WO2015066174A1 - Méthodes de séquençage génomique de nouvelle génération - Google Patents

Méthodes de séquençage génomique de nouvelle génération Download PDF

Info

Publication number
WO2015066174A1
WO2015066174A1 PCT/US2014/062889 US2014062889W WO2015066174A1 WO 2015066174 A1 WO2015066174 A1 WO 2015066174A1 US 2014062889 W US2014062889 W US 2014062889W WO 2015066174 A1 WO2015066174 A1 WO 2015066174A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
nucleic acid
target
sequencing
gene
Prior art date
Application number
PCT/US2014/062889
Other languages
English (en)
Inventor
Luke T. Daum
Gerald W. Fischer
Original Assignee
Longhorn Vaccines And Diagnostics, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Longhorn Vaccines And Diagnostics, Llc filed Critical Longhorn Vaccines And Diagnostics, Llc
Priority to CA2929108A priority Critical patent/CA2929108A1/fr
Priority to AU2014342414A priority patent/AU2014342414B2/en
Priority to EP14856946.0A priority patent/EP3063301A4/fr
Priority to CN201480071698.4A priority patent/CN106170560A/zh
Publication of WO2015066174A1 publication Critical patent/WO2015066174A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa

Definitions

  • This invention is directed to tools, compositions and methods for identifying genetic mutation and mega-bases of nucleic acid information by sequencing and, in particular, to electronic media and programs for analyzing sequences, genes and complete genomes by sequencing, and to the mutations identified and kits comprising reagents for identifying mutations in biological samples.
  • MTB Mycobacterium tuberculosis
  • XDR extensively drug-resistant
  • Microscopy remains the cornerstone for diagnosing MTB in many low resource areas of the world where both MTB and also HIV are prevalent.
  • MDR multidrug-resistant
  • XDR extensively drug-resistant strains
  • NGS next- generation sequencing
  • MDR tuberculosis strains are resistant to the first line antibiotics rifampin (RIF) and isoniazid (INH), while XDR MTB strains are resistant to both RIF and INH as well as any fluoroquinolone and second-line injectable antibiotic drugs (e.g., amikacin, kanamycin or capreomycin).
  • RIF rifampin
  • INH isoniazid
  • XDR MTB strains are resistant to both RIF and INH as well as any fluoroquinolone and second-line injectable antibiotic drugs (e.g., amikacin, kanamycin or capreomycin).
  • DST Culture-based drug susceptibility testing
  • MDR strains are considered the gold- standard, but is time consuming (weeks to months), technically challenging and cost prohibitive, especially in resource limited countries.
  • the BACTEC MGIT 960 Becton Dickinson Microbiology System, Silver Sparks NV, USA
  • BACTEC MGIT 960 is an automated continuously culture-based monitoring system that measures bacterial oxygen consumption and can perform DST using prepared kits which are available for susceptibility of strains to a number of antibiotics.
  • DST results obtained with the BACTEC MGIT 960 yield reliable and reproducible but require handling of viable and potentially infectious cultures, days to weeks or delay until results are available, specialized laboratory accommodations and high costs associated with the instrument and consumables.
  • LPA GenoType MTBDRplus Line Probe Assay
  • the present invention overcomes disadvantages associated with current strategies and designs, and hereby provides tools, compositions, methods to facilitate and simplify sequencing and methods for analyzing sequence information of nucleic acids including full-length genes and complete genomes.
  • One embodiment of the invention is directed to analyzing drug resistance mutations by semi-conductor sequencing and, preferably, ion torrent sequencing.
  • Nucleic acid segments containing a gene of interest are amplified by PCR and the amplified products are processed and subsequently analyzed by sequencing.
  • the RNA is reverse transcribed to DNA.
  • Sequencing is preferably by Ion Torrent, or Next-Generation sequencers including the Ion Torrent Personal Genome Machine (PGMTM; Life Technologies).
  • the amplification products represent a common full-length, or multiple overlapping pieces of genes of a number of species, strains and/or serotypes of organisms.
  • the amplified products are sequenced and mutations identified and mapped.
  • Mapping identifies both known and previously unknown mutations and is useful to track the progress and movement of drug resistance across a population.
  • the invention analyzes nucleic acids of pathogens such as, for example, virus, bacteria or parasites.
  • pathogens such as, for example, virus, bacteria or parasites.
  • the viral pathogens are the causative agents of influenza or HIV and the bacterial pathogens are the causative agents of tuberculosis.
  • Ion torrent sequencing of the nucleic acid segments provides enhanced sequencing for rapid, efficient, cost-effective protocol for full length gene analysis. Drug resistance and other mutations are immediately determined.
  • Another embodiment of the invention is directed to tools, compositions and methods for performing NGS sequencing, preferably ion torrent or MiSeqTM sequencing of genes or complete genomes.
  • the invention comprises obtaining a DNA sequence of an organism of interest and performing polymerase chain reaction analysis using multiple pairs of nucleic acid primers. Each pair of primers is designed to simultaneously amplify overlapping segments of the genome under similar PCR conditions and these may be performed as sequencing reactions or multiplex for multiple genes or the entire genome. Preferred primers possess similar GC content and overall size.
  • a single PCR amplification of the genome produces hundreds of amplification products whose sequences include the full-length gene, large gene and noncoding segments or the entire genome of the organism. These products are analyzed, preferably by NGS, and the sequences matched to create a sequence map of the entire gene or genome.
  • Another embodiment of the invention is directed to methods of identifying a sequence motif in the genome of a microorganism that confers resistance to an antimicrobial compound, comprising: providing multiple nucleic acid samples obtained from multiple different strains or serotypes of the microorganism; amplifying the sequences of the multiple nucleic acid samples by a polymerase chain reaction; obtaining sequence information of the amplified sequences by ion torrent sequencing; identifying a polymorphism in the genome of at least one microorganism strain or serotype from the sequence information obtained; and correlating the polymorphism identified with a phenotype or genome location of the at least one microorganism strain or serotype to identify the sequence motif that confers resistance to the antimicrobial compound.
  • the microorganism is a virus, a bacterium, a fungus or a parasite, and the virus is influenza virus and the bacterium is Mycobacterium tuberculosis.
  • the nucleic acid samples are provided in an aqueous molecular transport medium that contains a chaotrope, a detergent, a reducing agent, a chelator, a buffer, and an alcohol, together present in an amount sufficient to lyse cells, denature proteins, inactivate nucleases, kill pathogens, and not degrade nucleic acid.
  • amplifying is performed in a one step polymerase chain reaction utilizing a primer pair that amplifies a gene or nucleic acid segment associated with resistance to an antimicrobial compound, and the polymerase chain reaction is carried out in an aqueous mix comprising: a heat-stable polymerase; a mix of deoxynucleotide tri phosphates comprising about equivalent amounts of dATP, dCTP, dGTP and dTTP, a chelating agent, an osmolality agent, an albumin, a magnesium salt; and a buffer.
  • the antimicrobial compound is an antibiotic.
  • Another embodiment of the invention is directed to methods of treating a disease or disorder caused by the at least one microorganism strain or serotype with the antimicrobial compound identified by the methods of the invention.
  • treatment comprises the targeted killing of the specific pathogen that is the causative agent of the disease or disorder.
  • the effective dose is determined from methods of the invention by assessing the phenotypic characteristics associated with the target sequence or sequences identified.
  • Another embodiment of the invention is directed to methods for determining a complete sequence of a genome of an microorganism comprising: producing a series of amplicons by performing a single polymerase chain reaction (PCR) of the genome in an aqueous mixture containing a heat-stable polymerase; a mix of deoxynucleotide tri phosphates comprising about equivalent amounts of dATP, dCTP, dGTP and dTTP; a chelating agent; a salt; a buffer; a stabilizing agent; and a plurality of primer pairs wherein each primer of the plurality of primer pairs has a similar annealing temperatures; sequencing each of the series of amplicons produced by semi-conductor sequencing, and correlating the sequences of the amplicons and constructing the complete sequence of the genome.
  • PCR polymerase chain reaction
  • each of the primers of the multiple primer pairs comprise primers that are from 15 to 25 nucleic acids in length and each has a GC content of about 25-50%.
  • each primer pair is designed to PCR amplify an amplicon, and the collection of amplicons that are PCR amplified encompass overlapping segment of the complete genome sequence.
  • the plurality of primer pairs hybridizes to the genome and are spaced along the genome at about every 500 to 2,000 nucleotides.
  • the microorganism is a virus, a bacterium, a fungus, a parasite or a cell, and the virus is influenza virus and the bacterium is Mycobacterium tuberculosis.
