WO2015073803A1 - Neurodegenerative disorders and methods of treatment and diagnosis thereof - Google Patents

Neurodegenerative disorders and methods of treatment and diagnosis thereof Download PDF

Info

Publication number
WO2015073803A1
WO2015073803A1 PCT/US2014/065670 US2014065670W WO2015073803A1 WO 2015073803 A1 WO2015073803 A1 WO 2015073803A1 US 2014065670 W US2014065670 W US 2014065670W WO 2015073803 A1 WO2015073803 A1 WO 2015073803A1
Authority
WO
WIPO (PCT)
Prior art keywords
animal
anaplerotic
neurodegenerative
disorder
enzymes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/065670
Other languages
English (en)
French (fr)
Inventor
Karin Borges
Shyuan T. NGO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Queensland UQ
Original Assignee
University of Queensland UQ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES14861265T priority Critical patent/ES2774321T3/es
Priority to US15/036,523 priority patent/US9833430B2/en
Priority to EP20150222.6A priority patent/EP3689343A1/en
Priority to AU2014348457A priority patent/AU2014348457B2/en
Priority to EP14861265.8A priority patent/EP3068492B1/en
Priority to CA2929601A priority patent/CA2929601A1/en
Application filed by University of Queensland UQ filed Critical University of Queensland UQ
Priority to JP2016529439A priority patent/JP6588903B2/ja
Publication of WO2015073803A1 publication Critical patent/WO2015073803A1/en
Anticipated expiration legal-status Critical
Priority to US15/825,572 priority patent/US20180207121A1/en
Priority to US16/171,191 priority patent/US20190255008A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/225Polycarboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/194Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/20Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/0004Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Definitions

  • THIS INVENTION relates generally to compositions and methods for the therapy and diagnosis of neurodegenerative and/or neuromuscular disorders. More particularly, this invention relates to use of anaplerotic agents for treating, preventing and/or delaying the onset of a neurodegenerative and/or neuromuscular disorder.
  • ALS Amyotrophic lateral sclerosis
  • TCA tricarboxylic acid
  • ATP adenosine triphosphate
  • Triheptanoin the triglyceride of heptanoate (C7 fatty acid), is a novel metabolic therapeutic that is being used in the USA to treat patients with rare genetic metabolic disorders of fatty acid oxidation (Brunengraber and Roe, 2006, Roe and Mochel, 2006).
  • Triheptanoin provides the body with heptanoate, which as a medium chain fatty acid diffuses into the mitochondria to be metabolized to propionyl-CoA by beta-oxidation.
  • heptanoate is metabolized in the liver to the C5 ketones, ⁇ -hydropentanoate and ⁇ -ketopentanoate, both of which are taken up by cells by monocarboxylate transporters.
  • Carboxylation of propionyl-CoA produces methyl- malonyl-CoA, which can be metabolized to succinyl-CoA, resulting in anaplerosis - the refilling of deficient C4 (containing four carbons) intermediates of the TCA cycle ( Figure 1).
  • Pcx pyruvate carboxylase
  • Gptl and 2 muscle glutamic pyruvic transaminases 1 and 2
  • Pcca a-ketoglutarate + alanine and propionyl-CoA carboxylase subunit A
  • Pccb methylmalonyl-CoA mutase
  • SOD1 Superoxide dismutase 1
  • the present invention is based in part on the discovery that the TCA cycle plays a role in the pathogenesis of the neurodegenerative disorder ALS, wherein anaplerotic agents can influence the onset and/or progression of disease.
  • One form of the present invention is broadly directed to methods that utilize anaplerotic agents for treating or preventing and/or delaying the onset of neurodegenerative and/or neuromuscular disorders.
  • the invention provides a method of treating an animal with a neurodegenerative and/or neuromuscular disease, disorder or condition, wherein said method includes the step of administering a therapeutically effective amount of one or more anaplerotic agents to said animal, to thereby treat the neurodegenerative and/or neuromuscular disease, disorder or condition in said animal.
  • the invention provides a method of preventing and/or delaying the onset of a neurodegenerative and/or neuromuscular disease, disorder or condition, wherein said method includes the step of administering a therapeutically effective amount of one or more anaplerotic agents to said animal.
  • the present invention provides triheptanoin for use in the preventative, prophylactic and/or therapeutic treatment of a neurodegenerative and/or neuromuscular disease, disorder or condition in an animal in need thereof.
  • the present invention provides a kit for use in the preventative, prophylactic and/or therapeutic treatment of an animal with a neurodegenerative and/or neuromuscular disease, disorder or condition, said kit comprising: (i) a therapeutically effective amount of one or more anaplerotic agents; and (ii) instructions for use.
  • the neurodegenerative and/or neuromuscular disease, disorder or condition of any one of the aforementioned aspects is a motor neuron disease (MND).
  • MND motor neuron disease
  • the MND is amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), progressive bulbar palsy (PBP), pseudobulbar palsy or spinal muscular atrophy (SMA). In yet another embodiment, the MND is amyotrophic lateral sclerosis.
  • ALS amyotrophic lateral sclerosis
  • PLS primary lateral sclerosis
  • PMA progressive muscular atrophy
  • PBP progressive bulbar palsy
  • SMA spinal muscular atrophy
  • the MND is amyotrophic lateral sclerosis.
  • the anaplerotic agents of the aforementioned aspects are glutamate, glutamine, pyruvate and/or one or more precursors of propionyl-CoA.
  • the one or more precursors of propionyl-CoA are selected from the group consisting of an uneven chain fatty acid, a triglyceride, a C5 ketone body, a phospholipid, a branched amino acid and combinations thereof.
  • the one or more precursors of propionyl-CoA is a triglyceride or phospholipid of an uneven chain fatty acid.
  • the C5 ketone body is selected from ⁇ - hydroxypentanoate and ⁇ -ketopentanoate.
  • the precursor of propionyl-CoA is propionyl-carnitine.
  • the branched amino acid is selected from the group consisting of valine, isoleucine and combinations thereof.
  • the one or more precursors of propionyl-CoA is one or more compounds of Formula I.
  • Ri, R 2 and R 3 are independently selected from alkyl, alkenyl or alkynyl. In one embodiment, R ls R 2 and R 3 are independently selected from Ci to C 2 o alkyl, alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from C 3 to C 15 alkyl, alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from C 5 to C 12 alkyl, alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from C 6 to C9 alkyl, alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl and pentadecyl, inclusive of all isomers.
  • the compound of Formula I is triheptanoin.
  • the compound of Formula I is trinonanoin.
  • the compound of Formula I is tripentanoin.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 5% of the dietary caloric intake for the animal.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 20% of the dietary caloric intake for the animal.
  • a anaplerotic agent is provided to the animal in an amount comprising at least about 30% of the dietary caloric intake for the animal.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 35% of the dietary caloric intake for the animal.
  • the animal is a mammal.
  • the mammal is a human.
  • Another form of the present invention is broadly directed to methods that detect alterations, changes or differences in gene expression associated with neurodegenerative and/or neuromuscular disorders.
  • the invention provides a method of determining whether an animal has, or is predisposed to, a neurodegenerative and/or neuromuscular disease, disorder or condition, wherein the method includes the step of measuring (i) the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism, (ii) the expression level and/or activity of said enzyme(s) and/or (iii) the level of one or more metabolites associated with energy metabolism.
  • a decrease or reduction in the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism and/or a decrease or reduction in the expression level and/or activity of said enzymes and/or a decrease or reduction in the level of one or more metabolites associated with energy metabolism indicates that said animal has, or is predisposed to, the neurodegenerative and/or neuromuscular disease, disorder or condition.
  • the invention provides a method of monitoring the response of an animal to treatment or prevention of a neurodegenerative and/or neuromuscular disease, disorder or condition by administration of one or more anaplerotic agents described herein, wherein the method includes the step of measuring (i) the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism (ii) the expression level and/or activity of said enzyme(s) and/or (iii) the level of one or more metabolites associated with energy metabolism.
  • an increase in the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism and/or an increase in the expression level and/or activity of said enzymes and/or an increase in the level of one or more metabolites associated with energy metabolism indicates that said animal is responding to the administration of the one or more anaplerotic agents.
  • the enzymes or metabolites may be selected from the group consisting of glycolytic enzymes or metabolites, TCA cycle enzymes or metabolites and anaplerotic enzymes or metabolites.
  • the glycolytic enzyme is pyruvate dehydrogenase alpha 1, phosphoglucose isomerase (PGI), or phosphofructokinase (PFK).
  • the TCA cycle enzymes are selected from the group consisting of oxoglutarate dehydrogenase and succinate dehydrogenase complex subunit A.
  • the anaplerotic enzymes are selected from the group consisting of glutamate-pyruvate transaminase 1, glutamate -pyruvate transaminase 2, propionyl-CoA carboxylase subunit A and B and methylmalonyl-CoA mutase.
  • Figure 1 depicts simplified TCA cycle and anaplerosis in CNS and muscle.
  • the numbers enclosed in boxes (“1", "2", and 3") indicate anaplerotic pathways that can refill the C4 intermediates of the cycle: 1. pyruvate carboxylase (mostly in the CNS); 2. propionyl-CoA carboxylase; and 3. glutamic pyruvic transaminases (very important in muscle).
  • C5 ketones, isoleucine (He), valine (Val), and heptanoate, are metabolised to propionyl-CoA and can therefore be anaplerotic via the propionyl-CoA carboxylation pathway.
  • Figure 2 shows alterations in metabolism in m. gastrocnemius of hSODl G93A mice at mid and end stage of disease.
  • Panel A depicts the metabolite levels of lactate or glucose in wild-type (WT) or hSODl G93A (SOD) mice. Lactate levels are decreased at mid stage (110-130 days) in the SOD mice as compared to the WT mice, indicating reduced glycolysis, while there is an increase in glucose at end stage (150-175 days) in the SOD mice as compared to the WT mice, indicating decreased glucose metabolism.
  • Panel B depicts the enzyme activity levels of several enzymes in wild- type (WT) or hSODl G93A (SOD) mice at mid disease (110-130 days).
  • Figures 3A-3E show that triheptanoin treatment delays the loss of hind limb grip strength in hSODl G93A mice.
  • Figures 3 A and 3B depict the hind limb grip strength of wild-type ( Figure 3 A) or hSODl G93A ( Figure 3B) mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • CON control diet
  • TEZ triheptanoin
  • FIG. 3C depicts the average hind limb grip strength of hSODl G93A mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • CON control diet
  • THC triheptanoin
  • Figure 3D depicts the onset of hind limb grip strength loss (in weeks) in hSODl G93A mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • CON control diet
  • THz triheptanoin
  • Figure 3E depicts the ages of hSODl G93A mice at the onset of hind limb grip strength loss (in weeks) plotted against hSODl G93A transgene copy numbers in those mice.
  • Figure 3F depicts the onset of balance loss on the rota-rod (in weeks) in hSODl G93A mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • CON control diet
  • TERT triheptanoin
  • Figure 3G depicts the body weights of wild-type (WT) or hSODl G93A (SOD) mice fed with control diet (CON) or triheptanoin (TRIH) diet plotted against the ages of the mice.
  • WT wild-type
  • SOD hSODl G93A mice fed with control diet
  • CON triheptanoin
  • FIG. 3H depicts the weight loss onset of hSODl G93A mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • CON control diet
  • TONE triheptanoin
  • Figure 4 depicts the result of motor neuron counting assay of 10 week old wild-type (WT) or hSODl G93A (SOD) mice fed with control diet (CON) or triheptanoin (TRIH) diet.
  • WT wild-type
  • SOD hSODl G93A mice fed with control diet
  • THC triheptanoin
  • the data in Figures 4 show that triheptanoin alleviated motor neuron death in hSODl G93A mice fed triheptanoin (TRIH).
  • Stereo logic counts analysed by One Way ANOVAs followed by Tukey's multiple comparisons test.
  • Figure 5 depicts the result of a quantitative real time PCR analysis of Gapdh, Pdh alpha, Ogdh and Sdh subunit A mRNA of the gastrocneminus muscle of 10 week old wild type and hSODl G93A mice fed control diet (CON) or triheptanoin (TRIH) relative to house keeping genes.
  • Levels of transcripts of Pdhalphal, OGDH and SDH subunit A were reduced in hSODl G93A mice fed control diet (CON). These reductions in Pdhalphal, and SDHalpha transcript levels were attenuated by triheptanoin feeding.
  • Figure 6 depicts relative expression levels of genes involved in anaplerosis, specifically pyruvate carboxylase Pcx, glutamic pyruvic transferases Gptl and 2, the alpha (Pcca) and beta (Pccb) subunit of propionyl-CoA carboxylase and methyl- malonyl mutase (Mut). Expression is compared in the gastrocneminus muscle of 10 old wild type and hSODl G93A mice fed control diet (CON) or triheptanoin (TRIH) relative to housekeeping genes. One Way ANOVAs for each gene and time point, followed by Bonferroni post tests (* p ⁇ 0.05) if significant.
  • Figure 7 illustrates metabolic alterations found in ALS patients and
  • Triheptanoin is metabolised to propionyl-CoA and later to succinyl-CoA. This should increase 1) TCA cycle metabolite levels, 2) oxidation of acetyl-CoA and all fuels providing acetyl-CoA, 3) the number of electrons for electron transport chain complexes I & II, and 4) ATP production, resulting in improved survival of neurons and muscles.
  • the present invention is based, at least in part, on the discovery that the TCA cycle plays a role in the pathogenesis of the neurodegenerative disorder ALS, wherein anaplerotic agents can influence the onset and/or progression of disease.
  • the invention relates to methods of not only treating a neurodegenerative and/or neuromuscular disease, disorder or condition, but also preventing and/or delaying the onset of a neurodegenerative and/or neuromuscular disease, disorder or condition, by administering a therapeutically effective amount of one or more anaplerotic agents to said animal.
  • the present invention provides triheptanoin for use in the preventative, prophylactic and/or therapeutic treatment of a neurodegenerative and/or neuromuscular disease, disorder or condition.
  • treating refers to a therapeutic intervention that ameliorates a sign or symptom of a neurodegenerative and/or neuromuscular disease, disorder or condition after it has begun to develop.
  • preventing or “prevent” or “prevention” or “preventative” and “delaying the onset” refer to a course of action (such as administering a composition comprising a therapeutically effective amount of one or more propionyl- CoA precursors) initiated prior to the onset of a symptom, aspect, or characteristic of the neurodegenerative and/or neuromuscular disease, disorder or condition so as to prevent or delay the onset of, respectively, said symptom, aspect, or characteristic. It is to be understood that such preventing need not be absolute to be beneficial to a subject.
  • a “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a neurodegenerative and/or neuromuscular disease, disorder or condition, or exhibits only early signs, for the purpose of decreasing the risk of developing a symptom, aspect, or characteristic of a neurodegenerative and/or neuromuscular disease, disorder or condition.
  • a “therapeutic” treatment is one administered to a subject who exhibits at least one symptom, aspect, or characteristic of the neurodegenerative and/or neuromuscular disease, disorder or condition so as to cure, remediate or reverse, at least in part, and/or halt or delay the progression of said symptom, aspect, or characteristic.
  • a neurodegenerative disease, disorder or condition any disease, disorder and/or condition that comprises a progressive decline and/or deterioration in the structure, function, signalling and/or population of the neurons or neural tissue in an animal.
  • a neuromuscular disease, disorder or condition refers to any disease, disorder and/or condition that comprises a progressive decline and/or deterioration in the structure, function, signalling and/or population of the neurons or neural tissue that innervate and/or communicate, whether directly or indirectly, with the muscles of an animal.
  • neurodegenerative and/or neuromuscular disease, disorder or condition may involve, but is not limited to, genetic mutations, protein misfolding and/or aggregation, autoimmune disorders, mitochondrial dysfunction, defective axonal transport, aberrant apoptosis and/or autophagy and elevated oxidative stress and/or reactive oxygen species (ROS) production.
  • neurodegenerative disorders include Parkinson's disease and related disorders, Huntington's disease, Alzheimer's disease and other forms of dementia, Spinocerebellar ataxia, Friedreich ataxia, Tay-Sachs disease, Lewy body disease, Prion diseases (e.g.
  • Creutzfeldt- Jakob disease Multiple sclerosis (MS), Pick disease, Shy-Drager syndrome, pontocerebellar hypoplasia, neuronal ceroid lipofuscinoses, Gaucher disease, neurodegeneration with brain iron accumulation, spastic ataxia/paraplegia, supranuclear palsy, mesolimbocortical dementia, thalamic degeneration, cortical-striatal-spinal degeneration, cortical-basal ganglionic degeneration, cerebrocerebellar degeneration, Leigh syndrome, post-polio syndrome, hereditary muscular atrophy, encephalitis, neuritis, hydrocephalus and the motor neuron diseases.
  • neuromuscular disorders may include Parkinson's disease and related disorders, Huntington's disease, Spinocerebellar ataxia, Friedreich ataxia, Tay Sachs disease, Lewy body disease, peripheral neuropathy, myasthenia gravis, MS, Leigh syndrome, post-polio syndrome, hereditary muscular atrophy, spastic ataxia/paraplegia and the motor neuron diseases, without limitation thereto.
  • the animal with a neurodegenerative and/or neuromuscular disease, disorder or condition subject to treatment, preventative and/or therapeutic, by the claimed method has been determined to either have an existing neurodegenerative and/or neuromuscular disease, disorder or condition or be predisposed to such a disease, disorder or condition.
  • the neurodegenerative and/or neuromuscular disease, disorder or condition of this broad aspect is a motor neuron disease.
  • motor neuron diseases are a form of neurodegenerative and/or neuromuscular disorder that typically involve the motor neurons of an affected animal.
  • motor neurons are nerve cells that control the voluntary muscles of the trunk, limbs and phalanges, as well as those muscles that influence speech, swallowing and respiration.
  • the clinical symptoms of an MND may include muscle weakness and/or wasting, muscle cramps, dysphagia, slurred speech, muscle tremors/fasciculations, reduced cognition, dyspnoea, respiratory failure, fatigue and weight loss without limitation thereto.
  • Motor neuron diseases include, but are not limited to, Amyotrophic lateral sclerosis (ALS; also known as Lou Gehrig's disease), Primary lateral sclerosis (PLS), Progressive muscular atrophy (PMA), Progressive bulbar palsy (PBP), Pseudobulbar palsy and Spinal muscular atrophy (SMA).
  • ALS Amyotrophic lateral sclerosis
  • PLS Primary lateral sclerosis
  • PMA Progressive muscular atrophy
  • PBP Progressive bulbar palsy
  • SMA Spinal muscular atrophy
  • the motor neuron disease may be ALS, PLS, PMA,
  • the motor neuron disease is ALS.
  • anaplerotic agent is meant a substance that when incorporated into the TCA cycle either replenishes one or more depleted C4 (containing four carbons) intermediates of the TCA cycle or maintains or increases the level of one or more intermediates of the TCA cycle, or both.
  • TCA cycle intermediates are crucial for the normal functioning and regulation of the TCA cycle. Most TCA cycle intermediates, however, are also involved in other metabolic pathways in the cell, and consequently following their efflux from the mitochondria their respective levels may be found to be reduced in the TCA cycle. Such reductions in the levels of TCA cycle intermediates may subsequently inhibit optimal functioning of the cycle. The entry of anaplerotic agents into the TCA cycle may overcome this efflux, and thus maintain suitable levels of TCA cycle intermediates for optimal functioning of the cycle.
  • the one or more anaplerotic agents of the current invention are citrate, alpha-keto-glutarate (2-oxoglutarate), glutamate, glutamine, succinate, fumarate, malate, pyruvate and/or one or more precursors of propionyl- CoA.
  • Any relevant salts such as calcium, sodium, magnesium or potassium salts
  • prodrugs, analogues, derivatives, substituted and/or branched forms, precursors and derivatives of these anaplerotic agents are also contemplated within the scope of the invention.
  • salts of the present invention may include monosodium glutamate, calcium pyruvate (and calcium pyruvate monohydrate), creatine pyruvate, magnesium pyruvate, potassium pyruvate and sodium pyruvate.
  • an anaplerotic agent is a precursor of propionyl-CoA.
  • precursor of propionyl-CoA is meant a substance from which propionyl-CoA can be formed by one or more metabolic reactions taking place within a cell or tissue of an animal body. This can include within its scope salts, prodrugs, analogues, derivatives, substituted, unsaturated, branched forms, or other uneven chain fatty acids and derivatives thereof if applicable.
  • Typical examples of precursors of propionyl-CoA are uneven-chain fatty acids, in particular seven-carbon fatty acids although without limitation thereto, heptanoate, triglycerides inclusive of triglycerides of an uneven chain fatty acid, a compound of Formula 1 , a phospholipid comprising one or two uneven chain fatty acid(s), C5 ketone bodies (e.g.
  • the at least one precursor of propionyl-CoA is selected from the group consisting of an uneven chain fatty acid, a triglyceride, a phospholipid and combinations thereof.
  • the at least one precursor of propionyl-CoA may be an uneven-chain fatty acid, such as a seven-carbon fatty acid.
  • the at least one precursor of propionyl-CoA is a triglyceride, such as a triglyceride of an uneven chain fatty acid.
  • the at least one precursor of propionyl-CoA is a phospholipid comprising one or two uneven chain fatty acid(s).
  • the at least one precursor of propionyl-CoA is a C5 ketone bodies.
  • prodrugs examples include esters, oligomers of hydroxyalkanoate such as oligo(3-hydroxyvalerate) ( Seebach 1999, Int J Biol Macromol 25 (1-3): 217-36) and other pharmaceutically acceptable derivatives, which, upon administration to a individual, are capable of providing propionyl-CoA.
  • a solvate refers to a complex formed between a precursor of propionyl-CoA described above and a pharmaceutically acceptable solvent.
  • pharmaceutically acceptable solvents include water, ethanol, isopropanol, ethyl acetate, acetic acid, and ethanolamine.
  • derivatives of the present invention have been altered, for example by conjugation or complexing with other chemical moieties.
  • the precursor of propionyl-CoA is an uneven chain fatty acid.
  • the invention also includes within its scope esters of uneven chain fatty acids. It will be appreciated by a person of skill in the art that an uneven chain fatty acid may also be referred to as an odd-carbon number fatty acid.
  • the uneven chain fatty acid may be selected from the group consisting of propionic acid, pentanoic acid, heptanoic acid, nonanoic acid and undecanoic acid.
  • the at least one precursor of propionyl-CoA may be one or more compounds of Formula I:
  • Ri, R 2 and R 3 are independently selected from alkyl, alkenyl or alkynyl. In one embodiment, R ls R 2 and R 3 are independently selected from Ci to C 2 o alkyl, alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from C 3 to Ci5 alkyl, alkenyl or alkynyl. In another further embodiment, R ls R 2 and R 3 are independently selected from
  • Ci 2 alkyl alkenyl or alkynyl.
  • R ls R 2 and R 3 are independently selected from C 5 to C9 alkyl, alkenyl or alkynyl.
  • Rl, R2 and R3 are the same and are selected from the group consisting of C 5 , C 6 , C 7 , Cg and C 9 alkyl, and in particular embodiments, selected from C 5 , C 7 and C 9 alkyl and yet in another particular embodiment, C 7 alkyl.
  • Ri, R 2 and R 3 are independently selected from methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl and pentadecyl, inclusive of all isomers. Ri, R 2 and R 3 may also be independently selected from hexyl, heptyl, octyl and nonyl, inclusive of all isomers.
  • the compound of Formula I is an odd-numbered triglyceride.
  • the odd-numbered triglyceride is selected from tripentanoin, triheptanoin and trinonanoin.
  • the compound of Formula I is a C7 triglyceride wherein it may contain one, two or three C7 chains.
  • the compound of Formula I is triheptanoin, shown below.
  • This compound may be known by a number of alternative names including 1,3- di(heptanoyloxy)propan-2-yl heptanoate, 1,2,3-propanetriyl triheptanoate and glycerol triheptanoate.
  • the compound of Formula I is trinonanoin.
  • This compound may be known by a number of alternative names including glyceroltrinonanoate and glyceryltripelargonate.
  • alkyl refers to optionally substituted linear and branched hydrocarbon groups having 1 to 20 carbon atoms. Where appropriate, the alkyl group may have a specified number of carbon atoms, for example, Ci-C 6 alkyl which includes alkyl groups having 1, 2, 3, 4, 5 or 6 carbon atoms in linear or branched arrangements.
  • Non- limiting examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, s- and t-butyl, pentyl, 2-methylbutyl, 3-methylbutyl, hexyl, heptyl, 2- methylpentyl, 3-methylpentyl, 4-methylpentyl, 2-ethylbutyl, 3-ethylbutyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl.
  • alkylene refers to a saturated aliphatic chain substituted at either end, also known as an alkanediyl. Non-limiting examples may include -CH 2 -, - CH2CH2- and -CH2CH2CH2-.
  • alkenyl refers to optionally substituted unsaturated linear or branched hydrocarbon groups, having 2 to 20 carbon atoms and having at least one carbon-carbon double bond. Where appropriate, the alkenyl group may have a specified number of carbon atoms, for example, C 2 -C6 alkenyl which includes alkenyl groups having 2, 3, 4, 5 or 6 carbon atoms in linear or branched arrangements.
  • Non- limiting examples of alkenyl groups include, ethenyl, propenyl, isopropenyl, butenyl, s- and t-butenyl, pentenyl, hexenyl, hept-l,3-diene, hex-l,3-diene, non-l,3,5-triene and the like.
  • alkynyl refers to optionally substituted unsaturated linear or branched hydrocarbon groups, having 2 to 20 carbon atoms and having at least one carbon-carbon triple bond. Where appropriate, the alkynyl group may have a specified number of carbon atoms, for example, C 2 -C 6 alkynyl groups have 2, 3, 4, 5 or 6 carbon atoms in linear or branched arrangements.
  • alkynyl groups include ethynyl, propynyl, butynyl, penrynyl, hexynyl and the like.
  • the invention contemplates administration of a phospholipid comprising one or two uneven chain fatty acid(s).
  • the phospholipid may be selected from the group consisting of phosphatidic acid (phosphatidate), phosphatidylethanolamine (cephalin), phosphatidylcholine (lecithin), phosphatidylserine and phosphoinositides.
  • the precursor of propionyl-CoA is a seven carbon (C7) fatty acid source or a derivative thereof.
  • C7 fatty acid source or derivatives thereof include, but are not limited to, triheptanoin, n-heptanoic acid, n-heptanoate, a triglyceride comprising n-heptanoic acid or comprising n-heptanoic acid and a different fatty acid such as n-pentanoic acid, n-nonanoic acid, or both.
  • Examples of derivatives of seven carbon fatty acid source also include, but are not limited to, 4-methylhexanoate, 4-methylhexenoate, 3- hydroxy-4-methylhexanoate, 5-methylhexanoate, 5-methylhexenoate and 3-hydroxy- 5 -methylhexanoate .
  • a seven carbon fatty acid source is triheptanoin, which is a triglyceride that can be made by the esterification of three n- heptanoic acid molecules and glycerol by any means known in the art. Triheptanoin is also commercially available through Ultragenyx Pharmaceutical , although without limitation thereto.
  • n-heptanoic acid is a saturated straight chain seven-carbon fatty acid with the following structure:
  • Heptanoic acid is found in various fusel oils in appreciable amounts and can be extracted by any means known in the art. It can also be synthesized by oxidation of heptaldehyde with potassium permanganate in dilute sulfuric acid (Ruhoff, Org Syn Coll. voIII, 315 (1943)). Heptanoic acid is also commercially available through Sigma Chemical Co. (St. Louis, Mo.).
  • any seven carbon fatty acid source or derivatives thereof can be used for the treatment methods provided in the present invention.
  • the terms heptanoic acid, heptanoate, and triheptanoin may be used interchangeably in the present description. It will be understood by those skilled in the art that heptanoic acid, heptanoate, and triheptanoin are used throughout the present description as an exemplary seven-carbon fatty acid source to be used in the invention and is intended to be illustrative of the invention, but is not to be construed to limit the scope of the invention in any way. Substituted, unsaturated, or branched heptanoate, as well as other modified seven-carbon fatty acid source can be used without departing from the scope of the invention.
  • the C7 fatty acid source is provided in a formulation that has minimum impurity, e.g., the formulation contains at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% triheptanoin.
  • the C7 fatty acid source has an acid value has an acid value of 0.1 or less mg KOH/gr, a hydroxyl value of 2.8 or less mg KOH/gr.
  • the precursors of propionyl-CoA may be used as single agents or in association with other therapeutic agents or treatments. In some embodiments, they are used in combination with other therapeutic agents.
  • a precursor of propionyl-CoA may be used in combination with a carnitine supplement, biotin, vitamin B12, or combinations thereof.
  • carnitine supplement is L-carnitine.
  • vitamin B 12 is Cyanocobalamin.
  • administering is meant the introduction of a composition (e.g., a composition comprising one or more anaplerotic agents) into a subject by a chosen route.
  • a composition e.g., a composition comprising one or more anaplerotic agents
  • therapeutically effective amount describes a quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this can be the amount of a composition comprising one or more anaplerotic agents necessary to reduce, alleviate, prevent and/or delay the onset of one or a plurality of symptoms of a neurodegenerative and/or neuromuscular disease, disorder or condition.
  • a "therapeutically effective amount” is sufficient to reduce or eliminate a symptom of a neurodegenerative and/or neuromuscular disease, disorder or condition.
  • a "therapeutically effective amount” is an amount sufficient to achieve a desired biological effect, for example an amount that is effective to reverse, at least in part, the impaired mitochondrial function associated with a neurodegenerative and/or neuromuscular disease, disorder or condition.
  • a therapeutically effective amount of an anaplerotic agent is an amount sufficient to induce the desired result without causing a substantial cytotoxic effect in the subject.
  • the effective amount of an anaplerotic agent useful for reducing, alleviating, preventing and/or delaying the onset of one or more symptoms of a neurodegenerative and/or neuromuscular disease, disorder or condition will be dependent on the subject being treated, the type and severity of any associated disease, disorder and/or condition, and the manner of administration of the therapeutic composition.
  • the present invention includes within its scope a therapeutic amount of one or more anaplerotic agents that are less than 100% of dietary caloric intake and may be within a range from between about 5% and about 90%, between about 15% and about 80%, between about 20%> and about 60%>, between about 25% and 50%> and/or between about 30%> and about 40%>.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 20.5%, at least about 21%, at least about 21.5%, at least about 22%, at least about 22.5%, at least about 23%, at least about 23.5%, at least about 24%, at least about 24.5% at least about 25%, at least about 25.5%), at least about 26%, at least about 26.5%, at least about 27%, at least about 27.5%), at least about 28%, at least about 28.5%, at least about 29%, at least about 29.5%), at least about 30%, at least about 30.5%, at least about 31%, at least about 31.5%), at least about 32%, at least about 32.5%, at least about 33%, at least about 33.5%), at least about 34%, at least about 34.5%, at least about 35%, at least about 35.5%), at least about 36%, at least about 36
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 5% of the dietary caloric intake for the animal.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 20% of the dietary caloric intake for the animal.
  • the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 30% of the dietary caloric intake for the animal. In yet another further embodiment, the one or more anaplerotic agents are provided to the animal in an amount comprising at least about 35% of the dietary caloric intake for the animal.
  • % of dietary caloric intake may relate to % of kJoules or % of kcal.
  • Any safe route of administration may be employed for providing a patient with the one or more anaplerotic agents.
  • enteral, oral, rectal, parenteral, sublingual, buccal, intra-duodenal, intra-gastric, intravenous, intra-articular, intramuscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed. It can be administered via ingestion of a food substance containing triheptanoin at a concentration effective to achieve therapeutic levels. Alternatively, it can be administered as a capsule or entrapped in liposomes, in solution or suspension, alone or in combination with other nutrients, additional sweetening and/or flavoring agents. Capsules and tablets can be coated with shellac and other enteric agents as is known.
  • Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, oils troches, capsules, suppositories, aerosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release may be effected by using other polymer matrices, liposomes and/or microspheres.
  • Anaplerotic agents for enteral, intraperitoneal, oral or parenteral administration may be presented in discrete units such as capsules, sachets or tablets each containing a pre-determined amount of the therapeutic agent of the invention, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non- aqueous liquid, an oil-in- water emulsion or a water-in-oil liquid emulsion.
  • administration of the one or more anaplerotic agents is by way of oral administration.
  • Such therapeutically effective amounts of the one or more anaplerotic agents may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association one or more agents as described above with the carrier which constitutes one or more necessary ingredients.
  • such compositions may be prepared by uniformly and intimately admixing the agents of the invention with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
  • the anaplerotic agents may be administered in a manner compatible with the dosage formulation, and in such amount as is pharmaceutically-effective.
  • the dose administered to a patient in the context of the present invention, should be sufficient to effect a beneficial response in a patient over an appropriate period of time.
  • the quantity of agent(s) to be administered may depend on the subject to be treated inclusive of the age, sex, weight and general health condition thereof, factors that will depend on the judgement of the practitioner.
  • treatment methods may be applicable to prophylactic or therapeutic treatment of mammals, inclusive of humans and non- human mammals such as livestock (e.g. horses, cattle and sheep), companion animals (e.g. dogs and cats), laboratory animals (e.g. mice rats and guinea pigs) and performance animals (e.g. racehorses, greyhounds and camels), although without limitation thereto.
  • livestock e.g. horses, cattle and sheep
  • companion animals e.g. dogs and cats
  • laboratory animals e.g. mice rats and guinea pigs
  • performance animals e.g. racehorses, greyhounds and camels
  • the invention provides a kit for the treatment of an animal with a neurodegenerative and/or neuromuscular disease, disorder or condition comprising: (i) a therapeutically effective amount of one or more anaplerotic agents described herein; and (ii) instructions for use.
  • the one or more anaplerotic agents may be selected from tripentanoin, triheptanoin and trinonanoin.
  • the one or more anaplerotic agents is triheptanoin.
  • the one or more anaplerotic agents of this aspect may further comprise a pharmaceutically-acceptable carrier, diluent or excipient.
  • a pharmaceutically-acceptable carrier, diluent or excipient may include a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration.
  • a useful reference describing pharmaceutically acceptable carriers, diluents and excipients is Remington's Pharmaceutical Sciences (Mack Publishing Co. N.J. USA, 1991) which is incorporated herein by reference.
  • certain embodiments of this aspect may further comprise one or more additional therapies for a neurodegenerative and/or neuromuscular disease, disorder and/or condition.
  • additional therapies for a neurodegenerative and/or neuromuscular disease, disorder and/or condition.
  • these may include, for example, antioxidants, anti-inflammatories, anti-apoptotic compounds, cholinesterase inhibitors, acetylcholine receptor agonists and/or antagonists, a-adrenoceptor agonists and/or antagonists, monoamine oxidase inhibitors, catechol-O-methyl transferase inhibitors, nitric oxide donors, analgesics, riluzole (Rilutek®), muscle relaxants and/or anticonvulsants, albeit without limitation thereto.
  • antioxidants for example, antioxidants, anti-inflammatories, anti-apoptotic compounds, cholinesterase inhibitors, acetylcholine receptor agonists and/or antagonists, a-adrenocept
  • the one or more anaplerotic agents of this aspect may comprise a dosage form as described hereinbefore.
  • certain embodiments of the present aspect may include devices suitable for dispensing the dosage form/s and/or composition/s of said kit.
  • Such dispensing devices may include, for example, one or more of a syringe and/or needle, blister pack, applicator, cup or suitably shaped container, inhalant device, spoon, dropper, nebulizer, transdermal patch, gauze and/or bandage, albeit without limitation thereto.
  • the invention provides a method of determining whether an animal has, or is predisposed to, a neurodegenerative and/or neuromuscular disease, disorder or condition, wherein the method includes the step of measuring (i) the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism (ii) the expression level and/or activity of said enzymes and/or (iii) the level of one or more metabolites associated with energy metabolism.
  • the invention provides a method of monitoring the response of an animal to treatment or prevention of a neurodegenerative and/or neuromuscular disease, disorder or condition by administration of one or more anaplerotic agents, wherein the method includes the step of measuring (i) the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism (ii) the expression level and/or activity of said enzymes and/or (iii) the level of one or more metabolites associated with energy metabolism.
  • the neurodegenerative and/or neuromuscular disease, disorder or condition is as hereinbefore described.
  • energy metabolism is meant the sum total of all the chemical reactions and/or processes involved in maintaining the energy supply of a cell and thus an organism. These reactions and/or processes are largely catalyzed by enzymes, and typically involve the breakdown of larger molecules, such as carbohydrates like glucose, to smaller molecules to extract energy. For the present invention, those substances involved in or produced as a result of these reactions and/or processes are referred to as metabolites. Broadly, energy metabolism includes, but is not limited to, glycolysis, the TCA cycle, oxidative phosphorylation, anaplerosis and anaerobic respiration.
  • the enzymes or metabolites may be selected from the group consisting of glycolytic enzymes or metabolites, TCA cycle enzymes or metabolites and anaplerotic enzymes or metabolites.
  • Non-limiting examples of glycolytic enzymes include hexokinase, phosphoglucose isomerase, phosphofructokinase, fructose-biphosphate aldolase, triose-phosphate isomerase, glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, phosphoglycerate mutase, enolase, pyruvate kinase, pyruvate dehydrogenase, dihydrolipoyl transacetylase and dihydrolipoyl dehydrogenase.
  • the glycolytic enzyme is pyruvate dehydrogenase alpha 1, phosphoglucose isomerase (PGI), or phosphofructokinase (PFK).
  • Non-limiting examples of glycolytic metabolites include glucose, glucose 6- phosphate, fructose 6-phosphate, fructose 1,6-biphosphate, glyceraldehyde 3- phosphate, 1,3-biphosphoglycerate, 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, pyruvate and lactate.
  • TCA cycle enzymes include citrate synthase, aconitase, isocitrate dehydrogenase, oxoglutarate dehydrogenase, succinyl-CoA synthetase, succinate dehydrgoenase complex, fumarase, Complex I (a.k.a. NADH dehydrogenase or NADH ubiquinone oxidoreductase), and malate dehydrogenase.
  • the TCA cycle enzymes may be selected from the group consisting of oxoglutarate dehydrogenase and succinate dehydrogenase complex subunit A.
  • TCA cycle metabolites include acetyl CoA, citrate, cis-Aconitate, isocitrate, oxalosuccinate, oxoglutarate, succinyl CoA, succinate, fumurate, malate and oxaloacetate.
  • Non-limiting examples of anaplerotic enzymes include pyruvate carboxylase, aspartate transaminase, glutamate dehydrogenase, methylmalonyl-CoA mutase, adenylosuccinate lyase, glutamate pyruvate transaminase 1 , glutamate pyruvate transaminase 2 and propionyl-CoA carboxylase subunits A and B.
  • the anaplerotic enzymes may be selected from the group consisting of glutamate-pyruvate transaminase 1 , glutamate -pyruvate transaminase 2, propionyl- CoA carboxylase subunit A and B and methylmalonyl-CoA mutase.
  • Non-limiting examples of anaplerotic metabolites include aspartate, alanine, GABA, citrate, succinate, malate, fumarate, alpha-ketoglutarate (2-oxo-glutarate), glutamate, glutamine, proline, histidine, arginine, phenylalanine, tyrosine, methionine, isoleucine, valine, propionyl CoA, methylmalonyl CoA and adenylosuccinate.
  • a relative level of expression or activity may be determined relative to a reference or standard level of expression or activity, such as in a sample obtained from a normal or non- suffering individual or population of individuals.
  • a change or alteration in the level of a metabolite or the level of a enzyme's protein expression, gene expression and/or enzymatic activity in an animal that has, or is predisposed to, a neurodegenerative and/or neuromuscular disease, disorder or condition may be determined by comparing such levels from a biological sample obtained from said animal to either those levels of another animal known not to have, nor be predisposed to, a neurodegenerative and/or neuromuscular disease, disorder or condition or those levels of the general population or a reference population.
  • a decrease or reduction in the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism and/or a decrease or reduction in the expression level and/or activity of said enzyme(s) and/or a decrease or reduction in the level of one or more metabolites associated with energy metabolism indicate that said animal has, or is predisposed to, the neurodegenerative and/or neuromuscular disease, disorder or condition.
  • an increase in the expression level of one or more nucleic acids that respectively encode enzymes associated with energy metabolism and/or an increase in the expression level and/or activity of said enzyme(s) and/or an increase in the level of one or more metabolites associated with energy metabolism indicate that said animal is responding to the administration of one or more anaplerotic agents.
  • the one or more nucleic acids that respectively encode enzymes associated with energy metabolism and/or said enzyme(s) and/or the one or more metabolites associated with energy metabolism are detected or measured in a biological sample.
  • the sample may be a fluid, cell or tissue sample obtained from the animal.
  • nucleic acid may be single- or double-stranded DNA inclusive of genomic DNA and cDNA although without limitation thereto or may be single- or double-stranded RNA inclusive of mRNA and miRNA, although without limitation thereto.
  • a particular example of a nucleic acid is an "amplification product" resulting from nucleic acid sequence amplification.
  • primers suitable for nucleic acid amplification of nucleic acids encoding these enzymes comprise respective nucleotide sequences set forth in Table 1. Table 1. Gene names, GenBank accession numbers, symbols, forward and reverse primer sequences (SEQ ID NOS: 1-20) used for the gene expression studies of metabolic genes.
  • Propionyl-CoA F AGAATTGCAAGGGAAATTGG Carboxylase (Subunit A) Pcca (SEQ ID NO: 1)
  • Propionyl-CoA F AGCCTACAACATGCTGGACA Carboxylase (Subunit B) Pccb (SEQ ID NO: 3)
  • Methylmalonyl-CoA F CCAAACACTGACCGTTCTCA
  • NM_008650.3 SEQ ID NO: 6
  • Oxoglutarate F TGCAGATGTGCAATGATGAC SEQ dehydrogenase Ogdh ID NO: 13
  • Glutamate-pyruvate F GCGACGGTATTTCTACAATCC transaminase 2 (alanine (SEQ ID NO: 19)
  • methods of measuring gene expression may include, but are not limited to, northern blotting, nucleic acid amplification techniques (e.g. qPCR, real-time PCR and competitive PCR), high throughput expression profiling (e.g. microarrays), serial analysis of gene expression (SAGE) and RNA-seq.
  • nucleic acid amplification techniques e.g. qPCR, real-time PCR and competitive PCR
  • high throughput expression profiling e.g. microarrays
  • SAGE serial analysis of gene expression
  • RNA-seq RNA-seq.
  • Suitable techniques at measuring the expression level of enzymes associated with energy metabolism are similarly well known. Such techniques may include, but are not limited to, immunoassays, (e.g. western blots), radioimmunoassays, enzyme- linked immunosorbent assays (ELISAs), protein microarray techniques (e.g. reverse phase protein microarray (RPPA), histological methods (e.g. immunofluorescence (IF) and immunohistochemistry (IHC)), colorimetric/f uorometric/luminescence assays and proteomics approaches such as mass spectrometry (MS) and high- performance liquid chromatography (HPLC).
  • immunoassays e.g. western blots
  • ELISAs enzyme- linked immunosorbent assays
  • protein microarray techniques e.g. reverse phase protein microarray (RPPA)
  • histological methods e.g. immunofluorescence (IF) and immunohistochemistry (IHC)
  • MS mass spectrometry
  • HPLC
  • Suitable techniques for measuring the level of metabolites associated with energy metabolism are also well known in the art. Such techniques may include, but are not limited to colorimetric/fluorometric/luminescence enzymatic assays, high- performance liquid chromatography (HPLC), mass spectrometry (MS) coupled with gas or liquid chromatography (GC-MS or LC-MS) and histological methods (e.g. immunofluorescence (IF) and immunohistochemistry (IHC) for GABA).
  • HPLC high- performance liquid chromatography
  • MS mass spectrometry
  • GC-MS or LC-MS gas or liquid chromatography
  • histological methods e.g. immunofluorescence (IF) and immunohistochemistry (IHC) for GABA.
  • IF immunofluorescence
  • IHC immunohistochemistry
  • Wild-type and hSODl G93A mice (B6.Cg-Tg(SODl *G93A)lGur/J, stock no. 004435, Jackson laboratory, Maine, USA), were generated by mating hSODl G93A males with C57B/L6 wild-type females (University of Queensland). Mice were housed in a 12 hour light, 12 hour dark cycle, and had free access to food and water. Experimenters were blinded to animal genotype (until the mice started expressing the ALS phenotype) and dietary interventions.
  • mice Immediately after weaning, mice were placed on either a standard diet (SF11- 027, Specialty Feeds, WA, AUS) or a matched diet (SF 11-028, Specialty Feeds) in which 35% of the calories were from triheptanoin oil (Sasol, Germany). All diets were matched in protein, mineral, antioxidant and vitamin content relative to their caloric densities (Thomas et al, 2012). Triheptanoin replaced sucrose, some of the complex carbohydrates and long chain fats in the diet.
  • gastrocnemius muscle via homogenisation (Potter-Elvehjem tissue grinder) in cold isolation buffer (lOmM EDTA, 215mM D-mannitol, 75mM sucrose, 0.1% BSA and 20mM HEPES, pH 7.4). Samples were centrifuged at 700g for 10 minutes at 4°C. The supernatant was collected and centrifuged at 10,500g for 10 minutes at 4°C, the supernatant collected, and the pellet resuspended in lmL isolation buffer. The centrifugation process was repeated, and the collective supernatant (cytosolic fraction) and resuspended pellet (mitochondrial fraction) stored at -80°C.
  • cold isolation buffer lOmM EDTA, 215mM D-mannitol, 75mM sucrose, 0.1% BSA and 20mM HEPES, pH 7.4
  • the assay was adapted from Lai & Cooper, 1986.
  • the assay mixture contained 50 mM Tris-HCl (pH 7.4), 0.2 mM sodium CoA, 2 mM Nicotinamide adenine dinucleotide, 0.5 mM, thiamine pyrophosphate, 0.5 mM magnesium chloride, 10 mM dithiothreitol and 10 of isolated mitochondria from sample. Reactions were initiated by the addition of 10 mM oxoglutarate to measure the reduction of NAD.
  • PGI assay The activity of phosphoglucose isomerase (PGI) was measured by coupling the reaction to NADP reduction via glucose 6-phosphate dehydrogenase.
  • the assay mixture contained lOOmM Tris-HCl (pH 7.4), 0.6mM nicotinamide adenine dinucleotide phosphate, 17.5mM magnesium chloride, 5U/mL glucose 6-phosphate dehydrogenase (G8404, Sigma Aldrich), and 5 ⁇ of the cytosolic fraction from samples.
  • the reaction was initiated by the addition of lOmM fructose 6-phosphate.
  • the activity of phosphofructokinase was measured by coupling the production of fructose 1,6-bisphosphate from the reaction to the enzymes aldolase, a- glycerophosphate dehydrogenase and triosephosphate isomerase to measure the oxidation of NADH.
  • the assay mixture contained 80mM Tris-HCl (pH 7.4), 2mM dithiothreitol, 3.6mM adenosine triphosphate, 0.6mM nicotinamide adenine dinucleotide reduced, 20mM magnesium chloride, 6U/mL aldolase (A8811, Sigma Aldrich), lU/mL a-glycerophosphate dehydrogenase and 5U/mL triosephosphate isomerase (G1881, Sigma Aldrich) and 5 ⁇ of the cytosolic fraction from samples. The reaction was initiated by the addition of 15mM fructose 6-phosphate.
  • mice underwent behavioral testing approximately 3-4 hours into the light cycle. All behavioral testing was conducted in an environment with minimal stimuli so as to minimize any possible effects caused by changes in external stimuli. Animals were weighed before every test session. Mice were observed, and disease progression tracked and graded according to a neurological score sheet to ensure that any non- ALS related deaths were excluded from the study. The neurological score was adapted from criteria developed at the ALS therapy development institute (Gill et al., 2009). In accordance with ethical requirements, hSODl G93A mice that became too weak to reach the food hoppers were provided with wet chow on the floor of the cages. The endpoint of the study was defined as the mouse being unable to right itself within 15 seconds after being placed on its back.
  • transgenic mice and their respective wild-type littermates were euthanized with an overdose of pentobarbital (120 mg/kg, i.p., Provet, Australia). Tissues, including the m. gastrocnemius and tail, were collected for subsequent analysis. To measure the time point when body weight loss started, we defined the day where a loss of more than 10% of the combined mean body weight from week 12 to 17 was observed and all subsequent three measurements were ⁇ 90% of the original mean weight.
  • Hind limb grip strength test Hind limb grip strength tests were conducted twice a week using a T-bar force transducer (Ugo Basile, Italy). The animal was held by the tail, ensuring its hind limbs were gripping the T-bar before being pulled downwards at a 60° angle. The reading on the force transducer was taken only if both hind limbs released the bar at the same time. The average of 10 trials per mouse was recorded each training session. To compare time points of grip strength loss, the time point where a loss of more than 30%) of the combined mean grip strength of week 9 to 13 was recorded, if the subsequent 3 measurements were ⁇ 70%> of the original averge strength.
  • the rotarod tests were conducted with 10 repeats once a week using a rotarod designed for mice (Ugo Basile, Italy). Animals were placed on the rod and the rod was then rotated for 3 min at 25 revolutions per min. The time at which the animal fell off was recorded. We defined the age of balance loss on the rotarod when this time was zero.
  • mice were genotyped post-mortem by real time quantitative PCR according to a previously described procedure to assess relative copy number of the hSODl G93A transgene (Alexander et al, 2004). Primers used were documented by the Jackson laboratory for genotyping with conventional PCR (http://jaxmice.jax.org).
  • the final concentration of forward and reverse primers in each reaction was 0.4 ⁇ for hSOD and 0.5 ⁇ for mouse interleukin 2 (mI12) mixed with 5ng genomic DNA and 5 ⁇ 1 of SYBR Green Mastermix (Applied Biosystems, CA, USA)
  • the thermal profile for the assay was an initial hot start of 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds, 60°C for 1 minute and 72°C for 30 seconds (ABI 7900HT Fast Real-Time PCR system, Applied Biosystems).
  • the melt curve was generated by heating to 95°C for 2 minutes, cooling to 60°C for 15 seconds and a final 2% heating ramp to 95°C for 15 seconds. Water was added to replace the DNA in the negative controls.
  • CT values were calculated by the Sequence Detection Software 2.4 from the raw data. Copy number was then calculated using the equation documented below.
  • Copy number RNA extraction, cDNA synthesis, Quantitative real time PCR assay.
  • RNA was extracted from muscle samples with a cold mortar and pestle, dissolved with TRI reagent (Life Technologies, CA, USA) and extracted according to the manufacturer's instructions. Contaminating DNA was removed by DNase I treatment and cDNA was synthesized using the Tetro cDNA synthesis kit (Bio line, London, UK) according to the manufacturer's instructions.
  • mice were fed with control or triheptanoin diet from 35 days until 70 days of age, when mice were anesthetized with pentobarbital (100 mg/kg i.p.), perfused with 0.9% saline followed by 4% paraformaldehyde.
  • Spinal cords were removed and further fixed in 4% paraformaldehyde and subsequently embedded in OCT compound and serial sections of 16 ⁇ were cut from lumbar vertebrae. Sections were washed in cold PBS and stained with 0.1% thionin in acetate buffer (pH3.4). The motor neurons were counted using stereological method as previously described (Banks et al, 2001; 2003; Forgarty et al., 2013).
  • LMC lateral motor column
  • Triheptanoin delays the onset of loss of hind limb grip strength and balance in hSODl G93A mice.
  • One of the characteristics of ALS in hSODl G93A mice is the progressive loss of muscle mass and strength.
  • mice with only 12-17 copies of the SOD1 transgene were excluded from the analysis of grip strength and gene expression. Mice with 19-24 copies of the transgene were combined as one group with high copy transgene numbers.
  • the grip strength of hSODl G93A mice on both diets never exceeded 400mN ( Figure 3B).
  • Body weight loss and survival in hSODl G93A mice with and without triheptanoin is another indicator of disease progression in hSODl G93A transgenic mice.
  • gained weight at a slower rate and were lighter when culled p ⁇ 0.0001, Figure 3G.
  • triheptanoin fed wild- type mice were approximately 3g lighter than control fed wild-type mice (p ⁇ 0.05). This weight difference increased to approximately 4g at 22 weeks of age.
  • the latter include pyruvate carboxylase (Pcx) producing oxaloacetate, glutamic pyruvic transaminase 1 and 2 (Gptl and 2, Figure 5), and the enzymes of the propionyl-CoA carboxylation pathway ( Figure 6), namely the alpha and beta subunit of propionyl-carboxylase (Pcca and Pccb) and methylmalonyl mutase (Mut), which together metabolize propionyl-CoA to succinyl- CoA.
  • Pcx pyruvate carboxylase
  • Figure 6 the enzymes of the propionyl-CoA carboxylation pathway
  • Triheptanoin feeding protected hSODl G93A mice from changes in the expression of pyruvate and succinate dehydrogenases, but not 2-oxo-glutarate dehydrogenase and methylmalonyl mutase. No alterations of mRNA levels were found in the other investigated genes, including glycolytic Gapdh and the genes involved in anaplerosis, Gptl and 2, Pcca and Pccb ( Figures 5 and 6). Again triheptanoin feeding prevented some of the mRNA level reductions, indicating that it is effectively preserving the muscle and its metabolism.
  • hSODl G93A mice show metabolic alterations (summarized in Fig. 7) in glycolysis and TCA cycle enzyme activity. These metabolic deficiencies can be mechanistically addressed by feeding triheptanoin, because it provides an alternative fuel to glucose and will improve TCA cycling and thereby oxidation of any fuel, including glucose.
  • triheptanoin attenuated reductions in the gene expression of enzymes involved in TCA cycling and delayed symptoms of disease occurrence and disease progression in hSODl G93A mice. This was observed as a delay in motor neuron death, in the onset of the loss in grip strength and loss of balance on the rotarod, a delay in the loss of body weight, and the reversal of the reduced expression of metabolism genes.
  • Our data show a clear improvement in the condition of the hSODl G93A mice in which triheptanoin feeding was initiated prior to the onset of disease symptoms.
  • presymptomatic hSODl G93A mice already show loss of crural flexor neurons (Ngo et al, 2012).
  • triheptanoin quickly provides heptanoic acid to the blood, which can enter all tissues and mitochondria by diffusion without involvement of carrier systems. Also, C5 ketones are quickly produced by the liver and they can enter most tissues via monocarboxylate transporters. Therefore, it is expected that anaplerosis via this pathway will begin quickly after treatment initiation.
  • triheptanoin In addition to slowing the disease process, triheptanoin prevented the downregulation of several enzymes which were reduced in the gastrocneminus muscles from hSODl G93A when compared to wild-type mice. This finding implies that normalization of energy metabolism by triheptanoin may prevent downregulation of certain metabolism genes, which in turn will help to maintain a healthy metabolism to optimize energy supply and survival of tissue.
  • Impairments to the GH-IGF-I Axis in hSODlG93A Mice Give Insight into Possible Mechanisms of GH Dysregulation in Patients with Amyotrophic Lateral Sclerosis. Endocrinol 2012; 153: 3735-3746.
  • Vucic S Kiernan MC. Pathophysiology of neurodegeneration in familial amyotrophic lateral sclerosis. Current molecular medicine 2009; 9: 255-272.
  • Wijesekera LC Leigh PN. Amyotrophic lateral sclerosis. Orphanet J Rare Dis 2009;

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Emergency Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Diabetes (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Rheumatology (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physiology (AREA)
  • Nutrition Science (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Psychiatry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
PCT/US2014/065670 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof Ceased WO2015073803A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US15/036,523 US9833430B2 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof
EP20150222.6A EP3689343A1 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof using anaplerotic agents
AU2014348457A AU2014348457B2 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof
EP14861265.8A EP3068492B1 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof
CA2929601A CA2929601A1 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof
ES14861265T ES2774321T3 (es) 2013-11-14 2014-11-14 Trastornos neurodegenerativos y métodos de tratamiento y diagnóstico de los mismos
JP2016529439A JP6588903B2 (ja) 2013-11-14 2014-11-14 神経変性障害、ならびにその治療及び診断法
US15/825,572 US20180207121A1 (en) 2013-11-14 2017-11-29 Neurodegenerative disorders and methods of treatment and diagnosis thereof
US16/171,191 US20190255008A1 (en) 2013-11-14 2018-10-25 Neurodegenerative disorders and methods of treatment and diagnosis thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361904365P 2013-11-14 2013-11-14
US61/904,365 2013-11-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/036,523 A-371-Of-International US9833430B2 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof
US15/825,572 Continuation US20180207121A1 (en) 2013-11-14 2017-11-29 Neurodegenerative disorders and methods of treatment and diagnosis thereof

Publications (1)

Publication Number Publication Date
WO2015073803A1 true WO2015073803A1 (en) 2015-05-21

Family

ID=53058060

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/065670 Ceased WO2015073803A1 (en) 2013-11-14 2014-11-14 Neurodegenerative disorders and methods of treatment and diagnosis thereof

Country Status (7)

Country Link
US (3) US9833430B2 (cg-RX-API-DMAC7.html)
EP (2) EP3068492B1 (cg-RX-API-DMAC7.html)
JP (2) JP6588903B2 (cg-RX-API-DMAC7.html)
AU (1) AU2014348457B2 (cg-RX-API-DMAC7.html)
CA (1) CA2929601A1 (cg-RX-API-DMAC7.html)
ES (1) ES2774321T3 (cg-RX-API-DMAC7.html)
WO (1) WO2015073803A1 (cg-RX-API-DMAC7.html)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9717705B2 (en) 2006-12-04 2017-08-01 Institut National De La Sante Et De La Recherche Medicale Anaplerotic therapy of huntington disease and other polyglutamine diseases
US9833430B2 (en) 2013-11-14 2017-12-05 The University Of Queensland Neurodegenerative disorders and methods of treatment and diagnosis thereof
WO2017208217A3 (en) * 2016-06-01 2018-03-01 Aspi Ip Holder Llc C5 ketone compositions, and related methods, for therapeutic and performance supplementation
US10111848B2 (en) 2012-12-13 2018-10-30 National Institute Of Health And Medical Research Triheptanoin for the treatment of glucose transport 1 deficiency
WO2019052629A1 (en) * 2017-09-12 2019-03-21 Sunregen Healthcare Ag LIPIDS HAVING AN IMPERATIVE NUMBER OF CARBON ATOMS AND THEIR USE AS A PHARMACEUTICAL COMPOSITION OR FOOD SUPPLEMENT
JP2019518034A (ja) * 2016-06-08 2019-06-27 サンレーゲン ヘルスケア アーゲー 奇数個の炭素原子を有する脂質及び医薬組成物又は栄養補助食品としてのそれらの使用
WO2024155950A3 (en) * 2023-01-20 2024-08-29 Keto Innovations, Llc C5 ketones for inducing weight loss and improving cognitive function

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12599579B2 (en) 2016-04-19 2026-04-14 Axcess Global Sciences, Llc Compositions and compounds containing ketone bodies and/or ketone body precursors and one or more amino acids
US12109182B2 (en) 2016-04-19 2024-10-08 Axcess Global Sciences, Llc Administration of R-beta-hydroxybutyrate and related compounds in humans
US20230346721A1 (en) 2018-04-18 2023-11-02 Axcess Global Sciences, Llc Beta-hydroxybutyric acid compositions and methods for delivery of ketone bodies
US12533346B2 (en) 2016-04-19 2026-01-27 Axcess Global Sciences, Llc Administration of berberine metabolites
US11944598B2 (en) 2017-12-19 2024-04-02 Axcess Global Sciences, Llc Compositions containing s-beta-hydroxybutyrate or non-racemic mixtures enriched with the s-enatiomer
US12329734B2 (en) 2017-12-19 2025-06-17 Axcess Global Sciences, Llc Use of S-beta-hydroxybutyrate compounds for induction and maintenance of flow
US12521378B2 (en) 2016-04-19 2026-01-13 Axcess Global Sciences, Llc Administration of R-beta-hydroxybutyrate salt blend and related compounds in humans
US12496283B2 (en) 2016-04-19 2025-12-16 Axcess Global Sciences, Llc Administration of R-beta-hydroxybutyrate and related compounds in humans
US10925843B2 (en) 2018-04-18 2021-02-23 Axcess Global Sciences, Llc Compositions and methods for keto stacking with beta-hydroxybutyrate and acetoacetate
US12090129B2 (en) 2017-11-22 2024-09-17 Axcess Global Sciences, Llc Non-racemic beta-hydroxybutyrate compounds and compositions enriched with the R-enantiomer and methods of use
US12472200B2 (en) 2019-05-15 2025-11-18 Axcess Global Sciences, Llc Autobiotic compositions and method for promoting healthy gut microbiome
US11969430B1 (en) 2023-03-10 2024-04-30 Axcess Global Sciences, Llc Compositions containing paraxanthine and beta-hydroxybutyrate or precursor for increasing neurological and physiological performance
US12167993B2 (en) 2019-06-21 2024-12-17 Axcess Global Sciences, Llc Non-vasoconstricting energy-promoting compositions containing ketone bodies
US12186297B2 (en) 2020-08-26 2025-01-07 Axcess Global Sciences, Llc Compositions and methods for increasing lean-to-fat mass ratio
CN113917034A (zh) * 2021-10-19 2022-01-11 北京豪思生物科技有限公司 用于评估阿尔茨海默症的生物标记组合及其应用和试剂盒
WO2025184834A1 (zh) * 2024-03-06 2025-09-12 中国科学院昆明动物研究所 一种庚酸酯化合物及其用于制备预防和/或治疗神经退行性疾病的药物或功能食品中的用途

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008068230A1 (en) 2006-12-04 2008-06-12 Inserm (Institut National De La Sante Et De La Recherche Medicale) Anaplerotic therapy of huntington disease and other polyglutamine diseases
WO2009124250A1 (en) * 2008-04-03 2009-10-08 The Trustees Of The University Of Pennsylvania Compositions and methods for detecting tricarboxylic acid (tca) metabolic flux
US20110301238A1 (en) * 2010-06-02 2011-12-08 Borges Karin Seizure related disorders and therapeutic methods thereof
US20120164243A1 (en) * 2010-12-23 2012-06-28 Amazentis Sa Compositions and Methods for Improving Mitochondrial Function and Treating Neurodegenerative Diseases and Cognitive Disorders
EP2599482A1 (en) 2011-11-30 2013-06-05 Lunamed AG Low dose therapeutic use of glyceryl tri-(4-phenylbutyrate)

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4025649A (en) 1974-08-19 1977-05-24 Labaz Acetic acid derivatives having pharmacological activity and compositions containing the same
DE3032300A1 (de) 1980-08-27 1982-04-01 Alfred Ing. Wien Lohninger Mittel zur parenteralen ernaehrung
GB2104079B (en) 1981-08-14 1985-08-21 London Polytech New aminoacid isomers, their production and their medicinal use
US4753963A (en) 1985-09-26 1988-06-28 The Procter & Gamble Company Nutritional fat suitable for enteral and parenteral products
JP3486778B2 (ja) 1993-04-02 2004-01-13 三菱ウェルファーマ株式会社 アルツハイマー病予防治療剤
US20090253781A1 (en) 2002-05-24 2009-10-08 Btg International Limited Therapeutic compositions
US6740679B1 (en) 1999-02-05 2004-05-25 Baylor University Medical Center Nutritional supplement or pharmaceutical preparation comprising triglycerides with seven-carbon fatty acid
WO2000045649A1 (en) 1999-02-05 2000-08-10 Baylor University Medical Center Nutritional supplement or pharmaceutical preparation comprising triglycerides with seven-carbon fatty acid
JP2003513039A (ja) 1999-11-03 2003-04-08 ジュヴェノン インコーポレイテッド 良性の健忘症を治療する方法
US8124589B2 (en) 2000-05-01 2012-02-28 Accera, Inc. Use of ketogenic compounds for treatment of age-associated memory impairment
US20020006959A1 (en) 2000-05-01 2002-01-17 Henderson Samuel T. Use of medium chain triglycerides for the treatment and prevention of Alzheimer's Disease and other diseases resulting from reduced Neuronal Metabolism
US6835750B1 (en) 2000-05-01 2004-12-28 Accera, Inc. Use of medium chain triglycerides for the treatment and prevention of alzheimer's disease and other diseases resulting from reduced neuronal metabolism II
EP1605950A4 (en) 2003-03-06 2008-01-09 Accera Inc NOVEL CHEMICAL ENTITIES AND METHODS OF USE IN THE TREATMENT OF METABOLIC DISORDERS
US8399515B2 (en) 2003-05-20 2013-03-19 Baylor Research Institute Five and fifteen carbon fatty acids for treating metabolic disorders and as nutritional supplements
EP1773317A4 (en) 2004-07-02 2012-10-03 Baylor Res Inst METHOD OF TREATING OVERLOADING DISEASE DUE TO ACCUMULATION OF GLYCOGENES OR POLYSACCHARIDES
US7884115B2 (en) 2004-09-28 2011-02-08 Allergan, Inc. Methods and compositions for the treatment of pain and other neurological conditions
CA2700431A1 (en) 2006-09-26 2008-04-03 Baylor Research Institute Use of odd-chain fatty acids in the modulation of cellular catabolism
KR101335021B1 (ko) 2007-07-31 2013-12-12 액세라인크 게놈 테스트의 용도 및 인지 기능 저하 치료용 케톤성 화합물
KR20120129898A (ko) 2009-12-30 2012-11-28 베일러 리서치 인스티튜트 알츠하이머 질환 및 노화 뇌를 위한 보충대사 치료요법
JP2013528648A (ja) * 2010-06-14 2013-07-11 ベイラー リサーチ インスティテュート 成人ポリグルコサン小体病(apbd)を処置するためのトリヘプタノイン食
CA2894456C (en) 2012-12-13 2022-06-28 Baylor Research Institute Triheptanoin for the treatment of glucose transporter 1 deficiency
ES2774321T3 (es) 2013-11-14 2020-07-20 Univ Queensland Trastornos neurodegenerativos y métodos de tratamiento y diagnóstico de los mismos

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008068230A1 (en) 2006-12-04 2008-06-12 Inserm (Institut National De La Sante Et De La Recherche Medicale) Anaplerotic therapy of huntington disease and other polyglutamine diseases
WO2009124250A1 (en) * 2008-04-03 2009-10-08 The Trustees Of The University Of Pennsylvania Compositions and methods for detecting tricarboxylic acid (tca) metabolic flux
US20110301238A1 (en) * 2010-06-02 2011-12-08 Borges Karin Seizure related disorders and therapeutic methods thereof
US20120164243A1 (en) * 2010-12-23 2012-06-28 Amazentis Sa Compositions and Methods for Improving Mitochondrial Function and Treating Neurodegenerative Diseases and Cognitive Disorders
EP2599482A1 (en) 2011-11-30 2013-06-05 Lunamed AG Low dose therapeutic use of glyceryl tri-(4-phenylbutyrate)

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
"Enzyme Assays: A Practical Approach (The Practical Approach Series", 2002, OXFORD UNIVERSITY PRESS
"Remington's Pharmaceutical Sciences", 1991, MACK PUBLISHING CO.
ALEXANDER GM; ERWIN KL; BYERS N; DEITCH JS; AUGELLI BJ; BLANKENHORN EP; HEIMAN-PATTERSON TD: "Effect of transgene copy number on survival in the G93A SOD1 transgenic mouse model of ALS", BRAIN RES MOL BRAIN RES, vol. 130, 2004, pages 7 - 15, XP004618515, DOI: doi:10.1016/j.molbrainres.2004.07.002
ALLEN SP; RAJAN S; DUFFY L; MORTIBOYS H; HIGGINBOTTOM A; GRIERSON AJ; SHAW PJ: "Superoxide dismutase 1 mutation in a cellular model of amyotrophic lateral sclerosis shifts energy generation from oxidative phosphorylation to glycolysis", NEUROBIOLOGY OF AGING, vol. 35, 2014, pages 1499 - 1509, XP028631588, DOI: doi:10.1016/j.neurobiolaging.2013.11.025
BANKS GB; CHAU TN; BARTLETT SE; NOAKES PG: "Promotion of motoneuron survival and branching in rapsyn-deficient mice", J COMP NEUROL, vol. 429, 2001, pages 156 - 165
BANKS GB; CHOY PT; LAVIDIS NA; NOAKES PG: "Neuromuscular synapses mediate motor axon branching and motoneuron survival during the embryonic period of programmed cell death", DEV BIOL, vol. 257, 2003, pages 71 - 84
BORGES ET AL.: "Gene expression changes after seizure preconditioning in the three major hippocampal cell layers", NEUROBIOLOGY OF DISEASE, vol. 26, 18 January 2007 (2007-01-18), pages 66 - 77, XP005931180 *
BRUNENGRABER H; ROE CR: "Anaplerotic molecules: Current and future", J INHERIT METAB DIS, vol. 29, 2006, pages 327 - 331, XP019392123, DOI: doi:10.1007/s10545-006-0320-1
BRUNENGRABER; ROE, J INHERIT METABOL DIS, vol. 29, no. 2-3, 2006, pages 327 - 31
CLARKE PGH; OPPENHEIM RW: "Neuron death in vertebrate development: in vivo methods", METHODS CELL BIOL., vol. 46, 1995, pages 277 - 321
COZZOLINO M; CARRI MT: "Mitochondrial dysfunction in ALS", PROGR NEUROBIOL, vol. 97, 2012, pages 54 - 66, XP028917037, DOI: doi:10.1016/j.pneurobio.2011.06.003
FORGARTY MJ; SMALLCOMBE, KL; YANAGAWE, Y; OBATA K; BELLINGHAM MC; NOAKES PG: "Genetic deficiency of GABA differentially regulates respiratory and non-respiratory motor neuron development", PLOS ONE, vol. 8, 2013, pages e56257
GILL A; KIDD J; VIEIRA F; THOMPSON K; PERRIN S.: "No benefit from chronic lithium dosing in a sibling-matched, gender balanced, investigator-blinded trial using a standard mouse model of familial ALS", PLOS ONE, vol. 4, 2009, pages e6489
GREEN; WUTS: "Protective Groups in Organic Synthesis", 1999, JOHN WILEY & SONS INC.
KINMAN, AM J PHYSIOL ENDOCRINOL METAB, vol. 291, no. 4, 2006, pages E860 - 6
LAI JCK; COOPER AJL: "Brain a-Ketoglutarate Dehydrogenase Complex: Kinetic Properties, Regional Distribution, and Effects of Inhibitors", J. NEUROCHEM, vol. 47, 1986, pages 1376 - 1386
LAROCK R.C.: "Comprehensive Organic Transformations", 1989, VCH PUBLISHERS LTD.
MILANI P; GAGLIARDI S; COVA E; CEREDA C: "SOD1 Transcriptional and Posttranscriptional Regulation and Its Potential Implications in ALS", NEUROLOGY RES INT 2011, 2011, pages 458427
NGO ST; BAUMANN F; RIDALL PG; PETTITT AN; HENDERSON RD; BELLINGHAM MC; MCCOMBE PA: "The relationship between Bayesian motor unit number estimation and histological measurements of motor neurons in wild-type and SOD1G93A mice", CLIN NEUROPHYSIOL, vol. 123, 2012, pages 2080 - 2091
NIESSEN HG; DEBSKA-VIELHABER G; SANDER K; ANGENSTEIN F; LUDOLPH AC; HILFERT L; WILLKER W; LEIBFRITZ D; HEINZE HJ; KUNZ WS: "Metabolic progression markers of neurodegeneration in the transgenic G93A-SOD1 mouse model of amyotrophic lateral sclerosis", EUROPEAN JOURNAL OF NEUROSCIENCE, vol. 25, 2007, pages 1669 - 1677, XP055018095, DOI: doi:10.1111/j.1460-9568.2007.05415.x
ROE CR; MOCHEL F: "Anaplerotic diet therapy in inherited metabolic disease: Therapeutic potential", J INHERIT METAB DIS, vol. 29, 2006, pages 332 - 340, XP019392111, DOI: doi:10.1007/s10545-006-0290-3
RUSSELL AP; WADA S; VERGANI L; HOCK MB; LAMON S; LEGER B; USHIDA T; CARTONI R; WADLEY GD; HESPEL P: "Disruption of skeletal muscle mitochondrial network genes and miRNAs in amyotrophic lateral sclerosis", NEUROBIOLOGY OF DISEASE, vol. 49C, 2012, pages 107 - 117
See also references of EP3068492A4
SEEBACH: "25", INT J BIOL MACROMOL, no. 1-3, 1999, pages 217 - 36
SHI P; WEI Y; ZHANG J; GAL J; ZHU H: "Mitochondrial dysfunction is a converging point of multiple pathological pathways in amyotrophic lateral sclerosis", J ALZ DIS, vol. 20, no. 2, 2010, pages 311 - 324
SMITH M.B.; MARCH J.: "March's Advanced Organic Chemistry", 2001, JOHN WILEY & SONS INC.
STEYN FJ; NGO ST; LEE JD; LEONG JW; BUCKLEY AJ; VELDHUIS JD; MCCOMBE PA; CHEN C; BELLINGHAM MC: "Impairments to the GH-IGF-I Axis in hSODIG93A Mice Give Insight into Possible Mechanisms of GH Dysregulation in Patients with Amyotrophic Lateral Sclerosis", ENDOCRINOL, vol. 153, 2012, pages 3735 - 3746
THOMAS NK; WILLIS S; SWEETMAN L; BORGES K: "Triheptanoin in acute mouse seizure models", EPILEPSY RES, vol. 99, 2012, pages 312 - 317
TURNER BJ; TALBOT K: "Transgenics, toxicity and therapeutics in rodent models of mutant SODl-mediated familial ALS", PROGR NEUROBIOL, vol. 85, 2008, pages 94 - 134, XP022619837, DOI: doi:10.1016/j.pneurobio.2008.01.001
TURNER; TALBOT, VUCIC AND KIERNAN, 2009
VANDESOMPELE J; DE PRETER K; PATTYN F; POPPE B; VAN ROY N; DE PAEPE A: "Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes", GENOME BIOL, vol. 3, 2002
VUCIC S; KIERNAN MC: "Pathophysiology of neurodegeneration in familial amyotrophic lateral sclerosis", CURRENT MOLECULAR MEDICINE, vol. 9, 2009, pages 255 - 272
WEI ZHAO ET AL.: "Caprylic Triglyceride as a Novel Therapeutic Approach to Effectively Improve the Performance and Attenuate the Symptoms Due to the Motor Neurone Loss in ALS Disease", PLOS ONE, vol. 7, no. 11, 7 November 2012 (2012-11-07)
WIJESEKERA LC; LEIGH PN: "Amyotrophic lateral sclerosis", ORPHANET J RARE DIS, vol. 4, 2009, pages 3, XP021052313, DOI: doi:10.1186/1750-1172-4-3

