel 2 did not inhibit the otCD3-mediated induction of IL2 and TNF- ⁇ .
- these peptides did not inhibit the otCD3-mediated induction of the Thl cytokines IFN- ⁇ ( Figure 2A), showing that they do not block signaling through the T cell receptor.
- the CD28 dimer interface mimetic peptide p2TA was designed to be a superantigen toxin antagonist that by binding to the superantigen prevents it from binding to CD28 and thereby from inducing a harmful pathogen-induced inflammatory cytokine response (3). Therefore, the results presented in Figure 4A, namely the finding that p2TA binds directly to CD28, was unexpected.
- B7-2/CD28 costimulatory axis is critical for full T-cell activation resulting in an inflammatory cytokine response.
- CD28 and B7-2 were each separately expressed on the cell surface of cells and the effect of p2TA on binding of B7-2 and CD28 was studied.
- This strategy allowed for monitoring the B7-2/CD28 interaction in the absence of multiple ligand-receptor interactions that underlie synapse formation between the antigen-presenting cell and the T cell, involving not only MHC-II/TCR interaction but also numerous costimulatory ligand pairs (CD28, CTLA-4, CD40, PD-1, ICOS, B7-1, B7-2, etc.), that would mask the contribution of B7-2/CD28 engagement.
- p2TA (SEQ ID NO: 47) strongly inhibited the binding of soluble B7-2 to cell-surface CD28.
- binding of soluble CD28 to cell-surface B7-2 was inhibited by an order of magnitude by p2TA.
- This inhibitory activity of p2TA was sequence-specific, as verified by scrambling of the amino acid sequence of p2TA. Random scrambling of the amino acid sequence of p2TA (namely (D-A)SPMLVAYD(D-A)), denoted by SEQ ID NO: 47 to (D- A)ASMDYPVL(D-A), denoted by SEQ ID NO.
- the ability of the peptides to suppress symptoms of an autoimmune disease caused by excessive production of inflammatory cytokines, including IFN- ⁇ , IL2 and TNF-ot was examined in the rat adjuvant arthritis model, in which arthritis was induced by exposure to Mycobacterium tuberculosis, as described above.
- EAE in the mouse is an established model of multiple sclerosis. In this model system, symptoms appear around day 10 after disease induction and increase up to day 30 (see for example Figure 11 A). EAE was induced in mice as described above.
- IR ionizing radiation
- GI gastrointestinal
- mice The effect of the peptide (D-Ala)-p2JA-(D-Ala) (denoted by SEQ ID NO: 47) on irradiated mice was thus further examined in a radiation-induced inflammation animal model, as described above. The effect was assessed based on the levels of IL-6, and fibrinogen, all of which are considered as pro-inflammatory mediators.
- Cytokine interleukin 6 is an important mediator of the acute phase of protein expression and hematopoietic cell production.
- IL-6 Cytokine interleukin 6
- Figure 12A when measured seven days after exposure to radiation, IL-6 had increased significantly in the plasma of mice that were exposed to radiation as described above, consistent with previous reports.
- Figure 12A demonstrates that IL-6 levels were enhanced 6.9- and 8.9-fold in the plasma of irradiated mice, respectively, in BALB/c and A/J mice (P ⁇ 0.05, R vs. C group). Injection of sham-irradiated mice with the (D-Ala)-p2JA-(D-Ala) peptide did not affect IL-6 levels ( Figure 12A).
- p2TA peptide protects the small intestine from radiation-induced damage
- mice the number of microcolonies elevated from 6.5 ⁇ 1.3/ ⁇ in the R group to 12.4 ⁇ 3.2/ ⁇ in the RP group (P ⁇ 0.05).
- a J mice the number of microcolonies elevated from 7.8 ⁇ 1.6/ ⁇ in the R group to 12.1 ⁇ 2.1/ ⁇ in the RP group (P ⁇ 0.05).
- Villus height in jejunal cross sections is another hallmark of gastrointestinal tract (GI) injury.