  • Another embodiment of the invention is directed to methods for determining the sequence of a nucleic acid segment in one step comprising: performing a polymerase chain reaction on the nucleic acid segment to produce a series of amplicons, wherein the PCR comprises a heat-stable composition comprising: a polymerase; a mix of deoxynucleotide tri phosphates comprising about equivalent amounts of dATP, dCTP, dGTP and dTTP; a chelating agent; a salt; a buffer; a stabilizing agent; and a plurality of primer pairs wherein each primer of the plurality of primer pairs has an annealing temperature within 5°C; sequencing each of the series of amplicons produced by semiconductor sequencing, and correlating the sequences of the amplicons and constructing the sequence of the nucleic acid segment.
  • the nucleic acid segment is 1 Mb or greater in length, more preferably greater 2 or more Mb in length, more preferably 5 or more Mb in length and more preferably 10 or more Mb in length.
  • each of the primers of the multiple primer pairs is of from 16 to 24 nucleotides in length, has a GC content of about 28-35%, and has an annealing temperature of within 3°C of each other primer.
  • each primer pair is designed to PCR amplify an amplicon representing a portion of the sequence of the nucleic acid segment, and the collection of amplicons that are PCR amplified represent overlapping portions of the complete sequence of the segment.
  • the plurality of primer pairs hybridizes to the segment at a spacing of about 800 to 1,200 nucleotides in length.
  • Another embodiment of the invention is directed to mixtures comprising multiple pairs of nucleic acid primers wherein, upon subjecting the collection to a polymerase chain reaction in association with a nucleic acid segment, the collection of primer pairs generates a collection of amplicons, wherein each amplicon is about 500 to 2,000 nucleotides in length, such that the entire sequence of the segment is represented in the resulting collection of amplicons.
  • each primer of the collection of primer pairs is about 15 to 25 nucleotides in length, has a GC content of about 25-45%, and an annealing temperature within 3°C of each other primer, and each primer of the collection of primer pairs contains a sequence that hybridizes to the genome of the same microorganism.
  • the microorganism is a virus, a bacterium, a parasite, or a fungus.
  • the mixture contains a heat-stable polymerase; a mix of deoxynucleotide tri phosphates comprising about equivalent amounts of dATP, dCTP, dGTP and dTTP; a chelating agent; a salt; a buffer; a stabilizing agent and nuclease- free water.
  • kits containing reagent vessels preferably including one or more of chemical reagents, primers and polymerases for sequencing The sample to be analyzed is mixed with a reagent vessel that preferably contains chemical components sufficient to kill all pathogens present in the sample, inactivate nucleases in the sample, and maintain the integrity of the nucleic acids rendering the sample safe for transportation and subsequent manipulation, such as, for example, aqueous lysis buffer, aqueous or anhydrous transport medium, or aqueous PrimeStore Molecular Transport Medium®.
  • the mixture may be combined in a column, such as a micro-centrifuge column, which may be included in the kit, to aid in the extraction of nucleic acid form the sample.
  • Extracted nucleic acid is preferably combined with another chemical reagent composition such as, for example PrimeMix® that facilitates nucleic acid testing such as, for example, PCR sequencing.
  • reagent composition may contain positive control sequences, negative control sequences and/or sequences that specifically hybridize (under the desired high or low stringency hybridization conditions) to a particular target sequences that is characteristic for the presence of a pathogen.
  • Another embodiment of the invention is directed to computer-readable media that implements the analytical methods of the invention.
  • the computer- readable media analyses sequence information obtained and centralizes the collection of information.
  • the sequence information is compared with sequence information obtained from one or more known databases of sequence information for the same or similar sequences and identifies mutations that provide antibiotic resistance and other phenotypic characteristics to the microorganism.
  • Figure 1 Illustrates the pncA gene sequence plus 100 flanking base pairs as well as the reverse compliment sequence, the protein sequence, and the primers sequences.
  • Figure 2 Illustrates the nucleotide sequence of H37RV Gene strain as well as the sequences of the TB 16S ribosomal RNA gene sequencing primers.
  • Figure 3 Illustrates the rpoB gene conferring sensitivities/resistance to Rifampin as well as the forward and reverse primer sequences for rpoB.
  • Figure 4 Illustrates the Mycobacterium tuberculosis H37Ra, complete genome (GenBank: CP0006.1 1 ,1) GyrA Gene and three sets of forward and reverse primers.
  • Figure 5 Mycobacterium tuberculosis H37Ra, complete genome (GenBank: CP000611.1) catalase-peroxidase-peroxynitritase T katG and three sets of forward and reverse primers.
  • Figure 6 Illustrates the cycle threshold of Gyrase A and IS 6110 assays.
  • Figure 7 Illustrates Gyrase A assay and the IS 6110 assay using sequence isolates by cycle number vs. Ct value.
  • Figure 8 Illustrates Gyrase A assay and the IS 6110 assay using sequence isolates vs cycle threshold (ct).
  • Figure 9 Summary of results achieved in sequencing the influenza A genome using various primer pair collections with ion torrent sequencing methodology.
  • Figure 11 (A) Gene sequence of pncA showing coding regions as shaded, and (B) pncA forward and reverse primers utilized in PCR tiling and pncA regions P1-P4.
  • Rapid analysis of genes associated with drug resistant strains is a major challenge for successful treatment of many diseases and disorders.
  • Real-time geographical surveillance of emerging MTB drug resistance would facilitate more appropriate treatment strategies (e.g., drug, antibiotic, chemical).
  • available molecular methods such as the GenoType® MTBDRplus LPA offer limited detection capabilities, particularly when novel/uncommon amino acid substitutions are within known drug resistance regions or when undiscovered amino acid mutations impact drug resistance.
  • current methodology including Ion Torrent protocol requires multi- steps, ancillary equipment and increased expense, and is labor intensive.
  • the invention comprises a standardized protocol for gene sequencing preferably utilizing semiconductor sequencing and preferably Ion Torrent sequencing of full-length genes.
  • the protocol enables sequencing of entire coding regions implemented allowing characterization of known mutations and discovery of new polymorphisms.
  • This protocol also enables the sequencing of mega-bases of nucleotide information such that complete genomes of cells and organisms can be determined and the genetic polymorphism readily mapped and identified.
  • the cells or organisms are disease causing prokaryotic or eukaryotic cells, or yeast or fungal cells.
  • Preferred disease causing organisms include strains of bacteria, virus, fungus, and parasites.
  • Exemplary organisms include, but are not limited to DNA virus, an RNA virus, a positive or negative single-strand virus, a double strand virus, orthomyxovirus, paramyxovirus, Morbillivirus (e.g., Rubeola), retrovirus, flavivirus, filovirus, lentivirus, hanta virus, herpes virus (e.g., VZV, HSV I, HSV II, EBV), hepatitis virus (e.g., A, B, C, non-A, non-B), Influenza virus (e.g., H5N1, H1N1, H7N9), Respiratory Syncytial Virus, HIV, or Ebola virus.
  • DNA virus an RNA virus
  • a positive or negative single-strand virus e.g., a double strand virus
  • orthomyxovirus e.g., paramyxovirus
  • Morbillivirus e.g., Rubeola
  • retrovirus e.g., Rub
  • Exemplary organisms also include but are not limited to Mycobacteria (e.g., M. tuberculosis), Bacillus anthracis, Plasmodium (e.g., Plasmodium falciparum), Shistosomiasis (e.g., Schistosoma mansoni), Francisella tularensis, Clostridium difficile, Meningococcal infections, Pseudomonas infections, Yersinia pestis, and Vibrio cholerae.
  • the invention is also directed to the detection and characterization of organisms that are related to the pathogenic organisms, but are nonpathogenic. Detection of one or more of the non-pathogenic, but related organisms can be a definitive diagnosis of the absence of disease.
  • the tools and methods of the invention allow for the identification and characterization of abnormalities in the existing genome of an individual such as a condition that may be present from birth (congenital) and may be heritable. These genetic disorders are equally detectable and characterizable by the tools and methods of the invention and can be diagnosed by comparison with an otherwise normal or control genome of a non-afflicted individual.
  • RNA sequence of interest in the sample is typically reverse transcribed to DNA for PCR analysis.
  • identified and characterized are one or more gene mutations that provide a microorganism with resistance to an antibiotic.
  • Preferred mutations that are identified with the methods of the invention are located in one or more sites within an amino acid coding region, a transcription promoter or termination site, a stop or start codon, a site within a non- coding region, a splice junction site, a modification site, a transcription or translation factor binding or recognition site, one or more sites that contribute to a three dimensional structure, or a combination thereof, Preferred genes that are analyzed include MTB genes associated with first and second-line MTB drug resistance (see Figures 1-5).
  • MTB-associated genes include, for example, rpoB (rifampin), katG and inhA (isoniazid), gyrA and gyrB (fluoroquinolones), pncA and panD (PZA or pyrazinamide) and rrs(16s) (aminoglycosides, amikacin, kanamycin, capreomycin, streptomycin) and rspL (streptomycin).
  • rpoB rifampin
  • katG and inhA isoniazid
  • gyrA and gyrB fluoroquinolones
  • pncA and panD PZA or pyrazinamide
  • rrs(16s) aminoglycosides, amikacin, kanamycin, capreomycin, streptomycin
