WO2015042564A1 - Méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (ttr) - Google Patents

Méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (ttr) Download PDF

Info

Publication number
WO2015042564A1
WO2015042564A1 PCT/US2014/056923 US2014056923W WO2015042564A1 WO 2015042564 A1 WO2015042564 A1 WO 2015042564A1 US 2014056923 W US2014056923 W US 2014056923W WO 2015042564 A1 WO2015042564 A1 WO 2015042564A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
rnai agent
ttr
nucleotides
administered
Prior art date
Application number
PCT/US2014/056923
Other languages
English (en)
Other versions
WO2015042564A8 (fr
Inventor
Kallanthottahil G. Rajeev
Tracy Zimmermann
Muthiah Manoharan
Martin Maier
Satyanarayana Kuchimanchi
Klaus CHARISSE
Original Assignee
Alnylam Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals, Inc. filed Critical Alnylam Pharmaceuticals, Inc.
Publication of WO2015042564A1 publication Critical patent/WO2015042564A1/fr
Publication of WO2015042564A8 publication Critical patent/WO2015042564A8/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol

Definitions

  • Transthyretin (also known as prealbumin) is found in serum and cerebrospinal fluid (CSF). TTR transports retinol-binding protein (RBP) and thyroxine (T4) and also acts as a carrier of retinol (vitamin A) through its association with RBP in the blood and the CSF. Transthyretin is named for its transport of thyroxine and retinol. TTR also functions as a protease and can cleave proteins including apoA-I (the major HDL apolipoprotein), amyloid ⁇ -peptide, and neuropeptide Y. See Liz, M.A. et al. (2010) IUBMB Life, 62(6):429-435.
  • apoA-I the major HDL apolipoprotein
  • amyloid ⁇ -peptide amyloid ⁇ -peptide
  • neuropeptide Y neuropeptide Y. See Liz, M.A. et al. (2010) IUBMB Life,
  • TTR is a tetramer of four identical 127-amino acid subunits (monomers) that are rich in beta sheet structure. Each monomer has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel.
  • the liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium) and pancreas.
  • Amyloidosis is a general term for the group of amyloid diseases that are characterized by amyloid deposits. Amyloid diseases are classified based on their precursor protein; for example, the name starts with "A” for amyloid and is followed by an abbreviation of the precursor protein, e.g., ATTR for amloidogenic transthyretin. Ibid.
  • TTR-associated diseases There are numerous TTR-associated diseases, most of which are amyloid diseases.
  • Normal-sequence TTR is associated with cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis).
  • SSA senile systemic amyloidosis
  • SCA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac amyloidosis
  • SSA senile cardiac
  • Abnormal amyloidogenic proteins may be either inherited or acquired through somatic mutations. Guan, J. et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am J Physiol Heart Circ Physiol, doi: 10.1152/ajpheart.00815.2011. Transthyretin associated ATTR is the most frequent form of hereditary systemic amyloidosis. Lobato, L. (2003) J. Nephrol., 16:438-442. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. TTR mutations usually give rise to systemic amyloid deposition, with particular involvement of the peripheral nervous system, although some mutations are associated with cardiomyopathy or vitreous opacities. Ibid.
  • the V30M mutation is the most prevalent TTR mutation. See, e.g., Lobato, L. (2003) J Nephrol, 16:438-442.
  • the V122I mutation is carried by 3.9% of the African American population and is the most common cause of FAC. Jacobson, D.R. et al.
  • the present invention provides methods of treating or preventing a TTR- associated disease in a subject using the RNAi agents, e.g. double stranded RNAi agents, of the invention, targeting the Transthyretin (TTR) gene.
  • RNAi agents e.g. double stranded RNAi agents
  • TTR Transthyretin
  • the present invention is based, at least in part, on the discovery that RNAi agents that comprise particular chemical modifications show a superior ability to inhibit expression of TTR.
  • Agents including a certain pattern of chemical modifications (e.g., an alternating pattern) and a ligand are shown herein to be effective in silencing the activity of the TTR gene.
  • consecutive nucleotides show surprisingly enhanced TTR gene silencing activity.
  • a single such chemical motif is present in the agent, it is preferred to be at or near the cleavage region for enhancing of the gene silencing activity.
  • Cleavage region is the region surrounding the cleavage site, i.e., the site on the target mRNA at which cleavage occurs.
  • the present invention provides methods of treating or preventing a TTR-associated disease in a subject.
  • the methods include administering to the subject an RNAi agent at a dose of about 7.5 mg/kg, daily for five days, followed by a dose of about 7.5 mg/kg weekly for about five weeks, thereby treating or preventing the TTR-associated disease in the subject.
  • RNAi agents suitable for use in the methods of the invention include double stranded RNAi agents RNAi agents, e.g., double stranded RNAi agents, that inhibit expression of a transthyretin (TTR) gene.
  • TTR transthyretin
  • the double stranded RNAi agent includes a sense strand complementary to an antisense strand.
  • the antisense strand includes a region complementary to a part of an mRNA encoding transthyretin. Each strand has 14 to 30 nucleotides, and the double stranded RNAi agent is represented by formula (III):
  • the sense strand is conjugated to at least one ligand, e.g. , at least one ligand, e.g., at least one ligand attached to the 3' end of the sense strand.
  • the ligand may be conjugated to the antisense strand.
  • the present invention provides methods of treating or preventing a TTR-associated disease in a subject.
  • the methods include administering to the subject an RNAi agent at a dose of about 500 mg, daily for five days, followed by a weekly dose of about 500 mg, thereby treating or preventing the TTR-associated disease in the subject.
  • RNAi agents suitable for use in the methods of the invention include double stranded RNAi agents RNAi agents, e.g. , double stranded RNAi agents, that inhibit expression of a transthyretin (TTR) gene.
  • TTR transthyretin
  • the double stranded RNAi agent includes a sense strand complementary to an antisense strand.
  • the antisense strand includes a region complementary to a part of an mRNA encoding transthyretin. Each strand has 14 to 30 nucleotides, and the double stranded RNAi agent is represented by formula (III):
  • TTR expression in a sample derived from the subject is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% or at least about 70% at least about 80%, or at least about 90%.
  • the subject is a human.
  • the subject is a subject suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTR- associated disease.
  • the subject is a subject who carries a TTR gene mutation that is associated with the development of a TTR-associated disease.
  • the subject has a TTR-associated amyloidosis and the method reduces an amyloid TTR deposit in the subject.
  • the RNAi agent is administered to the subject by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof.
  • the RNAi agent is administered to the subject via subcutaneous or intravenous administration.
  • the RNAi agent is administered to the subject via subcutaneous administration.
  • the subcutaneous administration is subcutaneous injection of the RNAi agent.
  • the subcutaneous injection may be at an anatomical location selected from the group consisting of the abdomen of the subject, the thigh of the subject, and the upper arm of the subject.
  • the RNAi agent is administered to the subject as a split 500 mg dose at two different anatomical locations.
  • the subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot. In one embodiment, the subcutaneous administration comprises administration via a subcutaneous infusion pump. In one embodiment, the RNAi agent is administered to the subject as a single 500 mg dose. In one embodiment, the RNAi agent is administered to the subject over of period of 5-20, 5- 10, 5- 15, 10- 15, 10-20, or 15-20 minutes. In another embodiment, the RNAi agent is administered to the subject over of period of 15 minutes or less, 10 minutes or less, or 5 minutes or less.
  • the RNAi agent is administered to the subject as a single dose 500 mg dose. In another embodiment, the RNAi agent is administered to the subject as a split 500 mg dose.
  • administering the RNAi agent does not result in an inflammatory response in the subject as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN- ⁇ , IL- 10, IL- 12 (p70), ILip, IL- lra, IL-6, IL-8, IP-10, MCP- 1, ⁇ - ⁇ , ⁇ - ⁇ , TNFa, and any combinations thereof, in a sample from the subject.
  • a cytokine or chemokine selected from the group consisting of G-CSF, IFN- ⁇ , IL- 10, IL- 12 (p70), ILip, IL- lra, IL-6, IL-8, IP-10, MCP- 1, ⁇ - ⁇ , ⁇ - ⁇ , TNFa, and any combinations thereof, in a sample from the subject.
  • each N b and N b ' independently represents an oligonucleotide sequence including 1-5 modified nucleotides.
  • formula (III) is represented as formula (IIIc):
  • the duplex region is 15-30 nucleotide pairs in length. In some embodiments, the duplex region is 17-23 nucleotide pairs in length, 17-25 nucleotide pairs in length, 23-27 nucleotide pairs in length, 19-21 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the modifications on the nucleotides are selected from the group consisting of LNA, UNA, CRN, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-0-alkyl, 2'-0-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.
  • the modifications on the nucleotides are 2'-0-methyl or 2'-fluoro.
  • the ligand is one or more N-acetylgalactosamine
  • the ligand is attached to the 3' end of the sense strand.
  • the RNAi agent is conjugated to the ligand as shown in the following schematic
  • the RNAi agent is conjugated to the ligand as shown in the following schematic
  • the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
  • linkages between n p ' include phosphorothioate linkages. In some such embodiments, the linkages between n p ' are phosphorothioate linkages.
  • the RNAi agent is selected from the group of agents listed in Table 1.
  • the present invention provides methods of treating or preventing a TTR-associated disease in a subject.