- GI gastrointestinal tract
- the mean villus height was 192 ⁇ 41 ⁇ for control BALB/c and 208 ⁇ 45 ⁇ for control A/J mice.
- the mean villus height decreased to 86 ⁇ 25 ⁇ for BALB/c and 122 ⁇ 22 ⁇ for A/J mice.
- administration of the (D-Ala)-p2JA-(D-Ala) peptide reversed some of this radiation-induced effect.
- Cyclin Dl expression is a marker for cell proliferation in jejunal crypts, and is critical for the maintenance of tissue homeostasis. While gastrointestinal (GI) samples from irradiated mice showed a marked decline in numbers of cyclin Dl positive cells (determined as described above), as demonstrated in Figure 14, this decline was negligible in both BALB/c and A/J mice that had received the (D-Ala)-p2JA-(D-Ala) peptide 24 hours after the 8Gy irradiation.
- GI gastrointestinal
- Figure 14 demonstrates a weak cyclin Dl staining observed in a tissue of the R group (namely Figure 14C and Figure 14G for BALB/c and A/J mice, respectively) that is restored in the RP group of mice that received 5 mg/kg of (D-Ala)-p2JA-(D-Ala) peptide 24 h after irradiation (namely Figure 14D and Figure 14H for BALB/c and A/J mice, respectively).
- p2TA peptide inhibits radiation-induced over-expression of the inflammatory marker COX-2 in jejunal crypts and spleen
- Cyclooxygenase-2 (COX-2) is a key inducible enzyme involved in prostaglandin production; it is generally undetectable in unperturbed epithelial tissues but can be strongly up-regulated by a number of inflammatory stimuli, including ionizing radiation (17).
- Figure 15 and Figure 16 show representative microphotographs of jejunum and spleen tissues, respectively, immuno-stained for COX-2 protein. Seven days after exposure to a radiation of 8 Gy, the jejunum ( Figure 15) and spleen ( Figure 16) demonstrated a marked increase in the expression of COX-2. Remarkably, a single administration of (D-Ala)-p2JA-(D-Ala) peptide 24 hours after radiation exposure ameliorated this radiation effect in all three tissues tested.
- (D-Ala)-p2JA-(D-Ala) treated irradiated animals displayed decreased numbers of F4/80-positive cells in both strains of mice.
- the number of macrophages in RP group was 0.77 + 0.31 cells/mm2 (P ⁇ 0.05, R vs. RP group) in BALB/c mice and 1.37 + 0.68 cells/mm2 (P ⁇ 0.05, R vs. RP group) in A/J mice. Therefore, a single administration of ⁇ 2 ⁇ peptide 24 hours after exposure to radiation compensated for radiation-induced increase in macrophage recruitment to mouse intestine.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Dermatology (AREA)
- Pulmonology (AREA)
- Epidemiology (AREA)
- Diabetes (AREA)
- Neurology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Toxicology (AREA)
- Biomedical Technology (AREA)
- Rheumatology (AREA)
- Neurosurgery (AREA)
- Urology & Nephrology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Pain & Pain Management (AREA)
- Otolaryngology (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2014358677A AU2014358677A1 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
| CA2932150A CA2932150A1 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 |
| JP2016536910A JP6757667B2 (ja) | 2013-12-06 | 2014-12-07 | Cd28を介したシグナル伝達を阻害する短ペプチドによる炎症性疾病の症候の軽減 |
| US15/035,571 US9963497B2 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
| SG11201604512XA SG11201604512XA (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 |
| EP14830734.1A EP3077415B1 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 |
| IL245613A IL245613B (en) | 2013-12-06 | 2016-05-11 | Peptides for use in the treatment of inflammatory diseases that are not related to pathogenic factors |