  • rspL streptomycin
  • the methods of the invention were used to evaluate 26 geographically diverse clinical isolates collected in South Africa including MDR and XDR strains with next- generation Ion Torrent Personal Genome Machine (PGM).
  • PGM Personal Genome Machine
  • INDELS which are insertions or deletions if a single nucleotide (A,T,G,C) causing missense changes in the protein structure.
  • the sequencing data obtained from this developed methodology were compared to the HAIN LPA and genotyping DST data from culture. This methodology for the first time enables sequencing entire coding as well as non-coding regions for genes implemented in resistance allowing characterization of known mutations and discovery of new polymorphisms.
  • Previously uncharacterized substitution mutations were identified on the rrs, rpoB, katG, pncA gyrA and gyr B, katG, inhA and panD genes.
  • the present invention offers significant potential for new sequencing platforms such as, for example, next- generation instruments to be more utilized in resource deprived environments such as Africa, Asia, and India. Specifically, the current invention improves and streamlines the up-front library preparation process. Methodology of the invention does not require the use of expensive ancillary equipment pieces typically utilized or required by the manufacturer.
  • the standardized procedure of the invention does not require an Agilient Bioanalyzer for DNA quantifications; the OneTouch ePCR system for emulsification PCR step, or the PipinPrep for gel excision. Additionally, since the protocol of the invention involves re-sequencing full-coding genes (not necessarily full genomes) the Bioruptor is not required for shearing DNA into smaller pieces. Additionally, it is not necessary to sequence the entire genome and then identify genes. The method and tools of the invention allow for pre-selection of the genes and/or regions of interest that are to be sequenced. As the Agilent 2100 Bio Analyzer, OneTouch, PipinPrep, and Bioruptor all require additional training for use, consume valuable laboratory bench space, and are extremely expensive, the invention represents a significant advance and improvement over convention methodologies.
  • the sequencing protocol of the invention is exemplified herein using Ion Torrent sequencing as this sequencing method has been applied to M. tuberculosis.
  • the protocol involves semiconductor sequencing, with is exemplified by Ion Torrent sequencing and, as such, involves the sequencing of large numbers of different regions simultaneously.
  • the sequencing and nucleic acid methodologies are applicable to any series of genes, genomes or nucleic acid sequences.
  • the invention also includes a methodology for selecting primer pairs for sequencing a target of interest.
  • Primer pairs are preferably selected with matched annealing and melting temperature as to the target.
  • melting and annealing temperatures are based on sequence characteristics such as the GC content of the sequence, the possibility of self -hybridization of the primer (e.g., forming hairpin loops within the primer), and possible structures near the binding site.
  • the primers do not self -hybridize under the conditions of sequencing.
  • the GC content of primers is between about 25% and 50%, more preferably between about 30% and 40%, more preferably between about 25% and 35%, and also more preferably between about 40% and 50%.
  • primer sequences of the target are selected for hybridization based on sequence characteristics such that all of the primer pairs utilized for the target will have similar melting and/or annealing temperatures to the target.
  • primer sequences contain no regions of reasonably possible self hybridization of the primer sequence.
  • primer pairs are matched for annealing and/or disassociation temperatures which may be within 5°C, within 4°C, with 3°C, within 2°C, with 1°C and more preferably the same annealing temperature, the same melting temperature or both.
  • Primer pairs preferably generate amplicons of between about 500 to about 2,000 nucleotides (NT) in length that represent overlapping segment of the target, more preferably between about 600 and 1,500 NT, more preferably between about 700 and 1,300 NT, more preferably between about 800 and 1,200 NT, more preferably between about 900 and 1,100 NT, and more preferably about 1,000 NT.
  • Primers are generally between 12 NT and 45 NT in length, more preferably between 15 and 35 NT, and more preferably between about 18 and 25 NT. Although not a rule, generally longer primers have a lower GC content.
  • Exemplary primers pairs are identified for the pncA gene (see Figure 1), the H37RV gene strain (see Figure 2), the rpoB gene (see Figure 3), the GyrA gene (see Figure 4, and the katG gene (see Figure 5). These primer pairs are useful to combine in ready to use kits to simplify the sequencing of full-length genes.
  • a semiconductor sequencing protocol was determined for five genes of M. tuberculosis for determining drug resistance in MDR and XDR strains (e.g., cumulatively sequencing 11.4 kb per isolate).
  • the M. tuberculosis rpoB gene encodes a 1,178 amino acid beta subunit for an RNA dependent DNA polymerase enzyme. Mutations within an 81 -bp "core region" of the rpoB gene are responsible for approximately 95% of rifampin resistance in M. tuberculosis strains. Three of these mutations at positions 516 (D ⁇ V), 526 (H ⁇ Y/D), and 531 (S ⁇ L) constitute the majority of mutations within this region.
  • Ion Torrent sequencing revealed 1 of 3 isolates contained an uncommon arginine (R) residue (H526R) that by HAIN LPA was shown to be absent for both wild type and mutant bands (Table 1). While absence of wild type and mutant bands in a sample are interpreted as resistant according to LPA testing, there remains ambiguity since the type of amino acid change is not directly characterized. This underscores the utility of Ion Torrent sequencing for resistance surveillance, and discovery of novel amino acids in circulating MTB strains.
  • the katG gene encodes catalase peroxidase, an enzyme that converts isoniazid (INH) into the active form.
  • the majority of isoniazid resistance is associated with katG codon 315 (S315T), although mutations in the promoter region of inhA and nod also contribute to resistance.
  • S315T katG codon 315
  • Rifampin resistance is known to occur in rpoB at positions 531(S ⁇ T), 526 (H ⁇ Y/D), and 516 (D ⁇ V).
  • Pyrazinamide is a synthetic derivative of nicotinamide that has been used as a first-line drug to fight tuberculosis since 1952.
  • Standard DST for PZA is complicated due to an acidic pH requirement in vitro, which inhibits M. tuberculosis growth and complicates accurate phenotypic assessment.
  • PZA resistance is attributed to mutations in the pncA gene which encodes a pyrazinamidase. These resistance conferring mutations are numerous and include amino acid substitutions, frameshifts and stop codon mutations. Seven mutations were characterized from the 26 South African isolates assessed, including one silent mutation, 5 amino acid substitutions, and one chain termination mutation.
  • the Q122 (Stop) termination mutation (Table 3) observed in one isolate is novel, having not been reported elsewhere. The difficulty in
  • the primary target of fluoroquinolones (FQ) in M. tuberculosis is DNA gyrase, a type II topoisomerase composed of two A and B subunits encoded by the gyrA and gyrB genes, respectively.
  • the majority of resistance to second line drugs is associated with mutations in codons 1401 (A1401G), 1402 (C1402T), and 1484 (G1483T) in the 16 S ribosomal RNA rrs gene.
  • Aminoglycoside resistance is known to occur at positions 1401 (A ⁇ G), 1402 (C ⁇ T), and 1484(G ⁇ T).
  • Group 1 strains are genetic ancestors of Group 2 and Group 3 strains that link the predominately non- human mycobacterium genus (M. microti and M. bovis strains) with human M. africanum and M. tuberculosis lineages.
  • substitution mutations in katG codon 463 and gyrA codon 95 a total of 7 of 26 (27%), 18 of 26 (69%), and 1 of 26 (4%) of the African isolates characterized in this study were members of genetic Group 1, 2, and 3, respectively. Tracking Group 1 organisms is important in terms of MTB detection since several isolates belonging to genetic Group 1 lack Insertion Sequence 1661 (IS-1661), a common genetic target for several PCR-based MTB detection assays.
  • the Ion Torrent protocol for MTB drug resistance can be easily integrated into low resource settings throughout countries and regions such as Africa, India, and China.
  • the Ion Torrent methodology does not require the use of expensive ancillary equipment such as Agilent 2100 Bio Analyzer, DiaGenode Bioruptor® Sonication System, Ion OneTouch SystemTM, ultracentrifuges, or the Pippin PrepTM Workstation as current Ion Torrent protocols recommend. This is significant since these instruments and needed accessories and consumables can be expensive, require large laboratory footprints, and often require routine maintenance.
  • LPA the Ion Torrent PGM protocol provides full-length characterization of genes, making possible discovery of new amino acid substitutions that could potentially be missed by LPA since LPA is limited to only known mutations. Using the protocol, several uncommon amino acid changes in clinical field isolates have been found. Furthermore, the extensive depth of sequence coverage from the Ion Torrent allows for discovery of heterogeneous or mixed strain genetic populations within an isolate.
  • Ion Torrent sequencing permits expansion to include megabases of additional genes on a single chip.
  • the methodology of the invention is expandable beyond the five full-length MTB genes to include all 16 plus genes that currently constitute MTB drug resistance.
  • Full-length gene analysis using the Ion Torrent PGM will identify novel mutations that, when correlated to phenotypic minimal inhibitory concentration (MIC) testing, identify new tuberculosis resistant residues as well as the cumulative inhibitory effect of multiple mutations.