  • the methods include administering to the subject an RNAi agent at a dose of about 500 mg, daily for five days, followed by a weekly dose of about 500 mg, wherein the RNAi agent is AD-51547, having the following structure: sense: 5 ' - UfgGfg AfuUfuCf AfUfgUfaacCfaAfgAfL96-3 ' (SEQ ID NO:2211 ) antisense: 5'- uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3' (SEQ ID NO:2217) wherein lowercase nucleotides (a, u, g, c) indicate 2'-0-methyl nucleotides; Nf (e.g. , Af) indicates a 2' -fluoro nucleotide; s indicates a
  • the subject is a subject suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTR- associated disease.
  • the subject is a subject who carries a TTR gene mutation that is associated with the development of a TTR-associated disease.
  • the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.
  • SSA senile systemic amyloidosis
  • FAP familial amyloidotic polyneuropathy
  • FAC familial amyloidotic cardiomyopathy
  • CNS central Nervous System
  • the subject has a TTR-associated amyloidosis and the method reduces an amyloid TTR deposit in the subject.
  • the subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot. In one embodiment, the subcutaneous administration comprises administration via a subcutaneous infusion pump. In one embodiment, the RNAi agent is administered to the subject as a single 500 mg dose. In one embodiment, the RNAi agent is administered to the subject over of period of 5-20, 5- 10, 5- 15, 10- 15, 10-20, or 15-20 minutes. In another embodiment, the RNAi agent is administered to the subject over of period of 15 minutes or less, 10 minutes or less, or 5 minutes or less.
  • the RNAi agent is administered to the subject as a single dose 500 mg dose. In another embodiment, the RNAi agent is administered to the subject as a split 500 mg dose.
  • kits for performing the methods of the invention include an RNAi agent of the invention, such as AD-51547, having the following structure:
  • kits may optionally contain means for administering the RNAi agent to the subject, such as an injection device or an infusion pump.
  • Figure 1 is a graph depicting that administering to mice a single subcutaneous dose of a GalN Ac-conjugated RNAi agent targeting TTR resulted in dose-dependent suppression of TTR mRNA.
  • Figure 2 is a graph depicting that administering to mice a single subcutaneous dose of 7.5 mg/kg or 30 mg/kg of a GalN Ac conjugated RNAi agent targeting TTR resulted in long lasting suppression of TTR mRNA.
  • Figure 4 is a graph depicting improved silencing activity of RNAi agents modified relative to the parent AD-45163.
  • Figure 5 is a graph depicting improved silencing activity of RNAi agents modified relative to the parent AD-45165.
  • Figure 6 is a graph depicting improved free uptake silencing following 4 hour incubation with RNAi agents modified relative to the parent AD-45163.
  • Figure 10 is a graph depicting silencing of TTR mRNA in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of RNAi agents AD-51544, AD-51545, AD-45163, AD-51546, AD-51547, or AD-45165.
  • Figure 12 is a graph depicting TTR protein suppression in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of 5 mg/kg or lmg/kg of RNAi agents AD-51546, AD-51547, or AD-45165.
  • Figure 13 depicts the protocol for post-dose blood draws in monkeys that received 5x5mg/kg RNAi agent (top line) or lx25mg/kg RNAi agent (bottom line).
  • Figures 14A and 14B are graphs depicting suppression of TTR protein in non- human primates following subcutaneous administration of five 5 mg/kg doses ( Figure 14A) or a single 25mg/kg dose ( Figure 14B) of AD-45163, AD-51544, AD-51545, AD- 51546, or AD-51547.
  • Figure 15 is a graph depicting suppression of TTR protein in non-human primates following subcutaneous administration of AD-51547 at 2.5 mg/kg (white squares), 5 mg/kg (black squares) or 10 mg/kg (patterned squares) per dose, or administration of PBS as a negative control (gray squares).
  • Figures 16A- 16D are graphs depicting serum levels of IL-6 (A), TNF alpha (B), G-CSF (C), and CRP (D) in human subjects administered the indicated doses of AD- 51547.
  • Figure 18 is a graph depicting the mean TTR knockdown relative to baseline in human subjects administered a single dose of AD-51547 as indicated.
  • Figure 19 is a graph depicting the mean TTR knockdown relative to baseline in human subjects administered a multiple dose of 2.5 mg/kg, 5 mg/kg, or 10 mg/kg of
  • strand comprising a sequence refers to an
  • RNAi agent refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined below, nucleic acid strands.
  • nucleic acid strands In general, the majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide.
  • an "RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by "RNAi agent" for the purposes of this specification and claims.
  • the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3 '-end of one strand and the 5 '-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a "hairpin loop.” Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3 '-end of one strand and the 5 '-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a "linker.”
  • the RNA strands may have the same or a different number of nucleotides.
  • RNAi agent may comprise one or more nucleotide overhangs.
  • siRNA is also used herein to refer to an RNAi agent as described above.
  • nucleotide overhang refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of an RNAi agent when a 3 '-end of one strand of the RNAi agent extends beyond the 5 '-end of the other strand, or vice versa.
  • Bount or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang.
  • RNAi agent is a dsRNA that is double- stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.
  • the RNAi agents of the invention include RNAi agents with nucleotide overhangs at one end (i.e., agents with one overhang and one blunt end) or with nucleotide overhangs at both ends.
  • the term "complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12- 16 hours followed by washing.
  • “Complementary” sequences may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.
  • non- Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.
  • inhibitor as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.
  • “Inhibiting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
  • TTR gene may be assessed based on the level of any variable associated with TTR gene expression, e.g., TTR mRNA level, TTR protein level, retinol binding protein level, vitamin A level, or the number or extent of amyloid deposits. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level.
  • the control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
  • contacting a cell with an RNAi agent includes contacting a cell by any possible means.
  • Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent.
  • the contacting may be done directly or indirectly.
  • the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
  • a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
  • a "patient” or “subject,” as used herein, is intended to include either a human or non-human animal, preferably a mammal, e.g., a monkey. Most preferably, the subject or patient is a human.
  • TTR-associated disease is intended to include any disease associated with the TTR gene or protein. Such a disease may be caused, for example, by excess production of the TTR protein, by TTR gene mutations, by abnormal cleavage of the TTR protein, by abnormal interactions between TTR and other proteins or other endogenous or exogenous substances.
  • a "TTR-associated disease” includes any type of TTR amyloidosis (ATTR) wherein TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits.
  • TTR-associated diseases include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC),
  • TTR amyloidosis e.g. , central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia.
  • Symptoms of TTR amyloidosis include sensory neuropathy (e.g. , paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g.
  • RNAi agent that, when administered to a subject who does not yet experience or display symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease.
  • Symptoms that may be ameliorated include sensory neuropathy (e.g.
  • autonomic neuropathy e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension
  • motor neuropathy seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy.
  • Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease.
  • the "prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
  • a “therapeutically-effective amount” or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
  • RNAi gents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
  • sample includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
  • biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like.
  • Tissue samples may include samples from tissues, organs or localized regions.
  • samples may be derived from particular organs, parts of organs, or fluids or cells within those organs.
  • samples may be derived from the liver (e.g. , whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g.
  • hepatocytes the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system or parts of the central nervous system (e.g., ventricles or choroid plexus), or the pancreas or certain cells or parts of the pancreas.
  • a "sample derived from a subject” refers tocerebro spinal fluid obtained from the subject.
  • a “sample derived from a subject” refers to blood or plasma drawn from the subject.
  • a “sample derived from a subject” refers to liver tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.
  • the present invention provides RNAi agents with superior gene silencing activity. It is shown herein and in PCT Publication No. WO 2013/075035 (the entire contents of which are incorporated by reference) that a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into a sense strand and/or antisense strand of a RNAi agent, particularly at or near the cleavage site. The sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense and/or antisense strand.
  • the RNAi agent also optionally conjugates with a GalNAc derivative ligand, for instance on the sense strand. The resulting RNAi agents present superior gene silencing activity.
  • RNAi agents e.g., double stranded RNAi agents, capable of inhibiting the expression of a target gene (i.e., a TTR gene) in vivo.
  • the RNAi agent comprises a sense strand and an antisense strand.
  • Each strand of the RNAi agent can range from 12-30 nucleotides in length.
  • each strand can be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • RNAi agent a duplex double stranded RNA
  • the duplex region of an RNAi agent may be 12-30 nucleotide pairs in length.
  • the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
  • the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27.
  • the RNAi agent may contain one or more overhang regions and/or capping groups of RNAi agent at 3 '-end, or 5 '-end or both ends of a strand.
  • the overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • RNAi agents provided by the present invention include agents with chemical modifications as disclosed, for example, in U.S. Provisional Application No.
  • the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2'-sugar modified, such as, 2-F, 2'-0-methyl, thymidine (T), 2 -0-methoxyethyl-5- methyluridine (Teo), 2 -0-methoxyethyladenosine (Aeo), 2 -0-methoxyethyl-5- methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.
  • the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
  • the single- stranded overhang is located at the 3 '-terminal end of the sense strand or, alternatively, at the 3 '-terminal end of the antisense strand.
  • the RNAi may also have a blunt end, located at the 5 '-end of the antisense strand (or the 3 '-end of the sense strand) or vice versa.
  • the antisense strand of the RNAi has a nucleotide overhang at the 3 '-end, and the 5 '-end is blunt. While the Applicants are not bound by theory, the theoretical mechanism is that the asymmetric blunt end at the 5 '-end of the antisense strand and 3 '-end overhang of the antisense strand favor the guide strand loading into RISC process.
  • the RNAi agent is a double ended bluntmer of 19 nt in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7,8,9 from the 5'end.
  • the antisense strand contains at least one motif of three 2'-0-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.
  • the RNAi agent is a double ended bluntmer of 20 nt in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8,9,10 from the 5'end.
  • the antisense strand contains at least one motif of three 2'-0-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.
  • the RNAi agent is a double ended bluntmer of 21 nt in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5'end.