| AU2017261479A AU2017261479B2 (en) | 2013-12-06 | 2017-11-14 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
| US15/936,686 US10280209B2 (en) | 2013-12-06 | 2018-03-27 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361912631P | 2013-12-06 | 2013-12-06 | |
| US61/912,631 | 2013-12-06 | ||
| US201461924869P | 2014-01-08 | 2014-01-08 | |
| US61/924,869 | 2014-01-08 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/035,571 A-371-Of-International US9963497B2 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
| US15/936,686 Continuation US10280209B2 (en) | 2013-12-06 | 2018-03-27 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015083173A1 true WO2015083173A1 (en) | 2015-06-11 |
Family
ID=52396781
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2014/051067 Ceased WO2015083173A1 (en) | 2013-12-06 | 2014-12-07 | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through cd28 |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US9963497B2 (OSRAM) |
| EP (1) | EP3077415B1 (OSRAM) |
| JP (1) | JP6757667B2 (OSRAM) |
| AU (2) | AU2014358677A1 (OSRAM) |
| CA (1) | CA2932150A1 (OSRAM) |
| SG (2) | SG10201804750XA (OSRAM) |
| WO (1) | WO2015083173A1 (OSRAM) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019069307A1 (en) * | 2017-10-06 | 2019-04-11 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | PEPTIDES FOR THE TREATMENT OF VIRAL INFECTIONS |
| CN111253469A (zh) * | 2020-03-06 | 2020-06-09 | 暨南大学 | 一种自组装短肽及其在治疗痤疮方面的应用 |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9963497B2 (en) * | 2013-12-06 | 2018-05-08 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
| US11344578B2 (en) | 2017-04-19 | 2022-05-31 | Board Of Regents, The University Of Texas System | Immune cells expressing engineered antigen receptors |
| WO2019165121A1 (en) | 2018-02-21 | 2019-08-29 | Board Of Regents, The University Of Texas System | Methods for activation and expansion of natural killer cells and uses therof |
| CA3233983A1 (en) * | 2021-11-02 | 2023-05-11 | Ole-Jan Iversen (Deceased) | Tri-, tetra and pentapeptides, compositions thereof and their use in the therapy of psoriasis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004087754A1 (en) * | 2003-04-03 | 2004-10-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Broad-spectrum in-vivo effective superantigen toxin antagonists based on the interaction between cd28 and the superantigen and uses thereof |
| DE102012008730A1 (de) * | 2011-12-02 | 2013-06-06 | Dr. Budz GmbH | Orale Zusammensetzungen mit ungesättigten C18-Fettsäuren und ihre Verwendung |
| WO2013108193A1 (en) | 2012-01-16 | 2013-07-25 | Atox Bio Ltd. | Synthetic peptides for treatment of bacterial infections |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8535672B2 (en) * | 2002-04-04 | 2013-09-17 | Yissum Research Development Of The Hebrew University Of Jerusalem | Broad-spectrum in-vivo effective superantigen toxin antagonists based on the interaction between CD28 and the superantigen and uses thereof |
| US20110097339A1 (en) * | 2008-07-18 | 2011-04-28 | Domantis Limited | Compositions monovalent for CD28 binding and methods of use |
| US8785604B2 (en) * | 2010-02-18 | 2014-07-22 | Effimune | Anti-CD28 humanized antibodies |
| US9963497B2 (en) * | 2013-12-06 | 2018-05-08 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 |
-
2014
- 2014-12-07 US US15/035,571 patent/US9963497B2/en active Active
- 2014-12-07 SG SG10201804750XA patent/SG10201804750XA/en unknown
- 2014-12-07 SG SG11201604512XA patent/SG11201604512XA/en unknown