  • MIC phenotypic minimal inhibitory concentration
  • Megabase sequencing involves selection of primer pairs that amplify different sections of the target sequence whereby the collection of sections represent the entirety of the target sequence. Preferably the sections overlap to a degree that permits alignment of the resulting amplicons forming the complete target sequence.
  • Primer pairs are preferably designed to form amplicons with lengths of about 0.5k to about 5k nucleotides, preferably about 0.6k to about 3 k nucleotides, more preferably about 0.7k to about 2k nucleotides, and more preferably about 0.8k to about lk nucleotides.
  • Primer pairs are preferably of similar GC contact such that the annealing or hybridization temperatures are as similar or preferably within about 5°C, more preferably within about 2°C, and more preferably within about 1°C. Also preferred is that the hybridization disassociation temperatures be similar, such that annealing and disassociation occur at very similar temperature for polymerization and PCR. In annealing and disassociation, the length of the primer influences the temperature profile, thus similar length for the all or at least most of the primers is preferred. Primer lengths are preferably about 15-30 nucleotides, more preferably about 20-28 nucleotides, and more preferably about 18 to 25 nucleotides.
  • megabase sequencing can be performed when greater than about 80% of the primers share one or more characteristics, more preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more.
  • Primer pairs can be assembled into kits to facilitate full- length sequencing. Primers targeted to amplify a target sequence are added to nucleic acid obtained from samples.
  • a PCR reaction is performed with one target nucleic acid to be amplified with a mixture of all primer pairs.
  • performance of duplicate PCR analysis on identical mixtures The number of cycles can range from 10 to 50 or more and, preferably temperature cycling is performed in accordance with convention PCR temperature and reaction conditions.
  • Another embodiment of the invention is directed to methods of treating a disease or disorder caused by the at least one microorganism strain or serotype with the antimicrobial compound identified by the methods of the invention.
  • treatment comprises the targeted killing of the specific pathogen that is the causative agent of the disease or disorder.
  • the effective dose is determined from methods of the invention by assessing the phenotypic characteristics associated with the target sequence or sequences identified, and thereby selected known or testing suspected agents for treatment.
  • the therapeutically effective dose can be determined from the sequencing information obtained by the sequencing methods of the invention. For example, certain sequences, if determined to be present, are known to cause certain phenotypic characteristics, such as, for example, resistance or sensitivity to certain antibiotics or other therapeutic treatments. The presence or absence of these sequences, as well as the quantity of sequences present, can provide an indication and direction of effective treatment as well as the therapeutically effective dose for treatment.
  • kits containing reagent vessels preferably including one or more of chemical reagents, primers and polymerases for sequencing The sample to be analyzed is mixed with a reagent vessel that preferably contains chemical components sufficient to kill all pathogens present in the sample, inactivate nucleases in the sample, and maintain the integrity of the nucleic acids rendering the sample safe for transportation and subsequent manipulation, such as, for example, aqueous lysis buffer, aqueous or anhydrous transport medium, or aqueous PrimeStore Molecular Transport Medium® (described in U.S. Patent Nos. 8,084,443, 8,080,645 and 8,097,419, all of which are specifically incorporated by reference).
  • the mixture may be combined in a column, such as a micro-centrifuge column, which may be included in the kit, to aid in the extraction of nucleic acid form the sample.
  • Extracted nucleic acid is preferably combined with another chemical reagent composition such as, for example PrimeMix® (also described in U.S. Patent Publication No. 2011/0281754 entitled “Compositions and Methods for Detecting, Identifying and Quantitating Mycobacterial-Specific Nucleic Acids” filed April 25, 2011, and International Application Publication No.
  • reagent composition may contain positive control sequences, negative control sequences and/or sequences that specifically hybridize (under the desired high or low stringency hybridization conditions) to a particular target sequences that is characteristic for the presence of a pathogen.
  • Another embodiment of the invention is directed to computer readable programming that implements the methods of the invention (see Figure 12).
  • the computer readable media includes provides formats for including both specific and general information with regard to each sample.. That information can be easily centralized and stored.
  • An exemplary electronic system of the method of the invention includes at least one general-purpose computing device 100, including a processing unit (CPU) 120 and a system bus 110 that couples various system components including the system memory such as read only memory (ROM) 140 and random access memory (RAM) 150 to the processing unit 120.
  • ROM read only memory
  • RAM random access memory
  • additional system memory 130 is also available for use.
  • the electronic method may operate on a computing device with more than one CPU 120 or on a group or cluster of computing devices networked together to provide greater processing capability.
  • the system bus 110 may be any of several types of bus structures including a memory bus or memory controller, a peripheral bus, and a local bus using any of a variety of bus architectures.
  • a basic input/output (BIOS) stored in ROM 140 or the like may provide the basic routine that helps to transfer information between elements within the computing device 100, such as during start-up.
  • the computing device 100 further includes storage devices such as a hard disk drive 160, a magnetic disk drive, an optical disk drive, tape drive or the like.
  • the storage device 160 is connected to the system bus 110 by a drive interface.
  • the drives and the associated computer readable media provide nonvolatile storage of computer readable instructions, data structures, program modules and other data for the computing device 100.
  • the basic components are known to those of skill in the art and appropriate variations are contemplated depending on the type of device, such as whether the device is a small, handheld computing device, a desktop computer, a computer server, a handheld scanning device, or a wireless devices, including wireless Personal Digital Assistants ("PDAs”), tablet devices, wireless web-enabled or “smart” phones.
  • PDAs Personal Digital Assistants
  • tablet devices wireless web-enabled or "smart” phones.
  • the system is technology agnostic.
  • the exemplary environment described herein employs the hard disk, other types of computer-readable media that can store data that are accessible by a computer, such as magnetic cassettes, flash memory cards, digital versatile disks, cartridges, random access memories (RAMs), read only memory (ROM), a cable or wireless signal containing a bit stream and the like, may also be used in the exemplary operating environment.
  • RAMs random access memories
  • ROM read only memory
  • an input device 190 represents any number of input mechanisms, such as a microphone for speech, a touch- sensitive screen for gesture or graphical input, keyboard, mouse, motion input, speech, game console controller, TV remote and so forth.
  • the output device 170 can be one or more of a number of output mechanisms known to those of skill in the art, for example, printers, monitors, projectors, speakers, and plotters.
  • the output can be via a network interface, for example uploading to a website, emailing, attached to or placed within other electronic files, and sending an SMS or MMS message.
  • multimodal systems enable a user to provide multiple types of input to communicate with the computing device 100.
  • the communications interface 180 generally governs and manages the user input and system output. There is no restriction on the invention operating on any particular hardware arrangement and therefore the basic features here may easily be substituted for improved hardware or firmware arrangements as they are developed.
  • the illustrative system embodiment is presented as comprising individual functional blocks (including functional blocks labeled as a "processor").
  • the functions these blocks represent may be provided through the use of either shared or dedicated hardware, including, but not limited to, hardware capable of executing software.
  • the functions of one or more processors presented in FIG. 1 may be provided by a single shared processor or multiple processors.
  • processors User's Control
  • Illustrative embodiments may comprise microprocessor and/or digital signal processor (DSP) hardware, read-only memory (ROM) for storing software performing the operations discussed below, and random access memory (RAM) for storing results.
  • DSP digital signal processor
  • ROM read-only memory
  • RAM random access memory
  • VLSI Very large scale integration
  • Embodiments within the scope of the present invention may also include computer-readable media for carrying or having computer-executable instructions or data structures stored thereon.
  • Such computer-readable media can be any available media that can be accessed by a general purpose or special purpose computer.
  • Such computer-readable media can comprise RAM, ROM, EEPROM, CD-ROM or other optical disk storage, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to carry or store desired program code means in the form of computer-executable instructions or data structures.
  • Computer-executable instructions include, for example, instructions and data which cause a general purpose computer, special purpose computer, or special purpose processing device to perform a certain function or group of functions.
  • Computer- executable instructions also include program modules that are executed by computers in stand-alone or network environments.
  • program modules include routines, programs, objects, components, and data structures, etc. that performs particular tasks or implement particular abstract data types.
  • Computer-executable instructions, associated data structures, and program modules represent examples of the program code means for executing steps of the methods disclosed herein. The particular sequence of such executable instructions or associated data structures represents examples of corresponding acts for implementing the functions described in such steps.
  • Preferred embodiments of the invention may be practiced in network computing environments with many types of computer system configurations, including personal computers, hand-held devices, multi-processor systems, microprocessor-based or programmable consumer electronics, network PCs, minicomputers, mainframe computers, and the like.
  • Networks may include the Internet, one or more Local Area Networks ("LANs”), one or more Metropolitan Area Networks ("MANs”), one or more Wide Area Networks ("WANs”), one or more Intranets, etc.
  • LANs Local Area Networks
  • MANs Metropolitan Area Networks
  • WANs Wide Area Networks
  • Intranets etc.
  • Embodiments may also be practiced in distributed computing environments where tasks are performed by local and remote processing devices that are linked (either by hardwired links, wireless links, or by a combination thereof) through a communications network.
  • program modules may be located in both local and remote memory storage devices.
  • the computer-readable media is connected to the Internet and can access publically available databases, such as for example, PubMed or GeneBank and retrieve sequence and related information regarding the microorganism being analyzed including the DNA, RNA and/or protein sequence of one or more genes or portions of genes of the microorganism.
  • the sequences being analyzed by, for example, Ion Torrent sequencing is compared with one or more (e.g., 1, 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 , or even greater numbers) known sequences of the same or similar microorganism or other synthetic or recombinant sequences. Results achieved can provide a rapid and thorough analysis of the gene or gene portion as compared with dozens, hundreds or even thousands of known sequences. Mutations that represent resistance can be easily and rapidly determined and identified.
  • Phenotypic resistance for first and second line drugs was performed using the MGITTM 960 System as previously described.
  • Critical concentrations for ofloxacin and kanamycin (second line drugs) were 2.0 ⁇ g/mL and 5.0 ⁇ g/mL, respectively.
  • Resistance to first and second line drugs was determined using standard diagnostics algorithms.
  • Primer pairs for rpoB (2 sets of primers), katG, pncA, gyrA, and rrs (16s) gene amplification were designed using the genome sequence of M. tuberculosis H37Rv strain as reference (GenBank accession no. NC_000962). Primer secondary structure, melting temperature, and potential primer-dimer formation were determined using LaserGene 9.1 (DNAStar, Madison, WI) and PrimerExpress 3.0 (Life Technologies, Foster City, CA). All oligonucleotides were synthesized using standard, de-salted primers (Integrated DNA Technologies (IDT), San Diego, CA). PCR Amplification.
  • Amplification reactions for all MTB gene targets were designed and optimized to be used under one standardized set of thermocycling parameters. All PCR 'mastermixes' were prepared using Platinum Taq DNA Polymerase, 10X Buffer, and 50 mM MgCl 2 (P N 10966-034; Life Technologies, Foster City, CA). Amplification was carried out in a 50 ⁇ final volume reaction mixture containing 24.1 ⁇ Ambion Nuclease-Free Water (Cat No.
  • Reactions were carried out in MicroAmp Optical 96-Well Reaction Plates (P/N N801-0560, Life Technologies, Foster City, CA) and capped using MicroAmp 8-Cap Strips (P/N 4323032, Life Technologies, Foster City, CA). Amplification was performed using an ABI 2720 thermocycler (Life Technologies, Foster City, CA). Thermocycling parameters were 95°C for 2 minutes, followed by 40 cycles at 95°C for 30 seconds, 55°C for 15 seconds, and 72°C for 2 minutes with final extension at 72°C for 5 minutes.
  • Ion Torrent Library Preparation Barcoded libraries were generated using the Ion Xpress Plus Fragment Library Kit (Cat No. 4471269, Life Technologies, Foster City, CA) and the Ion Xpress DNA Barcoding 1-16 Kit (Cat No. 4468654, Life Technologies, Foster City, CA) according to a modified version of the protocol outlined in the Ion Xpress Plus gDNA and Amplicon Library Preparation.
  • DNA shearing was performed using 1-3 ⁇ g DNA containing an approximate equimolar pool of rpoB, katG, pncA, gyrA, and rrs (16s) gene amplicons.
  • DNA shearing was performed in a 50 ⁇ total reaction volume by combining 5 ⁇ Ion Shear Plus 10X Reaction Buffer, 10 ⁇ enzyme, and 35 ⁇ pooled DNA template (Ion Xpress Plus Fragment Library Kit, Cat No. 4471269, Life Technologies, Foster City, CA). The reaction mixture was incubated at 37°C for 45 minutes, terminated using 5 ⁇ Ion Shear Stop Buffer, and stored on ice until purification.
  • Sheared DNA was purified using Agencourt Ampure XP-PCR Purification beads (P/N A63880; Beckman Coulter, Brea, CA) with Dynal magnetic bead stand (Cat No. 123-21D; Life Technologies, Foster City, CA) according to manufacturer's recommendations. Briefly, 99 ⁇ Agencourt beads was mixed with 50 ⁇ ion shear reaction, incubated for 5 minutes at room temperature, placed on a magnetic stand, washed twice with 70% (v/v) ethanol, and eluted using 12 ⁇ Low TE Buffer (Cat No. 602-1155-010; Life Technologies Inc., Foster City, CA).
  • Adaptor Ligation was performed in a 0.2 mL low bind PCR tube (P/N PCR-02-L-C; Axygen Inc., Union City, CA) by combining 12 ⁇ sheared amplicon with 1.25 ⁇ Ligase Buffer, 1.25 ⁇ Pl-IA Adaptor Mix (Ion DNA Barcoding 1-16 Kit, Cat No. 4468654 Life Technologies, Foster City, CA) and 0.2 ⁇ DNA Ligase (Ion Xpress Plus Fragment Library Kit, Cat No. 4471269, Life Technologies, Foster City, CA). The mixture was pipetted up and down 5 times and incubated at room temperature (22-25°C) for 30 minutes.
  • Adaptor ligation reactions were purified and eluted in 10 ⁇ Low TE Buffer using the Agencourt Ampure XP-PCR Purification beads (P/N A63880; Beckman Coulter, Brea, CA) with the Dynal magnetic bead stand (Cat No. 123-21D; Life Technologies, Foster City, CA) according to manufacturer's recommendations ..
  • Thermocycling parameters comprised 72°C for 20 minutes, 95°C for 5 minutes, followed by 10 cycles of 95°C for 15 seconds, 58°C for 15 seconds and 68°C for 1 minute.
  • bar-coded samples were purified and eluted in 50 ⁇ of Low TE (Cat No. 602-1155-010; Life Technologies, Foster City, CA) using the MinElute Reaction Cleanup Kit (Cat No. 28204; Qiagen, Germantown, MD) according to manufacturer's instructions. DNA concentration and purity was determined by spectrophotometric analysis using a NanoDrop ND 1000 (Thermo Fischer Scientific, Wilmington, DE).
  • Ranges for purified bar-coded samples are typically 150-300 ng/ ⁇ with A260/280 purity of 1.7-1.9. Equimolar concentrations (-2-3 ⁇ g of each bar-coded sample) were combined into a single 1.5 mL nuclease-free microcentrifuge tube and used for size selection.
  • Size estimations were determined using a Tracklt 1 kb Plus DNA Ladder (P/N 10488-085; Life Technologies, Foster City, CA). Gel excision was performed under UV transillumination using a sterile scalpel blade excising out a target region between 75-200 bp. Excised agarose gel slices were placed into sterile 1.5 mL microcentrifuge tubes and subjected to DNA purification using the PureLink Quick Gel Extraction Kit (Cat No. K210012; Life Technologies, Foster City, CA) according to manufacturer's instructions. Concentration and purity values for the barcoded DNA library were determined spectrophotometrically using a NanoDrop ND 1000 (Thermo Fischer Scientific, Wilmington, DE). The recommended library input for emulsion PCR is -140-560 x 10 6 molecules per 18 ⁇ . This range was achieved by a 1: 1000 dilution using library stock and nuclease-free water.
  • Emulsion Polymerase Chain Reaction was performed in a 1 mL reaction volume using the Ion Template Preparation Kit (Cat No. 4469000; Life Technologies, Foster City, CA) by adding 582 ⁇ nuclease-free water, 200 ⁇ 5X PCR Reagent Mix, 100 ⁇ 10X PCR Enzyme Mix, 100 ⁇ Ion Sphere Particles, and 18 ⁇ diluted library template. The preparation was mixed thoroughly followed by brief centrifugation in a microcentrifuge. Emulsion was achieved using the Ultra- Turrax Tube Drive (Life Technologies, Foster City, CA). A total of 9 mL chilled Emulsion Oil (Ion Torrent Preparation Kit; Cat No.
  • the mixed emulsion was transferred to a 96- well PCR plate and amplified using an ABI 2720 thermocycler (Life Technologies, Foster City, CA) using the following thermocycling parameters: 94°C for 6 minutes, followed by 40 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 90 seconds; followed by 5 cycles at 94°C for 30 seconds, and 68°C for 6 minutes.
  • thermocycler Life Technologies, Foster City, CA