  • the antisense strand contains at least one motif of three 2'-0-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end.
  • the RNAi agent comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense strand, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9,10,11 from the 5'end; the antisense strand contains at least one motif of three 2'-0-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5'end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nt overhang.
  • the 2 nt overhang is at the 3 '-end of the antisense.
  • the RNAi agent further comprises a ligand (preferably GalNAc 3 ).
  • antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site.
  • the antisense strand contains at least one motif of three 2'-0-methyl modifications on three consecutive nucleotides at or near the cleavage site.
  • the RNAi agent further comprises a ligand.
  • the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
  • the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand
  • the sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
  • the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
  • at least two nucleotides may overlap, or all three nucleotides may overlap.
  • the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides.
  • the first motif should occur at or near the cleavage site of the strand and the other motifs may be wing modifications.
  • the term "wing modification" herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand.
  • the wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides.
  • the motifs are immediately adjacent to each other than the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different.
  • Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
  • the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3 '-end, 5 '-end or both ends of the strand.
  • the RNAi agent comprises the pattern of the alternating motif of 2'-0-methyl modification and 2'-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-0-methyl modification and 2'-F modification on the antisense strand initially, i.e., the 2'-0-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa.
  • the 1 position of the sense strand may start with the 2'- F modification
  • the 1 position of the antisense strand may start with the 2'- O- methyl modification.
  • the RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.
  • methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand.
  • the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern.
  • the alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
  • the RNAi comprises the phosphorothioate or
  • the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.
  • Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or
  • methylphosphonate internucleotide linkage and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • these terminal three nucleotides may be at the 3 '-end of the antisense strand.
  • the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof.
  • the mistmatch can occur in the overhang region or the duplex region.
  • the base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g. , on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
  • A:U is preferred over G:C
  • G:U is preferred over G:C
  • Mismatches e.g. , non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
  • the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'- end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g. , non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5'-end of the duplex.
  • the nucleotide at the 1 position within the duplex region from the 5 '-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
  • At least one of the first 1, 2 or 3 base pair within the duplex region from the 5'- end of the antisense strand is an AU base pair.
  • the first base pair within the duplex region from the 5'- end of the antisense strand is an AU base pair.
  • the sense strand sequence may be represented by formula
  • i and j are each independently 0 or 1 ;
  • each N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
  • i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1.
  • the sense strand can therefore be represented by the following formulas:
  • k and 1 are each independently 0 or 1 ;
  • p' and q' are each independently 0-6;
  • each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
  • N b ' and Y' do not have the same modification
  • ⁇ ' ⁇ ' ⁇ ', ⁇ ' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • the N a ' and/or N b ' comprise modifications of alternating pattern.
  • ⁇ ' motif is all 2'-OMe modified nucleotides.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
  • the antisense strand can therefore be represented by the following formulas:
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5 or 6.
  • Each of X', Y' and Z' may be the same or different from each other.
  • Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, UNA, CRN, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-0-methyl, 2'- O-allyl, 2'-C- allyl, 2'-hydroxyl, 2'-deoxy or 2'-fluoro.
  • each nucleotide of the sense strand and antisense strand is independently modified with 2'-0-methyl or 2'- fluoro.
  • Each X, Y, Z, X', Y' and Z' in particular, may represent a 2'-0-methyl modification or a 2' -fluoro modification.
  • the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1 st nucleotide from the 5 '-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end; and Y represents 2'- F modification.
  • the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification.
  • the sense strand represented by any one of the above formulas (la), (lb) and (Ic) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (lib) and (lie), respectively.
  • i, j, k, and 1 are each independently 0 or 1;
  • each N b and N b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides
  • each n p ', n p , n q ', and n q independently represents an overhang nucleotide; and XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 1.
  • k is 1 and 1 is 0; k is 0 and 1 is 1; or both k and 1 are 1.
  • each N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7,
  • N a , N a independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a , N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of N a , N a ', N b and N b independently comprises modifications of alternating pattern.
  • the acyclic group is selected from serinol backbone or diethanolamine backbone.
  • D1200 D1201, D1202, D1203, D1204, D1205, D1206, D1207, D1208, D1209, D1210,
  • RNAi agents of the invention may optionally be conjugated to one or more ligands.
  • the ligand can be attached to the sense strand, antisense strand or both strands, at the 3 '-end, 5 '-end or both ends.
  • the ligand may be conjugated to the sense strand.
  • the ligand is conjgated to the 3 '-end of the sense strand.
  • the ligand is a GalNAc ligand.
  • the ligand is GalNAc 3 :
  • RNAi agents of the present invention A wide variety of entities can be coupled to the RNAi agents of the present invention.
  • Preferred moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether.
  • Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; and nuclease-resistance conferring moieties.
  • therapeutic modifiers e.g., for enhancing uptake
  • diagnostic compounds or reporter groups e.g., for monitoring distribution
  • cross-linking agents e.g., for monitoring distribution
  • nuclease-resistance conferring moieties lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics.
  • Ligands can include a naturally occurring substance, such as a protein ⁇ e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); a carbohydrate ⁇ e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid.
  • the ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an oligonucleotide ⁇ e.g., an aptamer).
  • polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
  • PLL polylysine
  • poly L-aspartic acid poly L-glutamic acid
  • styrene-maleic acid anhydride copolymer poly(L-lactide-co-glycolied) copolymer
  • divinyl ether-maleic anhydride copolymer divinyl ether-
  • ligands include dyes, intercalating agents (e.g., acridines), cross-linkers (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin,
  • intercalating agents e.g., acridines
  • cross-linkers e.g., psoralene, mitomycin C
  • porphyrins TPPC4, texaphyrin
  • Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell.
  • Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, or aptamers.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.
  • RGD peptides cyclic peptides containing RGD, RGD peptides that include D-amino acids, as well as synthetic RGD mimics.
  • RGD one can use other moieties that target the integrin ligand.
  • ligands can be used to control proliferating cells and angiogeneis.
  • Preferred conjugates of this type of ligand target PECAM-1, VEGF, or other cancer gene, e.g., a cancer gene described herein.
  • the ligands can all have same properties, all have different properties or some ligands have the same properties while others have different properties.
  • a ligand can have targeting properties, have endosomolytic activity or have PK modulating properties.
  • all the ligands have different properties.
  • ligands can be attached to one or both strands.
  • a double- stranded iRNA agent contains a ligand conjugated to the sense strand.
  • a double- stranded iRNA agent contains a ligand conjugated to the antisense strand.
  • the position can also be attached to a conjugate moiety, such as in an abasic residue.
  • Internucleosidic linkages can also bear conjugate moieties.
  • phosphorus-containing linkages e.g. , phosphodiester, phosphorothioate,
  • q 2A ,q 2B ,q 3A ,q 3B ,q4 ,, ⁇ ,q 4B ,q 5A ,q 5B and i q 5C represent .
  • p2A p2B p3A p3B p4A p4B p5A p5B p5C r 2A r 2B r 3A r 3B r 4A r 4B r 4A r 5B r 5C each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NHorCH 2 0;
  • R a is H or amino acid side chain.
  • the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g. , at the physiologic values of the human plasma.
  • Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts.
  • the agent for controlling the osmolarity of the solution is a salt.
  • the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.
  • the RNAi agent preparation includes at least a second therapeutic agent (e.g., an agent other than an RNA or a DNA).
  • a second therapeutic agent e.g., an agent other than an RNA or a DNA
  • an RNAi agent composition for the treatment of a TTR-associated disease e.g., a transthyretin- related hereditary amyloidosis (familial amyloid polyneuropathy, FAP)
  • FAP transthyretin- related hereditary amyloidosis
  • a known drug for the amelioration of FAP e.g., Tafamidis (INN, or Fx-1006A or Vyndaqel).
  • a formulated RNAi agent composition can assume a variety of states.
  • the composition is at least partially crystalline, uniformly crystalline, and/or anhydrous (e.g., it contains less than 80, 50, 30, 20, or 10% of water).
  • the RNAi agent is in an aqueous phase, e.g., in a solution that includes water.
  • aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase) or a particle (e.g., a microparticle as can be appropriate for a crystalline composition).
  • a delivery vehicle e.g., a liposome (particularly for the aqueous phase) or a particle (e.g., a microparticle as can be appropriate for a crystalline composition).
  • the RNAi agent composition is formulated in a manner that is compatible with the intended method of administration, as described herein.
  • the composition is prepared by at least one of the following methods: spray drying, lyophilization, vacuum drying, evaporation, fluid bed drying, or a combination of these techniques; or sonication with a lipid, freeze-drying, condensation and other self- assembly.
  • RNAi agent preparation can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes RNAi agent, e.g., a protein that complexes with the RNAi agent to form an iRNP.
  • another agent e.g., another therapeutic agent or an agent that stabilizes RNAi agent, e.g., a protein that complexes with the RNAi agent to form an iRNP.
  • Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg 2+ ), salts, RNAse inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth.
  • compositions comprise a therapeutically- or
  • prophylactically effective amount of one or more of the the dsRNA agents in any of the preceding embodiments taken alone or formulated together with one or more pharmaceutically acceptable carriers (additives), excipient and/or diluents.
  • compositions of the invention include the step of bringing into association an RNAi agent of the present invention with the carrier and, optionally, one or more accessory ingredients.
  • the compositions are prepared by uniformly and intimately bringing into association an RNAi agent of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
  • the pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral
  • drenches aqueous or non-aqueous solutions or
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • a pharmaceutically-acceptable material such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in carrying or transport
  • compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
  • amount of RNAi agent which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and the particular mode of
  • RNAi agent which can be combined with a carrier material to produce a single dosage form will generally be that amount of the RNAi agent which produces a desired effect, e.g., therapeutic or prophylactic effect. Generally, out of one hundred per cent, this amount will range from about 0.1 per cent to about ninety-nine percent of RNAi agent, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.