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10220014B2 (en) 2006-12-04 2019-03-05 Inserm (Institut National De La Sante Et De La Recherche Medicale) Anaplerotic therapy of huntington disease and other polyglutamine diseases
US9717705B2 (en) 2006-12-04 2017-08-01 Institut National De La Sante Et De La Recherche Medicale Anaplerotic therapy of huntington disease and other polyglutamine diseases
US10111848B2 (en) 2012-12-13 2018-10-30 National Institute Of Health And Medical Research Triheptanoin for the treatment of glucose transport 1 deficiency
US9833430B2 (en) 2013-11-14 2017-12-05 The University Of Queensland Neurodegenerative disorders and methods of treatment and diagnosis thereof
US11337945B2 (en) 2016-06-01 2022-05-24 Keto Innovations, Llc C5 ketone compositions, and related methods, for therapeutic and performance supplementation
WO2017208217A3 (en) * 2016-06-01 2018-03-01 Aspi Ip Holder Llc C5 ketone compositions, and related methods, for therapeutic and performance supplementation
JP2019518034A (ja) * 2016-06-08 2019-06-27 サンレーゲン ヘルスケア アーゲー 奇数個の炭素原子を有する脂質及び医薬組成物又は栄養補助食品としてのそれらの使用
EP3468551A4 (en) * 2016-06-08 2020-01-22 Sunregen Healthcare AG LIPIDS WITH ODD NUMBER OF CARBON ATOMS AND THEIR USE AS A PHARMACEUTICAL COMPOSITION OR A FOOD SUPPLEMENT
JP2021113204A (ja) * 2016-06-08 2021-08-05 サンレーゲン ヘルスケア アーゲー 奇数個の炭素原子を有する脂質及び医薬組成物又は栄養補助食品としてのそれらの使用
US11406616B2 (en) 2016-06-08 2022-08-09 Sunregen Healthcare Ag Lipids with odd number of carbon atoms and their use as pharmaceutical composition or nutritional supplement
US12594255B2 (en) 2016-06-08 2026-04-07 Sunregen Healthcare Ag Lipids with odd number of carbon atoms and their use as pharmaceutical composition or nutritional supplement
WO2019052629A1 (en) * 2017-09-12 2019-03-21 Sunregen Healthcare Ag LIPIDS HAVING AN IMPERATIVE NUMBER OF CARBON ATOMS AND THEIR USE AS A PHARMACEUTICAL COMPOSITION OR FOOD SUPPLEMENT
WO2024155950A3 (en) * 2023-01-20 2024-08-29 Keto Innovations, Llc C5 ketones for inducing weight loss and improving cognitive function

Also Published As

Publication number Publication date
US20160263071A1 (en) 2016-09-15
EP3068492A1 (en) 2016-09-21
AU2014348457B2 (en) 2019-04-18
ES2774321T3 (es) 2020-07-20
EP3068492A4 (en) 2017-07-05
US9833430B2 (en) 2017-12-05
JP6588903B2 (ja) 2019-10-09
JP2016539935A (ja) 2016-12-22
AU2014348457A1 (en) 2016-05-26
JP2020063233A (ja) 2020-04-23
US20180207121A1 (en) 2018-07-26
CA2929601A1 (en) 2015-05-21
EP3689343A1 (en) 2020-08-05
EP3068492B1 (en) 2020-01-08
US20190255008A1 (en) 2019-08-22

Similar Documents

Publication Publication Date Title
AU2014348457B2 (en) Neurodegenerative disorders and methods of treatment and diagnosis thereof
Tefera et al. Triheptanoin protects motor neurons and delays the onset of motor symptoms in a mouse model of amyotrophic lateral sclerosis
Chegary et al. Mitochondrial long chain fatty acid β-oxidation in man and mouse
Lillycrop Effect of maternal diet on the epigenome: implications for human metabolic disease
Williams et al. New insights into the regulation of methyl group and homocysteine metabolism
Qin et al. Anti-obesity and anti-diabetic effects of flavonoid derivative (Fla-CN) via microRNA in high fat diet induced obesity mice
Arai et al. Trehalose prevents adipocyte hypertrophy and mitigates insulin resistance
Kennedy et al. Presymptomatic alterations in amino acid metabolism and DNA methylation in the cerebellum of a murine model of Niemann-Pick type C disease
Guan et al. Bisphenol A disturbed the lipid metabolism mediated by sterol regulatory element binding protein 1 in rare minnow Gobiocypris rarus
Takemura et al. S-Allyl cysteine improves nonalcoholic fatty liver disease in type 2 diabetes Otsuka Long-Evans Tokushima Fatty rats via regulation of hepatic lipogenesis and glucose metabolism
Yang et al. Suppression of ABCA1 by unsaturated fatty acids leads to lipid accumulation in HepG2 cells
Peters et al. Dose-dependent effects of leucine supplementation on preservation of muscle mass in cancer cachectic mice
Zhang et al. β-Casomorphin-7 attenuates the development of nephropathy in type I diabetes via inhibition of epithelial–mesenchymal transition of renal tubular epithelial cells
Mahmood et al. Lack of mitochondria-generated acetyl-CoA by pyruvate dehydrogenase complex downregulates gene expression in the hepatic de novo lipogenic pathway
Hernandez-Vazquez et al. Biotinidase knockout mice show cellular energy deficit and altered carbon metabolism gene expression similar to that of nutritional biotin deprivation: clues for the pathogenesis in the human inherited disorder
Lutkewitte et al. Hepatic monoacylglycerol acyltransferase 1 is induced by prolonged food deprivation to modulate the hepatic fasting response
Gonçalves et al. Trans-fatty acids aggravate anabolic steroid-induced metabolic disturbances and differential gene expression in muscle, pancreas and adipose tissue
Parida et al. Supplementation of Bacillus amyloliquefaciens AS385 culture broth powder containing 1-deoxynojirimycin in a high-fat diet altered the gene expressions related to lipid metabolism and insulin signaling in mice epididymal white adipose tissue
Su et al. Inhibition of miR-146a-5p and miR-8114 in insulin-secreting cells contributes to the protection of melatonin against stearic acid-induced cellular senescence by targeting Mafa
Xia et al. Long-term effects of l-serine supplementation upon a mouse model of diabetic neuropathy
Okuma et al. JTP-103237, a monoacylglycerol acyltransferase inhibitor, prevents fatty liver and suppresses both triglyceride synthesis and de novo lipogenesis
Cheema et al. Effect of lifelong carnitine supplementation on plasma and tissue carnitine status, hepatic lipid metabolism and stress signalling pathways and skeletal muscle transcriptome in mice at advanced age
Nicolas-Frances et al. Disturbances in cholesterol, bile acid and glucose metabolism in peroxisomal 3-ketoacylCoA thiolase B deficient mice fed diets containing high or low fat contents
WO2021211959A2 (en) Methods and compositions for treating drug induced steatohepatitis
Smith et al. Tamoxifen effect on L-DOPA induced response complications in parkinsonian rats and primates

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14861265

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2929601

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016529439

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15036523

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2014861265

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014861265

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014348457

Country of ref document: AU

Date of ref document: 20141114

Kind code of ref document: A