- 2014-12-07 WO PCT/IL2014/051067 patent/WO2015083173A1/en not_active Ceased
- 2014-12-07 EP EP14830734.1A patent/EP3077415B1/en active Active
- 2014-12-07 JP JP2016536910A patent/JP6757667B2/ja not_active Expired - Fee Related
- 2014-12-07 CA CA2932150A patent/CA2932150A1/en not_active Abandoned
- 2014-12-07 AU AU2014358677A patent/AU2014358677A1/en not_active Abandoned
-
2017
- 2017-11-14 AU AU2017261479A patent/AU2017261479B2/en not_active Ceased
-
2018
- 2018-03-27 US US15/936,686 patent/US10280209B2/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004087754A1 (en) * | 2003-04-03 | 2004-10-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Broad-spectrum in-vivo effective superantigen toxin antagonists based on the interaction between cd28 and the superantigen and uses thereof |
| WO2004087196A2 (en) * | 2003-04-03 | 2004-10-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Methods and compositions for the inhibition of modulation of t cell costimulatory pathway by a pathogenic agent |
| DE102012008730A1 (de) * | 2011-12-02 | 2013-06-06 | Dr. Budz GmbH | Orale Zusammensetzungen mit ungesättigten C18-Fettsäuren und ihre Verwendung |
| WO2013108193A1 (en) | 2012-01-16 | 2013-07-25 | Atox Bio Ltd. | Synthetic peptides for treatment of bacterial infections |
Non-Patent Citations (11)
| Title |
|---|
| ARAD G; LEVY R; HILLMAN D; KAEMPFER R: "Superantigen antagonist protects against lethal shock and defines a new domain for T-cell activation", NAT MED., vol. 6, 2000, pages 414 - 21, XP002255219, DOI: doi:10.1038/74672 |
| ARAD G; LEVY R; NASIE I; HILLMAN D; ROTFOGEL Z; BARASH U ET AL.: "Binding of Superantigen Toxins into the CD28 Homodimer Interface Is Essential for Induction of Cytokine Genes That Mediate, Lethal Shock", PLOS BIOL., 2011, pages E1001149 |
| BULGER E; MAIER R; SPERRY J; JOSHI; HENRY S; MOORE FA ET AL.: "A novel drug for treatment of necrotizing soft tissue infections: Results of a Phase 2a randomized controlled trial of AB103, a CD28 co-stimulatory receptor antagonist", JAMA J AM MED ASSOC SURG., vol. 149, 2014, pages 528 - 536 |
| EVANS, J. E. ET AL., NAT IMMUN, vol. 6, 2005, pages 271 - 279 |
| FRANÇOIS A; MILLIAT F; GUIPAUD O; BENDERITTER M: "Inflammation and immunity in radiation damage to the gut mucosa", BIOMED RES INT., 2013, pages 123241 |
| KAEMPFER R; ARAD; LEVY R; HILLMAN D; NASIE I; ROTFOGEL Z: "CD28: Direct and Critical Receptor for Superantigen Toxins", TOXINS (BASEL, vol. 5, 2013, pages 1531 - 42, XP055170193, DOI: doi:10.3390/toxins5091531 |
| KAPSOGEORGOU, E.K.; MOUTSOPOULOS, H.M.; MANOUSSAKIS, M.N.: "A novel B7-2 (CD86) splice variant with a putative negative regulatory role", J. IMMUNOL., vol. 180, 2008, pages 3815 - 3823 |
| PETERSEN C; BAUMANN M; PETERSEN S: "New targets for the modulation of radiation response-selective inhibition of the enzyme cyclooxygenase 2", CURR MED CHEM ANTICANCER AGENTS, vol. 3, 2003, pages 354 - 9 |
| RAMACHANDRAN G; TULAPURKAR ME; HARRIS KM; ARAD G; SHIRVAN A; SHEMESH R ET AL.: "A peptide antagonist of CD28 signaling attenuates toxic shock and necrotizing soft-tissue infection induced by Streptococcus pyogenes", J INFECT DIS., vol. 207, 2013, pages 1869 - 77, XP055170279, DOI: doi:10.1093/infdis/jit104 |
| SCHWARTZ JC ET AL., NATURE, vol. 410, pages 604 - 608 |
| SRINIVASAN M; GIENAPP IE; STUCKMAN SS; ROGERS CJ; JEWELL SD; KAUMAYA PT; WHITACRE CC: "Suppression of experimental autoimmune encephalomyelitis using peptide mimics of CD28", J IMMUNOL., vol. 169, 2002, pages 2180 - 2188 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019069307A1 (en) * | 2017-10-06 | 2019-04-11 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | PEPTIDES FOR THE TREATMENT OF VIRAL INFECTIONS |