  • RNAi agent in order to prolong the effect of an RNAi agent, it is desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the RNAi agent then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered RNAi agent may be accomplished by dissolving or suspending the agent in an oil vehicle.
  • RNAi agent of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle.
  • liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi agent composition.
  • the lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the RNAi agent composition, although in some examples, it may.
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the RNAi agent to particular cell types.
  • a liposome containing an RNAi agent can be prepared by a variety of methods.
  • the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component.
  • the lipid component can be an amphipathic cationic lipid or lipid conjugate.
  • the detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine.
  • the RNAi agent preparation is then added to the micelles that include the lipid component.
  • the cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome.
  • the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.
  • a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition.
  • the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also be adjusted to favor condensation.
  • Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., Proc. Natl. Acad. Set, USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678;
  • Liposomes that are pH-sensitive or negatively-charged entrap nucleic acid molecules rather than complex with them. Since both the nucleic acid molecules and the lipid are similarly charged, repulsion rather than complex formation occurs.
  • nucleic acid molecules are entrapped within the aqueous interior of these liposomes.
  • pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 19, (1992) 269-274).
  • liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
  • Neutral liposome compositions for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
  • phosphatidylcholine DPPC
  • Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in
  • Liposome formulations Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
  • a positively charged synthetic cationic lipid, N-[l-(2,3-dioleyloxy)propyl]- ⁇ , ⁇ , ⁇ -trimethylammonium chloride can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
  • RNAi agent see, e.g., Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a
  • a DOTMA analogue, l,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles.
  • LipofectinTM Bethesda Research Laboratories, Gaithersburg, Md. is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive.
  • DOTAP cationic lipid, l,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane
  • cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5- carboxyspermylglycine dioctaoleoylamide (“DOGS”) (TransfectamTM, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl- amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).
  • DOGS 5- carboxyspermylglycine dioctaoleoylamide
  • DPES dipalmitoylphosphatidylethanolamine 5-carboxyspermyl- amide
  • Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions.
  • Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and
  • DOSPA Lipofectamine
  • Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin.
  • liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin.
  • the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., Journal of Drug Targeting, 1992, vol.
  • Papahadjopoulos D. Meth. Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin.
  • Such formulations with RNAi agent are useful for treating a dermatological disorder.
  • Liposomes that include RNAi agent can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome.
  • transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient.
  • these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.
  • Other formulations amenable to the present invention are described in United States provisional application serial Nos. 61/018,616, filed January 2, 2008; 61/018,611, filed January 2, 2008; 61/039,748, filed March 26, 2008; 61/047,087, filed April 22, 2008 and 61/051,528, filed May 8, 2008.
  • PCT application no PCT/US2007/080331, filed October 3, 2007 also describes formulations that are amenable to the present invention.
  • RNAi agent or a precursor, e.g., a larger dsiRNA which can be processed into a siRNA, or a DNA which encodes a siRNA or precursor
  • compositions can include a surfactant.
  • the siRNA is formulated as an emulsion that includes a surfactant.
  • HLB hydrophile/lipophile balance
  • hydrophilic group provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p. 285).
  • Nonionic surfactants find wide application in pharmaceutical products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and
  • ethoxylated/propoxylated block polymers are also included in this class.
  • the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
  • amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
  • RNAi agents of the invention can also be provided as micellar formulations.
  • Micelles are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the
  • hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase.
  • the converse arrangement exists if the environment is hydrophobic.
  • a mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal Cg to C 22 alkyl sulphate, and a micelle forming compound.
  • exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxy
  • a first micellar composition which contains the siRNA composition and at least the alkali metal alkyl sulphate.
  • the first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition.
  • the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
  • Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth.
  • phenol and/or m-cresol may be added with the micelle forming ingredients.
  • An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
  • the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant.
  • the propellant which is under pressure, is in liquid form in the dispenser.
  • the ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve.
  • the dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.
  • Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen- containing fluorocarbons, dimethyl ether and diethyl ether.
  • HFA 134a (1,1,1,2 tetrafluoroethane) may be used.
  • the specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation.
  • an RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle.
  • Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques. IV. Methods For Inhibiting TTR Expression
  • the present invention also provides methods of inhibiting expression of a transthyretin (TTR) in a cell.
  • the methods include contacting a cell with an RNAi agent, e.g., double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell, thereby inhibiting expression of TTR in the cell.
  • an RNAi agent e.g., double stranded RNAi agent
  • RNAi agent e.g., a double stranded RNAi agent
  • Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, e.g. , a GalNAc 3 ligand, or any other ligand that directs the RNAi agent to a site of interest, e.g. , the liver of a subject.
  • the targeting ligand is a carbohydrate moiety, e.g. , a GalNAc 3 ligand, or any other ligand that directs the
  • inhibitor as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.
  • TTR tumor necrosis factor receptor
  • any TTR gene such as, e.g. , a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene
  • the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to amyloid deposition), or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism.
  • “Inhibiting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g. , at least partial suppression of the expression of a TTR gene.
  • the expression of the TTR gene may be assessed based on the level, or the change in the level, of any variable associated with TTR gene expression, e.g. , TTR mRNA level, TTR protein level, or the number or extent of amyloid deposits. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject.
  • Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TTR expression compared with a control level.
  • the control level may be any type of control level that is utilized in the art, e.g., a pre- dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
  • expression of a TTR gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
  • Inhibition of the expression of a TTR gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a TTR gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present) such that the expression of a TTR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)).
  • the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:
  • TTR gene silencing may be determined in any cell expressing TTR, either constitutively or by genomic engineering, and by any assay known in the art.
  • the liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina and pancreas.
  • Inhibition of the expression of a TTR protein may be manifested by a reduction in the level of the TTR protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject).
  • the inhibiton of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
  • a control cell or group of cells that may be used to assess the inhibition of the expression of a TTR gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention.
  • the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.
  • the level of TTR mRNA that is expressed by a cell or group of cells, or the level of circulating TTR mRNA may be determined using any method known in the art for assessing mRNA expression.
  • the level of expression of TTR in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the TTR gene.
  • RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland).
  • RNAzol B acid phenol/guanidine isothiocyanate extraction
  • RNeasy RNA preparation kits Qiagen
  • PAXgene PreAnalytix, Switzerland.
  • the level of expression of TTR is determined using a nucleic acid probe.
  • probe refers to any molecule that is capable of selectively binding to a specific TTR. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
  • Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction (PCR) analyses and probe arrays.
  • One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TTR mRNA.
  • the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array.
  • a skilled artisan can readily adapt known mRNA detection methods for use in determining the level of TTR mRNA.
  • An alternative method for determining the level of expression of TTR in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878),
  • the level of expression of TTR is determined by quantitative fluorogenic RT-PCR (i.e., the TaqManTM System).
  • TTR mRNA The expression levels of TTR mRNA may be monitored using a membrane blot
  • TTR expression level may also comprise using nucleic acid probes in solution.
  • the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR).
  • bDNA branched DNA
  • qPCR real time PCR
  • the level of TTR protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid
  • HPLC high resolution liquid chromatography
  • TLC thin layer chromatography
  • the efficacy of the methods of the invention can be monitored by detecting or monitoring a reduction in an amyloid TTR deposit.
  • Reducing an amyloid TTR deposit includes any decrease in the size, number, or severity of TTR deposits, or to a prevention or reduction in the formation of TTR deposits, within an organ or area of a subject, as may be assessed in vitro or in vivo using any method known in the art. For example, some methods of assessing amyloid deposits are described in Gertz, M.A. & Rajukumar, S.V. (Editors) (2010), Amyloidosis: Diagnosis and Treatment, New York: Humana Press.
  • Methods of assessing amyloid deposits may include biochemical analyses, as well as visual or computerized assessment of amyloid deposits, as made visible, e.g., using immunohistochemical staining, fluorescent labeling, light microscopy, electron microscopy, fluorescence microscopy, or other types of microscopy.
  • Invasive or noninvasive imaging modalities including, e.g., CT, PET, or NMR/MRI imaging may be employed to assess amyloid deposits.
  • the methods of the invention may reduce TTR deposits in any number of tissues or regions of the body including but not limited to the heart, liver, spleen, esophagus, stomach, intestine (ileum, duodenum and colon), brain, sciatic nerve, dorsal root ganglion, kidney and retina.
  • sample refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
  • biological fluids include blood, serum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like.
  • Tissue samples may include samples from tissues, organs or localized regions.
  • samples may be derived from particular organs, parts of organs, or fluids or cells within those organis.
  • samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g.
  • hepatocytes the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system or parts of the central nervous system (e.g., ventricles or choroid plexus), or the pancreas or certain cells or parts of the pancreas.
  • a "sample derived from a subject” refers to blood or plasma drawn from the subject.
  • a "sample derived from a subject” refers to liver tissue or retinal tissue derived from the subject.
  • the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject.
  • the inhibition of expression of TTR may be assessed using measurements of the level or change in the level of TTR mRNA or TTR protein in a sample derived from fluid or tissue from the specific site within the subject.
  • the site is selected from the group consisting of liver, choroid plexus, retina, and pancreas.
  • the site may also be a subsection or subgroup of cells from any one of the aforementioned sites (e.g., hepatocytes or retinal pigment epithelium).
  • the site may also include cells that express a particular type of receptor (e.g. , hepatocytes that express the asialogycloprotein receptor).
  • the present invention also provides methods for treating or preventing a TTR- associated disease in a subject.
  • the methods include administering to the subject a therapeutically effective amount or prophylactically effective amount of an RNAi agent of the invention.
  • a "subject” includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal.
  • a subject may include a transgenic organism.
  • the subject is a human, such as a human suffering from or predisposed to developing a TTR-associated disease.
  • the subject is suffering from a TTR-associated disease.
  • the subject is a subject at risk for developing a TTR-associated disease, e.g. , a subject with a TTR gene mutation that is associated with the development of a TTR associated disease, a subject with a family history of TTR-associated disease, or a subject who has signs or symptoms suggesting the development of TTR
  • amyloidosis is amyloidosis.
  • TTR-associated disease includes any disease caused by or associated with the formation of amyloid deposits in which the fibril precurosors consist of variant or wild-type TTR protein. Mutant and wild-type TTR give rise to various forms of amyloid deposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, resulting in extracellular deposits that impair organ function. Climical syndromes associated with TTR aggregation include, for example, senile systemic amyloidosis (SSA); systemic familial amyloidosis; familial amyloidotic polyneuropathy (FAP); familial amyloidotic cardiomyopathy (FAC); and
  • leptomeningeal amyloidosis also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form.
  • CNS central nervous system
  • RNAi agents of the invention are administered to subjects suffering from familial amyloidotic
  • SSA senile systemic amyloidosis
  • SCA senile cardiac amyloidosis
  • TTR amyloidosis amyloidosis
  • ATTR amyloidosis-transthyretin type
  • RNAi agents of the invention are administered to subjects suffering from transthyretin (TTR)-related familial amyloidotic polyneuropathy (FAP). Such subjects may suffer from ocular manifestations, such as vitreous opacity and glaucoma. It is known to one of skill in the art that amyloidogenic transthyretin (ATTR) synthesized by retinal pigment epithelium (RPE) plays important roles in the progression of ocular amyloidosis.
  • TTR transthyretin
  • FAP familial amyloidotic polyneuropathy
  • RNAi agent can be delivered in a manner suitable for targeting a particular tissue, such as the eye.
  • Modes of ocular delivery include retrobulbar, subcutaneous eyelid, subconjunctival, subtenon, anterior chamber or intravitreous injection (or internal injection or infusion).
  • Specific formulations for ocular delivery include eye drops or ointments.
  • TTR-associated disease is hyperthyroxinemia, also known as hyperthyroxinemia
  • distransthyretinemic hyperthyroxinemia or "dysprealbuminemic hyperthyroxinemia”. This type of hyperthyroxinemia may be secondary to an increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine.
  • RNAi agents of the invention may be administered to a subject using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof.
  • the administration is via a depot injection.
  • a depot injection may release the RNAi agent in a consistent way over a prolonged time period.
  • RNAi agent that, when administered to a subject who does not yet experience or display symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease.
  • Symptoms that may be ameliorated include sensory neuropathy (e.g.
  • the "prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
  • Any of these schedules may optionally be repeated for one or more iterations.
  • the number of iterations may depend on the achievement of a desired effect, e.g., the suppression of a TTR gene, retinol binding protein level, vitamin A level, and/or the achievement of a therapeutic or prophylactic effect, e.g. , reducing an amyloid deposit or reducing a symptom of a TTR-associated disease.
  • AD-43527 The mouse/rat cross-reactive GalNAc-conjugate, AD-43527, was chosen for in vivo evaluation in WT C57BL/6 mice for silencing of TTR mRNA in liver.
  • the sequence of each strand of AD-43527 is shown below.
  • AD-43527 was administered to female C57BL/6 mice (6-10 weeks, 5 per group) via subcutaneous injection at a dose volume of ⁇ /g at a dose of 30, 15, 7.5, 3.5, 1.75 or 0.5 mg/kg of AD-43527. Control animals received PBS by subcutaneous injection at the same dose volume.
  • Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volume of nuclease-free water and ⁇ of Proteinase-K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes. 5 ⁇ 1 of liver lysate and 95 ⁇ of working probe set (TTR probe for gene target and GAPDH for endogenous control) were added into the Capture Plate. Capture Plates were incubated at 53 °C +1 °C (aprx. 16-20hrs).
  • the hydroxyprolinol-ligand moiety was then coupled to a solid support via a succinate linker or was converted to phosphoramidite via standard phosphitylation conditions to obtain the desired carbohydrate conjugate building blocks.
  • Fluorophore labeled siRNAs were synthesized from the corresponding phosphoramidite or solid support, purchased from Biosearch Technologies.
  • the oleyl lithocholic (GalNAc) 3 polymer support made in house at a loading of 38.6 ⁇ /gram.
  • the Mannose (Man) polymer support was also made in house at a loading of 42.0 ⁇ /gram.
  • TSA.3HF trihydrofluoride
  • pyridine-HF and DMSO (3:4:6) and heated at 60°C for 90 minutes to remove the ie/t-butyldimethylsilyl (TBDMS) groups at the 2' position.
  • TDMS ie/t-butyldimethylsilyl
  • oligonucleotides were analyzed by high-performance liquid chromatography (HPLC) prior to purification and selection of buffer and column depends on nature of the sequence and or conjugated ligand.
  • oligonucleotides were diluted in water to 150 ⁇ and then pipetted in special vials for CGE and LC/MS analysis. Compounds were finally analyzed by LC-ESMS and CGE.
  • Lowercase nucleotides are 2'-0-methyl nucleotides; Nf (e.g., Af) is a 2'-fluoro nucleotide; s is a phosphothiorate linkage; L96 indicates a GalNAc 3 ligand.
  • Human Hep3B cells or rat H.II.4.E cells were grown to near confluence at 37 °C in an atmosphere of 5% C02 in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being released from the plate by trypsinization.
  • Transfection was carried out by adding 14.8 ⁇ of Opti-MEM plus 0.2 ⁇ of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778- 150) to 5 ⁇ of siRNA duplexes per well into a 96- well plate and incubated at room temperature for 15 minutes.
  • Cells were harvested and lysed in 150 ⁇ of Lysis/Binding Buffer then mixed for 5 minutes at 850rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process).
  • Ten microliters of magnetic beads and 80 ⁇ Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, magnetic beads were washed 2 times with 150 ⁇ Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed.
  • Beads were then washed with 150 ⁇ Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 ⁇ Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 ⁇ of Elution Buffer was added and mixed for 5 minutes at 70°C. Beads were captured on magnet for 5 minutes. 40 ⁇ of supernatant was removed and added to another 96 well plate.
  • RNA samples were added into 5 ⁇ total RNA.
  • cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25 °C 10 min, 37 °C 120 min, 85 °C 5 sec, 4 °C hold.
  • IC 50 S were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 (sense sequence:
  • UCGAAGuCUcAGCGuAAGdTsdT (SEQ ID NO: 2203)) or naive cells over the same dose range, or to its own lowest dose.
  • IC 50 S were calculated for each individual transfection as well as in combination, where a single IC 50 was fit to the data from both transfections.
  • Example 5 In vitro Silencing Activity of Chemically Modified RNAi Agents that Target TTR
  • RNAi agents AD-45165, AD-51546 and AD-51547 are provided in Table 2 below.
  • the regions of complementarity to the TTR mRNA are as follows: the region of complementarity of RNAi agents AD-45165, AD-51546 and AD-51547 is
  • RNAi agents AD-45163, AD-51544, and AD-51545 is a region or complemetarity of RNAi agents AD-45163, AD-51544, and AD-51545.
  • TTCATGTAACCAAGAGTATTCCAT SEQ ID NO: 2205.
  • the IC 50 for each modified siRNA was determined in Hep3B cells (a human hepatoma cell line) by standard reverse transfection using Lipofectamine RNAiMAX.
  • reverse transfection was carried out by adding 5 ⁇ ⁇ of Opti-MEM to 5 ⁇ ⁇ of siRNA duplex per well into a 96-well plate along with 10 ⁇ ⁇ of Opti-MEM plus 0.5 ⁇ ⁇ of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) and incubating at room temperature for 15-20 minutes. Following incubation, 100 ⁇ ⁇ of complete growth media without antibiotic containing 12,000-15,000 Hep3B cells was then added to each well.
  • Free uptake silencing in primary cynomolgus hepatocytes was assessed following incubation with TTR siRNA for either 4 hours or 24 hours. Silencing was measured at 24 hours from the initial exposure.
  • 96-well culture plates were coated with 0.05 -0.1 collagen (Sigma C3867-1VL) at room temperature, 24 hours prior to the start of the experiment.
  • siRNAs were diluted in pre- warmed Plating Media consisting of DMEM supplemented with GIBCO' s Maintenance Media Kit (Serum-Free, Life Technologies CM4000), and added to the collagen-coated 96-well culture plates. Cryopreserved primary cynomolgus hepatocytes were rapidly thawed in a 37 °C water bath, and immediately diluted in Plating Media to a
  • TTR and GAPDH mRNA concentration of 360,000 cells/mL.
  • a volume of cell suspension was gently pipetted on top of the pre-plated siRNAs such that the final cell count was 18,000 cells/well.
  • the plate was lightly swirled to mix and spread cells evenly across the wells and placed in a 37 °C, 5% C0 2 incubator for 24 hours prior to lysis and analysis of TTR and GAPDH mRNA by bDNA (Quantigene, Affymetrix).
  • the media was decanted after 4 hours of exposure to the cells, and replaced with fresh Plating Media for the remaining 20 hours of incubation.
  • Downstream analysis for TTR and GAPDH mRNA was the same as described above.
  • siRNAs were titrated from ⁇ to 0.24nM by 4 fold serial dilution.
  • Table 2 In vitro Activity Summary for Alternating TTR-GalNAc and Variants with Triplet Motifs
  • Lowercase nucleotides (a, u, g, c) indicate 2'-0-methyl nucleotides; Nf (e.g., Af) indicates a 2'-fluoro nucleotide; s indicates a phosphothiorate linkage;
  • L96 indicates a GalNAc 3 ligand; bold nucleotides indicate changes relative to the corresponding parent agent. Each bold nucleotide is at the center of a triplet motif.
  • RNAi agents with alternating chemical modifications and a GalNAc 3 ligand provided an IC 50 in Hep3B cells of about 0.01 nM.
  • agents modified relative to the parent agents, for example, by the addition of one or more repeating triplets of 2'-fluoro and 2'-0-methyl modifications showed unexpectedly enhanced silencing activity, achieving IC 50 values in Hep3B cells that were 5-8 fold better than the corresponding parent agent.
  • RNAi agents modified relative to the parent AD-45163 also showed enhanced free uptake silencing.
  • the modified agents showed more than double the silencing activity of the parent after a 24 hour incubation period and nearly 10 times the silencing activity of the parent after a 4 hour incubation period.
  • RNAi agents modified relative to the parent AD-45165 also showed enhanced free uptake silencing.
  • the modified agents showed 2-3 times the silencing activity of the parent after a 24 hour incubation period and 5-8 times the silencing activity of the parent after a 4 hour incubation period.
  • RNAi agents presented herein e.g., AD-51544, AD-51545, AD-51546, and AD-51547, all showed unexpectedly good inhibition of TTR mRNA in in vitro silencing experiments.
  • RNAi agents in PBS buffer
  • PBS control mice were administered to mice (2 male and 2 female) of 18-24 months of age in a single subcutaneous dose of 5 mg/kg or 1 mg/kg. After approximately 48 hours, mice were anesthetized with 200 ⁇ of ketamine, and then exsanguinated by severing the right caudal artery. Whole blood was isolated and plasma was isolated and stored at -80°C until assaying. Liver tissue was collected, flash-frozen and stored at -80°C until processing.
  • Efficacy of treatment was evaluated by (i) measurement of TTR mRNA in liver at 48 hours post-dose, and (ii) measurement of TTR protein in plasma at pre-bleed and at 48 hours post-dose.
  • TTR liver mRNA levels were assayed utilizing the Branched DNA assays- QuantiGene 2.0 (Panomics cat #: QS0011). Briefly, mouse liver samples were ground and tissue lysates were prepared. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volume of nuclease-free water and lOul of Proteinase- K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes.
  • Component 2 then dried by centrifuging for 1 minute at 240g.
  • ⁇ of pre- Amplifier Working Reagent was added into the Capture Plate, which was sealed with aluminum foil and incubated for 1 hour at 55°C ⁇ 1°C. Following 1 hour incubation, the wash step was repeated, then ⁇ of Amplifier Working Reagent was added. After 1 hour, the wash and dry steps were repeated, and ⁇ of Label Probe was added. Capture plates were incubated 50 °C +1 °C for 1 hour. The plate was then washed with IX Wash Buffer, dried and ⁇ Substrate was added into the Capture Plate.
  • Capture Plates were read using the SpectraMax Luminometer following a 5 to 15 minute incubation.bDNA data were analyzed by subtracting the average background from each triplicate sample, averaging the resultant triplicate GAPDH (control probe) and TTR (experimental probe) values, and then computing the ratio: (experimental probe-background)/(control probe- background).
  • Plasma TTR levels were assayed utilizing the commercially available kit "AssayMax Human Prealbumin ELISA Kit” (AssayPro, St. Charles, MO, Catalog # EP3010-1) according to manufacturer's guidelines. Briefly, mouse plasma was diluted 1: 10,000 in IX mix diluents and added to pre-coated plates along with kit standards, and incubated for 2 hours at room temperature followed by 5X washes with kit wash buffer. Fifty microliters of biotinylated prealbumin antibody was added to each well and incubated for 1 hr at room temperature, followed by 5X washes with wash buffer.
  • Figure 10 shows that the RNAi agents modified relative to the parent agents AD-45163 and AD-45165 showed RNA silencing activity that was similar or more potent compared with that of the parent agents.
  • Figure 11 shows that the agents AD-51544 and AD-51545 showed dose dependent silencing activity and that the silencing activity of these agents at a dose of 5mg/kg was similar to that of the corresponding parent AD-45163.
  • Figure 12 shows that the agents AD-51546 and AD-51547 also showed dose-dependent silencing activity. Furthermore, the silencing activity of AD-51546 and AD-51547 at a dose of 5mg/kg was superior to that of the corresponding parent AD-45165.
  • RNAi agents AD-45163, AD-51544, AD- 51545, AD-51546, and AD-51547 achieved similar or higher concentrations in the liver when administered subcutaneously than when administered by IV bolus.
  • the liver pharmacokinetic parameters are presented in Tables 5 and 6 below.
  • the peak concentration (C max ) and area under the curve (AUCo-kst) in the liver were two to three times higher after subcutaneous administration as compared with IV administration of the same agent at the same dose. Liver exposures were highest for AD-51547 and lowest for AD-51545.
  • the mean resident time (MRT) and elimination half-life were longer for AD-51546 and AD-51547 compared with AD-51544 and AD-51545.
  • AD-51546 and AD-51547 were 40 hours for AD- 51546 and 25 hours for AD-51547, whereas the MRTs for AD-51544 and AD-51545 were lower (about 6-9 hours).
  • the elimination half life of AD-51546 and AD-51547 was also higher (41-53 hours) than was the elimination half life of AD-51544 and AD- 51545 (6-10 hours).
  • RNAi agents AD-51544, AD-51545, AD-51546, and AD- 51547 were also assessed in monkeys. The results demonstrated that the antisense and sense strands of AD-51544, AD-51545, and AD-51547 showed serum stability over a period of about 24 hours (data not shown).
  • RNA silencing activity of RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547 was assessed by measuring suppression of TTR protein in serum of cynomologous monkeys following subcutaneous administration of five 5 mg/kg doses (one dose each day for 5 days) or a single 25mg/kg dose.
  • Pre-dose TTR protein levels in serum were assessed by averaging the levels at 11 days prior to the first dose, 7 days prior to the first dose, and 1 day prior to the first dose.
  • Post-dose serum levels of TTR protein were assessed by determining the level in serum beginning at 1 day after the final dose (i.e.
  • study day 5 in the 5x5 mg/kg group and study day 1 in the 1x25 mg/kg group until 49 days after the last dose (i.e., study day 53 in the 5x5 mg/kg group and study day 49 in the 1x25 mg/kg group). See Figure 13.
  • TTR protein levels were assessed as described in Example 6. The results are shown in Figures 14A and 14B and in Tables 7 and 8.
  • a maximal suppression of TTR protein of up to about 50% was achieved in the groups that received 25 mg/kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 8).
  • a greater maximal suppression of TTR protein of about 70% was achieved in the groups that received 5x5 mg/kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 7).
  • the agent AD-51545 produced a lesser degree of suppression in both administration protocols.
  • better suppression was achieved in the 5x5 mg/kg protocol than in the 1x25 mg/kg protocol.
  • Table 7 Fraction Serum Transthyretin Relative to Pre-dose in Cynomolgus Monkeys ( 5 mg/kg daily for 5 days)
  • RNAi agents that target TTR including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547
  • each agent was tested in a whole blood assay using blood from three human donors.
  • the agents were either 300 nM DOTAP transfected or 1 ⁇ without transfection reagent (free siRNA).
  • RNAi agents were injected subcutaneously in CD1 mice at a dose of 125 mg/kg. No cytokine induction was observed at 2, 4, 6, 24, or 48 hours after subcutaneous injection of AD-45163. No significant cytokine induction was observed at 6 or 24 hours after subcucutaneous injection of AD-51544, AD-51545, AD- 51546, or AD-51547.
  • RNAi agents including AD- 45163, AD-51544, AD-51545, AD-51546, and AD-51547
  • AD- 45163, AD-51544, AD-51545, AD-51546, and AD-51547 were tested by subcutaneous injection of 5 and 25 mg in non-human primates (cynomologous monkeys) with dose volumes between 1-2 ml per site. No erythema or edema was observed at injection sites.
  • rats were injected with a single subcutaneous dose of 100, 250, 500, or 750 mg/kg of AD-45163 (see Table 9).
  • the following assessments were made: clinical signs of toxicity, body weight, hematology, clinical chemistry and coagulation, organ weights (liver & spleen); gross and microscopic evaluation (kidney, liver, lung, lymph node, spleen, testes, thymus, aorta, heart, intestine (small and large).
  • MONO metal-oxide-semiconductor
  • RNA silencing activity of RNAi agent AD-51547 was assessed by measuring suppression of TTR protein in the serum of cynomologous monkeys following subcutaneous administration of a "loading phase" of the RNAi agent: five daily doses of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg (one dose each day for 5 days) followed by a "maintenance phase" of the RNAi agent: weekly dosing of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg for 4 weeks.
  • Pre-dose TTR protein levels in serum were assessed by averaging the levels at 11 days prior to the first dose, 7 days prior to the first dose, and 1 day prior to the first dose.
  • Post-dose serum levels of TTR protein were assessed by determining the level in serum relative to pre-dose beginning at 1 day after the loading phase was completed until 40 days after the last dose of the maintenance phase (i.e., study day 70).
  • TTR protein levels were assessed as described in Example 6. The results are shown in Figure 15.
  • a maximal suppression of TTR protein of up to about 80% was achieved in all of the groups that received either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD-51547.
  • Nadir knockdown was achieved in all of the groups by about day 14, the suppression sustained at nadir knockdown levels with a weekly maintenance dose of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD-51547.
  • the levels of TTR had not returned to baseline more than 40 days after the day of administration of the last maintenance dose for the 5 and 2.5 mg/kg dose levels.
  • Cohorts 1-4 each including 4 male subjects, were administered subcutaneously a single dose of AD-51547 at 1.25 mg/kg, 2.5 mg/kg, 5.0 mg/kg, or 10 mg/kg.
  • Cohorts 5-7 each including 4 male subjects, were administered subcutaneously multiple doses of AD-51547.
  • the schedule for multi-dose administration was a daily dose of AD-51547 at 2.5 mg/kg, 5.0 mg/kg, or 10 mg/kg for five days, followed by a single dose of AD-51547 at 2.5 mg/kg, 5 mg/kg, or 10 mg/kg once per week for five weeks.
  • the median age of the subjects enrolled in the trial was 35 years of age (ranging in age from 25 to 47) and the mean serum TTR level at the time of study entry was 270 ⁇ (+/- 47 ⁇ g/ml).
  • Figure 20 shows the serum TTR knockdown by dose group.
  • AD-51547 multiple doses were generally safe and well tolerated. There was no evidence of inflammation (cytokine, CRP), no evidence of abnormalities in liver function tests, renal function, or hematologic parameters, and transient erythema most common reaction at the injection site. As shown in Figures 18 and 19, the knockdown of serum TTR was greater than 80% and this level of knockdown was maintained at a dose of > 5 mg/kg of AD-51547 dosed weekly. There was statistically significant dose-dependent knockdown of serum TTR at doses of > 2.5 mg/kg. In addition, TTR knockdown was sustained for at least 14 days after the last dose of 2.5 and 5.0 mg/kg. Equivalents:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (TTR-) dans lesquelles on utilise des agents d'interférence à ARN, par exemple, des agents d'interférence à ARN double brin, qui ciblent le gène de transthyrétine (TTR).
PCT/US2014/056923 2013-09-23 2014-09-23 Méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (ttr) WO2015042564A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361881257P 2013-09-23 2013-09-23
US61/881,257 2013-09-23

Publications (2)

Publication Number Publication Date
WO2015042564A1 true WO2015042564A1 (fr) 2015-03-26
WO2015042564A8 WO2015042564A8 (fr) 2015-05-28

Family

ID=51663511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/056923 WO2015042564A1 (fr) 2013-09-23 2014-09-23 Méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (ttr)

Country Status (3)

Country Link
AR (1) AR097738A1 (fr)
TW (1) TW201610151A (fr)
WO (1) WO2015042564A1 (fr)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150307881A1 (en) * 2014-03-25 2015-10-29 Arcturus Therapeutics, Inc. Una oligomers having reduced off-target effects in gene silencing
US20150307880A1 (en) * 2014-03-25 2015-10-29 Arcturus Therapeutics, Inc. Transthyretin allele selective una oligomers for gene silencing
US20150322435A1 (en) * 2014-03-25 2015-11-12 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
WO2017015671A1 (fr) * 2015-07-23 2017-01-26 Arcturus Therapeutics, Inc. Compositions permettant de traiter l'amylose
WO2017040078A1 (fr) * 2015-09-02 2017-03-09 Alnylam Pharmaceuticals, Inc. Compositions d'arni ciblant le ligand de mort cellulaire programmée 1 (pd-l1) et leurs méthodes d'utilisation
WO2017177326A1 (fr) * 2016-04-11 2017-10-19 Protiva Biotherapeutics, Inc. Compositions de conjugués d'acides nucléiques ciblés
JP2018512140A (ja) * 2015-04-01 2018-05-17 アークトゥラス・セラピューティクス・インコーポレイテッドＡｒｃｔｕｒｕｓ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． 治療上のｕｎａオリゴマーおよびその使用
JP2018523655A (ja) * 2015-07-31 2018-08-23 アルナイラム ファーマシューティカルズ， インコーポレイテッドＡｌｎｙｌａｍ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ． ＴＴＲ関連疾患を治療または予防するためのトランスサイレチン（ＴＴＲ）ｉＲＮＡ組成物およびその使用方法
WO2020069055A1 (fr) * 2018-09-28 2020-04-02 Alnylam Pharmaceuticals, Inc. Compositions d'arni de la transthyrétine (ttr) et leurs procédés d'utilisation pour traiter ou prévenir des maladies oculaires associées à la ttr
US10745704B2 (en) 2010-04-06 2020-08-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of CD274/PD-L1 gene
WO2021092145A1 (fr) * 2019-11-06 2021-05-14 Alnylam Pharmaceuticals, Inc. Composition d'arni de la transthyrétine (ttr) et ses procédés d'utilisation pour le traitement ou la prévention de maladies oculaires associées à ttr
JP2022506517A (ja) * 2018-11-02 2022-01-17 アルブータス・バイオファーマー・コーポレイション 標的指向化二価結合体
US11401517B2 (en) 2014-08-20 2022-08-02 Alnylam Pharmaceuticals, Inc. Modified double-stranded RNA agents
EP4035659A1 (fr) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes destinés à l'administration d'agents thérapeutiques
US11427823B2 (en) 2017-04-11 2022-08-30 Arbutus Biopharma Corporation Targeted compositions
WO2022260939A2 (fr) 2021-06-08 2022-12-15 Alnylam Pharmaceuticals, Inc. Compositions et méthodes de traitement ou de prévention de la maladie de stargardt et/ou de troubles associés à la protéine 4 de liaison du rétinol (rbp4)
WO2023014677A1 (fr) * 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Compositions d'arni de la transthyrétine (ttr) et leurs procédés d'utilisation
US11806360B2 (en) 2017-09-19 2023-11-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating transthyretin (TTR) mediated amyloidosis

Citations (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1861108A (en) 1930-01-24 1932-05-31 Eugene O Brace Integral clutch and transmission control
US1861608A (en) 1929-12-21 1932-06-07 Emerson Electric Mfg Co Fan and means for directing the air current therethrough
US3974808A (en) 1975-07-02 1976-08-17 Ford Motor Company Air intake duct assembly
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4708708A (en) 1982-12-06 1987-11-24 International Paper Company Method and apparatus for skiving and hemming
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
WO1991016024A1 (fr) 1990-04-19 1991-10-31 Vical, Inc. Lipides cationiques servant a l'apport intracellulaire de molecules biologiquement actives
US5152808A (en) 1989-07-20 1992-10-06 Rockwool/Grodan B.V. Drainage coupling member
US5171678A (en) 1989-04-17 1992-12-15 Centre National De La Recherche Scientifique Lipopolyamines, their preparation and their use
WO1993024640A2 (fr) 1992-06-04 1993-12-09 The Regents Of The University Of California PROCEDES ET COMPOSITIONS UTILISES DANS UNE THERAPIE GENIQUE $i(IN VIVO)
WO1994000569A1 (fr) 1992-06-18 1994-01-06 Genpharm International, Inc. Procede de production d'animaux transgeniques non-humains abritant un chromosome artificiel de levure
US5283185A (en) 1991-08-28 1994-02-01 University Of Tennessee Research Corporation Method for delivering nucleic acids into cells
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
WO1996037194A1 (fr) 1995-05-26 1996-11-28 Somatix Therapy Corporation Vehicules d'apport medicamenteux comprenant des complexes d'acides nucleiques/de lipides stables
US5677195A (en) 1991-11-22 1997-10-14 Affymax Technologies N.V. Combinatorial strategies for polymer synthesis
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5770722A (en) 1994-10-24 1998-06-23 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
WO1998039359A1 (fr) 1997-03-06 1998-09-11 Genta Incorporated Lipides cationiques dimeres sur une base de cystine
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5874219A (en) 1995-06-07 1999-02-23 Affymetrix, Inc. Methods for concurrently processing multiple biological chip assays
WO2007091269A2 (fr) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEAU TANDEM d'ARNsi
WO2007117686A2 (fr) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Composés d'arn immunomodulateur stabilisé (simra) pour tlr7 et tlr8
WO2009014887A2 (fr) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Composés d'arn immunomodulateur stabilisé (simra)
WO2009073809A2 (fr) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Conjugués glucidiques utilisés en tant qu'agents d'administration pour des oligonucléotides
WO2010048228A2 (fr) * 2008-10-20 2010-04-29 Alnylam Pharmaceuticals, Inc. Compositions et procédés pour inhiber l'expression de la transthyrétine
WO2010141511A2 (fr) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucléotides pour interférence arn multivalente, compositions et procédés pour les utiliser
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
WO2011031520A1 (fr) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition pour inhiber l'expression génique et ses utilisations
WO2011056883A1 (fr) * 2009-11-03 2011-05-12 Alnylam Pharmaceuticals, Inc. Compositions de lipides formulés et procédés pour l'inhibition de l'expression de transthyrétine (ttr)