  • Ion Sphere Particle (ISP) Recovery and Qubit Measurement Ion Sphere Particles were recovered using reagents supplied in the Ion Xpress Template Kit (Cat No. 4469001, Life Technologies, Foster City, CA) according to manufacturer's protocol (Ion Xpress Template Kit User Guide v2.0, pages 18-19). Quantification of recovered particles was performed using a Qubit 2.0 Fluorometer (Life Technologies, Foster City, CA) and an Ion Sphere Quality Control Kit (Cat No. 4468656, Life Technologies, Foster City, CA) according to manufacturer's recommendations (Ion Xpress Template Kit User Guide, page 25-26). The optimal amount of template-positive ion sphere particles (ISPs) is between 4-50%. Relative fluorescent unit (RFU) values obtained outside of this range were not pursued into subsequent ISP enrichment.
  • REU Relative fluorescent unit
  • ISP Enrichment ISPs were enriched using reagents supplied in the Ion Xpress Template Kit, Ion Sequencing Kit, and DynaBeads MyOne Streptavidin CI beads (Cat Nos. 4469001, 4468997 and 650.01 respectively; Life Technologies, Foster City, CA) according to the manufacturer's protocols (Ion Xpress Template Kit User Guide v2.0, pages 15-17).
  • Ion Torrent 314 Chip Preparation and PGM Sequencing Ion Torrent 314 Chips (Cat No. 4462923; Life Technologies, Foster City, CA) were prepared and loaded according to manufacturer's recommendation (Ion Sequencing Kit User Guide v 2.0). The Ion Torrent PGM was run according to Ion Torrent 314 Chip specifications including a 65 -cycle sequencing protocol, use of 18 megaOhm purified water, and standard compressed argon gas to drive fluidics through the PGM system. All rpoB, katG, pncA, gyrA and rrs genes and corresponding proteins were deposited into GenBank (accession numbers JX303203-JX303332).
  • Gyrase PCR for the Detection of TB vs. 6110 PCR assay.
  • the gyrase target for OCR and whole Gyrase gene sequencing on the Ion Torrent PGM can also be used to identify TB mutations that lead to resistance.
  • This second PCR target allows for the accurate analysis of TB strains that may not include the entire IS6110 insertion element. While the IS6110 assay has multiple gene copies in most strains, some have only one. As shown in Figures 6, 7 and 8, this Gyrase assay has a generally higher cycle threshold in comparison to the IS6110 assay due to multiple IS6110 gene copies in those isolates and thus more sensitivity. Thus any possible TB mutation can be followed- even away from the detection site by this method of full gene sequencing.
  • Phenotypic and genotypic results Amino Acid characterization of 26 M. tuberculosis isolates by Ion Torrent sequencing of rpoB, katG, pncA, gyrA, and rrs (16s) genes are summarized in Tables 1-5, respectively, and compared to BACTECTM MGITTM 960 (phenotypic), and/or HAIN GenoType® MTBDRp/ws (genotypic) LP A. Of the 26 MTB clinical isolates, 14 (54%) were MDR, 7 (27%) were XDR, and 5 (19%) were sensitive to drugs by BACTECTM MGITTM 960 phenotypic analysis.
  • the Ion Torrent PGM sequencing method showed 100% (26/26) concordance to both phenotypic resistance obtained by MGITTM 960 culture (Tables 1-5) and genotypic rpoB and katG data obtained by Hain LPA (Table 1, 2).
  • rpoB gene mutations A total of 10 rpoB amino acid substitutions were identified in the 26 clinical isolates compared to the H37Rv wild type strain.
  • the common S531L mutation was the most prevalent, but mutations in codons 516 and 526, also known to confer resistance to rifampin were observed (Table 1). Additionally, mutations were observed within the rpoB open reading frame but outside of the 81-basepair rifampin resistance-determining region (RRDR; Table 1).
  • the VI 941 mutation observed outside of the RRDR in one strain is a unique substitution that is likely not associated with rifampin resistance. Five amino acid substitutions were noted in at least one strain beyond residue position 900 of the rpoB protein.
  • Ion Torrent sequencing revealed an uncommon amino acid substitution (i.e., glycine) within a known mutation site at position 516 where a valine (V) substitution (D516V) is typically known to occur (Table 2).
  • Ion Torrent sequencing revealed an arginine (R) within a known mutation site at position 526 where tyrosine (Y) or aspartic acid (D) substitutions (H526Y/D) typically occur.
  • katG gene mutations Four amino acid substitutions were observed in the katG gene with S315T which is known to confer isoniazid resistance present in all resistant strains (Table 2). Clinical strains harboring R463L, W191R, and N138H mutations were detected by DST (Table 2) and have been previously characterized. A substitution at position 463 (R463L) in katG has been previously shown to have no effect on antibiotic resistance and can be used to categorize M. tuberculosis isolates into genetic Groups 1 (Arg463) or 2/3 (Leu463). Of 26 clinical isolates assessed, 7 (27%) were members of genetic Group 1 as evident by this R463L substitution.
  • pncA gene mutations Seven nucleotide mutations were noted in at least one strain among 561 bps comprising the full-length coding region for the pncA gene (Table 3). Nine of 26 strains (34.6%) contained an amino acid mutation conferring pyrazinamide resistance (Table 3). In one strain, a silent (synonymous) nucleotide mutation was characterized at nucleotide position 195 (C195T). Five strains contained previously characterized amino acid substitutions (C14R, A102V, V139G, R154G, and L172P) known to confer resistance to pyrazinamide. A novel mutation, not previously reported elsewhere, encoding a termination stop codon was found in one isolate at residue 122 (Q122Stop) in the pncA protein (Table 3).
  • Influenza virus genome was mass amplified by reverse transcription (RT) and certain amplified cDNA populations subjected to PCR. Each result was then analyzed using the Ion Torrent sequencing protocol. RT and/or RT-PCR analysis was performed with uniform hexamers, Uni 12, and/or 24 different influenza-specific primers (different in both length and sequence). Uniform hexamers comprise a collection of primers, each six nucleotides in length whereby the collections contain all of sequence iterations of the six nucleotides.
  • Uni 12 is primer that contains a sequence that is complimentary to 12 nucleotides at the 3' terminus of each of the segments of the influenza H3N2 viral genome (5 '- ACGCGTGATCAGCAAAAGCAGG; SEQ ID NO 13). As shown in Figure 9, Track 4 amplification and sequencing with hexamer primers and Uni 12 followed by PCR amplification with the 24 influenza-specific primers and Ion Torrent protocol sequencing identified about 70% of the influenza genome.
  • Sequencing of pncA gene The gene sequence of pncA for PZA resistance was determined using a series of primers spaced or "tiled" along the pncA gene in accordance with the invention and compared to results achieved with traditional Sanger sequencing.
  • the coding sequence of the pncA gene is depicted in Figure 11A and the primers utilized are depicted in Figure 11B in bold and underlined. Using these primers in conjunction with Ion Torrent methodology, the entire coding regions of pncA was determined (see P1-P4 of Figure 1 IB). Expanding the primers utilized to all genes or of specific regions allows for one-step sequencing of the entire genome.
  • WC2601/2 showed a T135 mutation had no corresponding mutation by Sanger sequencing.
  • the mutation was heterogeneous with 61% of cells containing the mutation with 29% as wildtype.
  • ML1440/2 a S59P mutation was identified with no corresponding mutation by Sanger sequencing.
  • the mutation was heterogeneous with 95% containing the mutation with 5% wild-type.
  • Rapid characterization of drug resistance genes directly from patient sputum samples The methods of the invention address a need for performing rapid characterization of drug resistance genes from patient sputum samples obtained from, for example, remote areas.
  • the method includes collection to analysis of MTB rpoB and pncA genes that confer resistance to first line drugs, rifampicin and pyrazinamide, respectively.
  • the methodology employs ambient temperature shipment of sputum in PrimeStore Molecular Transport Medium (MTM), nucleic acid extraction, gene amplification and sequencing directly from sputum for MTB drug resistance characterization.
  • MTM PrimeStore Molecular Transport Medium
  • PS -MTM molecular transport medium
  • PS -MTM is a clinical transport solution that inactivates microbes including M. tuberculosis, and preserves and stabilizes released RNA/DNA for safe, ambient temperature shipment.
  • PS -MTM tubes containing sputum were all shipped from South Africa to a fully equipped facility in San Antonio, Texas at ambient temperature using a commercial carrier.
  • Total genomic DNA was purified using the PrimeXtract kit (Longhorn Vaccines and Diagnostics, San Antonio, TX, USA) according to manufacturer's recommendations.
  • Real-time PCR amplification of MTB was performed using PrimeMix TB® (PM-PCR), an all-inclusive reagent blend that targets the highly conserved MTB IS6110 region.
  • PCR amplification using MTB primers for pncA and rpoB were performed as previously described.
  • Primers for rpoB (1,625 bps) and pncA (960 bps) amplify a portion of the gene containing the full rpoB determining region and the promoter plus full coding region of the pncA gene, respectively.
  • pncA and rpoB gene amplicons were prepared using the Nextera XT Sample Prep Kit.
  • MiSeq NGS was performed according to manufacturer's instructions (Illumina, San Diego, CA, USA) using MiSeq Reagent Kit (V3) with 600 cycles.
  • Bioinformatics were performed using SeqMan NGen (V8) and LaserGene (V12) Core Suite (DNAStar, Inc, USA) with genetic comparison to the H37Rv reference strain.
  • Wt wild-type according to H37Rv strain.
  • # mutation at position 526 of the rpoB gene is known for resistance mutation .
  • This example also demonstrates the feasibility of transporting sputum specimens efficiently to central and regional labs to provide support to rural clinics. Without adding extra training staff or infrastructure, patient sputum specimens from rural areas can be transported to labs with highly trained personnel and state of the art equipment to support MTB patient care surveillance and research.
  • MTB Mycobacterium tuberculosis
  • NGS next- generation sequencing

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé amélioré d'analyse rapide et peu coûteuse de séquences d'un microorganisme par séquençage à semi-conducteurs et, de préférence, séquençage Ion Torrent. Le procédé permet une analyse pleine longueur et de plusieurs zones (par exemples gènes) de multiples génomes. Ces procédés permettent d'identifier les mutation génétiques d'un gène particulier, mutations responsables de la résistance ou de la sensibilité à un antibiotique ou à un autre composé chimique. De multiples espèces, souches et/ou sérotypes différents d'un organisme particulier sont rapidement et efficacement passés au crible et les mutations peuvent être identifiées en même temps que le génome complet d'un organisme. Grâce à la sélection de paires d'amorces de taille et de teneur en GC similaires produisant des produits d'amplification dont les séquences recouvrent l'intégralité du génome, une unique réaction de PCR analysée par la méthodologie Ion Torrent peut permettre de déterminer la séquence d'un génome entier. Les procédés de l'invention s'avèrent utiles pour séquencer le génome d'agents viraux, comme les virus de la grippe, et d'agents bactériens, comme les bactéries responsables de la tuberculose.
PCT/US2014/062889 2012-05-09 2014-10-29 Méthodes de séquençage génomique de nouvelle génération WO2015066174A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA2929108A CA2929108A1 (fr) 2013-10-29 2014-10-29 Methodes de sequencage genomique de nouvelle generation
AU2014342414A AU2014342414B2 (en) 2012-05-09 2014-10-29 Next generation genomic sequencing methods
EP14856946.0A EP3063301A4 (fr) 2013-10-29 2014-10-29 Méthodes de séquençage génomique de nouvelle génération
CN201480071698.4A CN106170560A (zh) 2013-10-29 2014-10-29 下一代基因组测序方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361897015P 2013-10-29 2013-10-29
US61/897,015 2013-10-29

Publications (1)

Publication Number Publication Date
WO2015066174A1 true WO2015066174A1 (fr) 2015-05-07

Family

ID=53005068

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/062889 WO2015066174A1 (fr) 2012-05-09 2014-10-29 Méthodes de séquençage génomique de nouvelle génération

Country Status (5)

Country Link
EP (1) EP3063301A4 (fr)
CN (1) CN106170560A (fr)
AU (1) AU2014342414B2 (fr)
CA (1) CA2929108A1 (fr)
WO (1) WO2015066174A1 (fr)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105950726A (zh) * 2016-05-16 2016-09-21 杭州市疾病预防控制中心 结核分枝杆菌吡嗪酰胺分子药敏的检测方法
WO2017091809A1 (fr) * 2015-11-25 2017-06-01 Longhorn Vaccines And Diagnostics, Llc Compositions et procédés de détection et de quantification de séquences d'acides nucléiques dans des échantillons sanguins
WO2018094263A1 (fr) 2016-11-18 2018-05-24 Twist Bioscience Corporation Banques de polynucléotides à stœchiométrie contrôlée et leur procédé de synthèse
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US10975372B2 (en) 2016-08-22 2021-04-13 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US11041216B2 (en) 2007-10-01 2021-06-22 Longhorn Vaccines And Diagnostics, Llc Compositions and methods for detecting and quantifying nucleic acid sequences in blood samples
US11185837B2 (en) 2013-08-05 2021-11-30 Twist Bioscience Corporation De novo synthesized gene libraries
US11263354B2 (en) 2016-09-21 2022-03-01 Twist Bioscience Corporation Nucleic acid based data storage
US11332740B2 (en) 2017-06-12 2022-05-17 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11985923B2 (en) 2017-09-25 2024-05-21 Multiple Energy Technologies Llc Bioceramic and carbon-based hydroponic systems, methods and devices

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112236526A (zh) * 2018-04-20 2021-01-15 长角牛疫苗和诊断有限责任公司 用于检测微生物抗性的快速方法
CN112779343A (zh) * 2019-11-07 2021-05-11 杭州迪安医学检验中心有限公司 一种病原微生物药敏检测方法
CN112410406A (zh) * 2020-11-23 2021-02-26 深圳基因家科技有限公司 一种确定文库扩增循环数的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100285479A1 (en) * 2008-02-22 2010-11-11 Great Basin Scientific Systems and methods for point-of-care amplification and detection of polynucleotides
US20130302789A1 (en) * 2012-05-09 2013-11-14 Longhorn Vaccines And Diagnostics, Llc Ion Torrent Genomic Sequencing

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8652782B2 (en) * 2006-09-12 2014-02-18 Longhorn Vaccines & Diagnostics, Llc Compositions and methods for detecting, identifying and quantitating mycobacterial-specific nucleic acids
CN102250924A (zh) * 2010-05-17 2011-11-23 中国疾病预防控制中心病毒病预防控制所 盖塔病毒全基因组序列、扩增方法及引物
EP2616555B1 (fr) * 2010-09-16 2017-11-08 Gen-Probe Incorporated Sondes de capture immobilisables par l'intermédiaire d'une queue nucléotidique l
WO2013022961A1 (fr) * 2011-08-08 2013-02-14 3The Broad Institute Compositions et procédés pour la co-amplification de sous-séquences d'une séquence de fragment d'acide nucléique

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100285479A1 (en) * 2008-02-22 2010-11-11 Great Basin Scientific Systems and methods for point-of-care amplification and detection of polynucleotides
US20130302789A1 (en) * 2012-05-09 2013-11-14 Longhorn Vaccines And Diagnostics, Llc Ion Torrent Genomic Sequencing

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DAUM ET AL.: "Characterization of multi-drug resistant Mycobacterium tuberculosis from immigrants residing in the USA using lon torrent full- gene sequencing", EPIDEMIOLOGY AND INFECTION, vol. 142, no. 6, 27 September 2013 (2013-09-27), pages 1328 - 1333, XP055199498 *
DAUM ET AL.: "Next-Generation lon Torrent Sequencing of Drug Resistance Mutations in Mycobacterium tuberculosis Strains", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 50, no. 12, 12 September 2012 (2012-09-12), pages 3831 - 3837, XP055135559 *
See also references of EP3063301A4 *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11041216B2 (en) 2007-10-01 2021-06-22 Longhorn Vaccines And Diagnostics, Llc Compositions and methods for detecting and quantifying nucleic acid sequences in blood samples
US11185837B2 (en) 2013-08-05 2021-11-30 Twist Bioscience Corporation De novo synthesized gene libraries
US11452980B2 (en) 2013-08-05 2022-09-27 Twist Bioscience Corporation De novo synthesized gene libraries
US11559778B2 (en) 2013-08-05 2023-01-24 Twist Bioscience Corporation De novo synthesized gene libraries
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
WO2017091809A1 (fr) * 2015-11-25 2017-06-01 Longhorn Vaccines And Diagnostics, Llc Compositions et procédés de détection et de quantification de séquences d'acides nucléiques dans des échantillons sanguins
CN105950726A (zh) * 2016-05-16 2016-09-21 杭州市疾病预防控制中心 结核分枝杆菌吡嗪酰胺分子药敏的检测方法
US10975372B2 (en) 2016-08-22 2021-04-13 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US11562103B2 (en) 2016-09-21 2023-01-24 Twist Bioscience Corporation Nucleic acid based data storage
US11263354B2 (en) 2016-09-21 2022-03-01 Twist Bioscience Corporation Nucleic acid based data storage
EP3541973A4 (fr) * 2016-11-18 2020-07-29 Twist Bioscience Corporation Banques de polynucléotides à st chiométrie contrôlée et leur procédé de synthèse
CN110382752A (zh) * 2016-11-18 2019-10-25 特韦斯特生物科学公司 具有受控化学计量的多核苷酸文库及其合成
WO2018094263A1 (fr) 2016-11-18 2018-05-24 Twist Bioscience Corporation Banques de polynucléotides à stœchiométrie contrôlée et leur procédé de synthèse
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11332740B2 (en) 2017-06-12 2022-05-17 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
US11985923B2 (en) 2017-09-25 2024-05-21 Multiple Energy Technologies Llc Bioceramic and carbon-based hydroponic systems, methods and devices
US11745159B2 (en) 2017-10-20 2023-09-05 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11732294B2 (en) 2018-05-18 2023-08-22 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly

Also Published As

Publication number Publication date
AU2014342414B2 (en) 2017-06-29
EP3063301A1 (fr) 2016-09-07
AU2014342414A1 (en) 2016-05-19
CA2929108A1 (fr) 2015-05-07
EP3063301A4 (fr) 2017-07-19
CN106170560A (zh) 2016-11-30

Similar Documents

Publication Publication Date Title
US11186867B2 (en) Next generation genomic sequencing methods
AU2014342414B2 (en) Next generation genomic sequencing methods
AU2017203556B2 (en) Ion torrent genomic sequencing
Daum et al. Next-generation ion torrent sequencing of drug resistance mutations in Mycobacterium tuberculosis strains
JP2022501039A (ja) 核酸を検出する方法
US20220145375A1 (en) Methods and kits to identify klebsiella strains
McManus et al. Multilocus sequence typing reveals that the population structure of Candida dubliniensis is significantly less divergent than that of Candida albicans
Isola et al. A Pyrosequencing assay for rapid recognition of SNPs in Mycobacterium tuberculosis embB306 region
Hoang et al. Long-reads-based metagenomics in clinical diagnosis with a special focus on fungal infections
US20240167107A1 (en) Composition and method for nucleic acid detection
Oliveira et al. Feasibility of mitochondrial single nucleotide polymorphisms to detect and identify Aspergillus fumigatus in clinical samples
CN108660252B (zh) 一种基于焦磷酸测序的人类免疫缺陷病毒耐药性分析方法
AU2019375773B2 (en) Rapid PCR methodology
ES2843848T3 (es) Ensayo de referencia para múltiples copias
Nafea et al. Application of next-generation sequencing to identify different pathogens
Ziarsolo et al. K-seq, an affordable, reliable, and open Klenow NGS-based genotyping technology
Paun et al. Rapid detection, quantification and speciation of Leishmania using real-time PCR and DNA sequencing at the rRNA Internal Transcribed Spacer 2
Tollenaere et al. SNP Design from 454 Sequencing of Podosphaera plantaginis Transcriptome
Stead Detection of mixed Mycobacterium tuberculosis infections in South African TB patients
WO2010041444A1 (fr) Procédé pour la détection d'un intégron, procédé pour la détection de la pollution par un intégron dans l'environnement et paire d'amorces

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14856946

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2929108

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2014856946

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014856946

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2014342414

Country of ref document: AU

Date of ref document: 20141029

Kind code of ref document: A