| US11304989B2 (en) | 2017-10-06 | 2022-04-19 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd | Peptides for use in the treatment of viral infections |
| CN111253469A (zh) * | 2020-03-06 | 2020-06-09 | 暨南大学 | 一种自组装短肽及其在治疗痤疮方面的应用 |
| CN111253469B (zh) * | 2020-03-06 | 2021-09-07 | 暨南大学 | 一种自组装短肽及其在治疗痤疮方面的应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160289295A1 (en) | 2016-10-06 |
| AU2017261479B2 (en) | 2019-05-02 |
| SG11201604512XA (en) | 2016-07-28 |
| US10280209B2 (en) | 2019-05-07 |
| AU2017261479A1 (en) | 2017-11-30 |
| EP3077415B1 (en) | 2020-02-12 |
| JP6757667B2 (ja) | 2020-09-23 |
| AU2014358677A1 (en) | 2016-06-02 |
| US20180215804A1 (en) | 2018-08-02 |
| SG10201804750XA (en) | 2018-07-30 |
| JP2017501999A (ja) | 2017-01-19 |
| EP3077415A1 (en) | 2016-10-12 |
| CA2932150A1 (en) | 2015-06-11 |
| US9963497B2 (en) | 2018-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10280209B2 (en) | Reduction of inflammatory disease symptoms by short peptides that inhibit signaling through CD28 | |
| KR20220048988A (ko) | 대식세포 특이적 인게이저 조성물 및 이의 사용 방법 | |
| EP2680872B1 (en) | Use of pif peptides for treating infections, atherosclerosis and peritonitis | |
| CN113508129A (zh) | 突变的白介素-34(il-34)多肽及其在治疗中的用途 | |
| EP4041283A1 (en) | Il-2 chimeric proteins for immunosuppression | |
| US11613565B2 (en) | Isolated peptides derived from the B7 ligand dimer interface and uses thereof | |
| JP2023036860A (ja) | 腫瘍浸潤t細胞集団を生成する方法 | |
| KR102456666B1 (ko) | HLA-B57 개방 이형태체(open conformer) | |
| WO2020036987A1 (en) | Peptides and compositions for targeted treatment and imaging | |
| KR101913333B1 (ko) | 신규 ctl 에피토프 4 연결 펩타이드 | |
| EP3749684A1 (en) | Modified immunomodulatory peptide | |
| US20230190865A1 (en) | VIP Antagonists and Uses in Treating Cancer | |
| EP3126377B1 (en) | An isolated donor mhc-derived peptide and uses thereof | |
| US20240226306A1 (en) | Trem-2/dap-12 inhibitors for treating lung disease and injury and combinations thereof | |
| JP6758022B2 (ja) | 血管内皮細胞増殖因子受容体阻害ペプチド | |
| KR20180132766A (ko) | 신규한 tslp 저해인자 | |
| RU2851193C2 (ru) | Мутантный полипептид интерлейкина-34 (IL-34) и его применение в терапии | |
| JP7245844B2 (ja) | 抗悪性腫瘍剤による末梢神経障害の症状軽減及び/又は発症抑制のための医薬 | |
| EP4082562A2 (en) | Polypeptides comprising mutated forms of human vegf-a with rearrangements of disulfide bonds and compositions containing same | |
| WO2025217056A2 (en) | Vasoactive intestinal polypeptide (vip) receptor antagonists fc fusions and methods of use | |
| HK40012892B (en) | Antibodies and polypeptides directed against cd127 | |
| HK40012892A (en) | Antibodies and polypeptides directed against cd127 | |
| HK1209791A1 (en) | Novel il-17r-ecd mutants | |
| HK1209791B (en) | Novel il-17r-ecd mutants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14830734 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15035571 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 245613 Country of ref document: IL |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014830734 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014830734 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2932150 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014358677 Country of ref document: AU Date of ref document: 20141207 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2016536910 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |