WO2015070212A1 - Methods and compositions for treating huntington's disease - Google Patents

Methods and compositions for treating huntington's disease Download PDF

Info

Publication number
WO2015070212A1
WO2015070212A1 PCT/US2014/064987 US2014064987W WO2015070212A1 WO 2015070212 A1 WO2015070212 A1 WO 2015070212A1 US 2014064987 W US2014064987 W US 2014064987W WO 2015070212 A1 WO2015070212 A1 WO 2015070212A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
htt
zfp
domain
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/064987
Other languages
English (en)
French (fr)
Inventor
H. Steve Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sangamo Therapeutics Inc
Original Assignee
Sangamo Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sangamo Biosciences Inc filed Critical Sangamo Biosciences Inc
Priority to EP14860665.0A priority Critical patent/EP3068905A4/en
Priority to NZ719477A priority patent/NZ719477A/en
Priority to AU2014346424A priority patent/AU2014346424B2/en
Priority to CN201480072869.5A priority patent/CN105934524A/zh
Priority to MX2016006106A priority patent/MX391904B/es
Priority to BR112016010175A priority patent/BR112016010175A2/pt
Priority to RU2016123086A priority patent/RU2693891C1/ru
Priority to KR1020167015301A priority patent/KR102431079B1/ko
Priority to US15/036,020 priority patent/US10369201B2/en
Priority to CA2929179A priority patent/CA2929179A1/en
Priority to JP2016528904A priority patent/JP2016537341A/ja
Publication of WO2015070212A1 publication Critical patent/WO2015070212A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811Selection methods for production or design of target specific oligonucleotides or binding molecules
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10Peptides having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0085Brain, e.g. brain implants; Spinal cord
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/864Parvoviral vectors, e.g. parvovirus, densovirus
    • C12N15/8645Adeno-associated virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/34Allele or polymorphism specific uses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present disclosure is in the fields of gene expression and genome editing.
  • Huntington's Disease also known as Huntington's Chorea
  • the mean age of onset for this disease is age 35-44 years, although in about 10% of cases, onset occurs prior to age 21, and the average lifespan post-diagnosis of the disease is 15-18 years.
  • Prevalence is about 3 to 7 among 100,000 people of western European descent.
  • Trinucleotide repeat expansion disorders were first characterized in the early 1990s (see Di Prospero and Fischbeck (2005) Nature Reviews Genetics 6:756-765). These disorders involve the localized expansion of unstable repeats of sets of three nucleotides and can result in loss of function of the gene in which the expanded repeat resides, a gain of toxic function, or both. Trinucleotide repeats can be located in any part of the gene, including non- coding and coding gene regions. Repeats located within the coding regions typically involve either a repeated glutamine encoding triplet (CAG) or an alanine encoding triplet (CGA).
  • CAG repeated glutamine encoding triplet
  • CGA alanine encoding triplet
  • Expanded repeat regions within non-coding sequences can lead to aberrant expression of the gene while expanded repeats within coding regions (also known as codon reiteration disorders) may cause mis-folding and protein aggregation. The exact cause of the pathophysiology associated with the aberrant proteins is often not known.
  • these regions typically contain a variable number of repeat sequences in the normal population, but in the afflicted populations, the number of repeats can increase from a doubling to a log order increase in the number of repeats.
  • repeats are inserted within the N terminal coding region of the large cytosolic protein Huntingtin (Htt).
  • Normal Htt alleles contain 15-20 CAG repeats, while alleles containing 35 or more repeats can be considered potentially HD causing alleles and confer risk for developing the disease. Alleles containing 36-39 repeats are considered incompletely penetrant, and those individuals harboring those alleles may or may not develop the disease (or may develop symptoms later in life) while alleles containing 40 repeats or more are considered completely penetrant. In fact, no asymptomatic persons containing HD alleles with this many repeats have been reported. Those individuals with juvenile onset HD ( ⁇ 21 years of age) are often found to have 60 or more CAG repeats.
  • HD can involve +1 and +2 frameshifts within the repeat sequences such that the region will encode a poly-serine polypeptide (encoded by AGC repeats in the case of a +1 frameshift) track rather than poly-glutamine (Davies and Rubinsztein (2006) Journal of Medical Genetics 43: 893-896).
  • the mutant Htt allele is usually inherited from one parent as a dominant trait. Any child born of a HD patient has a 50% chance of developing the disease if the other parent was not afflicted with the disorder. In some cases, a parent may have an intermediate HD allele and be asymptomatic while, due to repeat expansion, the child manifests the disease. In addition, the HD allele can also display a phenomenon known as anticipation wherein increasing severity or decreasing age of onset is observed over several generations due to the unstable nature of the repeat region during spermatogenesis.
  • GABA A medium spiny gamma-aminobutyric acid
  • GAB A medium spiny gamma-aminobutyric acid
  • MSNs in HD display transcriptional dysregulation along with other abnormal alterations abnormal aggregations and inclusions of htt, bioenergetic defects, neurotophin deficiency , disorders of axonal transport and exictotoxicity.
  • the mechanism for the transcriptomic effects may be related to changes in activities of soluble DNA-binding transcription factors, abnormalities of chromatin biochemistry and organization, and aggregate-driven nuclear transcription factor sequestration (see Runne et al (2008) JNeurosci 28(39):9723-9731).
  • Other brain areas greatly affected in people with Huntington's disease include the substantia nigra, cortical layers 3, 5, and 6, the CA1 region of the hippocampus, the angular gyrus in the parietal lobe, Purkinje cells of the cerebellum, lateral tuberal nuclei of the hypothalamus, and the centromedialparafascicular complex of the thalamus (Walker (2007) Lancet 369:218-228).
  • Htt brain-derived neurotrophic factor
  • Treatment options for HD are currently very limited. Some potential methodologies designed to prevent the toxicities associated with protein aggregation that occurs through the extended poly-glutamine tract such as overexpression of chaperonins or induction of the heat shock response with the compound geldanamycin have shown a reduction in these toxicities in in vitro models. Other treatments target the role of apoptosis in the clinical manifestations of the disease. For example, slowing of disease symptoms has been shown via blockage of caspase activity in animal models in the offspring of a pairing of mice where one parent contained a HD allele and the other parent had a dominant negative allele for caspase 1. Additionally, cleavage of mutant HD Htt by caspase may play a role in the pathogenicity of the disease.
  • Targeted cleavage events can be used, for example, to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination at a predetermined chromosomal locus. See, e.g., U.S. Patent Nos. 8,623,618; 8,034,598; 8,586,526; 6,534,261; 6,599,692;
  • This technique can also be used to introduce site specific changes in the genome sequence through use of a donor oligonucleotide, including the introduction of specific deletions of genomic regions, or of specific point mutations or localized alterations (also known as gene correction).
  • Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALENs), or using the CRISPR/Cas system with an engineered crRNA/tracr RNA ('single guide RNA') to guide specific cleavage.
  • ZFN zinc finger nucleases
  • TALENs transcription-activator like effector nucleases
  • targeted nucleases are being developed based on the Argonaute system (e.g., from T. thermophilics, known as 'TtAgo', see Swarts et al (2014) Nature 507(7491): 258-261), which also may have the potential for uses in genome editing and gene therapy.
  • Engineered fusion proteins have also been developed for modulating expression of a targeted gene. Such proteins can be used for example to enhance or repress expression of a desired gene (see e.g. U.S. Patent Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 7, 013,219; 7,220,719; 8,268,618; 7,985,778; 8,586,526; U.S. Patent Application 20120294838 the disclosures of which are incorporated by reference in their entireties for all purposes).
  • Huntington's Disease In particular, provided herein are methods and compositions for modifying (e.g., modulating expression of) an HD Htt allele so as to treat
  • Huntington Disease Also provided are methods and compositions for generating animal models of Huntington's Disease.
  • engineered (non-naturally occurring) DNA binding domains e.g., zinc finger proteins, TAL effector (TALE) proteins or
  • CRISPR/dCas-TF that modulate expression of a HD allele (e.g., Htt) are provided.
  • Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA binding domains (e.g., recognition helices or RVDs) have been altered (e.g., by selection and/or rational design) to bind to a pre-selected target site.
  • Any of the zinc finger proteins described herein may include 1, 2, 3, 4, 5, 6 or more zinc fingers, each zinc finger having a recognition helix that binds to a target subsite in the selected sequence(s) (e.g., gene(s)).
  • any of the TALE proteins described herein may include any number of TALE RVDs.
  • At least one RVD has non-specific DNA binding.
  • at least one recognition helix (or RVD) is non-naturally occurring.
  • the zinc finger proteins have the recognition helices shown in Tables 1 A and IB.
  • the zinc finger proteins bind to the target sequences shown in Tables 2A and 2B.
  • the zinc finger proteins comprise the recognition helices in Table 2C.
  • the zinc finger proteins are formulated into a pharmaceutical composition, for example, for administration to a subject.
  • Engineered (non-naturally occurring) CRISPR/Cas systems are also provided that modulate the expression of a HD allele (e.g. Htt) are provided.
  • the Cas9 nuclease domain can be specifically engineered to lose DNA cleavage activity ("dCAS"), and fused to a functional domain capable of modulating gene expression (see Perez-Pimera (2013) Nat Method 10(10):973-976) to create a dCas-TF.
  • dCAS DNA cleavage activity
  • the dCas-TF is supplied with an Htt-specific guide RNA, the system modulates Htt gene expression.
  • repressors ZFP-TFs, CRISPR/dCas-TF or TALE-TFs
  • ZFP, Cas or TALE repressors ZFP-TFs, CRISPR/dCas-TF or TALE-TFs
  • these ZFP-TFs, CRISPR/dCas or TALE-TFs preferentially bind to expanded trinucleotide tracts relative to repeat tracts of a wild-type length, thereby achieving preferential repression of the expanded allele.
  • these ZFP-TFs, CRISPR/dCas-TFs or TALE-TFs include protein interaction domains (or "dimerization domains") that allow multimerization when bound to DNA.
  • these ZFP-TFs, CRISPR/dCas-TFs or TALE TFs achieve cooperative DNA binding to the repeat sequence so that the expanded allele is bound more efficiently by a larger number of ZFPs, dCas or TALE proteins than the wild-type allele, allowing preferential repression of the mutant allele.
  • These cooperative binding ZFP-TFs, CRISPR/dCas-TFs or TALE TFs may or may not further contain protein interaction domains that allow multimerization when bound to DNA.
  • ZFP TFs, CRISPR/dCas-TFs or TALE TFs form a stable complex of multimers of a given size, and thus are capable of preferentially interacting with a CAG tract above a certain minimum size, wherein that minimum size is greater than the length of a wild-type CAG tract.
  • the ZFPs, CRISPR/dCas-TFs or TALE proteins as described herein e.g., two-handed, multimerizing, etc.
  • the ZFP preferentially modify expression of a mutant Htt allele.
  • the CRISPR/dCas-TF or TALE binds specifically to mutant Htt alleles wherein the expanded tract encodes poly-glutamine
  • the ZFP, CRISPR/dCas-TF or TALE binds specifically to a mutant Htt allele wherein the expansion tract encodes poly-serine.
  • the ZFP-TF, CRISPR/dCas-TF or TALE-TF modulates both the wild type and mutant forms of the Htt allele.
  • the ZFP, CRISPR/dCas-TF or TALE modulates only the wild type Htt allele.
  • the ZFP, CRISPR/dCas-TF or TALE modulates only the mutant form of Htt.
  • TALE-TFs are provided which preferentially bind to known SNPs associated with the expanded HD Htt alleles.
  • the ZFP-TFs, CRISPR/dCas-TF or TALE-TFs are specific for mutant Htt alleles which contain the SNP, allowing for specific repression of the mutant Htt allele.
  • ZFP-TFs, CRISPR/dCas-TF or TALE-TFs that specifically activate the wild-type Htt allele by interacting with SNPs associated with wild-type alleles are provided. In this way, only the wild-type Htt allele is activated.
  • the zinc finger proteins (ZFPs), dCas or TALE proteins as described herein can be placed in operative linkage with a regulatory domain (or functional domain) as part of a fusion protein.
  • the functional domain can be, for example, a transcriptional activation domain, a transcriptional repression domain and/or a nuclease (cleavage) domain.
  • a fusion protein comprising a ZFP, dCas or TALE targeted to a mutant Htt as described herein fused to a transcriptional repression domain that can be used to down-regulate mutant Htt expression is provided.
  • a fusion protein comprising a ZFP, dCas or TALE targeted to a wild-type Htt allele fused to a transcription activation domain that can up-regulate the wild type Htt allele is provided.
  • the activity of the regulatory domain is regulated by an exogenous small molecule or ligand such that interaction with the cell's transcription machinery will not take place in the absence of the exogenous ligand.
  • Such external ligands control the degree of interaction of the ZFP-TF, CRISPR/dCas- TF or TALE-TF with the transcription machinery.
  • the regulatory domain(s) may be operatively linked to any portion(s) of one or more of the ZFPs.
  • dCas or TALEs including between one or more ZFPs, dCas or TALEs, exterior to one or more ZFPs, dCas or TALEs and any combination thereof. Any of the fusion proteins described herein may be formulated into a pharmaceutical composition.
  • the engineered DNA binding domains as described herein can be placed in operative linkage with nuclease (cleavage) domains as part of a fusion protein.
  • the nuclease comprises a Ttago nuclease.
  • nuclease systems such as the CRISPR/Cas system may be utilized with a specific single guide RNA to target the nuclease to a target location in the DNA.
  • such nucleases and nuclease fusions may be utilized for targeting mutant Htt alleles in stem cells such as induced pluripotent stem cells (iPSC), human embryonic stem cells (hESC), mesenchymal stem cells (MSC) or neuronal stem cells wherein the activity of the nuclease fusion will result in an Htt allele containing a wild type number of CAG repeats.
  • stem cells such as induced pluripotent stem cells (iPSC), human embryonic stem cells (hESC), mesenchymal stem cells (MSC) or neuronal stem cells wherein the activity of the nuclease fusion will result in an Htt allele containing a wild type number of CAG repeats.
  • iPSC induced pluripotent stem cells
  • hESC human embryonic stem cells
  • MSC mesenchymal stem cells
  • neuronal stem cells wherein the activity of the nuclease fusion will result in an Htt allele containing a wild
  • a polynucleotide encoding any of the DNA binding proteins described herein is provided.
  • polynucleotides encoding a CRIPSR/Cas nuclease and a single guide RNA are provided. Such polynucleotides can be administered to a subject in which it is desirable to treat Huntington's Disease.
  • the invention provides methods and
  • model systems in which mutant Htt alleles are generated using embryonic stem cells to generate cell and animal lines in which trinucleotide expansion tracts of specific lengths (50, 80, 109 and 180 CAG repeats, for example) are inserted into a wild-type Htt allele using zinc finger nuclease (ZFN), TALE -nuclease (TALEN), Ttago or CRISPR/Cas nuclease driven targeted integration.
  • ZFN zinc finger nuclease
  • TALEN TALE -nuclease
  • Ttago CRISPR/Cas nuclease driven targeted integration
  • the model systems comprise in vitro cell lines, while in other embodiments, the model systems comprise transgenic animals.
  • the animal may be, for example, a rodent (e.g., rat, mouse), a primate (e.g., non-human primate) or a rabbit.
  • the invention also comprises a cell or cell line in which an endogenous gene related to HD is modified, for example as compared to the wild-type sequence of the gene in the cell.
  • the cell or cell lines may be heterozygous or homozygous for the modification.
  • the modifications may comprise insertions, deletions and/or combinations thereof.
  • the gene e.g., Htt
  • the gene is modified by a nuclease (e.g., ZFN, TALEN, CRISPR/Cas system, Ttago system, etc.).
  • the modification is at or near the nuclease(s) binding and/or cleavage site(s), for example, within 1-300 (or any value therebetween) base pairs upstream or downstream of the site(s) of cleavage, more preferably within 1-100 base pairs (or any value therebetween) of either side of the binding and/or cleavage site(s), even more preferably within 1 to 50 base pairs (or any value therebetween) on either side of the binding and/or cleavage site(s).
  • the invention comprises delivery of a donor nucleic acid to a target cell.
  • the donor may be delivered prior to, after, or along with the nucleic acid encoding the nuclease(s).
  • the donor nucleic acid may comprise an exogenous sequence (transgene) to be integrated into the genome of the cell, for example, an endogenous locus.
  • the donor may comprise a full length gene or fragment thereof flanked by regions of homology with the targeted cleavage site.
  • the donor lacks homologous regions and is integrated into a target locus through homology independent mechanism (i.e. NHEJ).
  • the donor may comprise any nucleic acid sequence, for example a nucleic acid that, when used as a substrate for homology-directed repair of the nuclease-induced double-strand break, leads to a donor-specified deletion to be generated at the endogenous chromosomal locus or, alternatively (or in addition to), novel allelic forms of (e.g., point mutations that ablate a transcription factor binding site) the endogenous locus to be created.
  • the donor nucleic acid is an oligonucleotide wherein integration leads to a gene correction event, or a targeted deletion.
  • the polynucleotide encoding the DNA binding protein is an mRNA.
  • the mRNA may be chemically modified (See e.g. Kormann et al, (2011) Nature Biotechnology 29(2): 154-157).
  • the mR A may comprise an ARCA cap (see U.S. Patents 7,074,596 and 8,153,773).
  • the mRNA may comprise a mixture of unmodified and modified nucleotides (see U.S. Patent Publication 2012-0195936).
  • a gene delivery vector comprising any of the polynucleotides described herein.
  • the vector is an adenovirus vector (e.g., an Ad5/F35 vector), a lentiviral vector (LV) including integration competent or integration-defective lentiviral vectors, or an adenovirus associated viral vector (AAV).
  • the AAV vector is an AAV6 vector.
  • Ad adenovirus
  • LV lentiviral vector
  • AAV adenovirus associate viral vectors
  • AAV comprising a sequence encoding at least one nuclease (ZFN or TALEN) and/or a donor sequence for targeted integration into a target gene.
  • the Ad vector is a chimeric Ad vector, for example an Ad5/F35 vector.
  • the lentiviral vector is an integrase-defective lentiviral vector (IDLV) or an integration competent lentiviral vector.
  • IDLV integrase-defective lentiviral vector
  • the vector is pseudo-typed with a VSV-G envelope, or with other envelopes.
  • model systems are provided for Huntington's disease wherein the target alleles (e.g., mutant Htt) are tagged with expression markers.
  • the mutant alleles e.g., mutant Htt
  • the wild type allele e.g., wild-type Htt
  • both wild type and mutant alleles are tagged with separate expression markers.
  • the model systems comprise in vitro cell lines, while in other embodiments, the model systems comprise transgenic animals.
  • compositions comprising the nucleic acids and/or proteins (e.g., ZFPs, Cas or TALEs or fusion proteins comprising the nucleic acids and/or proteins (e.g., ZFPs, Cas or TALEs or fusion proteins comprising the nucleic acids and/or proteins (e.g., ZFPs, Cas or TALEs or fusion proteins comprising the nucleic acids and/or proteins (e.g., ZFPs, Cas or TALEs or fusion proteins comprising the
  • compositions include a nucleic acid comprising a sequence that encodes one of the ZFPs, Cas or TALEs described herein operably linked to a regulatory sequence, combined with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence allows for expression of the nucleic acid in a cell.
  • the ZFPs, CRISPR/Cas or TALEs encoded are specific for a HD Htt allele.
  • compositions comprise ZFPs, CRISPR/Cas or TALEs that modulate a HD Htt allele and ZFPs, CRISPR/Cas or TALEs that modulate a neurotrophic factor.
  • Protein based compositions include one of more ZFPs.
  • CRISPR/Cas or TALEs as disclosed herein and a pharmaceutically acceptable carrier or diluent.
  • an isolated cell comprising any of the proteins, polynucleotides and/or compositions as described herein.
  • compositions for treating and/or preventing Huntington's Disease using the methods and compositions described herein.
  • the methods involve compositions where the polynucleotides and/or proteins may be delivered using a viral vector, a non-viral vector (e.g., plasmid) and/or combinations thereof.
  • the methods involve compositions comprising stem cell populations comprising a ZFP or TALE, or altered with the ZFNs, TALENs, Ttago or the CRISPR/Cas nuclease system of the invention.
  • the methods and compositions of the invention are used to normalize and/or modify the expression of certain genes in medium spiny neurons.
  • the method involves use of, and/or the composition is, a genetic repressor that alters the expression of one or more biomarkers related to HD, including but not limited to DARPP-32A, PDElOa, Drdl and/or Drd2, for the treatment or prevention of a subject with Huntington's disease.
  • the genetic repressor is a small molecule, nucleic acid or a protein that inhibits the expression of a huntingtin protein.
  • the genetic repressor specifically binds to the huntingtin gene, in its genomic DNA or in a transcript form, such as mRNA.
  • the genetic repressor is exogenous and/or includes a chemical modification and/or a sequence modification that does not occur in nature.
  • the genetic repressor is a ZFP, TALE or Cas DNA binding domain that specifically binds to a coding and/or non- coding portion of huntingin gene relative to binding to other genes in the genome.
  • the genetic repressor is an antisense nucleic acid that includes a sequence that is 100%, or at least 90%, or at least 80%>, or at least 70%>, or at least 60% identical to a sequence complementary to a coding and/or non-coding portion of the huntingin gene in its transcript form, such as mRNA.
  • the portion of the huntingtin gene that the genetic repressor specifically binds to can be at least 8, at least 10, at least 12, at least 15, at least 18, at least 20, at least 22, at least 25, at least 30, at least 35, and/or at least 40 nucleotides or more in length.
  • use of the genetic repressor such as for treatment of a subject or for testing of a genetic repressor, can result in increased expression of one or more of DARPP-32A, PDElOa, Drdl and/or Drd2 relative to an untreated control.
  • An untreated control does not receive the genetic repressor, for example, an untreated subject or an untreated control cell, such as an MSN.
  • expression of DARPP-22 is increased in a MSN (for example, increased by 10% or more, increased by 20%> or more, increased by 30%> or more, increased by 40%> or more, increased by 50%> or more, increased by 60%> or more, increased by 70%> or more, increased by 80%> or more, increased by 90%> or more, increased by 100% or more, increased by 125%) or more, increased by 150%) or more, increased by 175% or more, and/or increased by 200%) or more, or any value therebetween) relative to an untreated control (e.g., an untreated subject or an untreated MSN cell).
  • an untreated control e.g., an untreated subject or an untreated MSN cell
  • the level of PDElOa is increased in a MSN (for example, increased by 10%> or more, increased by 20%> or more, increased by 30%> or more, increased by 40%> or more, increased by 50%> or more, increased by 60%> or more, increased by 70%> or more, increased by 80%> or more, increased by 90%> or more, increased by 100% or more, increased by 125% or more, increased by 150%) or more, increased by 175% or more, and/or increased by 200%) or more, or any value therebetween) relative to an untreated control (e.g., an untreated subject or an untreated MSN cell).
  • an untreated control e.g., an untreated subject or an untreated MSN cell.
  • the level of a dopamine receptor Drdl and/or Drd2 is increased in a MSN (for example, increased by 10% or more, increased by 20%) or more, increased by 30%> or more, increased by 40%> or more, increased by 50%) or more, increased by 60%> or more, increased by 70%> or more, increased by 80%) or more, increased by 90%> or more, increased by 100%) or more, increased by 125%) or more, increased by 150%) or more, increased by 175%) or more, and/or increased by 200% or more, or any value therebetween) relative to an untreated control (e.g., an untreated subject or an untreated MSN cell).
  • an untreated control e.g., an untreated subject or an untreated MSN cell
  • the level of any combination of DARPP-32A, PDElOa, Drdl and Drd2 is increased, for example, two or more are increased where the two can be DARP32A and PDElOa, or DARP32A and Drdl or any such combination.
  • the level of any three of DARPP-32A, PDElOa, Drdl and Drd2 is increased, while in other aspects, the level of DA PP-32A, PDElOa, Drdl and Drd2 are all increased relative to an untreated control (e.g., an untreated subject or an untreated MSN cell).
  • the methods and compositions of the invention are used to normalize clasping behavior in a subject (e.g., animal model) with HD.
  • a subject e.g., animal model
  • the use of the genetic repressor such as for treatment of a subject or for testing of a genetic repressor, can result in decreased clasping in a treated subject or animal model relative to an untreated control.
  • the model is an HD R6/2 mouse model.
  • clasping behavior is decreased by 10% or more, decreased by 20%> or more, decreased by 30%> or more, decreased by 40%) or more, decreased by 50%> or more, decreased by 60%> or more, decreased by 70%) or more, decreased by 80%> or more, decreased by 90%> or more, or decreased by 100%) or more, or any value therebetween.
  • the clasping decrease can be observed within 30 seconds of testing an animal that is within 7 weeks, within 8 weeks, within 9 weeks, within 10 weeks, within 1 1 weeks, or within 12 weeks of animal birth and/or within 2 weeks, within 3 weeks, within 4 weeks, within 5 weeks, within 6 weeks or within 7 weeks of treatment with the genetic repressor.
  • Figures 1A to IE are schematics depicting wild type and mutant
  • FIG. 1 A shows ZFP designs that bind outside of the CAG repeat, and therefore are predicted to bind equally to the wild type allele and the mutant (HD) allele.
  • KRAB refers to the KRAB repression domain from the KOX1 gene and "ZFP” refers to the zinc finger DNA binding protein.
  • Standard ZFP TF is a ZFP transcription factor fusion protein in which the zinc finger DNA binding domains are linked to the KRAB repression domain.
  • Figure IB shows ZFP-TFs designed to bind within the CAG region.
  • Figure 1C depicts a "two-handed ZFP TF," which is a ZFP transcription factor in which two clusters of zinc finger domains are separated by a rigid protein sequences.
  • the functional (repression) domain is depicted exterior to one ZFP in this Figure, but it will be apparent that the functional domain may be between the ZFPs or exterior to the ZFPs on either end of the protein.
  • Figure ID depicts a "multimerizing ZFP TF,” which is a ZFP TF that is capable of
  • Figure IE depicts a ZFP-ZFP-KRAB configuration where two zinc finger DNA binding domains are linked by a flexible linker and are also fused to a KRAB domain. It will be apparent to the skilled artisan that in all fusion proteins, the functional domain can be on either end of the DNA binding domain, and that the DNA binding domain may comprise a wide number range of zinc fingers. Also depicted in Figure 1 as a box with black diamonds is a functional domain (e.g., activation, repression, cleavage domain). It will be apparent to the skilled artisan that the exemplary models presented in the Figures may apply to TALE TFs as well.
  • Figures 2 A to 2E depict the repression of both alleles of Htt by ZFPs as described in Figure 1 A using ZFP TFs that do not bind to the CAG repeat sequences.
  • the ZFP identification numbers as shown in Tables 1 A and IB are indicated below the bars.
  • Figure 2A depicts repression of the human Htt alleles in HEK293 cells using ZFPs targeted to five loci in the human gene.
  • a diagram of the human Htt gene is shown and the locations of ZFP binding sites are shown. For each ZFP group, each bar represents an independent transfection.
  • Figure 2B depicts a Western blot showing Htt protein levels in HEK293 cells transfected with the GFP control or the 18856 ZFP TF repressor (comprising the KRAB repression domain of KOX1), where the NFKB p65 levels ("p65") were used to confirm equal protein loading.
  • the Western blot confirms the repression of Htt expression by the ZFP-TF.
  • Figure 2C depicts a similar set of data as Figure 2A for the mouse Htt specific ZFP in Neuro2A cells. As in Figure 2 A, a diagram of the mouse Htt gene is shown and the locations of ZFP binding sites are indicated.
  • Figure 2D and 2E demonstrate the repression of mouse Htt gene expression (RNA) in immortalized striatal cells, where different doses of ZFP-TF mRNA were used for transfection.
  • Htt mRNA levels were measured by real-time RT-PCR and normalized to those of Actin mRNA.
  • Figures 3A to 3G depict selective repression of mutant Htt by using ZFPs binding within the CAG repeat region, as illustrated in Figure IB.
  • This model illustrates that the longer CAG repeat region in the mutant allele allows for increased binding of C AG-targeted ZFP repressor molecules.
  • Figure 3 A depicts different repressor activities on the endogenous Htt gene (with normal CAG repeat length) by CAG-targeted ZFPs in HEK293 cells.
  • Figure 3B shows repression of luciferase reporters controlled by Htt promoter/exonl fragments containing CAG repeats of varying lengths, ranging from 10 to 47 CAG repeats.
  • CAG 10 shows results with 10 CAG repeats
  • CAG 17 shows results with 17 CAG repeats
  • CAG23 shows results with 23 CAG repeats
  • CAG47 shows results with 47 CAG repeats.
  • the schematic above the graph depicts the arrangement of the Htt promoter, exon 1 , the CAG repeats and the reporter luciferase gene used in this system. The data demonstrate that increasing the number of CAGs leads to a decreased expression from the Htt promoter by a CAG-targeted ZFP.
  • Figure 3C demonstrates that, while a relatively weak CAG-targeted ZFP does not repress the luciferase reporter that contains a normal-length CAG repeat as well as a strong CAG repressor, it drives similar repression of a luciferase reporter that contains an expanded CAG repeat as the strong CAG-targeted ZFP. at all doses tested.
  • "pRL-Htt-CAG23-intron 1" corresponds to expression from the wild type allele while "pRL-HttCAG47- intron 1" (right bar of each pair) correlates with expression from the mutant expanded Htt allele (containing 47 CAG repeats).
  • Figure 3D is a graph depicting repression of mutant Htt (1 1 1 CAG) by CAG-targeted ZFPs in immortalized mouse striatal cells derived from HdH(Ql 1 1/Q7) knock-in mice. Wild-type expression is shown in the left bar of each pair and knock-in expression in the right bar of each pair. ZFP-TFs comprising the specified ZFP fused to the KRAB repression domain were tested using three different concentrations of ZFP mRNA in the transfections.
  • Figure 3E depicts mutant Htt repression by CAG-targeted ZFPs in a HD patient derived fibroblast line (CAG 15/70).
  • the wild type Htt allele comprises 15 CAG repeats ("099T(CAG15)", middle bar of each indicated condition) and the mutant expanded Htt allele comprises 70 CAG repeats ("099C(CAG70)", right bar of each indicated condition).
  • Figure 3F shows selective repression of mutant Htt expression in 4 different HD patient derived fibroblast cell lines.
  • the numbers above each grouping indicate the number of CAG repeats on the wild type Htt allele (e.g. 15 or 18) and on the mutant allele (e.g. 70, 67, 45 and 44); where two different doses of ZFP mRNA were tested.
  • the left-bar of each pair shows wild-type Htt expression and the right bar of each shows expression of mutant Htt.
  • Figure 3G depicts Htt expression in HD derived patient fibroblasts as assayed by Western blot analysis in the presence of the ZFP-TFs 30640, 32528 and 30657.
  • the slower migrating protein bands are those produced by the expanded mutant Htt alleles.
  • 32528 binds to the transcription start site of Htt (TSS) and thus inhibits expression from both alleles, while 30640 and 30657 bind to the CAG repeats (CAG).
  • TSS transcription start site of Htt
  • CAG CAG repeats
  • Figures 4A and 4B depict repression of the mutant Htt in a HD patient derived fibroblast line by a panel of ZFPs targeted to the CAG repeat.
  • a range of R A concentrations were used from 0.1 ng to 3 ⁇ g.
  • the left bar of each indicated conditions shows total Htt expression
  • the middle bar shows expression of Htt in fibroblasts in which the Htt allele comprises 18 CAG repeats ("099T(CAG18)"
  • the mutant expanded Htt allele comprises 45 CAG repeats 099T (CAG45
  • Figure 5 shows the effect of CAG-targeted ZFP repressors on the expression of Htt and other CAG-containing genes in HD patient-derived fibroblasts.
  • the left bar under each indicated condition shows results with 30640; the middle bar under each indicated condition shows results with 30675; and the right bar shows mock transfections.
  • Figures 6A and 6B depict an experiment that examines the genome- wide specificity of three CAG-targeted ZFPs.
  • Figure 6A depicts qPCR analysis of Htt repression performed on six biological replicates (six separate transfections) of HD fibroblasts (CAG 18 (middle bars)/ CAG45, right bars) using 30640, 30645, or 33074.
  • Figure 7 depicts Htt repression in CAG 17/69 neuronal stem cells
  • NSC neurotrophic factor
  • Figure 8 depicts Htt expression in neurons differentiated from HD embryonic stem cells (ESC) (CAG 17/48) treated with ZFP TFs. The cells were transfected with ZFP mRNA at indicated doses.
  • ESC HD embryonic stem cells
  • Figure 9 depicts repression of a mutant Htt transgene expression in
  • FIGS 10A through 10D depict ZFPs with multimerization domains that specifically targets expanded CAG repeats, as illustrated in Figure ID.
  • Figure 10A shows a single ZFP that have four components: (i) a KOX repressor domain (oval labeled "repressor”); (ii) an array of 2-6 fingers (two shown, small ovals marked “Z") that binds to (CAG) N or a permutation of this sequence; and (iii) two
  • dimerization domains (rectangles labeled “dl” and “d2") that interact in an antiparallel configuration. These domains allow the ZFP to polymerize within the major groove of a CAG tract.
  • Figure 10B shows a sketch of the binding event with a multimer of 3 ZFPs. It will be apparent that any number of multimers can be used and that the functional domain may be positioned anywhere on one or more of the individual ZFPs and that these diagrams are applicable to TALE-TFs as well.
  • Figure IOC shows protein sequences of the four ZFP monomer scaffolds that are designed to multimerize via interactions between dimerizing zinc fingers (DZ).
  • DZ1 SEQ ID NO: 180
  • DZ2 SEQ ID NO: 181
  • DZ3 SEQ ID NO: 182
  • DZ4 SEQ ID NO: 183
  • Dimerizing zinc finger domains are underlined, while the repression domain and nuclear localization sequence are indicated by bold underline and italic text (respectively).
  • Figure 10D shows protein sequences of the seven ZFP monomer scaffolds that are designed to multimerize via interactions between coiled- coils (CC).
  • CC1 SEQ ID NO: 184
  • CC2 SEQ ID NO: 185
  • CC3 SEQ ID NO: 186
  • CC4 SEQ ID NO: 187
  • CC5 SEQ ID NO: 188
  • CC6 SEQ ID NO: 189
  • CC7 SEQ ID NO: 190.
  • Coiled-coil sequences are underlined, while the repression domain and nuclear localization sequence are indicated by bold underline and italic text (respectively).
  • the location of the ZFP region of each scaffold, which will vary between designs, is indicated by "[ZFP].”
  • the location of the (DNA-binding) ZFP region of each scaffold which will vary between designs, is indicated by "[ZFP].”
  • Figures 11A and 11B depict activity of ZFP-TFs with dimerization domains.
  • ZFP-TFs with "coiled coil” (CC) domains were tested with luciferase reporters.
  • pRL-Htt CAG 17 (left bar of each pair) stands for renilla luciferase reporter controlled by human Htt promoter/exonl fragment with 17 CAG;
  • pGL3-Htt-CAG47 (right bar of each pair) stands for firefly luciferase reporter controlled by human Htt promoter/exonl fragment with 47 CAG repeats. See text in Example 10 for description of the various dimerization domains.
  • Figures 12A and 12B depict repression of Htt by ZFP-ZFP-KOX proteins.
  • Figure 12A depicts Htt repression by the single 33088 and 33084 ZFP-TFs, and repression by the 33088-33088 and 33088-33084 ZFP-ZFP-KOX proteins in wild-type (left bar), CAG 18 (middle bar) and CAG45 (right bar) (Figure 12A) HD fibroblasts;
  • Figure 12B depicts Htt repression by 33088-33088 and 33088-33084 ZFP-ZFP-KOX in wild type (left bar), CAG 20 (middle bar) and CAG41 (left bar) HD fibroblasts.
  • Figures 13 A to 13E depict activation of mouse Htt.
  • Figure 13A demonstrates ZFP-TF-driven up-regulation of the mouse Htt genes at the R A level in Neuro2A cells using a ZFP fused to the p65 activation domain. Double bars indicate duplicate transfections.
  • Figure 13B depicts a Western blot demonstrating increased Htt protein production driven by the ZFP.
  • Figure 13C depicts a wild type mouse Htt allele and a "knock in" Htt allele where mouse sequence (most of exonl and part of intron 1, line above wild-type allele schematic) has been replaced with corresponding human sequence with CAG expansion (line over knock-in allele schematic).
  • Figure 13D depicts the alignment between mouse sequence (SEQ ID NO: 191) that was replaced with the corresponding human sequence (SEQ ID NO: 191) that was replaced with the corresponding human sequence (SEQ ID NO: 191) that was replaced with the corresponding human sequence (SEQ ID NO: 191) that was replaced with the corresponding
  • FIG. 13E depicts specific activation of the wild type mouse Htt allele in
  • Figures 14A and 14B depict the results of Cel-I mismatch assays
  • FIG. 15 depicts graphs of the Htt repression results for several candidate TALE-TF proteins.
  • the TALE-TFs were tested in HD patient derived fibroblasts (CAG 20/41). The results demonstrate that some of the TALE TFs were active in repressing overall Htt expression, while others exhibited mutant Htt- preferential repression.
  • Figure 16 depicts two photographs displaying clasping behavior
  • Figure 17 is a graphical display of clasping behavior in a mouse model of HD (R6/2). The mice are suspended for 30 seconds and scored for the type and length of clasping behavior over the time period. As can be observed, the ZFP treated mice showed a decrease in clasping behavior at all time-points over a 12 week period.
  • Figure 18 is a graphical display in the change of expression of four biomarkers for medium spiny neurons derived from brains of R6/2 mice treated with the ZFP.
  • Htt-modulating transcription factors comprising zinc finger proteins (ZFP TFs) or TALEs (TALE-TF) and methods utilizing such proteins are provided for use in treating or preventing Huntington's disease.
  • ZFP TFs zinc finger proteins
  • TALE-TF TALE-TF
  • ZFP-TFs or TALE-TFs which repress expression of a mutant Htt allele or activate expression of a wild-type Htt allele are provided.
  • ZFNs zinc finger nucleases
  • TALENs TALE nucleases
  • Ttago systems or
  • CRISPR/Cas nuclease systems that modify the genomic structure of the genes associated with HD are provided.
  • ZFNs, TALENs or CRISPR/Cas nuclease systems that are able to specifically alter portions of a mutant form of Htt are provided.
  • engineered zinc finger proteins or engineered TALE proteins i.e., non-naturally occurring proteins which bind to a predetermined nucleic acid target sequence.
  • the methods and compositions described herein provide methods for treatment and prevention of Huntington's Disease, and these methods and
  • compositions can comprise zinc finger transcription factors or TALE transcription factors that are capable of modulating target genes as well as engineered zinc finger and TALE nucleases, Ttago and CRISPR/Cas nuclease systems capable of modifying or editing Htt.
  • compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL,
  • nucleic acid refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
  • polynucleotide refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
  • these terms are not to be construed as limiting with respect to the length of a polymer.
  • the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
  • an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of corresponding naturally-occurring amino acids.
  • Binding refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all
  • binding interaction components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (3 ⁇ 4) of 10 ⁇ 6 M “1 or lower. "Affinity" refers to the strength of binding:
  • a "binding protein” is a protein that is able to bind non-covalently to another molecule.
  • a binding protein can bind to, for example, a DNA molecule (a DNA- binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein).
  • a protein-binding protein it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • a binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding and protein- binding activity.
  • a "zinc finger DNA binding protein” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • a "TALE DNA binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence.
  • a single “repeat unit” (also referred to as a “repeat”) is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. See, e.g., U.S. Patent No. 8,586,526.
  • Zinc finger binding domains or TALE DNA binding domains can be any organic or organic
  • engineered zinc finger proteins or TALEs are proteins that are non-naturally occurring.
  • methods for engineering zinc finger proteins or TALEs are design and selection.
  • a designed zinc finger protein or TALE is a protein not occurring in nature whose design/composition results
  • Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Patents 8,586,526; 6,140,081; 6,453,242; and 6,534,261; see also
  • WO 98/53058 ; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.
  • a "selected" zinc finger protein or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See, e.g., 8,586,526; 5,789,538; US 5,925,523; US 6,007,988; US 6,013,453; US 6,200,759; WO 95/19431; WO 96/06166;
  • TtAgo is a prokaryotic Argonaute protein thought to be involved in gene silencing.
  • TtAgo is derived from the bacteria Thermus thermophilus. See, e.g., Swarts et al, ibid, G. Sheng et al, (2013) Proc. Natl. Acad. Sci. U.S.A. I l l, 652).
  • a "TtAgo system” is all the components required including, for example, guide DNAs for cleavage by a TtAgo enzyme.
  • “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms. This process requires nucleotide sequence homology, uses a "donor” molecule to template repair of a "target” molecule (i.e., the one that experienced the double-strand break), and is variously known as “non- crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic information from the donor to the target.
  • such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or "synthesis-dependent strand annealing," in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes.
  • Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
  • one or more targeted nucleases as described herein create a double-stranded break in the target sequence (e.g., cellular chromatin) at a predetermined site, and a "donor" polynucleotide, having homology to the nucleotide sequence in the region of the break, can be introduced into the cell.
  • the presence of the double-stranded break has been shown to facilitate integration of the donor sequence.
  • the donor sequence may be physically integrated or, alternatively, the donor polynucleotide is used as a template for repair of the break via homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the donor into the cellular chromatin.
  • a first sequence in cellular chromatin can be altered and, in certain embodiments, can be converted into a sequence present in a donor polynucleotide.
  • replace or “replacement” can be understood to represent replacement of one nucleotide sequence by another, (i.e., replacement of a sequence in the informational sense), and does not necessarily require physical or chemical replacement of one polynucleotide by another.
  • additional pairs of zinc-finger or TALE proteins can be used for additional double-stranded cleavage of additional target sites within the cell.
  • a chromosomal sequence is altered by homologous recombination with an exogenous "donor" nucleotide sequence.
  • homologous recombination is stimulated by the presence of a double-stranded break in cellular chromatin, if sequences homologous to the region of the break are present.
  • the donor sequence can contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence in the region of interest.
  • sequences in the region of interest exhibit between about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence that is replaced.
  • the homology between the donor and genomic sequence is higher than 99%, for example if only 1 nucleotide differs as between donor and genomic
  • a non-homologous portion of the donor sequence can contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest.
  • the non-homologous sequence is generally flanked by sequences of 50- 1,000 base pairs (or any integral value therebetween) or any number of base pairs greater than 1,000, that are homologous or identical to sequences in the region of interest.
  • the donor sequence is non-homologous to the first sequence, and is inserted into the genome by non-homologous recombination
  • exogenous nucleic acid sequence can comprise, for example, one or more genes or cDNA
  • the exogenous nucleic acid sequence may produce one or more R A molecules (e.g., small hairpin R As (shR As), inhibitory RNAs (RNAis), microRNAs (miRNAs), etc.).
  • R A molecules e.g., small hairpin R As (shR As), inhibitory RNAs (RNAis), microRNAs (miRNAs), etc.
  • Cleavage refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DNA cleavage.
  • a "cleavage half-domain” is a polypeptide sequence which, in
  • first and second cleavage half-domains; "+ and - cleavage half-domains” and “right and left cleavage half-domains” are used interchangeably to refer to pairs of cleavage half- domains that dimerize.
  • An "engineered cleavage half-domain” is a cleavage half-domain that has been modified so as to form obligate heterodimers with another cleavage half- domain (e.g., another engineered cleavage half-domain). See, also, U.S. Patent
  • sequence refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded.
  • donor sequence refers to a nucleotide sequence that is inserted into a genome.
  • a donor sequence can be of any length, for example between 2 and 10,000 nucleotides in length (or any integer value
  • nucleotides in length preferably between about 100 and 1,000 nucleotides in length (or any integer therebetween), more preferably between about 200 and 500 nucleotides in length.
  • Chromatin is the nucleoprotein structure comprising the cellular genome.
  • Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. The majority of
  • eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a
  • nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores.
  • a molecule of histone HI is generally associated with the linker DNA.
  • chromatin is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin.
  • a "chromosome,” is a chromatin complex comprising all or a portion of the genome of a cell. The genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell. The genome of a cell can comprise one or more chromosomes.
  • An "episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell.
  • Examples of episomes include plasmids and certain viral genomes.
  • a "target site” or “target sequence” is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions for binding exist.
  • exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. "Normal presence in the cell" is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell.
  • An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally- functioning endogenous molecule.
  • An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein,
  • Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251.
  • Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.
  • an exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid.
  • an exogenous nucleic acid can comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell.
  • exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran- mediated transfer and viral vector-mediated transfer.
  • An exogenous molecule can also be the same type of molecule as an endogenous molecule but derived from a different species than the cell is derived from.
  • a human nucleic acid sequence may be introduced into a cell line originally derived from a mouse or hamster.
  • an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions.
  • an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally- occurring episomal nucleic acid.
  • Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
  • genetic repressor refers to any molecule that decreases to any extent the expression of one or more genes.
  • genes that can be repressed include biomarkers related to HD (e.g., DARPP-32A, PDElOa, Drdl and/or Drd2). Such genetic repression can result in the treatment and/or prevention of Huntington's disease in a subject.
  • the genetic repressor can be any molecule, including, but not limited to, a small molecule, a nucleic acid and/or a protein (e.g., a protein comprising a non-naturally occurring DNA-binding domain such as a zinc finger protein, CRISRP/Cas or TALE domain) that inhibits the expression of the gene (e.g., huntingtin gene).
  • a protein e.g., a protein comprising a non-naturally occurring DNA-binding domain such as a zinc finger protein, CRISRP/Cas or TALE domain
  • Genetic repressor proteins can comprise fusion molecules, for example fusion protein transcription factors (e.g., ZFP-TFs, CRISPR/dCas-TFs or TALE-TFs) comprising a DNA-binding domain and a transcriptional regulation domain or nucleases (e.g., ZFNs, TALENs, CRISPR/Cas and/or Ttago nuclease systems) comprising a DNA-binding domain and a nuclease domain.
  • the genetic repressor specifically binds to the huntingtin gene, in its genomic DNA or in a transcript form, such as mRNA.
  • a "fusion" molecule is a molecule in which two or more subunit molecules are linked, preferably covalently.
  • the subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules.
  • Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (for example, a fusion between a ZFP or TALE DNA-binding domain and one or more activation domains) and fusion nucleic acids (for example, a nucleic acid encoding the fusion protein described supra).
  • Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.
  • Fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein.
  • Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
  • a “multimerization domain”, (also referred to as a “dimerization domain” or “protein interaction domain”) is a domain incorporated at the amino, carboxy or amino and carboxy terminal regions of a ZFP TF or TALE TF. These domains allow for multimerization of multiple ZFP TF or TALE TF units such that larger tracts of trinucleotide repeat domains become preferentially bound by multimerized ZFP TFs or TALE TFs relative to shorter tracts with wild-type numbers of lengths. Examples of multimerization domains include leucine zippers.
  • Multimerization domains may also be regulated by small molecules wherein the multimerization domain assumes a proper conformation to allow for interaction with another multimerization domain only in the presence of a small molecule or external ligand. In this way, exogenous ligands can be used to regulate the activity of these domains.
  • Gene expression refers to the conversion of the information, contained in a gene, into a gene product.
  • a gene product can be the direct
  • Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
  • Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing (e.g., cleavage, alteration, inactivation, random mutation) can be used to modulate expression. Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include a ZFP or TALE protein as described herein. Thus, gene inactivation may be partial or complete.
  • a "region of interest” is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination.
  • a region of interest can be present in a chromosome, an episome, an organellar genome (e.g., mitochondrial, chloroplast), or an infecting viral genome, for example.
  • a region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region.
  • a region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
  • "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., T-cells).
  • operative linkage and "operatively linked” (or “operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
  • a transcriptional regulatory sequence such as a promoter
  • a transcriptional regulatory sequence is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors.
  • transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it.
  • an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
  • the term "operatively linked" can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked.
  • the ZFP or TALE DNA-binding domain and the activation domain are in operative linkage if, in the fusion polypeptide, the ZFP or TALE DNA-binding domain portion is able to bind its target site and/or its binding site, while the activation domain is able to upregulate gene expression.
  • ZFPs fused to domains capable of regulating gene expression are collectively referred to as "ZFP-TFs” or “zinc finger transcription factors”
  • TALEs fused to domains capable of regulating gene expression are collectively referred to as "TALE-TFs” or "TALE transcription factors.”
  • ZFP-TFs ZFP-TFs
  • TALE-TFs TALE transcription factors
  • ZFN ZFN or "zinc finger nuclease
  • the ZFP DNA-binding domain and the cleavage domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the cleavage domain is able to cleave DNA in the vicinity of the target site.
  • a fusion polypeptide in which a TALE DNA-binding domain is fused to a cleavage domain a "TALEN” or "TALE nuclease"
  • the TALE DNA-binding domain and the cleavage domain are in operative linkage if, in the fusion polypeptide, the TALE DNA-binding domain portion is able to bind its target site and/or its binding site, while the cleavage domain is able to cleave DNA in the vicinity of the target site.
  • a "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid.
  • a functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one or more amino acid or nucleotide substitutions.
  • DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al., supra.
  • the ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two-hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al.
  • a "vector" is capable of transferring gene sequences to target cells.
  • vector construct means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells.
  • vector construct means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells.
  • the term includes cloning, and expression vehicles, as well as integrating vectors.
  • reporter gene refers to any sequence that produces a protein product that is easily measured, preferably although not necessarily in a routine assay.
  • Suitable reporter genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored or fluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase).
  • antibiotic resistance e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance
  • sequences encoding colored or fluorescent or luminescent proteins e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase
  • proteins which mediate enhanced cell growth and/or gene amplification e.g., dihydrofolate reduc
  • Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA or any detectable amino acid sequence. "Expression tags” include sequences that encode reporters that may be operably linked to a desired gene sequence in order to monitor expression of the gene of interest. Biomarkers of Huntington's Disease
  • MSNs in HD display abnormal aggregations and inclusions of htt, bioenergetic defects, neurotophin deficiency, transcriptional dysregulation, disorders of axonal transport and exictotoxicity.
  • DARPP-32 Dopamine- and -c AMP -regulated phosphoprotein, Mr 32 kDa
  • PP-1 protein phosphatase 1
  • PKA protein phosphatase 1
  • the striatal-specific cyclic nucleotide phophodiesterase PDE10A acts in the striatum to limit cyclic nucleotide signaling via enzymatic hydrolysis. It is a dual substrate PDE that is expressed at high levels in both the indirect and direct MSNs (see Kleiman et al, 2011 J of Pharma and Exp Thera 336(l):64-78) and is down regulated in HD.
  • Dopamine signaling in the striatum is regulated in part by the dopamine receptors and indirect MSNs express the Dl and D2 dopamine receptors (Drdl and Drd2, respectively).
  • Dl expressing cells of the direct pathway project to the substantia nigra pars reticulate
  • D2 receptor expressing MSNs of the indirect pathway project to the medial globus pallidus
  • the classical model of basal ganglia functioning suggests that the ability of the striatum to select differential action of dopamine in the control of movement is due to the segregation of the Dl and D2 receptors into the two groups of MSNs (see Gerfen et al (1990) Science 250: 1429- 1432).
  • expression of both the Drdl and Drd2 genes is an essential function of MSNs and an imbalance or defect in expression can lead to the disruption of motor function observed in HD.
  • biomarkers of MSN function in HD that appear to recapitulate those observed in the human HD caudate include decreases in PENK (proenkephalin), RGS4 (regulator of G-protem signaling 4), the transcription factor NGFi- A,
  • Clasping behavior in mouse models is indicative of the disease.
  • a human Htt promoter and exon 1 fragment that contains an expanded CAG repeat is ectopically expressed (Mangiarini et al. ibid).
  • These mice exhibit HD-like behavioral changes as well as loss of striatal medium spiny neurons (MSNs), which is a hallmark of HD.
  • MSNs striatal medium spiny neurons
  • Age at death is generally between 10 and 13 weeks (although can occur earlier or later), and the mice display a progressive neurological phenotype.
  • One of the first symptoms is a dyskinesia of the limbs when held by the tail. This progresses to an alternating clasping together and releasing of the feet until the mice clasp their feet together immediately after being picked up and can no longer release this posture.
  • clasping behavior can be scored as a measure of degree of HD phenotypic behavior.
  • Phenotypic improvements in HD may be measured by comparing treated and untreated animals.
  • the models can be evaluated by measuring clasping behavior and changes in biomarkers following sacrifice.
  • Rodriguez- Lebron. et al 2005, Mol Tker 12(4):618-633 measured the efficacy of a shRNA against htt using an analysis of clasping behavior and change in DARPP-32 and PENK expression.
  • DNA-binding domains DNA-binding domains
  • compositions comprising a DNA-binding domain that specifically bind to a target sequence in any gene comprising a trinucleotide repeat, including, but not limited to, Htt. Any DNA-binding domain can be used in the compositions and methods disclosed herein.
  • the DNA binding domain comprises a zinc finger protein.
  • the zinc finger protein is non-naturally occurring in that it is engineered to bind to a target site of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215;
  • An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein.
  • Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Patents 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
  • Exemplary selection methods including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186;
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned WO 02/077227.
  • WO 96/06166 WO 98/53057; WO 98/5431 1 ; WO 00/27878; WO 01/60970 WO 01/88197; WO 02/099084; WO 98/53058; WO 98/53059; WO 98/53060;
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903, 185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • the DNA binding domain is an engineered zinc finger protein that binds (in a sequence-specific manner) to a target site in a Htt gene and modulates expression of Htt.
  • the ZFPs can bind selectively to either a mutant Htt allele or a wild-type Htt sequence.
  • Htt target sites typically include at least one zinc finger but can include a plurality of zinc fingers (e.g., 2, 3, 4, 5, 6 or more fingers).
  • the ZFPs include at least three fingers. Certain of the ZFPs include four, five or six fingers, while some ZFPs include 8, 9, 10, 1 1 or 12 fingers.
  • the ZFPs that include three fingers typically recognize a target site that includes 9 or 10 nucleotides; ZFPs that include four fingers typically recognize a target site that includes 12 to 14 nucleotides; while ZFPs having six fingers can recognize target sites that include 18 to 21 nucleotides.
  • the ZFPs can also be fusion proteins that include one or more regulatory domains, which domains can be transcriptional activation or repression domains. In some embodiments, the fusion protein comprises two ZFP DNA binding domains linked together. These zinc finger proteins can thus comprise 8, 9, 10, 1 1 , 12 or more fingers.
  • the two DNA binding domains are linked via an extendable flexible linker such that one DNA binding domain comprises 4, 5, or 6 zinc fingers and the second DNA binding domain comprises an additional 4, 5, or 5 zinc fingers.
  • the linker is a standard inter- finger linker such that the finger array comprises one DNA binding domain comprising 8, 9, 10, 11 or 12 or more fingers.
  • the linker is an atypical linker such as a flexible linker.
  • the DNA binding domains are fused to at least one regulatory domain and can be thought of as a 'ZFP-ZFP-TF' architecture.
  • ZFP- ZFP-KOX which comprises two DNA binding domains linked with a flexible linker and fused to a KOX repressor
  • ZFP-KOX-ZFP-KOX where two ZFP-KOX fusion proteins are fused together via a linker
  • the DNA-binding domain may be derived from a nuclease.
  • the recognition sequences of homing endonucleases and meganucleases such as l-Scel, l-Ceul, Fl-Pspl, Fl-Sce, l-SceTV, l-Csml, l-Panl, I- Scell, l-Ppol, I-SceIII, l-Crel, l-Tevl, l-Tevll and I- Tevlll are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et a/. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82: 115-118; Perler et a/. (1994)
  • Two handed zinc finger proteins are those proteins in which two clusters of zinc finger DNA binding domains are separated by intervening amino acids so that the two zinc finger domains bind to two discontinuous target sites.
  • An example of a two handed type of zinc finger binding protein is SIP1, where a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus ⁇ see Remacle et al, (1999) EMBO Journal 18 (18): 5073-5084).
  • Each cluster of zinc fingers in these proteins is able to bind to a unique target sequence and the spacing between the two target sequences can comprise many nucleotides.
  • Two-handed ZFPs may include a functional domain, for example fused to one or both of the ZFPs.
  • the functional domain may be attached to the exterior of one or both ZFPs (see, Figure 1C) or may be positioned between the ZFPs (attached to both ZFPs) (see, Figure 4).
  • the first column in this table is an internal reference name (number) for a ZFP and corresponds to the same name in column 1 of Tables 2A and 2B.
  • “F” refers to the finger and the number following "F” refers which zinc finger (e.g., "Fl” refers to finger 1).
  • Table 1A Htt-targeted zinc finger proteins
  • Table IB Human and Mouse Htt-targeted zinc finger proteins
  • Tables 2A and 2B show the target sequences for the indicated zinc finger proteins. Nucleotides in the target site that are contacted by the ZFP recognition helices are indicated in uppercase letters; non-contacted nucleotides indicated in lowercase.
  • the DNA-binding domain comprises a naturally occurring or engineered (non-naturally occurring) TAL effector (TALE) DNA binding domain.
  • TALE TAL effector
  • Xanthomonas depends on a conserved type III secretion (T3S) system which injects more than 25 different effector proteins into the plant cell.
  • T3S transcription activator-like effectors
  • TALE transcription activator-like effectors
  • These proteins contain a DNA binding domain and a transcriptional activation domain.
  • AvrBs3 from Xanthomonas campestgris pv. Vesicatoria see Bonas et al (1989) Mol Gen Genet 218: 127-136 and WO2010079430).
  • TALEs contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcriptional activation domain (for a review see Schornack S, et al (2006) J Plant Physiol 163(3): 256-272). In addition, in the phytopathogenic bacteria Ralstonia solanacearum two genes, designated brgl 1 and hpxl7 have been found that are homologous to the AvrBs3 family of
  • Xanthomonas in the R. solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain RS1000 See Heuer et al (2007) Appl and Envir Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other but differ by a deletion of 1,575 base pairs in the repeat domain of hpxl7. However, both gene products have less than 40% sequence identity with AvrBs3 family proteins of Xanthomonas .
  • TALEs [0117] Specificity of these TALEs depends on the sequences found in the tandem repeats.
  • the repeated sequence comprises approximately 102 base pair and the repeats are typically 91-100%) homologous with each other (Bonas et al, ibid).
  • Polymorphism of the repeats is usually located at positions 12 and 13 and there appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the TALE's target sequence (see Moscou and Bogdanove, (2009) Science 326: 1501 and Boch et al (2009) Science 326: 1509-1512).
  • the code for DNA recognition of these TALEs has been determined such that an HD sequence at positions 12 and 13 leads to a binding to cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or G, and IG binds to T.
  • C cytosine
  • NG binds to T
  • NI to A
  • C G or T
  • NN binds to A or G
  • IG binds to T.
  • These DNA binding repeats have been assembled into proteins with new combinations and numbers of repeats, to make artificial transcription factors that are able to interact with new sequences and activate the expression of a non-endogenous reporter gene in plant cells (Boch et al, ibid).
  • TAL proteins have been linked to a Fokl cleavage half domain to yield a TAL effector domain nuclease fusion (TALEN) exhibiting activity in a yeast reporter assay (plasmid based target).
  • TALEN TAL effector domain nuclease fusion
  • dimerization domains to be used with ZFPs or TALE proteins are listed in Table 3.
  • Fusion proteins comprising DNA-binding proteins (e.g., ZFPs or
  • TALEs as described herein and a heterologous regulatory (functional) domain (or functional fragment thereof) are also provided.
  • Common domains include, e.g., transcription factor domains (activators, repressors, co-activators, co-repressors), silencers, oncogenes (e.g., myc, jun, fos, myb, max, mad, rel, ets, bcl, myb, mos family members etc.); DNA repair enzymes and their associated factors and modifiers; DNA rearrangement enzymes and their associated factors and modifiers; chromatin associated proteins and their modifiers (e.g. kinases, acetylases and deacetylases); and DNA modifying enzymes (e.g., methyltransferases,
  • topoisomerases helicases, ligases, kinases, phosphatases, polymerases,
  • Suitable domains for achieving activation include the HSV VP 16 activation domain (see, e.g., Hagmann et al, J. Virol. 71, 5952-5962 (1997)) nuclear hormone receptors (see, e.g., Torchia et al., Curr. Opin. Cell. Biol. 10:373-383 (1998)); the p65 subunit of nuclear factor kappa B (Bitko & Barik, J. Virol. 72:5610- 5618 (1998) and Doyle & Hunt, Neuroreport 8:2937-2942 (1997)); Liu et al., Cancer Gene Ther.
  • HSV VP 16 activation domain see, e.g., Hagmann et al, J. Virol. 71, 5952-5962 (1997)
  • nuclear hormone receptors see, e.g., Torchia et al., Curr. Opin. Cell. Biol. 10:373-383 (1998)
  • chimeric functional domains such as VP64 (Beerli et al, (1998) Proc. Natl. Acad. Sci. USA 95: 14623-33), and degron (Molinari et al, (1999) EMBO J. 18, 6439-6447).
  • Additional exemplary activation domains include, Oct 1, Oct-2A, Spl, AP-2, and CTF1 (Seipel et al, EMBO J. 11, 4961-4968 (1992) as well as p300, CBP, PCAF, SRC1 PvALF, AtHD2A and ERF -2. See, for example, Robyr et al. (2000) Mol. Endocrinol.
  • Additional exemplary activation domains include, but are not limited to, OsGAI, HALF-1, CI, API, ARF- 5,-6,-7, and -8, CPRFl, CPRF4, MYC-RP/GP, and TRABl .
  • OsGAI OsGAI
  • HALF-1 CI
  • API API
  • ARF- 5,-6,-7, and -8 CPRFl
  • CPRF4 MYC-RP/GP
  • TRABl TRABl
  • any molecule capable of recruiting an activating complex and/or activating activity (such as, for example, histone acetylation) to the target gene is useful as an activating domain of a fusion protein.
  • Insulator domains, localization domains, and chromatin remodeling proteins such as ISWI-containing domains and/or methyl binding domain proteins suitable for use as functional domains in fusion molecules are described, for example, in U.S. Patent Nos. 6,919,204 and 7,053,264.
  • Exemplary repression domains include, but are not limited to, KRAB
  • TIEG TGF-beta-inducible early gene
  • MBD2 MBD3, members of the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2.
  • Additional exemplary repression domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al. (1996) Plant Cell 8:305-321; and Wu et al. (2000) Plant J. 22: 19-27.
  • Fusion molecules are constructed by methods of cloning and biochemical conjugation that are well known to those of skill in the art. Fusion molecules comprise a DNA-binding domain and a functional domain (e.g., a transcriptional activation or repression domain). Fusion molecules also optionally comprise nuclear localization signals (such as, for example, that from the SV40 medium T-antigen) and epitope tags (such as, for example, FLAG and
  • Fusion proteins are designed such that the translational reading frame is preserved among the components of the fusion.
  • Fusions between a polypeptide component of a functional domain (or a functional fragment thereof) on the one hand, and a non-protein DNA-binding domain (e.g., antibiotic, intercalator, minor groove binder, nucleic acid) on the other, are constructed by methods of biochemical conjugation known to those of skill in the art. See, for example, the Pierce Chemical Company (Rockford, IL) Catalogue. Methods and compositions for making fusions between a minor groove binder and a polypeptide have been described. Mapp et al. (2000) Proc. Natl. Acad. Sci. USA 97:3930-3935.
  • the target site bound by the DNA binding domain is present in an accessible region of cellular chromatin. Accessible regions can be determined as described, for example, in co-owned International Publication WO 01/83732. If the target site is not present in an accessible region of cellular chromatin, one or more accessible regions can be generated as described in co-owned WO 01/83793.
  • the DNA-binding domain of a fusion molecule is capable of binding to cellular chromatin regardless of whether its target site is in an accessible region or not. For example, such DNA-binding domains are capable of binding to linker DNA and/or nucleosomal DNA.
  • the fusion molecule may be formulated with a pharmaceutically acceptable carrier, as is known to those of skill in the art. See, for example,
  • the functional component/domain of a fusion molecule can be selected from any of a variety of different components capable of influencing transcription of a gene once the fusion molecule binds to a target sequence via its DNA binding domain.
  • the functional component can include, but is not limited to, various transcription factor domains, such as activators, repressors, co-activators, co- repressors, and silencers.
  • Functional domains that are regulated by exogenous small molecules or ligands may also be selected.
  • RheoSwitch® technology may be employed wherein a functional domain only assumes its active conformation in the presence of the external RheoChemTM ligand ⁇ see for example US 20090136465).
  • the ZFP or TALE may be operably linked to the regulatable functional domain wherein the resultant activity of the ZFP-TF or TALE-TF is controlled by the external ligand.
  • nucleases such as ZFNs, TALENs, homing endonucleases, CRISPR/Cas and/or Ttago RNA-guided systems, that are useful for in vivo for genetic modification, including insertions and/or deletions made following cleavage of a target by the nuclease(s).
  • the fusion protein comprises a DNA-binding binding domain and cleavage (nuclease) domain.
  • gene modification can be achieved using a nuclease, for example an engineered nuclease.
  • Engineered nuclease technology is based on the engineering of naturally occurring DNA-binding proteins. For example, engineering of homing endonucleases with tailored DNA-binding specificities has been described, ⁇ see, Chames et al.
  • ZFPs and TALEs have been fused to nuclease domains to create ZFNs and TALENs -functional entities that are able to recognize their intended nucleic acid target through their engineered (ZFP or TALE) DNA binding domains and cause the DNA to be cut near the ZFP or TALE DNA binding site via the nuclease activity.
  • ZFP or TALE engineered DNA binding domains
  • Nuclease e.g., ZFNs, TALENs, CRISPR/Cas and/or Ttago systems
  • nucleases include CRISPR/Cas and/or Ttago systems, meganucleases, TALENs and zinc finger nucleases.
  • the nuclease may comprise heterologous DNA-binding and cleavage domains (e.g., zinc finger nucleases; TALENs; meganuclease DNA-binding domains with heterologous cleavage domains) or, alternatively, the DNA-binding domain of a naturally-occurring nuclease may be altered to bind to a selected target site (e.g., a meganuclease that has been engineered to bind to site different than the cognate binding site).
  • a selected target site e.g., a meganuclease that has been engineered to bind to site different than the cognate binding site.
  • the nuclease is a meganuclease (homing endonuclease).
  • Naturally-occurring meganucleases recognize 15-40 base-pair cleavage sites and are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family and the HNH family.
  • Exemplary homing endonucleases include l-Scel, l-Ceul, Fl-Pspl, Fl-Sce, l-SceTV, I- Csml, l-Panl, l-Scell, l-Ppol, l-Scelll, l-Crel, l-Tevl, l-Tevll and l-Tevlll.
  • Their recognition sequences are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al.
  • DNA-binding domains from naturally-occurring meganucleases primarily from the LAGLIDADG family, have been used to promote site-specific genome modification in plants, yeast, Drosophila, mammalian cells and mice, but this approach has been limited to the modification of either homologous genes that conserve the meganuclease recognition sequence (Monet et al. (1999), Biochem. Biophysics. Res. Common. 255: 88-93) or to pre-engineered genomes into which a recognition sequence has been introduced (Route et al. (1994), Mol. Cell. Biol.
  • the nuclease is a zinc finger nuclease (ZFN).
  • ZFNs comprise a zinc finger protein that has been engineered to bind to a target site in a gene of choice and cleavage domain or a cleavage half-domain.
  • zinc finger binding domains can be engineered to bind to a sequence of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416.
  • An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein.
  • Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co- owned U.S. Patents 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
  • Exemplary selection methods including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186;
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length (e.g., TGEKP (SEQ ID NO: 135), TGGQRP (SEQ ID NO: 136), TGQKP (SEQ ID NO: 137), and/or TGSQKP (SEQ ID NO: 138)).
  • linkers of 5 or more amino acids in length e.g., TGEKP (SEQ ID NO: 135), TGGQRP (SEQ ID NO: 136), TGQKP (SEQ ID NO: 137), and/or TGSQKP (SEQ ID NO: 138)
  • linkers of 5 or more amino acids in length e.g., TGEKP (SEQ ID NO: 135), TGGQRP (SEQ ID NO: 136), TGQKP (SEQ ID NO: 137), and/or TGSQKP (SEQ ID NO: 138
  • linker sequences 6 or more amino acids in length may include any combination of suitable linkers between the individual zinc fingers of the protein. See, also, U.S. Provisional Patent Publication No. 20110287512.
  • the CRISPR (Clustered Regularly Interspaced Short Palindromic
  • CRISPR Associated nuclease system is a recently engineered nuclease system based on a bacterial system that can be used for genome engineering. It is based on part of the adaptive immune response of many bacteria and archea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNAs (crRNA) by the 'immune' response.
  • crRNA CRISPR RNAs
  • This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a "protospacer.”
  • Cas9 cleaves the DNA to generate blunt ends at the DSB at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript.
  • Cas9 requires both the crRNA and the tracrRNA for site specific DNA recognition and cleavage.
  • This system has now been engineered such that the crRNA and tracrRNA can be combined into one molecule (the "single guide RNA"), and the crRNA equivalent portion of the single guide RNA can be engineered to guide the Cas9 nuclease to target any desired sequence (see Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife 2:e00471, and David Segal, (2013) eLife
  • the CRISPR/Cas system can be engineered to create a DSB at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair.
  • the cleavage (nuclease) domain of the nuclease may be heterologous to the DNA-binding domain, for example a zinc finger DNA-binding domain and a cleavage domain from a nuclease or a meganuclease DNA-binding domain and cleavage domain from a different nuclease.
  • Heterologous cleavage domains can be obtained from any endonuclease or exonuclease.
  • Exemplary endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases.
  • a cleavage half-domain can be derived from any nuclease or portion thereof, as set forth above, that requires dimerization for cleavage activity.
  • two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains.
  • a single protein comprising two cleavage half- domains can be used.
  • the two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof).
  • the target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to each other that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerizing.
  • the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides.
  • any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more).
  • the site of cleavage lies between the target sites.
  • Restriction endonucleases are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding.
  • Certain restriction enzymes e.g., Type IIS
  • Fok I catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, US Patents 5,356,802; 5,436,150 and 5,487,994; as well as Li et al.
  • fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered.
  • Fok I An exemplary Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is Fok I. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575.
  • the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain.
  • two fusion proteins each comprising a Fokl cleavage half-domain, can be used to reconstitute a catalytically active cleavage domain.
  • a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage half-domains can also be used. Parameters for targeted cleavage and targeted sequence alteration using zinc finger- or ⁇ -Fok I fusions are provided elsewhere in this disclosure.
  • a cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity, or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
  • Exemplary Type IIS restriction enzymes are described in International Publication WO 07/014275, incorporated herein in its entirety. Additional restriction enzymes also contain separable binding and cleavage domains, and these are contemplated by the present disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31:418-420.
  • the cleavage domain comprises one or more engineered cleavage half-domain (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Nos. 8,772,453; 8,623,618; 8,409,861; 8,034,598; 7,914,796; and 7,888,121, the disclosures of all of which are incorporated by reference in their entireties herein.
  • engineered cleavage half-domain also referred to as dimerization domain mutants
  • exemplary engineered cleavage half-domains of Fok I that form obligate heterodimers include a pair in which a first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of Fok I and a second cleavage half-domain includes mutations at amino acid residues 486 and 499.
  • a mutation at 490 replaces Glu (E) with Lys
  • the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E ⁇ K) and 538 (I ⁇ K) in one cleavage half-domain to produce an engineered cleavage half-domain designated "E490K:I538K” and by mutating positions 486 (Q ⁇ E) and 499 (I ⁇ L) in another cleavage half-domain to produce an engineered cleavage half-domain designated "Q486E:I499L".
  • the engineered cleavage half-domains described herein are obligate heterodimer mutants in which aberrant cleavage is minimized or abolished. See, e.g., U.S. Patent Nos. 7,914,796 and 8,034,598, the disclosures of which are incorporated by reference in their entirety for all purposes.
  • the engineered cleavage half- domain comprises mutations at positions 486, 499 and 496 (numbered relative to wild-type Fokl), for instance mutations that replace the wild type Gin (Q) residue at position 486 with a Glu (E) residue, the wild type Iso (I) residue at position 499 with a Leu (L) residue and the wild-type Asn (N) residue at position 496 with an Asp (D) or Glu (E) residue (also referred to as a "ELD” and "ELE” domains, respectively).
  • the engineered cleavage half-domain comprises mutations at positions 490, 538 and 537 (numbered relative to wild-type Fokl), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue, the wild type Iso (I) residue at position 538 with a Lys (K) residue, and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as "KK " and "KKR” domains, respectively).
  • E wild type Glu
  • I Iso
  • H His
  • R Arg
  • the engineered cleavage half-domain comprises mutations at positions 490 and 537 (numbered relative to wild-type Fokl), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as "KIK” and "KIR” domains, respectively).
  • E wild type Glu
  • K Lys
  • H His
  • R Arg
  • Engineered cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis of wild-type cleavage half-domains (Fok I) as described in U.S. Patent Nos. U.S. Patent Nos. 8,772,453; 8,623,618; 8,409,861; 8,034,598; 7,914,796; and 7,888,121.
  • nucleases may be assembled in vivo at the nucleic acid target site using so-called "split-enzyme” technology (see e.g. U.S. Patent Publication No. 20090068164).
  • split-enzyme e.g. U.S. Patent Publication No. 20090068164.
  • Components of such split enzymes may be expressed either on separate expression constructs, or can be linked in one open reading frame where the individual components are separated, for example, by a self-cleaving 2A peptide or IRES sequence.
  • Components may be individual zinc finger binding domains or domains of a meganuclease nucleic acid binding domain.
  • the DNA binding domain is an engineered domain from a TAL effector similar to those derived from the plant pathogens Xanthomonas (see Boch et al, (2009) Science 326: 1509-1512 and Moscou and Bogdanove, (2009) Science326: 1501) and Ralstonia (see Heuer et al (2007) Applied and Environmental Microbiology 73(13): 4379-4384). Also, see PCT publication WO2010/079430.
  • Nucleases ⁇ e.g., ZFNs or TALENs, etc.
  • Nucleases can be screened for activity prior to use, for example in a yeast-based chromosomal system as described in 8,563,314.
  • Expression of the nuclease may be under the control of a constitutive promoter or an inducible promoter, for example the galactokinase promoter which is activated (de-repressed) in the presence of raffinose and/or galactose and repressed in presence of glucose.
  • proteins e.g., ZFPs, TALEs, CRISPR/Cas, Ttago
  • ZFPs e.g., ZFPs, TALEs, CRISPR/Cas, Ttago
  • polynucleotides encoding same and compositions comprising the proteins and/or polynucleotides described herein may be delivered to a target cell by any suitable means including, for example, by injection of ZFP-TF, TALE-TF proteins or by use of ZFN or TALEN encoding mRNA.
  • suitable cells include but not limited to eukaryotic and prokaryotic cells and/or cell lines.
  • Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO ⁇ e.g., CHO-S, CHO- Kl, CHO-DG44, CHO-DUXBl l, CHO-DUKX, CHOKISV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2/0-Agl4, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells as well as insect cells such as Spodoptera fugiperda (Sf), or fungal cells such as Saccharomyces, Pichia and
  • the cell line is a CHO-Kl, MDCK or HEK293 cell line.
  • Suitable cells also include stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells and mesenchymal stem cells.
  • stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells and mesenchymal stem cells.
  • Zinc finger, TALE or CRISPR/Cas proteins as described herein may also be delivered using vectors containing sequences encoding one or more of the zinc finger, TALE or CRISPR/Cas protein(s).
  • Any vector systems may be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc. See, also, U.S. Patent Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, incorporated by reference herein in their entireties.
  • any of these vectors may comprise one or more zinc finger or TALE protein-encoding sequences.
  • the sequences encoding the ZFPs, TALEs or CRISPR/Cas proteins may be carried on the same vector or on different vectors.
  • each vector may comprise a sequence encoding one or multiple ZFPs, TALEs or CRISPR/Cas systems.
  • nucleic acids encoding engineered ZFPs, TALEs or CRISPR/Cas systems can be used to introduce nucleic acids encoding engineered ZFPs, TALEs or CRISPR/Cas systems in cells ⁇ e.g., mammalian cells) and target tissues. Such methods can also be used to administer nucleic acids encoding ZFPs, TALEs or a CRISPR/Cas system to cells in vitro. In certain embodiments, nucleic acids encoding the ZFPs, TALEs or CRISPR/Cas system are administered for in vivo or ex vivo gene therapy uses.
  • Non- viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • TIBTECH 11 167- 175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and
  • Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, naked RNA, artificial virions, and agent-enhanced uptake of DNA.
  • Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.
  • one or more nucleic acids are delivered as mRNA.
  • capped mRNAs to increase translational efficiency and/or mRNA stability.
  • ARCA anti-reverse cap analog
  • nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc., (see for example US6008336).
  • Lipofection is described in e.g., U.S. Patent Nos. 5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM and LipofectamineTM
  • RNAiMAX RNAiMAX
  • Cationic and neutral lipids that are suitable for efficient receptor- recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • lipid:nucleic acid complexes including targeted liposomes such as immunolipid complexes
  • Boese et al. Cancer Gene Ther. 2:291-297 (1995); Behr et al, Bioconjugate Chem. 5:382-389 (1994); Remy et al, Bioconjugate Chem. 5:647-654 (1994); Gao et al, Gene Therapy 2:710-722 (1995); Ahmad et al, Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
  • Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (see MacDiarmid et al (2009) Nature Biotechnology 27(7):643).
  • EDVs EnGeneIC delivery vehicles
  • RNA or DNA viral based systems for the delivery of nucleic acids encoding engineered ZFPs, TALEs or CRISPR/Cas systems take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Viral vectors can be
  • Conventional viral based systems for the delivery of ZFPs, TALEs or CRISPR/Cas systems include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cz ' s-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum czs-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
  • Widely used retroviral vectors include those based upon mouse leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al, J. Virol. 66:2731-2739 (1992); Johann et al, J. Virol. 66: 1635-1640 (1992); Sommerfelt et al, Virol. 176:58-59 (1990); Wilson et al, J. Virol. 63:2374-2378 (1989); Miller et al, J. Virol. 65:2220- 2224 (1991); PCT/US94/05700).
  • MiLV mouse leukemia virus
  • GaLV gibbon ape leukemia virus
  • SIV Simian Immunodeficiency virus
  • HAV human immunodeficiency virus
  • Adenoviral based systems can be used.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
  • Adeno-associated virus (“AAV”) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures ⁇ see, e.g., West et al, Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994);
  • At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
  • pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al, Blood 85:3048-305 (1995); Kohn et al, Nat. Med. 1 : 1017-102 (1995); Malech et al, PNAS 94:22 12133-12138 (1997)).
  • PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al, Science 270:475-480 (1995)). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al, Immunol Immunother. 44(l): 10-20 (1997); Dranoff et al, Hum. Gene Ther. 1 : 111-2 (1997).
  • rAAV Recombinant adeno-associated virus vectors
  • All vectors are derived from a plasmid that retains only the AAV 145 base pair inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system.
  • AAV serotypes including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8AAV 8.2, AAV9, and AAV rhlO and pseudotyped AAV such as AAV2/8, AAV2/5 and AAV2/6 can also be used in accordance with the present invention.
  • Ad Replication-deficient recombinant adenoviral vectors
  • Ad can be produced at high titer and readily infect a number of different cell types.
  • Most adenovirus vectors are engineered such that a transgene replaces the Ad Ela, Elb, and/or E3 genes; subsequently the replication defective vector is propagated in human 293 cells that supply deleted gene function in trans.
  • Ad vectors can transduce multiple types of tissues in vivo, including nondividing, differentiated cells such as those found in liver, kidney and muscle. Conventional Ad vectors have a large carrying capacity.
  • Ad vector An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Sterman et al, Hum. Gene Ther. 7: 1083-9 (1998)). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al, Infection 24: 1 5-10 (1996); Sterman et al, Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al, Hum. Gene Ther. 2:205-18 (1995); Alvarez et al, Hum. Gene Ther. 5:597-613 (1997); Topf et al, Gene Ther. 5:507-513 (1998); Sterman et al, Hum. Gene Ther. 7: 1083-1089 (1998).
  • Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line.
  • AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
  • ITR inverted terminal repeat
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
  • the gene therapy vector be delivered with a high degree of specificity to a particular tissue type.
  • a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.
  • the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest.
  • Han et al., Proc. Natl. Acad. Sci. USA 92:9747- 9751 (1995) reported that Moloney mouse leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
  • filamentous phage can be engineered to display antibody fragments ⁇ e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
  • Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration ⁇ e.g., intravenous,
  • vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient ⁇ e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
  • cells ex vivo such as cells explanted from an individual patient ⁇ e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
  • cells are isolated from the subject organism, transfected with a ZFP, TALE or CRISPR/Cas system nucleic acid (gene. cDNA or mRNA), and re -infused back into the subject organism ⁇ e.g., patient).
  • a ZFP ZFP
  • TALE CRISPR/Cas system nucleic acid
  • one or more nucleic acids are delivered as mRNA.
  • capped mRNAs to increase translational efficiency and/or mRNA stability.
  • ARCA anti-reverse cap analog
  • stem cells are used in ex vivo procedures for cell transfection and gene therapy.
  • the advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow.
  • Methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN- ⁇ and TNF-a are known (see Inaba et al, J. Exp. Med. 176: 1693-1702 (1992)).
  • Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells) (see Inaba et al, J. Exp. Med. 176: 1693-1702 (1992)).
  • T cells CD4+ and CD8+
  • CD45+ panB cells
  • GR-1 granulocytes
  • lad differentiated antigen presenting cells
  • Stem cells that have been modified may also be used in some embodiments.
  • neuronal stem cells that have been made resistant to apoptosis may be used as therapeutic compositions where the stem cells also contain the ZFP TFs of the invention. Resistance to apoptosis may come about, for example, by knocking out BAX and/or BAK using BAX- or BAK-specific TALENs or ZFNs (see, U.S. Patent Publication No. 20100003756) in the stem cells, or those that are disrupted in a caspase, again using caspase-6 specific ZFNs for example. These cells can be transfected with the ZFP TFs or TALE TFs that are known to regulate mutant or wild-type Htt.
  • Vectors e.g., retroviruses, adenoviruses, liposomes, etc.
  • therapeutic ZFP nucleic acids can also be administered directly to an organism for transduction of cells in vivo.
  • naked DNA can be administered.
  • Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • Methods for introduction of DNA into hematopoietic stem cells are disclosed, for example, in U.S. Patent No. 5,928,638.
  • Vectors useful for introduction of transgenes into hematopoietic stem cells include adenovirus Type 35.
  • T-cells include non-integrating lentivirus vectors. See, for example, Ory et al. (1996) Proc. Natl. Acad. Sci. USA 93: 11382-11388; Dull et al. (1998) J. Virol. 72:8463- 8471; Zuffery et a/. (1998) J. Virol. 72:9873-9880; Follenzi et al. (2000) Nature Genetics 25:217-222.
  • compositions are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below ⁇ see, e.g., Remington 's Pharmaceutical Sciences, 17th ed., 1989).
  • the disclosed methods and compositions can be used in any type of cell including, but not limited to, prokaryotic cells, fungal cells, Archaeal cells, plant cells, insect cells, animal cells, vertebrate cells, mammalian cells and human cells.
  • Suitable cell lines for protein expression are known to those of skill in the art and include, but are not limited to COS, CHO ⁇ e.g.
  • compositions and methods can be used for any application in which it is desired to modulate the Htt allele, including but not limited to, therapeutic and research applications.
  • Htt repressing ZFP TFs or TALE TFs can be used as therapeutic agents include, but are not limited to, Huntington's disease. Additionally, methods and compositions comprising ZFNs or TALENs specific for mutant alleles of Htt can be used as a therapeutic for the treatment of Huntington's disease.
  • ZFP -TFs or TALE TFs that repress a HD Htt allele may also be used in conjunction with ZFP-TFs or TALE-TFs that activate neutrotrophic factors including, but not limited to, GDNF and BDNF.
  • ZFPs or TALEs or polynucleotides encoding these ZFPs or TALEs
  • Methods and compositions for the treatment of Huntington's disease also include stem cell compositions wherein a mutant copy of the Htt allele within the stem cells has been modified to a wild-type Htt allele using a Htt-specific ZFN or TALEN.
  • the methods and compositions of the invention are also useful for the design and implementation of in vitro and in vivo models, for example, animal models of trinucleotide repeat disorders, which allows for the study of these disorders.
  • suitable in vitro models include cells or cell lines from any organism, including fibroblasts.
  • suitable animals for use as animal models include, invertebrates (C. elegans, drosophila), rodents ⁇ e.g., rat or mouse), primates ⁇ e.g., non-human primates).
  • compositions described herein ⁇ e.g., proteins and/or
  • polynucleotides alone or in combination with other suitable components ⁇ e.g.
  • liposomes, nanoparticles or other components known in the art can be made into aerosol formulations ⁇ i.e., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • Compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally.
  • the formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
  • Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the dose administered to a patient should be sufficient to effect a beneficial therapeutic response in the patient over time.
  • the dose is determined by the efficacy and 3 ⁇ 4 of the particular Htt-binding molecule employed, the target cell, and the condition of the patient, as well as the body weight or surface area of the patient to be treated.
  • the size of the dose also is determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular compound or vector in a particular patient
  • Example 1 Design and Construction of Htt-targeted zinc finger protein transcription factors (ZFP-TFs) and ZFNs
  • Zinc finger proteins targeted to Htt were engineered essentially as described in U.S. Patent No. 6,534,261.
  • Tables 1A and IB show the recognition helices of the DNA binding domain of exemplary Htt-targeted ZFPs, while Tables 2A and 2B show the target sequences of these ZFPs.
  • ZFPs with one contiguous array of zinc fingers were designed to target sites completely within the CAG repeat region ( Figure IB). Such ZFPs may bind longer, mutant tracts with higher affinity and/or a higher net occupancy, achieving selective repression of the mutant allele. ZFNs were also designed that targeted sites which lay partially or wholly outside of the CAG region ( Figure 1 A), and which will therefore bind to the wild type and mutant allele equally, and regulate expression from both alleles with similar efficiency.
  • a set of one- and two-finger modules can be employed in a 'mix and match' combination. Those modules are shown below in Table 2C.
  • Table 2C Zinc finger recognition helices used in ZFP-TFs targeting CAG
  • Multimerizing ZFP TFs are also constructed as described above except that the vector also contains sequences encoding 1 or more protein interaction domains (also called dimerization or protein interaction domains) that enable multimerization of the expressed protein along a tract of trinucleotide repeats that is operably linked to the sequences encoding the ZFP TF.
  • Table 3 shows dimerization domain designs that are used with ZFPs targeted to the CAG repeat region.
  • Figure IOC shows protein sequences of the four ZFP monomer scaffolds that are designed to multimerize via interactions between dimerizing zinc fingers (DZ), DZ1 - DZ4. Designs are based on work described in Mol. Syst. Biol. (2006) 2:2006.2011.
  • Figure 10D shows protein sequences of the seven ZFP monomer scaffolds that are designed to multimerize via interactions between coiled-coils (CC), CC1 - CC7.
  • CC#1 coiled-coils
  • CC#2 CC#3 and CC#4 are based on (J. Am. Chem. Soc. (2000), 122:5658-5659).
  • CC and DZ domains allow the ZFP to polymerize within the major groove of a CAG tract (depicted in figure 10B). By choosing a finger array and dimerization domains with appropriate binding properties, efficient binding will occur only to the expanded CAG tract of a disease allele.
  • ZFP -TFs were constructed as fusion proteins comprising a nuclear localization sequence, the engineered zinc finger DNA-binding domain (Tables 1 A and IB), targeted to the Htt allele, and a KRAB repression domain from the human KOX1 protein. See, Fig 1A, IB and ID.
  • the designed DNA-binding domains contain 3-6 finger modules, recognizing 9-18 base pair sequences (Tables 2A and 2B). Nucleotides in the target site that are contacted by the ZFP recognition helices are indicated in uppercase letters; non-contacted nucleotides indicated in lowercase.
  • ZFP-ZFP-TF molecules were also constructed where two ZFP DNA binding domains were fused with a flexible linker and fused to a KRAB repression domain ( Figure IE). DNA binding domains were chosen from Tables 2A and 2B.
  • Example 2 Repression of both alleles of Htt in human and mouse cells.
  • ZFPs were designed to bind to the Htt promoter and exon 1 region, wherein the target site was not entirely within the CAG repeat. See, Figure 1 A.
  • the ZFP TFs were transfected into human cells and expression of Htt was monitored using real-time RT-PCR.
  • Human HEK293 cells (Graham et al (1977) J Gen Virol 36 :59-74) were cultured in DMEM supplemented with 10% FBS and le 5 cells were transfected with 1 ⁇ g of plasmid DNA encoding indicated ZFP-KOX fusions by Amaxa
  • Htt endogenous human Huntingtin
  • ACTB normalization control beta-actin
  • Htt-targeted ZFPs repressed Htt expression.
  • Western blot analyses were done using standard protocols to confirm the reduction in Htt protein level (Figure 2B); p65 protein was used as loading control.
  • Lipofectamine® 2000 kit (Invitrogen) according to manufacturer's protocols. mHtt and ACTB mRNA levels were measured at 48 hours after transfection using ABI Taqman® primer/probe set Mm01213820 ml and 4352933E, respectively.
  • mHtt/ ACTB ratios for ZFP transfected samples were normalized to that of the GFP control (set as 1).
  • mouse Htt-specific ZFP-TF repressors can repress mouse Htt in
  • mRNA for indicated ZFPs were generated using the mMessage mMachine kit (Ambion), and 0.1, 0.5 or 2 ⁇ g of these mRNAs were transfected using Amaxa nucleofector as described above. Cells were harvested 48 hours after transfection for mHtt and ACTB expression analysis as described above. More significant repression in the striatal cells compared to that in Neuro2A cells was observed and may be a result of enhanced transfection efficiency achieved via mRNA transfection in striatal cells.
  • ZFPs were designed to bind within the CAG repeat.
  • Figure IB shows one type of such ZFPs, with a contiguous array of zinc fingers linked to a repression domain ⁇ e.g. the KRAB domain from KOX1); these ZFPs can be designed with appropriate affinity such that threshold occupancy required from transcriptional repression can only be established on expanded CAG repeats.
  • Figures 1C, ID and IE show three other examples of ZFP design that can allow specific binding to the expanded CAG repeats.
  • ZFPs designed as illustrated in Figure IB were introduced into
  • Htt human Huntingtin
  • ACTB internal control beta-actin
  • FIG. 3A ZFP repressors (fused with KRAB repression domain) designed to bind to CAG repeats (Figure IB), either to top or bottom strand, in HEK293 cells, effectively repressed Htt expression.
  • Figure 3 A depicts repressors of transcription where expression was measure in duplicate transfections (separate bars in the Figure) and multiple real-time PCR assays completed (error bars).
  • promoter/exon 1 fragment that contains different CAG repeat lengths were constructed.
  • the human Htt promoter/exon 1 fragment was amplified from HEK293 genomic DNA using forward primer:
  • the forward primer introduces a Bglll site
  • the reverse primer changes the first ATG of Htt into TAG and creates an Avrll site, and also includes a Hindlll site.
  • the PCR product was digested with Bglll and Hindlll and li gated to pRL-TK vector (Promega) that was digested with the same enzymes to generate the construct pRL-Htt.
  • the human Htt exonl fragment (coding sequence minus first ATG) was amplified from HEK293 genomic DNA or genomic DNA from HD patients with expanded CAG repeats using forward primer: 5' GCCTAGGCGACCCTGGAAAAGCTGATGAAGGCC (SEQ ID NO: 141) and reverse primer: 5'
  • the forward primer introduces an Avrll site
  • the reverse primer introduces a Hindlll site.
  • the PCR product was digested with Avrll and Hindlll and ligated to pRL-Htt vector that was digested with the same enzymes. Clones with 10, 17, 23 or 47 CAG repeats (pRL-Htt-CAG(x)) were identified by sequencing.
  • Firefly (pGL reporter) and renilla (pRL reporter) luciferase activities were measured 24 hours after transfection. Renilla luciferase levels were normalized to those of firefly luciferase from the same transfected sample, and further normalized to the renilla/firefly ratio of the "reporter only" sample.
  • TF 30640 increases with the length of the CAG repeat, suggesting that ZFPs with DNA binding affinities similar to that of 30640 can repress Htt promoter activity via an expanded CAG repeat, and the level of repression is dependent on the CAG repeat lengths.
  • FIG. 3C shows a similar experiment as in Figure 3B, except the
  • FIG. 3D shows ZFP-TFs 30640 and 30657 (fused to the KRAB repression domain of KOX1) can repress the knock-in Htt allele (CAG111) in immortalized striatal cells derived from the Hdh(Ql 11/Q7) knock-in mice, demonstrating the ZFPs such as 30640, which drives CAG repeat length-dependent repression of luciferase reporters, can also repress expression from an endogenous Htt allele that has expanded CAG repeat.
  • mR A for indicated ZFPs were generated using the mMessage mMachine kit (Ambion), and transfected into Hdh(Ql 11/Q7) cells at indicated doses using Amaxa nucleofector.
  • forward primer CAGGTCCGGCAGAGGAACC SEQ ID NO: 193
  • reverse primer TTCACACGGTCTTTCTTGGTGG SEQ ID NO: 194
  • forward primer GCCCGGCTGTGGCTGA SEQ ID NO: 195
  • reverse primer TTCACACGGTCTTTCTTGGTGG SEQ ID NO: 196
  • Figure 3E show the result of testing the ZFP-TFs 30640 and 30657 in an HD patient-derived fibroblast line (GM21756, Coriell) that has 15 and 70 CAGs on the normal and mutant Htt allele, respectively.
  • a SNP -based allele-specific real-time PCR assay was first established to allow specific detection from the wild type or the mutant Htt allele. The phasing of the SNP (rs363099 T/C) was determined by Carroll et al. (Mol Ther. (2011) 19:2178-85); "T” is on the normal allele and "C” is on the mutant allele.
  • cDNA from the fibroblast was amplified by real-time PCR (SsoFast EvaGreen Supermix, Bio-Rad) using forward primer 099C.F (5 'AGTTTGGAGGGTTTCTC, SEQ ID NO: 143) and reverse primer 099.R5 (5' TCGACTAAAGCAGGATTTCAGG, SEQ ID NO: 144); the annealing/extension temperature was 55.6 °C.
  • real-time PCR of the fibroblast cDNA were done using forward primer 099T.F (5'AGTTTGGAGGGTTTCTT, SEQ ID NO: 145), reverse primer 099. R5 and the 3'phosphorylated blocker oligo 099T.BL
  • mRNA for indicated ZFPs were generated using the mMessage mMachine kit (Ambion), 1 ⁇ g of mRNA was transfected using Amaxa nucleofector as above. Cells were harvested 48 hours after transfection; mRNA levels from the normal (CAG15, 099T),the mutant (CAG70, 099C) Htt allele and total Htt (hHtt) were quantified as described above and normalized to the levels of ACTB; the Htt/ACTB ratios for each sample was further normalized to that of the mock-transfected sample.
  • ZFP 30657 repressed both alleles, as expected (based on its activity in HEK293 cells Fig.3A).
  • ZFP 30640 which showed CAG repeat length-dependent repression of the reporters, gave ⁇ 10% repression of the wild-type allele while repressed the mutant allele >90%.
  • the levels of total Htt in each sample were consistent with those of wild type (wt) and mutant Htt levels in the same sample.
  • ZFP-30640 was also tested in a normal fibroblast line as well as other HD fibroblast lines that contain different CAG repeat length in the Htt gene (see Figure 3F). Htt expression from each allele was detected as described above. No Htt repression was observed in the normal fibroblast line (CAG 18/ 18).
  • ZFPs such as 30640 selectively down-regulated mutant Htt protein levels in two patient-derived fibroblast lines, confirming allele-specific regulation that was shown by qPCR assays (see Figure 3G).
  • ZFPs were delivered by mRNA transfection (Amaxa nucleofection) at a 300 ng dose into 4 replicates of 1.5e5 cells and pooled prior to plating in 12-well plates. At 48 hours, cells were washed and harvested for protein extract preparation. Approximately 2.5 ⁇ g of extract was loaded onto 5% Tris-acetate gels and detected by MAB2166 (Millipore).
  • Example 4 Additional C AG-targeted ZFP designs that drive allele specific repression of Htt.
  • Figure 4A shows the results of testing ZFP-TFs 30640, 30643, 30645 and 33074 (all targeted to the CAG repeat and uses the KRAB repression domain) in a CAG 18/45 HD fibroblast line.
  • Different amounts of ZFP mR A were transfected using Amaxa nucleofector as indicated, expression of the mutant Htt (right bar), wild type Htt (middle bar) and total Htt (both alleles, left bar) were measured as described above at 24 hours after transfection.
  • ZFPs 30640, 30645 and 33074 drive allele- specific repression over the entire 3 ⁇ g - 10 ng ZFP mRNA dose range; while 30643 appears to repress both alleles significantly at doses that are 30 ng or higher, and begins to exhibit allele selectivity at the 10 ng dose.
  • Figure 4B shows the results of testing ZFP 30643, 30648, 30657 and
  • CAG repeat containing genes was analyzed, and the results are depicted in Figure 5.
  • the expression levels of the following genes was examined using real-time PCR and normalized to that of Actin: Ataxin 2 ("ATXN2”); Dynamin (“DNM1 “); F-box only protein 11 (“FBXOH”), nitrate reductase (“NAP”); Origin recognition complex subunit 4 ("ORC4"); phosphokinase ("PHK”); OCT3/4 protein (“POU3”); THAP domain containing, apoptosis associated protein 2 (" ⁇ ”); TATA binding protein (“TBP”); and stanniocalcin 1("STC1").
  • TSS transcriptional start site
  • HD fibroblasts (CAG 18/45) were transfected to study genome -wide specificity of C AG-targeted ZFPs by microarray analysis ( Figure 6).
  • ZFPs were delivered by mR A transfection (Amaxa nucleofection) at the indicated doses - ZFPs 30640, 30645 and 33074 were transfected in sextuplicate at the 75 ng, 15 ng and 15 ng dose, respectively;
  • GFP-Kox mRNA 150 ng was transfected as a control, and was used as carrier to bring the total amount of transfected mRNA to 150 ng in all samples.
  • HGU133plus2.0 HGU133plus2.0 as follows: GFP replicate 1, 3, 4 and 6; 30640 replicate 2, 3, 5 and 6; 30645 replicate 2, 3, 5 and 6; and 33074 replicate 1, 3, 4 and 5 were used for microarray analysis.
  • Robust Multi-array Average (RMA) was used to normalize raw signals from each probe set; ZFP -transfected samples were compared to GFP- transfected samples using T-test; "change" calls were made on genes (probe sets) with >2 fold difference relative to control samples and T-test P-value ⁇ 0.05.
  • HD iPSC/ESCs were passaged with accutase and cultured on matrigel coated plates in E8 media (Life Technologies).
  • Neural stem cells were derived using StemPro Neural Induction Medium (Life Technologies). Briefly, iPSC/ESCs were seeded into geltrex coated 6 well dish with 200,000 cells/well and when 10-20% confluent the medium was changed to StemPro Neural Induction Medium. Medium was changed every 2 days and NSC harvested and expanded on day 7. StemPro NSC SFM medium (Life Technologies) was used to culture NSCs.
  • HD NSCs (CAG 17/69, derived from Coriell GM23225 iPSC) were transfected with 1.5 or 0.5 ⁇ g ZFP mRNA using nucleofection. Forty-eight hours post transfection cells were harvested and expression quantified by RT-PCR. Allele-specific detection of Htt expression was performed using a SNP (rsl 143646)-based genotyping assay #4351376 (Applied Biosystems).
  • Example 8 Htt repression in differentiated HD neurons
  • HD NSCs were passaged with accutase on geltrex coated plates.
  • Neuron differentiation was induced by changing medium to neural differentiation medium containing StemPRO NSC SFM medium without (bFGF and EGF). Medium was changed every 3-4 days for up to 21 days. Neurons were derived from NSC (CAG17/48, derived from HD ESCs) by culture in neural differentiation medium. On day 15 post neural induction cells were transfected with 1.0 or 0.5 ⁇ g ZFP mRNA using nucleofection. Forty-eight hours post transfection cells were harvested and gene expression quantified by RT-PCR. Because this patient line does not contain a SNP that allows qPCR-based allele-specific detection of wt and mutant Htt, only total Htt levels can be measured.
  • Example 9 A CAG targeted repressor represses mutant Htt transgene in R6/2 mice
  • R6/2 mice which carries a transgene of mutant human Htt exon 1 with -120 CAG repeat, see Mangiarini et al, (1996) Cell 15: 197) received stereotactic, bilateral striatal injections of 3el0 vector genome of recombinant AAV2/6 encoding either ZFP 30640-KOX or GFP driven by a CMV promoter. Mice were injected at 5 weeks of age and sacrificed for molecular analysis at 8 weeks of age. Left and right striata were dissected from each hemisphere and snap frozen.
  • the dimerization domains can interact in a "parallel” fashion and yield "head-to-head” or "tail-to-tail” dimers of fusion proteins that contain them.
  • One potential dimerization strategy requires an array of identical ZFP-transcription factor fusions that bind in a "head-to-tail” orientation and thus this strategy requires dimerization domains that interact in an "anti-parallel” fashion. See, e.g., McClain et al. (2001) J. Am. Chem. Soc. 123:3151-3152) and dimerizing zinc finger peptides (Giesecke et al. (2006), Molecular Systems Biology 2:2006.2011).
  • Dimerization constructs CC1 and CC2 were based on pairs of antiparallel coiled coils (McClain et al , ibid, Ghosh et al. (2000) J Am Chem Soc 122:5658-5659). Dimerization constructs CC3 and CC4 were truncated versions of CC2 that lack either 4 residues or 7 residues respectively. Dimerization constructs DZ1, DZ2, DZ3, and DZ4 were based on pairs of dimerizing zinc finger domains (Giesecke et al, ibid).
  • one member of the pair was fused to the N- terminus of the zinc finger DNA binding domain and the other member of the pair was fused to the C-terminus of the zinc finger DNA binding domain.
  • Short linkers rich in glycine and serine residues were used to fuse the dimerization domains to the zinc finger binding domain.
  • Additional embodiments of the invention utilize linkers with alternate lengths and/or amino acid composition. Linkers with one or more residues removed or with one or more glycine or serine residues changes to other amino acid residues will reduce the flexibility of these linkers and may result in improved discrimination between long and short CAG repeats.
  • ZFPs were designed as illustrated in Figure ID and Figure 10A and 4B.
  • Figure IOC and 10D show the sequences of the multimerization domains.
  • Figure 11 A and 1 IB depict the results that experiments designed to measure the ability of the ZFP-TFs comprising the CC and DZ domains, respectively to repress their targets.
  • indicated ZFP constructs 50 ng were co-transfected with pRL-Htt-CAG17 (200ng), pGL3-Htt-CAG47 (200ng) and pVax-SEAP (secreted alkaline phosphatase, 10 ng, used as normalization control) into HEK293 cells.
  • Luciferase activity and secreted alkaline phosphatase activities were measured 24 hours after transfection.
  • the Renilla luciferase (CAG17)/SEAP and firefly luciferase (CAG47)/SEAP ratios for each sample were normalized to those of the reporter-only samples.
  • the pGL3-Htt- CAG47 reporter was constructed in the same way as the pRL-Htt-CAG47 reporter (see Example 3), except the pGL-promoter construct (Promega) was used instead of the pPvL-TK construct.
  • ZFP TFs were tested in HD fibroblasts that were of the ZFP-ZFP-KOX design.
  • the two ZFP DNA binding domains were linked together with a flexible linker (LRQKDAARGS AAMAERPFQ, SEQ ID NO: 179) and fused to a KOX repression domain.
  • the linker was placed between the conserved histidines and cysteines.
  • the proteins were tested as described above using ZFP mRNA at indicated doses.
  • ZFPs as described herein were also evaluated for their ability to activate Htt expression.
  • ZFPs targeted to the +200 to +467 base pairs region (relative to the transcription start site) of mouse Htt were fused to the transcriptional activation domain of NFKB p65 subunit. This targeting region was chosen because this fragment was replaced by the corresponding sequence (majority of exon 1 and some intron 1 sequence) from human Htt in various knock-in mouse models of HD
  • ZFPs targeted to this region can selectively activate the wild type allele in those animals but not the knock-in allele.
  • ZFPs were transfected into Neuro2A cells (both Htt alleles are wild type in these cells), mouse Htt and ACTB mR A levels were measured as described in Example 2 (duplicate transfections and multiple assays).
  • FIG. 13C The generation of the knock-in Htt allele is illustrated in Figure 13C; sequence alignment ( Figure 13D) shows divergence between the mouse sequence that was replaced and the corresponding human sequence.
  • Figure 13E shows that when such ZFP activators were transfected into immortalized striatal cells derived from HdhQl 11/Q7 knock-in mice, only the wild type Htt was selectively activated.
  • AAV2 vectors encoding the ZFPs are produced. These AAV2 based constructs are then delivered to the brains of mice.
  • AAV vectors are delivered to R6/2 mice or BAC HD mice (C57B1/6 or FVB/N strains) to assess the repression of the human transgene, as well as change in HD-like phenotypes.
  • AAV vectors are delivered to wild-type mice (C57B1/6 or FVB/N) or human Htt knock-in mice (HdhQl 11/Q7, HdhQ140/Q7 or HdhQl 75/Q7) to assess the activation or repression of the endogenous mouse Htt expression.
  • AAV vectors are delivered to R6/2 mice or human Htt knock-in mice (HdhQl 11/Q7, HdhQ140/Q7 or HdhQ175/Q7) to examine the selective repression of wt vs.
  • Htt allele Following sacrifice, brain tissues are analyzed for Htt expression by Taqman real-time RT-PCR, and demonstrate that the Htt genes are modulated by ZFP-TFs.
  • the transgenic mouse line R6/2 is a well-characterized animal model of HD in which a human Htt promoter and exon 1 fragment that contains an expanded CAG repeat is ectopically expressed (Mangiarini et al. (1996) Cell 87, 493-506). These mice exhibit HD-like phenotypic behavioral changes as well as loss of striatal medium spiny neurons (MSNs), which is a hallmark of HD. Consistent with MSN degeneration, reduced expression of MSN markers DARPP-32 (Bibb et al. 2000, Proc. Natl. Acad. Sci. 97(12):6809-6814), phosphodiesterase 10a (PDElOa) (Hebb et al.
  • AAV6-33074 (i.e., AAV6 comprising the genetic repressor) was bilaterally delivered into the striatum of 5 -week old R6/2 mice using stereotaxic injection. Each striatum received AAV injections at two sites, the coordinates for the anterior and posterior infusion was A/P +1.4, M/L +/-1.7, D/V -3.5 and A/P +0.2, M/L +/-2.3, D/V -3.2, respectively.
  • the anterior site received 5 ⁇ of AAV vector and the posterior site received 4 ⁇ of vector.
  • the titer of the AAV6-33074 vector was 1x10 13 vector genome/ml.
  • Control animals received same dose of AAV6-GFP (i.e., AAV6 comprising green fluorescent protein) to the same locations in the striatum.
  • AAV6-33074-treated R6/2 mice displayed reduced frequency of clasping between 7 and 12 weeks of age (when the animals were sacrificed for expression analysis); the reduction was statistically significant (chi- square analysis, p ⁇ 0.05) at 9 and 12 weeks of age (Figure 17). This result
  • Neurodegeneration 3 17.
  • the primer/probe sets for mouse DARPP-32, PDElOa, Dopamine Receptor Dl, Dopamine Receptor D2, Atp5b, Eif a2 and UbC were purchased from IDT; the primer/probe for mouse Htt was purchased from Life Technologies, and the primer/probe for mutant Htt transgene was as described in Benn et al, ibid.
  • the sequences of primer/probe sets are listed in Table 3. Real-time PCR assays were performed using SsoFast Probes Supermix (Bio-Rad) in 384-well plate format on CFX-384 real-time PCR instrument (Bio-Rad) as per manufacture's instruction.
  • Expression analysis was done using CFX manager software (v3.0). In brief, the expression level of each gene of interest and normalization gene was assayed in triplicate reactions and quantified using standard curves spanning a 125- fold concentration range (five-fold dilution series). The expression level of each gene of interest was normalized to the average levels of the three normalization genes from the same sample (gene of interest/normalization gene ratio); this ratio for each sample was then scaled to that of the mean of all the AAV-GFP -treated samples (set as 1) and plotted. Statistical significance was assessed using a two-tailed Student's T-test.
  • Primer 1 CAT TCT CTA TGG TGT CAC TGG G (SEQ ID NO:227)
  • Primer 2 AAC ATC CAG AAA GAG TCC ACC (SEQ ID NO:228)
  • Example 14 Co-transfection of a neurotrophic factor and a HD Htt allele-specific ZFP TF
  • the ZFP TF specific for brain TFs-specific for a brain neurotrophic factor.
  • the ZFP TF specific for brain TFs-specific for brain neurotrophic factor.
  • neurotrophic factors used are specific for either GDNF or BDNF.
  • ZFNs targeting human Htt and mouse Htt were designed to target the sequences flanking the CAG repeats, sequences near the first coding ATG, the stop codon, as well as in early exons. ZFNs were designed and incorporated into plasmids or adenoviral vectors essentially as described in Urnov et al. (2005) Nature
  • K562 cells were obtained from the American Type Culture Collection and grown as recommended in F-12 medium (Invitrogen) supplemented with 10% qualified fetal calf serum (FCS, Cyclone). Cells were disassociated from plastic ware using TrypLE SelectTM protease (Invitrogen). For transfection, one million K562 cells were mixed with 2 ⁇ g of the zinc-finger nuclease plasmid and ⁇ Amaxa Solution T. Cells were transfected in an Amaxa Nucleofector IITM using program U-23 and recovered into 1.4mL warm F- 12 medium + 10% FCS.
  • FCS fetal calf serum
  • Genomic DNA was harvested and a portion of the Htt locus encompassing the intended cleavage site was PCR amplified. PCR using the
  • Accuprime HiFi polymerase from InVitrogen was performed as follows: after an initial 3 minute denaturation at 94°C, 30 cycles of PCR are performed with a 30 second denaturation step at 94°C followed by a 30 second annealing step at 58°C followed by a 30 second extension step at 68°C. After the completion of 30 cycles, the reaction was incubated at 68°C for 7 minutes, then at 10°C indefinitely.
  • Plasmids encoding the pairs of mouse Htt-specific ZFNs were tested in similar fashion in Neuro-2a cells.
  • Figure 14A and B show that the ZFNs were capable of targeting the
  • Htt genes with a gene modification efficiency of between 8-40%>, assayed as described previously by the amount of indels observed.
  • Example 17 Targeted integration of varying lengths of trinucleotide repeats
  • Htt-specific ZFNs with the greatest cleaving activity for sequences flanking the CAG repeat as described above are used in a targeted integration strategy to introduce varying lengths of CAG repeat into a wild-type copy of Htt.
  • Donors are constructed that contain 50, 80, 109 and 180 repeat CAG units. These donors are then transfected into K562 cells with plasmids encoding the Htt-specific ZFNs as described above. Verification of donor integration is achieved by genomic DNA isolation, PCR amplification (as described above) followed by sequencing of the region of interest.
  • ZFNs that cleave in early exons can result in small insertion or deletions (in-dels) as a result non-homologous end joining (NHEJ), this can generate cell models with one or both alleles of Htt disrupted.
  • Indicated ZFN pairs were prepared as described above and tested for cleavage activity using the Cel I mismatch as described for Example 8. These ZFN pairs target early exons of human Htt, and thus may be used to knock-out either the wild-type or a mutant Htt allele.
  • Example 19 Expression tagging of wild-type and HD Htt alleles.
  • ZFNs with the greatest cleaving activity for the first or last coding exon are used to tag the wild-type and mutant Htt allele with different reporter proteins.
  • Donor DNAs for each reporter (A and B) are designed based on the cleavage site of the lead ZFN pair(s) to allow targeted integration of the reporter gene to produce an in- frame fusion to Htt.
  • Donor DNAs are co-transfected with the lead ZFN pair(s) into K562 cells for selecting the donor DNA construct that gives the highest frequency of integration.
  • ZFN pairs were prepared as described above and tested for cleavage activity using the Cel I mismatch as described for Example 8.
  • the ZFN pairs used target the 3 ' end of the Htt coding sequence, and thus may be used to target either a wild-type or a mutant Htt allele.
  • ZFP pairs 25917/25916, 25920/25921 and 25923/25922 were capable of cleaving the Htt gene and can thus be utilized for the introduction of a reporter tag.
  • the selected donor DNA construct for reporter A along with corresponding ZFNs are delivered to cells derived from subjects carrying mutant Htt gene (e.g. fibroblasts, induced pluripotent cells)
  • Clones are derived and screened for the target integration of the reporter A. Heterozygous events are desired and the targeted alleles are identified by PCR. Clones containing a single reporter-tagged Htt allele and unmodified ZFN target sequence on the other allele are selected; the donor construct for reporter B and corresponding ZFNs are transfected to tag the second allele with the reporter B.
  • the resulting mouse embryonic stem cell clone contains the wild-type
  • TALE DNA binding domains were linked to the KRAB repression domain from the Koxl protein (TALE TF) and used to test repression of the Htt gene in HD patient (CAG 20/41)-derived fibroblasts.
  • TALE TF Koxl protein
  • the construction of the TALE proteins was done as described previously (see U.S. Patent No. 8,586,526 and U.S. Patent Publication No. 20130196373, both of which are incorporated herein by reference), and were constructed with three different C-terminal architectures: +63, +231 and +278 as described in U.S. Patent No. 8,586,526.
  • To construct the TALE TF expression plasmids the TALEN expression plasmids described previously (see U.S. Patent No.
  • TALE code NI for A, HD for C, NN for G (NK in half repeat), NG for T.
  • the protein is designed to bind the sense (5 '-3') strand of the DNA, while in others, the TALE TF is designed to bind to the anti-sense (3 '-5') strand.
  • This set of TALE TFs was designed to target the CAG repeats of the Htt gene.
  • TALE DNA binding proteins often preferentially interact with a 'T' nucleotide base at the 5' end of the target, and so since the targets are CAG repeat regions, it can be predicted that the proteins that bind to the anti-sense DNA strand, and thus CTG repeat sequences with the base ' at the 5 ' 3nd of the target, might have better binding affinity and specificity and thus repressor activity.
  • SBS# specificity for the Sense or Antisense strand is indicated (“S/A), as well as the target, the number of repeat units or RVDs and the type of C-terminus.
  • the TALE TFs in the table were then tested for Htt repression in HD patient (CAG 20/41) derived fibroblasts, and the results are shown in Figure 15.
  • the cells were transfected with either 1000, 100 or 10 ng of TALE-TF encoding mRNA.
  • the results for each TALE TF assayed are shown in groups of three, representing the three transfected mRNA amounts. In each grouping, there are also three samples: the left bar indicates the total Htt expression, the middle bar indicates the expression from the CAG20 Htt allele, and the right bar indicates the expression from the CAG41 Htt allele.
  • TALE TFs that were able to repress both Htt alleles (see for example 102454), while other TALE TFs were able to selectively inhibit the mutant Htt with the extended CAG repeat (see for example 102451 and 102472).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Virology (AREA)
  • Psychology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Analytical Chemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2014/064987 2013-11-11 2014-11-11 Methods and compositions for treating huntington's disease Ceased WO2015070212A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
EP14860665.0A EP3068905A4 (en) 2013-11-11 2014-11-11 Methods and compositions for treating huntington's disease
NZ719477A NZ719477A (en) 2013-11-11 2014-11-11 Methods and compositions for treating huntington’s disease
AU2014346424A AU2014346424B2 (en) 2013-11-11 2014-11-11 Methods and compositions for treating Huntington's Disease
CN201480072869.5A CN105934524A (zh) 2013-11-11 2014-11-11 用于治疗亨廷顿氏病的方法和组合物
MX2016006106A MX391904B (es) 2013-11-11 2014-11-11 Un represor genetico para usarse en el tratamiento de la enfermedad de huntington.
BR112016010175A BR112016010175A2 (pt) 2013-11-11 2014-11-11 Repressor genético, seus usos, e composição farmacêutica
RU2016123086A RU2693891C1 (ru) 2013-11-11 2014-11-11 Способы и композиции для лечения болезни хантингтона
KR1020167015301A KR102431079B1 (ko) 2013-11-11 2014-11-11 헌팅턴병을 치료하기 위한 방법 및 조성물
US15/036,020 US10369201B2 (en) 2013-11-11 2014-11-11 Methods and compositions for treating Huntington's disease
CA2929179A CA2929179A1 (en) 2013-11-11 2014-11-11 Htt genetic repressor, viral vector, and uses thereof
JP2016528904A JP2016537341A (ja) 2013-11-11 2014-11-11 ハンチントン病を処置するための方法および組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361902704P 2013-11-11 2013-11-11
US61/902,704 2013-11-11

Publications (1)

Publication Number Publication Date
WO2015070212A1 true WO2015070212A1 (en) 2015-05-14

Family

ID=53042231

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/064987 Ceased WO2015070212A1 (en) 2013-11-11 2014-11-11 Methods and compositions for treating huntington's disease

Country Status (12)

Country Link
US (1) US10369201B2 (https=)
EP (1) EP3068905A4 (https=)
JP (2) JP2016537341A (https=)
KR (1) KR102431079B1 (https=)
CN (1) CN105934524A (https=)
AU (1) AU2014346424B2 (https=)
BR (1) BR112016010175A2 (https=)
CA (1) CA2929179A1 (https=)
MX (1) MX391904B (https=)
NZ (1) NZ719477A (https=)
RU (1) RU2693891C1 (https=)
WO (1) WO2015070212A1 (https=)

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10479995B2 (en) 2015-07-22 2019-11-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10724035B2 (en) 2016-05-04 2020-07-28 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US20210285010A1 (en) * 2016-10-31 2021-09-16 University Of Florida Research Foundation, Inc. Compositions and methods for impeding transcription of expanded microsatellite repeats
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
EP3911349A4 (en) * 2019-01-15 2023-01-18 Sangamo Therapeutics, Inc. HTT REPRESSORS AND THEIR USES
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12139517B2 (en) 2019-04-23 2024-11-12 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
EP4696705A1 (en) * 2024-08-13 2026-02-18 Fondazione Telethon ETS Engineered transcription repressors and uses thereof

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230145206A (ko) 2014-11-14 2023-10-17 보이저 테라퓨틱스, 인크. 조절성 폴리뉴클레오티드
US20160362667A1 (en) * 2015-06-10 2016-12-15 Caribou Biosciences, Inc. CRISPR-Cas Compositions and Methods
KR20240056729A (ko) 2016-05-18 2024-04-30 보이저 테라퓨틱스, 인크. 조절성 폴리뉴클레오티드
KR102427379B1 (ko) 2016-05-18 2022-08-02 보이저 테라퓨틱스, 인크. 헌팅톤 질환을 치료하기 위한 조성물 및 방법
US10457940B2 (en) * 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
CN106636388A (zh) * 2016-12-15 2017-05-10 湖南中能荆卫生物科技有限公司 用于亨廷顿病诊断的基因及其应用以及由其编码的蛋白和蛋白的应用
JP2020518259A (ja) 2017-05-05 2020-06-25 ボイジャー セラピューティクス インコーポレイテッドVoyager Therapeutics,Inc. ハンチントン病治療組成物および方法
CN111356763B (zh) * 2017-09-22 2024-03-12 建新公司 变体RNAi
WO2019084140A1 (en) * 2017-10-24 2019-05-02 Sangamo Therapeutics, Inc. METHODS AND COMPOSITIONS FOR THE TREATMENT OF RARE DISEASES
US11421007B2 (en) * 2018-04-18 2022-08-23 Sangamo Therapeutics, Inc. Zinc finger protein compositions for modulation of huntingtin (Htt)
KR20240033089A (ko) * 2018-06-06 2024-03-12 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 신경 줄기 세포 조성물 및 신경변성 장애를 치료하는 방법
CN109112162B (zh) * 2018-08-30 2021-10-15 西南大学 利用CRISPR/Cas9技术构建的亨廷顿病原位敲入小鼠模型及构建方法
US20210130828A1 (en) 2019-11-01 2021-05-06 Sangamo Therapeutics, Inc. Gin recombinase variants
EP4051795A1 (en) * 2019-11-01 2022-09-07 Alnylam Pharmaceuticals, Inc. Huntingtin (htt) irna agent compositions and methods of use thereof
CN110747208B (zh) * 2019-11-28 2022-04-22 海南大学 一种木薯硝酸还原酶基因及其过量表达载体的构建和抗病应用
CN115443339A (zh) * 2019-12-20 2022-12-06 阿斯克肋匹奥生物制药公司 用于治疗亨廷顿病的方法
CN115786395B (zh) * 2022-08-19 2026-04-28 南京启真基因工程有限公司 构建htt基因突变的亨廷顿舞蹈症模型猪核移植供体细胞的基因编辑系统及其应用
CN120752255A (zh) * 2023-01-05 2025-10-03 恩沐辑医药有限责任公司 神经元启动子及其用途
AU2024206221A1 (en) * 2023-01-05 2025-07-03 Emugen Therapeutics Llc Retro-aav and use in treating neurodegenerative diseases
CN121729237A (zh) 2023-06-30 2026-03-24 武田药品工业株式会社 Htt阻遏物及其用途

Citations (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
WO1991017424A1 (en) 1990-05-03 1991-11-14 Vical, Inc. Intracellular delivery of biologically active substances by means of self-assembling lipid complexes
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5420032A (en) 1991-12-23 1995-05-30 Universitge Laval Homing endonuclease which originates from chlamydomonas eugametos and recognizes and cleaves a 15, 17 or 19 degenerate double stranded nucleotide sequence
US5422251A (en) 1986-11-26 1995-06-06 Princeton University Triple-stranded nucleic acids
WO1995019431A1 (en) 1994-01-18 1995-07-20 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
WO1996006166A1 (en) 1994-08-20 1996-02-29 Medical Research Council Improvements in or relating to binding proteins for recognition of dna
US5585245A (en) 1994-04-22 1996-12-17 California Institute Of Technology Ubiquitin-based split protein sensor
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
WO1998037186A1 (en) 1997-02-18 1998-08-27 Actinova Limited In vitro peptide or protein expression library
WO1998044350A1 (en) 1997-04-02 1998-10-08 The Board Of Trustees Of The Leland Stanford Junior University Detection of molecular interactions by reporter subunit complementation
WO1998053058A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding proteins
WO1998053059A1 (en) 1997-05-23 1998-11-26 Medical Research Council Nucleic acid binding proteins
WO1998054311A1 (en) 1997-05-27 1998-12-03 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
US5928638A (en) 1996-06-17 1999-07-27 Systemix, Inc. Methods for gene transfer
GB2338237A (en) 1997-02-18 1999-12-15 Actinova Ltd In vitro peptide or protein expression library
US6008336A (en) 1994-03-23 1999-12-28 Case Western Reserve University Compacted nucleic acids and their delivery to cells
WO2000027878A1 (en) 1998-11-09 2000-05-18 Gendaq Limited Screening system for zinc finger polypeptides for a desired binding ability
WO2000042219A1 (en) 1999-01-12 2000-07-20 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US6242568B1 (en) 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
WO2001060970A2 (en) 2000-02-18 2001-08-23 Toolgen, Inc. Zinc finger domains and methods of identifying same
WO2001083732A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Databases of regulatory sequences; methods of making and using same
WO2001083793A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
WO2001088197A2 (en) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
US6410248B1 (en) 1998-01-30 2002-06-25 Massachusetts Institute Of Technology General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites
WO2002077227A2 (en) 2000-11-20 2002-10-03 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US6479626B1 (en) 1998-03-02 2002-11-12 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
WO2002099084A2 (en) 2001-04-04 2002-12-12 Gendaq Limited Composite binding polypeptides
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
WO2003016496A2 (en) 2001-08-20 2003-02-27 The Scripps Research Institute Zinc finger binding domains for cnn
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
US20040002092A1 (en) 2002-03-15 2004-01-01 Sylvain Arnould Hybrid and single chain meganucleases and use thereof
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US6833252B1 (en) 1992-05-05 2004-12-21 Institut Pasteur Nucleotide sequence encoding the enzyme I-SecI and the uses thereof
US20050026157A1 (en) 2002-09-05 2005-02-03 David Baltimore Use of chimeric nucleases to stimulate gene targeting
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US6919204B2 (en) 2000-09-29 2005-07-19 Sangamo Biosciences, Inc. Modulation of gene expression using localization domains
US20050208489A1 (en) 2002-01-23 2005-09-22 Dana Carroll Targeted chromosomal mutagenasis using zinc finger nucleases
US20050267061A1 (en) 2004-04-08 2005-12-01 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathic and neurodegenerative conditions
US7013219B2 (en) 1999-01-12 2006-03-14 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
US7030215B2 (en) 1999-03-24 2006-04-18 Sangamo Biosciences, Inc. Position dependent recognition of GNN nucleotide triplets by zinc fingers
US7053264B2 (en) 2000-09-28 2006-05-30 Sangamo Biosciences, Inc. Nuclear reprogramming using IWSI and related chromatin remodeling ATPases
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7070934B2 (en) 1999-01-12 2006-07-04 Sangamo Biosciences, Inc. Ligand-controlled regulation of endogenous gene expression
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
US20060153826A1 (en) 2003-01-28 2006-07-13 Sylvain Arnould Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
WO2007014275A2 (en) 2005-07-26 2007-02-01 Sangamo Biosciences, Inc. Targeted integration and expression of exogenous nucleic acid sequences
US20070060606A1 (en) * 1999-10-07 2007-03-15 Robertson Harold A Compounds and methods for modulating phosphodiesterase 10A
US20070117128A1 (en) 2005-10-18 2007-05-24 Smith James J Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20080015164A1 (en) 2006-05-19 2008-01-17 Sangamo Biosciences, Inc. Methods and compositions for inactivation of dihydrofolate reductase
US7361635B2 (en) 2002-08-29 2008-04-22 Sangamo Biosciences, Inc. Simultaneous modulation of multiple genes
US20080131962A1 (en) 2006-05-25 2008-06-05 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US20090068164A1 (en) 2005-05-05 2009-03-12 The Ariz Bd Of Regents On Behald Of The Univ Of Az Sequence enabled reassembly (seer) - a novel method for visualizing specific dna sequences
US20090136465A1 (en) 2007-09-28 2009-05-28 Intrexon Corporation Therapeutic Gene-Switch Constructs and Bioreactors for the Expression of Biotherapeutic Molecules, and Uses Thereof
US20100003756A1 (en) 2008-06-10 2010-01-07 Sangamo BioSciences ,Inc. Methods and compositions for generation of Bax-and Bak-deficient cell lines
WO2010079430A1 (en) 2009-01-12 2010-07-15 Ulla Bonas Modular dna-binding domains and methods of use
US20100218264A1 (en) 2008-12-04 2010-08-26 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
US20100299768A1 (en) 2007-06-18 2010-11-25 Commissariat A L'energie Atomique Reversible siRNA-Based Silencing of Mutant and Endogenous Wild-Type Huntingtin Gene and its Application for the Treatment of Huntington's Disease
US20110082093A1 (en) 2009-07-28 2011-04-07 Sangamo Biosciences, Inc. Methods and compositions for treating trinucleotide repeat disorders
US7985778B2 (en) 2006-03-07 2011-07-26 Koichi Nakamura Method for decomposing and reclaiming synthetic resin having ester bond in the composition structure
US20110201055A1 (en) 2010-02-08 2011-08-18 Yannick Doyon Engineered cleavage half-domains
US20110265198A1 (en) 2010-04-26 2011-10-27 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using nucleases
US20110287512A1 (en) 2010-05-03 2011-11-24 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US8153773B2 (en) 2007-06-19 2012-04-10 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse phosphorothioate analogs of the messenger RNA cap
US20120195936A1 (en) 2009-07-31 2012-08-02 Ethris Gmbh Rna with a combination of unmodified and modified nucleotides for protein expression
US8409861B2 (en) 2003-08-08 2013-04-02 Sangamo Biosciences, Inc. Targeted deletion of cellular DNA sequences
US20130122591A1 (en) 2011-10-27 2013-05-16 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US20130177960A1 (en) 2011-09-21 2013-07-11 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US20130196373A1 (en) 2011-11-16 2013-08-01 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US8586526B2 (en) 2010-05-17 2013-11-19 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002008286A2 (en) 2000-07-21 2002-01-31 Syngenta Participations Ag Zinc finger domain recognition code and uses thereof
RU2192884C2 (ru) * 2000-11-09 2002-11-20 Государственное учреждение Научно-исследовательский институт клинической иммунологии СО РАМН Вакцина для стимуляции противоопухолевого иммунитета
EP2188384B1 (en) 2007-09-27 2015-07-15 Sangamo BioSciences, Inc. Rapid in vivo identification of biologically active nucleases
EP2441774B1 (en) 2010-10-15 2018-12-12 Fundació Centre de Regulació Genòmica Peptides having zinc finger domains and uses thereof

Patent Citations (131)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
US5422251A (en) 1986-11-26 1995-06-06 Princeton University Triple-stranded nucleic acids
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
WO1991017424A1 (en) 1990-05-03 1991-11-14 Vical, Inc. Intracellular delivery of biologically active substances by means of self-assembling lipid complexes
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5420032A (en) 1991-12-23 1995-05-30 Universitge Laval Homing endonuclease which originates from chlamydomonas eugametos and recognizes and cleaves a 15, 17 or 19 degenerate double stranded nucleotide sequence
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US6833252B1 (en) 1992-05-05 2004-12-21 Institut Pasteur Nucleotide sequence encoding the enzyme I-SecI and the uses thereof
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
WO1995019431A1 (en) 1994-01-18 1995-07-20 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6140466A (en) 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6242568B1 (en) 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6008336A (en) 1994-03-23 1999-12-28 Case Western Reserve University Compacted nucleic acids and their delivery to cells
US5585245A (en) 1994-04-22 1996-12-17 California Institute Of Technology Ubiquitin-based split protein sensor
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
WO1996006166A1 (en) 1994-08-20 1996-02-29 Medical Research Council Improvements in or relating to binding proteins for recognition of dna
US6013453A (en) 1994-08-20 2000-01-11 Medical Research Council Binding proteins for recognition of DNA
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
US5928638A (en) 1996-06-17 1999-07-27 Systemix, Inc. Methods for gene transfer
US6200759B1 (en) 1996-08-23 2001-03-13 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
WO1998037186A1 (en) 1997-02-18 1998-08-27 Actinova Limited In vitro peptide or protein expression library
GB2338237A (en) 1997-02-18 1999-12-15 Actinova Ltd In vitro peptide or protein expression library
WO1998044350A1 (en) 1997-04-02 1998-10-08 The Board Of Trustees Of The Leland Stanford Junior University Detection of molecular interactions by reporter subunit complementation
WO1998053057A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding polypeptide library
WO1998053058A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding proteins
WO1998053060A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding proteins
WO1998053059A1 (en) 1997-05-23 1998-11-26 Medical Research Council Nucleic acid binding proteins
WO1998054311A1 (en) 1997-05-27 1998-12-03 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6410248B1 (en) 1998-01-30 2002-06-25 Massachusetts Institute Of Technology General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites
US6903185B2 (en) 1998-03-02 2005-06-07 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US7153949B2 (en) 1998-03-02 2006-12-26 Massachusetts Institute Of Technology Nucleic acid encoding poly-zinc finger proteins with improved linkers
US6479626B1 (en) 1998-03-02 2002-11-12 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
WO2000027878A1 (en) 1998-11-09 2000-05-18 Gendaq Limited Screening system for zinc finger polypeptides for a desired binding ability
US6824978B1 (en) 1999-01-12 2004-11-30 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6933113B2 (en) 1999-01-12 2005-08-23 Sangamo Biosciences, Inc. Modulation of endogenous gene expression in cells
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US8268618B2 (en) 1999-01-12 2012-09-18 Sangamo Biosciences, Inc. Repressing endogenous CCR5 gene expression in cells using engineered zinc finger proteins
US7163824B2 (en) 1999-01-12 2007-01-16 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
WO2000042219A1 (en) 1999-01-12 2000-07-20 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US7220719B2 (en) 1999-01-12 2007-05-22 Sangamo Biosciences, Inc. Modulation of endogenous gene expression in cells
US7070934B2 (en) 1999-01-12 2006-07-04 Sangamo Biosciences, Inc. Ligand-controlled regulation of endogenous gene expression
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US20120294838A1 (en) 1999-01-12 2012-11-22 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6607882B1 (en) 1999-01-12 2003-08-19 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7013219B2 (en) 1999-01-12 2006-03-14 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6979539B2 (en) 1999-01-12 2005-12-27 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7030215B2 (en) 1999-03-24 2006-04-18 Sangamo Biosciences, Inc. Position dependent recognition of GNN nucleotide triplets by zinc fingers
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US20070060606A1 (en) * 1999-10-07 2007-03-15 Robertson Harold A Compounds and methods for modulating phosphodiesterase 10A
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
WO2001060970A2 (en) 2000-02-18 2001-08-23 Toolgen, Inc. Zinc finger domains and methods of identifying same
WO2001083793A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
WO2001083732A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Databases of regulatory sequences; methods of making and using same
WO2001088197A2 (en) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
US7053264B2 (en) 2000-09-28 2006-05-30 Sangamo Biosciences, Inc. Nuclear reprogramming using IWSI and related chromatin remodeling ATPases
US6919204B2 (en) 2000-09-29 2005-07-19 Sangamo Biosciences, Inc. Modulation of gene expression using localization domains
WO2002077227A2 (en) 2000-11-20 2002-10-03 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US6794136B1 (en) 2000-11-20 2004-09-21 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
WO2002099084A2 (en) 2001-04-04 2002-12-12 Gendaq Limited Composite binding polypeptides
WO2003016496A2 (en) 2001-08-20 2003-02-27 The Scripps Research Institute Zinc finger binding domains for cnn
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20050208489A1 (en) 2002-01-23 2005-09-22 Dana Carroll Targeted chromosomal mutagenasis using zinc finger nucleases
US20060078552A1 (en) 2002-03-15 2006-04-13 Sylvain Arnould Hybrid and single chain meganucleases and use thereof
US20040002092A1 (en) 2002-03-15 2004-01-01 Sylvain Arnould Hybrid and single chain meganucleases and use thereof
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
US7361635B2 (en) 2002-08-29 2008-04-22 Sangamo Biosciences, Inc. Simultaneous modulation of multiple genes
US20050026157A1 (en) 2002-09-05 2005-02-03 David Baltimore Use of chimeric nucleases to stimulate gene targeting
US20060206949A1 (en) 2003-01-28 2006-09-14 Sylvain Arnould Custom-made meganuclease and use thereof
US20060153826A1 (en) 2003-01-28 2006-07-13 Sylvain Arnould Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
US8409861B2 (en) 2003-08-08 2013-04-02 Sangamo Biosciences, Inc. Targeted deletion of cellular DNA sequences
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7888121B2 (en) 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US20050267061A1 (en) 2004-04-08 2005-12-01 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathic and neurodegenerative conditions
US8034598B2 (en) 2004-08-06 2011-10-11 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
US20090068164A1 (en) 2005-05-05 2009-03-12 The Ariz Bd Of Regents On Behald Of The Univ Of Az Sequence enabled reassembly (seer) - a novel method for visualizing specific dna sequences
WO2007014275A2 (en) 2005-07-26 2007-02-01 Sangamo Biosciences, Inc. Targeted integration and expression of exogenous nucleic acid sequences
US20070117128A1 (en) 2005-10-18 2007-05-24 Smith James J Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US7985778B2 (en) 2006-03-07 2011-07-26 Koichi Nakamura Method for decomposing and reclaiming synthetic resin having ester bond in the composition structure
US20080015164A1 (en) 2006-05-19 2008-01-17 Sangamo Biosciences, Inc. Methods and compositions for inactivation of dihydrofolate reductase
US20080131962A1 (en) 2006-05-25 2008-06-05 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US7914796B2 (en) 2006-05-25 2011-03-29 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US7951925B2 (en) 2006-05-25 2011-05-31 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US20100299768A1 (en) 2007-06-18 2010-11-25 Commissariat A L'energie Atomique Reversible siRNA-Based Silencing of Mutant and Endogenous Wild-Type Huntingtin Gene and its Application for the Treatment of Huntington's Disease
US8153773B2 (en) 2007-06-19 2012-04-10 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse phosphorothioate analogs of the messenger RNA cap
US20090136465A1 (en) 2007-09-28 2009-05-28 Intrexon Corporation Therapeutic Gene-Switch Constructs and Bioreactors for the Expression of Biotherapeutic Molecules, and Uses Thereof
US20100003756A1 (en) 2008-06-10 2010-01-07 Sangamo BioSciences ,Inc. Methods and compositions for generation of Bax-and Bak-deficient cell lines
US20100218264A1 (en) 2008-12-04 2010-08-26 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
WO2010079430A1 (en) 2009-01-12 2010-07-15 Ulla Bonas Modular dna-binding domains and methods of use
US20110082093A1 (en) 2009-07-28 2011-04-07 Sangamo Biosciences, Inc. Methods and compositions for treating trinucleotide repeat disorders
US20120195936A1 (en) 2009-07-31 2012-08-02 Ethris Gmbh Rna with a combination of unmodified and modified nucleotides for protein expression
US8623618B2 (en) 2010-02-08 2014-01-07 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US20110201055A1 (en) 2010-02-08 2011-08-18 Yannick Doyon Engineered cleavage half-domains
US20120017290A1 (en) 2010-04-26 2012-01-19 Sigma Aldrich Company Genome editing of a Rosa locus using zinc-finger nucleases
US20110265198A1 (en) 2010-04-26 2011-10-27 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using nucleases
US20110287512A1 (en) 2010-05-03 2011-11-24 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
US8772453B2 (en) 2010-05-03 2014-07-08 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
US8586526B2 (en) 2010-05-17 2013-11-19 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit
US20130177960A1 (en) 2011-09-21 2013-07-11 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US20130177983A1 (en) 2011-09-21 2013-07-11 Sangamo Bioscience, Inc. Methods and compositions for regulation of transgene expression
US20130122591A1 (en) 2011-10-27 2013-05-16 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US20130137104A1 (en) 2011-10-27 2013-05-30 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US20130196373A1 (en) 2011-11-16 2013-08-01 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US20130253040A1 (en) 2012-02-29 2013-09-26 c/o Sangamo BioSciences, Inc. Methods and compositions for treating huntington's disease

Non-Patent Citations (180)

* Cited by examiner, † Cited by third party
Title
"METHODS IN ENZYMOLOGY", ACADEMIC PRESS
"METHODS IN ENZYMOLOGY", vol. 304, 1999, ACADEMIC PRESS, article "Chromatin"
"METHODS IN MOLECULAR BIOLOGY", vol. 119, 1999, HUMANA PRESS, article "Chromatin Protocols"
"Remington's Pharmaceutical Sciences", 1985
"Remington's Pharmaceutical Sciences,", 1989
AHMAD ET AL., CANCER RES., vol. 52, 1992, pages 4817 - 4820
ALVAREZ ET AL., HUM. GENE THER., vol. 5, 1997, pages 597 - 613
ANDERSON, SCIENCE, vol. 256, 1992, pages 808 - 813
ARGAST ET AL., J. MOL. BIOL., vol. 280, 1998, pages 345 - 353
ARNOULD ET AL., J. MOL. BIOL., vol. 355, 2006, pages 443 - 458
ASHWORTH ET AL., NATURE, vol. 441, 2006, pages 656 - 659
AUSUBEL ET AL.: "CURRENT PROTOCOLS IN MOLECULAR BIOLOGY", 1987, JOHN WILEY & SONS
BEERLI ET AL., NATURE BIOTECHNOL., vol. 20, 2002, pages 135 - 141
BEERLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 14623 - 33
BEHR ET AL., BIOCONJUGATE CHEM., vol. 5, 1994, pages 382 - 389
BELFORT ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3379 - 3388
BENN ET AL., MOLECULAR NEURODEGENERATION, vol. 3, 2008, pages 17
BIBB ET AL., PROC. NATL. ACAD. SCI., vol. 97, no. 12, 2000, pages 6809 - 6814
BIRD ET AL., CELL, vol. 99, 1999, pages 451 - 454
BITINAITE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, no. 10, 1998, pages 570 - 10,575
BITKO; BARIK, J. VIROL., vol. 72, 1998, pages 5610 - 5618
BLAESE ET AL., CANCER GENE THER., vol. 2, 1995, pages 291 - 297
BLAESE ET AL., SCIENCE, vol. 270, 1995, pages 475 - 480
BOCH ET AL., SCIENCE, vol. 326, 2009, pages 1509 - 1512
BOGDANOVE, SCIENCE, vol. 326, 2009, pages 1501
BONAS ET AL., MOL GEN GENET, vol. 218, 1989, pages 127 - 136
BUCHSCHER ET AL., J. VIROL., vol. 66, 1992, pages 2731 - 2739
CARROLL ET AL., MOL THER., vol. 19, 2011, pages 2178 - 85
CATALOGUE, NEW ENGLAND BIOLABS, 2002
CHA ET AL., PROC. NATL. ACAD. SCI., vol. 95, no. 11, 1998, pages 6480 - 6485
CHAMES ET AL., NUCLEIC ACIDS RES, vol. 33, no. 20, 2005, pages el78
CHEM ET AL., PLANT CELL, vol. 8, 1996, pages 305 - 321
CHEVALIER ET AL., MOLEC. CELL, vol. 10, 2002, pages 895 - 905
CHILTON ET AL., PLANT PHYSIOLOGY, vol. 133, 2003, pages 956 - 65
CHO ET AL., PLANT MOL. BIOL., vol. 40, 1999, pages 419 - 429
CHOO ET AL., CURR. OPIN. STRUCT. BIOL., vol. 10, 2000, pages 411 - 416
CHRISTIAN ET AL., GENETICS, 2010
CIRILLO ET AL., EMBO J., vol. 17, 1998, pages 244 - 254
COLLINGWOOD ET AL., J. MOL. ENDOCRINOL., vol. 23, 1999, pages 255 - 275
CORDINGLEY ET AL., CELL, vol. 48, 1987, pages 261 - 270
CRYSTAL, SCIENCE, vol. 270, 1995, pages 404 - 410
DAVID SEGAL, ELIFE, vol. 2, 2013, pages e00563
DAVIES; RUBINSZTEIN, JOURNAL OF MEDICAL GENETICS, vol. 43, 2006, pages 893 - 896
DI PROSPERO; FISCHBECK, NATURE REVIEWS GENETICS, vol. 6, 2005, pages 756 - 765
DILLON, TIBTECH, vol. 11, 1993, pages 167 - 175
DOYLE; HUNT, NEUROREPORT, vol. 8, 1997, pages 2937 - 2942
DRANOFF ET AL., HUM. GENE THER., vol. 1, 1997, pages 111 - 2
DUJON ET AL., GENE, vol. 82, 1989, pages 115 - 118
DULL ET AL., J. VIROL., vol. 72, 1998, pages 8463 - 8471
DUNBAR ET AL., BLOOD, vol. 85, 1995, pages 3048 - 305
EHRLICH, NEUROTHERAPEUTICS, vol. 9, no. 2, 2012, pages 270 - 284
ELLEM ET AL., IMMUNOL IMMUNOTHER., vol. 44, no. 1, 1997, pages 10 - 20
EPINAT ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 2952 - 2962
EPINAT ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 2952 - 62
FIELDS ET AL., NATURE, vol. 340, 1989, pages 245 - 246
FOLLENZI ET AL., NATURE GENETICS, vol. 25, 2000, pages 217 - 222
FRESHNEY ET AL., CULTURE OF ANIMAL CELLS, A MANUAL OF BASIC TECHNIQUE, 1994
G. SHENG ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 111, 2013, pages 652
GAO ET AL., GENE THERAPY, vol. 2, 1995, pages 710 - 722
GARRIGA-CANUT ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 109, no. 45, 2012, pages E3136 - E3145
GERFEN ET AL., SCIENCE, vol. 250, 1990, pages 1429 - 1432
GHOSH ET AL., JAM CHEM SOC, vol. 122, 2000, pages 5658 - 5659
GIESECKE ET AL., MOLECULAR SYSTEMS BIOLOGY, vol. 2, 2006, pages 2006.2011
GIMBLE ET AL., J. MOL. BIOL., vol. 263, 1996, pages 163 - 180
GOFF ET AL., GENES DEV., vol. 5, 1991, pages 298 - 309
GONG ET AL., PLANT MOL. BIOL., vol. 41, 1999, pages 33 - 44
GOUBLE ET AL., GENE MED., vol. 8, no. 5, 2006, pages 616 - 622
GRAHAM ET AL., CELL, vol. 125, 2006, pages 1179 - 1191
GRAHAM ET AL., J GEN VIROL, vol. 36, 1977, pages 59 - 74
HADDADA ET AL.: "Current Topics in Microbiology and Immunology", 1995
HAGMANN ET AL., J. VIROL., vol. 71, 1997, pages 5952 - 5962
HAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 9747 - 9751
HEBB ET AL., NEUROSCIENCE, vol. 123, no. 4, 2004, pages 967 - 81
HERMONAT; MUZYCZKA, PNAS, vol. 81, 1984, pages 6466 - 6470
HEUER ET AL., APPL ANDENVIR MICRO, vol. 73, no. 13, 2007, pages 4379 - 4384
HEUER ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 73, no. 13, 2007, pages 4379 - 4384
HOBO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, no. 15, 1999, pages 348 - 15,353
INABA ET AL., J. EXP. MED., vol. 176, 1992, pages 1693 - 1702
ISALAN ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 656 - 660
J. AM. CHEM. SOC., vol. 122, 2000, pages 5658 - 5659
J. AM. CHEM. SOC., vol. 123, 2001, pages 3151 - 3152
JASIN, TRENDS GENET., vol. 12, 1996, pages 224 - 228
JINEK ET AL., ELIFE, vol. 2, 2013, pages e00471
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
JOHANN ET AL., J. VIROL., vol. 66, 1992, pages 1635 - 1640
KAY ET AL., SCIENCE, vol. 318, 2007, pages 648 - 651
KEARNS ET AL., GENE THER., vol. 9, 1996, pages 748 - 55
KELLS ET AL., MOLECULAR THERAPY, vol. 9, no. 5, 2004, pages 682 - 688
KIM ET AL., J. BIOL. CHEM., vol. 269, no. 31, 1994, pages 978 - 31,982
KIM ET AL., PROC NATL ACAD SCI USA, vol. 93, no. 3, 1996, pages 1156 - 1160
KIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 883 - 887
KLEBE; RUDDLE, J. CELL BIOL., vol. 43, 1969, pages 69A
KLEIMAN ET AL., J OF PHARMA AND EXP THERA, vol. 336, no. l, 2011, pages 64 - 78
KNOEPFLER ET AL., CELL, vol. 99, 1999, pages 447 - 450
KOHN ET AL., NAT. MED., vol. 1, 1995, pages 1017 - 102
KORMANN ET AL., NATURE BIOTECHNOLOGY, vol. 29, no. 2, 2011, pages 154 - 157
KOTIN, HUMAN GENE THERAPY, vol. 5, 1994, pages 793 - 801
KREMER; PERRICAUDET, BRITISH MEDICAL BULLETIN, vol. 51, no. 1, 1995, pages 31 - 44
LEMON ET AL., CURR. OPIN. GENET. DEV., vol. 9, 1999, pages 499 - 504
LEO ET AL., GENE, vol. 245, 2000, pages 1 - 11
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4275 - 4279
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 2764 - 2768
LINN ET AL.: "Nucleases", 1993, COLD SPRING HARBOR LABORATORY PRESS
LIU ET AL., CANCER GENE THER., vol. 5, 1998, pages 3 - 28
MACDIARMID ET AL., NATURE BIOTECHNOLOGY, vol. 27, no. 7, 2009, pages 643
MALECH ET AL., PNAS, vol. 94, no. 22, 1997, pages 12133 - 12138
MALIK ET AL., TRENDS BIOCHEM. SCI., vol. 25, 2000, pages 277 - 283
MANGIARINI ET AL., CELL, vol. 15, 1996, pages 197
MANGIARINI ET AL., CELL, vol. 87, 1996, pages 493 - 506
MANGIARINI ET AL., CELL, vol. 87, 1996, pages 493 - 605
MANGIARINI ET AL., CELL, vol. 87, pages 493 - 506
MANTEUFFEL-CYMBOROWSKA, ACTA BIOCHIM. POL., vol. 46, 1999, pages 77 - 89
MAPP ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 3930 - 3935
MCCLAIN ET AL., J. AM. CHEM. SOC., vol. 123, 2001, pages 3151 - 3152
MCKENNA ET AL., J. STEROID BIOCHEM. MOL. BIOL., vol. 69, 1999, pages 3 - 12
MENALLED ET AL., J. COMP. NEUROL, vol. 4651, 2003, pages 11 - 26
MILLER ET AL., J. VIROL., vol. 65, 1991, pages 2220 - 2224
MILLER, NATURE, vol. 357, 1992, pages 455 - 460
MITANI; CASKEY, TIBTECH, vol. 11, 1993, pages 162 - 166
MOL. SYST. BIOL., vol. 2, 2006, pages 2006.2011
MOLINARI ET AL., EMBO J., vol. 18, 1999, pages 6439 - 6447
MONET ET AL., BIOCHEM. BIOPHYSICS. RES. COMMON., vol. 255, 1999, pages 88 - 93
MOSCOU; BOGDANOVE, SCIENCE, vol. 326, 2009, pages 1501
MUZYCZKA, J. CLIN. INVEST., vol. 94, 1994, pages 1351
NABEL; FELGNER, TIBTECH, vol. 11, 1993, pages 211 - 217
OGAWA ET AL., GENE, vol. 245, 2000, pages 21 - 29
OKANAMI ET AL., GENES CELLS, vol. 1, 1996, pages 87 - 99
ORY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11382 - 11388
PABO ET AL., ANN. REV. BIOCHEM., vol. 70, 2001, pages 313 - 340
PAQUES ET AL., CURRENT GENE THERAPY, vol. 7, 2007, pages 49 - 66
PEREZ ET AL., NATURE BIOTECHNOLOGY, vol. 26, no. 7, 2008, pages 808 - 816
PEREZ-PIMERA, NAT METHOD, vol. 10, no. 10, 2013, pages 973 - 976
PERLER ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 1125 - 1127
PINA ET AL., CELL, vol. 60, 1990, pages 719 - 731
PORTEUS ET AL., NAT. BIOTECHNOL., vol. 23, 2005, pages 967 - 73
PUCHTA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 5055 - 60
REMACLE ET AL., EMBO JOURNAL, vol. 18, no. 18, 1999, pages 5073 - 5084
REMY ET AL., BIOCONJUGATE CHEM., vol. 5, 1994, pages 647 - 654
ROBERTS ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 418 - 420
ROBERTSON ET AL., NATURE GENET., vol. 25, 2000, pages 338 - 342
ROBYR ET AL., MOL. ENDOCRINOL., vol. 14, 2000, pages 329 - 347
RODRIGUEZ-LEBRON ET AL., MOL THER, vol. 12, no. 4, 2005, pages 618 - 633
RONG ET AL., GENES DEV., vol. 16, 2002, pages 1568 - 81
ROSENECKER ET AL., INFECTION, vol. 24, no. 1, 1996, pages 5 - 10
ROUTE ET AL., MOL. CELL. BIOL., vol. 14, 1994, pages 8096 - 106
RUNNE ET AL., JNEUROSCI, vol. 28, no. 39, 2008, pages 9723 - 9731
SAMBROOK ET AL.: "MOLECULAR CLONING: A LABORATORY MANUAL", 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 03822 - 3828
SCHORNACK S ET AL., J PLANT PHYSIOL, vol. 163, no. 3, 2006, pages 256 - 272
SEGAL ET AL., CURR. OPIN. BIOTECHNOL., vol. 12, 2001, pages 632 - 637
SEIPEL ET AL., EMBO J., vol. 11, 1992, pages 4961 - 4968
SOMMERFELT ET AL., VIROL., vol. 176, 1990, pages 58 - 59
SPRENGER-HAUSSELS ET AL., PLANT J., vol. 22, 2000, pages 1 - 8
STERMAN ET AL., HUM. GENE THER., vol. 7, 1998, pages 1083 - 1089
STERMAN ET AL., HUM. GENE THER., vol. 7, 1998, pages 1083 - 9
STERMAN ET AL., HUM. GENE THER., vol. 9, no. 7, 1998, pages 1083 - 1089
SUSSMAN ET AL., J. MOL. BIOL., vol. 342, 2004, pages 31 - 41
SVENNINGSSON ET AL., ANNU REV PHARMACOL TOXICOL, vol. 44, 2004, pages 269 - 96
SWARTS ET AL., NATURE, vol. 507, no. 7491, 2014, pages 258 - 261
TOPF ET AL., GENE THER., vol. 5, 1998, pages 507 - 513
TORCHIA ET AL., CURR. OPIN. CELL. BIOL., vol. 10, 1998, pages 373 - 383
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072 - 2081
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 3251 - 3260
TRETTEL ET AL., HUM. MOL. GENET, vol. 9, 2000, pages 2799 - 2809
TYLER ET AL., CELL, vol. 99, 1999, pages 443 - 446
ULMASON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 5844 - 5849
URNOV ET AL., NATURE, vol. 435, no. 7042, 2005, pages 646 - 651
VAN BRUNT, BIOTECHNOLOGY, vol. 6, no. 10, 1988, pages 1149 - 1154
VIGNE, RESTORATIVE NEUROLOGY AND NEUROSCIENCE, vol. 8, 1995, pages 35 - 36
WAGNER ET AL., LANCET, vol. 351, no. 9117, 1998, pages 1702 - 3
WALKER, LANCET, vol. 369, 2007, pages 218 - 228
WELSH ET AL., HUM. GENE THER., vol. 2, 1995, pages 205 - 18
WEST ET AL., VIROLOGY, vol. 160, 1987, pages 38 - 47
WHEELER ET AL., HUM MOL GENET, vol. 8, 2000, pages 115 - 122
WILSON ET AL., J. VIROL., vol. 63, 1989, pages 2374 - 2378
WOLFFE: "CHROMATIN STRUCTURE AND FUNCTION", 1998, ACADEMIC PRESS
WU ET AL., PLANT J., vol. 22, 2000, pages 19 - 27
YU ET AL., GENE THERAPY, vol. 1, 1994, pages 13 - 26
ZUCCATO ET AL., PHARMACOLOGICAL RESEARCH, vol. 52, no. 2, 2005, pages 133 - 139
ZUFFERY ET AL., J. VIROL., vol. 72, 1998, pages 9873 - 9880

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10479995B2 (en) 2015-07-22 2019-11-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
WO2017158153A1 (en) 2016-03-17 2017-09-21 Imba - Institut Für Molekulare Biotechnologie Gmbh Conditional crispr sgrna expression
US10724035B2 (en) 2016-05-04 2020-07-28 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US12180499B2 (en) * 2016-10-31 2024-12-31 University Of Florida Research Foundation, Inc. Compositions and methods for impeding transcription of expanded microsatellite repeats
US20210285010A1 (en) * 2016-10-31 2021-09-16 University Of Florida Research Foundation, Inc. Compositions and methods for impeding transcription of expanded microsatellite repeats
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
EP3911349A4 (en) * 2019-01-15 2023-01-18 Sangamo Therapeutics, Inc. HTT REPRESSORS AND THEIR USES
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12139517B2 (en) 2019-04-23 2024-11-12 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
EP4696705A1 (en) * 2024-08-13 2026-02-18 Fondazione Telethon ETS Engineered transcription repressors and uses thereof
WO2026038105A1 (en) * 2024-08-13 2026-02-19 Fondazione Telethon Ets Engineered transcription repressors and uses thereof

Also Published As

Publication number Publication date
JP2019116502A (ja) 2019-07-18
AU2014346424A1 (en) 2016-05-19
JP2016537341A (ja) 2016-12-01
EP3068905A4 (en) 2017-07-05
MX391904B (es) 2025-03-12
RU2693891C1 (ru) 2019-07-05
CA2929179A1 (en) 2015-05-14
KR20160077208A (ko) 2016-07-01
BR112016010175A2 (pt) 2017-10-03
AU2014346424B2 (en) 2020-09-17
KR102431079B1 (ko) 2022-08-11
NZ719477A (en) 2022-05-27
CN105934524A (zh) 2016-09-07
EP3068905A1 (en) 2016-09-21
US20160296605A1 (en) 2016-10-13
US10369201B2 (en) 2019-08-06
MX2016006106A (es) 2016-12-09
RU2016123086A (ru) 2017-12-19

Similar Documents

Publication Publication Date Title
US11723952B2 (en) Methods and compositions for treating Huntington's Disease
AU2014346424B2 (en) Methods and compositions for treating Huntington's Disease
EP2727600B1 (en) Zinc finger fusion proteins for repressing a huntington gene
HK1193768A (en) Zinc finger fusion proteins for repressing a huntington gene
HK1193768B (en) Zinc finger fusion proteins for repressing a huntington gene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14860665

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2929179

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016528904

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2016/006106

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15036020

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016010175

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2014346424

Country of ref document: AU

Date of ref document: 20141111

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014860665

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014860665

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20167015301

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016123086

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016010175

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160505