WO2011123468A1 (fr) * 2010-03-29 2011-10-06 Alnylam Pharmaceuticals, Inc. Thérapie siarn pour amylose oculaire liée à la transthyrétine (ttr)
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
WO2012177906A1 (fr) * 2011-06-21 2012-12-27 Alnylam Pharmaceuticals, Inc. Dosages et procédés de détermination de l'activité d'un agent thérapeutique chez un sujet
WO2013075035A1 (fr) 2011-11-18 2013-05-23 Alnylam Pharmaceuticals Agents arni, compositions et procédés d'utilisation de ceux-ci pour traiter des maladies associées à la transthyrétine (ttr)
US11598905B2 (en) 2020-03-19 2023-03-07 Korea Institute Of Science And Technology Inverted nanocone structure for optical device and method of producing the same

Patent Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1861608A (en) 1929-12-21 1932-06-07 Emerson Electric Mfg Co Fan and means for directing the air current therethrough
US1861108A (en) 1930-01-24 1932-05-31 Eugene O Brace Integral clutch and transmission control
US3974808A (en) 1975-07-02 1976-08-17 Ford Motor Company Air intake duct assembly
US4708708A (en) 1982-12-06 1987-11-24 International Paper Company Method and apparatus for skiving and hemming
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (fr) 1985-03-28 1990-11-27 Cetus Corp
US5171678A (en) 1989-04-17 1992-12-15 Centre National De La Recherche Scientifique Lipopolyamines, their preparation and their use
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5744305A (en) 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US5152808A (en) 1989-07-20 1992-10-06 Rockwool/Grodan B.V. Drainage coupling member
WO1991016024A1 (fr) 1990-04-19 1991-10-31 Vical, Inc. Lipides cationiques servant a l'apport intracellulaire de molecules biologiquement actives
US5283185A (en) 1991-08-28 1994-02-01 University Of Tennessee Research Corporation Method for delivering nucleic acids into cells
US5677195A (en) 1991-11-22 1997-10-14 Affymax Technologies N.V. Combinatorial strategies for polymer synthesis
WO1993024640A2 (fr) 1992-06-04 1993-12-09 The Regents Of The University Of California PROCEDES ET COMPOSITIONS UTILISES DANS UNE THERAPIE GENIQUE $i(IN VIVO)
WO1994000569A1 (fr) 1992-06-18 1994-01-06 Genpharm International, Inc. Procede de production d'animaux transgeniques non-humains abritant un chromosome artificiel de levure
US5770722A (en) 1994-10-24 1998-06-23 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
WO1996037194A1 (fr) 1995-05-26 1996-11-28 Somatix Therapy Corporation Vehicules d'apport medicamenteux comprenant des complexes d'acides nucleiques/de lipides stables
US5874219A (en) 1995-06-07 1999-02-23 Affymetrix, Inc. Methods for concurrently processing multiple biological chip assays
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
WO1998039359A1 (fr) 1997-03-06 1998-09-11 Genta Incorporated Lipides cationiques dimeres sur une base de cystine
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
WO2007091269A2 (fr) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEAU TANDEM d'ARNsi
WO2007117686A2 (fr) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Composés d'arn immunomodulateur stabilisé (simra) pour tlr7 et tlr8
WO2009014887A2 (fr) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Composés d'arn immunomodulateur stabilisé (simra)
WO2009073809A2 (fr) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Conjugués glucidiques utilisés en tant qu'agents d'administration pour des oligonucléotides
WO2010048228A2 (fr) * 2008-10-20 2010-04-29 Alnylam Pharmaceuticals, Inc. Compositions et procédés pour inhiber l'expression de la transthyrétine
WO2010141511A2 (fr) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucléotides pour interférence arn multivalente, compositions et procédés pour les utiliser
WO2011031520A1 (fr) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition pour inhiber l'expression génique et ses utilisations
WO2011056883A1 (fr) * 2009-11-03 2011-05-12 Alnylam Pharmaceuticals, Inc. Compositions de lipides formulés et procédés pour l'inhibition de l'expression de transthyrétine (ttr)
WO2011123468A1 (fr) * 2010-03-29 2011-10-06 Alnylam Pharmaceuticals, Inc. Thérapie siarn pour amylose oculaire liée à la transthyrétine (ttr)
WO2012177906A1 (fr) * 2011-06-21 2012-12-27 Alnylam Pharmaceuticals, Inc. Dosages et procédés de détermination de l'activité d'un agent thérapeutique chez un sujet
WO2013075035A1 (fr) 2011-11-18 2013-05-23 Alnylam Pharmaceuticals Agents arni, compositions et procédés d'utilisation de ceux-ci pour traiter des maladies associées à la transthyrétine (ttr)
US11598905B2 (en) 2020-03-19 2023-03-07 Korea Institute Of Science And Technology Inverted nanocone structure for optical device and method of producing the same

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
"Amyloidosis: Diagnosis and Treatment", 2010, HUMANA PRESS
"Heart Failure Society of America Annual Scientific Meeting ALN-TTRsc Phase I Study Results", 23 September 2013 (2013-09-23), XP055163623, Retrieved from the Internet <URL:http://www.alnylam.com/web/wp-content/uploads/2013/09/ALN-TTRsc-PhaseI-Results-HFSA-Sept2013.pdf> [retrieved on 20150120] *
AOKI ET AL., CANCER GENE THERAPY, vol. 8, 2001, pages 783 - 787
BANGHAM ET AL., M. MOL. BIOL., vol. 23, 1965, pages 238
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
BEAUCAGE, S.L.: "Solid-phase synthesis of siRNA oligonucleotides", CURR. OPIN. DRUG DISCOV. DEVEL., vol. 11, 2008, pages 203 - 216
BLAKE, C.C. ET AL., J MOL BIOL, vol. 88, 1974, pages 1 - 12
DIAS, N. ET AL., MOL CANCER THER, vol. 1, 2002, pages 347 - 355
DICKSON, P.W. ET AL., J. BIOL. CHEM., vol. 260, no. 13, 1985, pages 8214 - 8219
DU PLESSIS ET AL., ANTIVIRAL RESEARCH, vol. 18, 1992, pages 259 - 265
FAC. JACOBSON, D.R. ET AL., N. ENGL. J. MED., vol. 336, no. 7, 1997, pages 466 - 73
FELGNER, J. BIOL. CHEM., vol. 269, 1994, pages 2550
FELGNER, P. L. ET AL., PROC. NATL. ACAD. SCI., USA, vol. 8, 1987, pages 7413 - 7417
FUKUNAGA ET AL., ENDOCRINOL., vol. 115, 1984, pages 757
GAO, X.; HUANG, L., BIOCHIM. BIOPHYS. RES. COMMUN., vol. 179, 1991, pages 280
GERSHON, BIOCHEM., vol. 32, 1993, pages 7143
GUAN, J. ET AL.: "Current perspectives on cardiac amyloidosis", AM J PHYSIOL HEART CIRC PHYSIOL, 4 November 2011 (2011-11-04)
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
HAUBNER ET AL., JOUR. NUCL. MED., vol. 42, 2001, pages 326 - 336
ITANI, T. ET AL., GENE, vol. 56, 1987, pages 267 - 276
KAWAJI, T. ET AL., OPHTHALMOLOGY, vol. 117, 2010, pages 552 - 555
KIM ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 728, 1983, pages 339
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 - 1177
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
LIZ, M.A. ET AL., IUBMB LIFE, vol. 62, no. 6, 2010, pages 429 - 435
LIZARDI ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1197
LOBATO, L., J. NEPHROL., vol. 16, 2003, pages 438 - 442
LOBATO, L., JNEPHROL, vol. 16, 2003, pages 438 - 442
LOBATO, L., JNEPHROL., vol. 16, no. 3, 2003, pages 438 - 42
MANNINO, R. J.; FOULD-FOGERITE, S., BIOTECHNIQUES, vol. 6, 1988, pages 682 - 690
MAYER ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 858, 1986, pages 161
MAYHEW ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 775, 1984, pages 169
MELTON ET AL., NUC. ACIDS RES., vol. 12, pages 7035
MOSES ET AL., J. CLIN. INVEST., vol. 86, 1982, pages 2025 - 2033
MUELLER, S.; WOLF, J.; IVANOV, S.A.: "Current Strategies for the Synthesis of RNA", CURR. ORG. SYNTH., vol. 1, 2004, pages 293 - 307
NABEL, HUMAN GENE THER., vol. 3, 1992, pages 649
NABEL, PROC. NATL. ACAD. SCI., vol. 90, 1993, pages 11307
NICOLAU, C. ET AL., METH. ENZ., vol. 149, 1987, pages 157 - 176
OLSON ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 557, 1979, pages 9
RIEGER: "Pharmaceutical Dosage Forms", 1988, MARCEL DEKKER, INC., pages: 285
ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, pages: 245
SANTOS, SD.; FERNAANDES, R.; SARAIVA, MJ., NEUROBIOLOGY OF AGING, vol. 31, 2010, pages 280 - 289
SARAIVA M.J.M., EXPERT REVIEWS IN MOLECULAR MEDICINE, vol. 4, no. 12, 2002, pages 1 - 11
SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724
STRAUBINGER, R. M.; PAPAHADJOPOULOS, D., METH. ENZ., vol. 101, 1983, pages 512 - 527
STRAUSS, EMBO J., vol. 11, 1992, pages 417
SUBBARAO ET AL., BIOCHEMISTRY, vol. 26, 1987, pages 2964 - 2972
SZOKA ET AL., PROC. NATL. ACAD. SCI., vol. 75, 1978, pages 4194
TRACY ZIMMERMANN ET AL: "Phase I First-in-Humans Trial of ALN-TTRsc, a Novel RNA Interference Therapeutic for the Treatment of Familial Amyloidotic Cardiomyopathy (FAC)", JOURNAL OF CARDIAC FAILURE, vol. 19, no. 8, 1 August 2013 (2013-08-01), pages S66, XP055163300, ISSN: 1071-9164, DOI: 10.1016/j.cardfail.2013.06.214 *
TURK ET AL., BIOCHEM. BIOPHYS. ACTA, vol. 1559, 2002, pages 56 - 68
VOGEL ET AL., J. AM. CHEM. SOC., vol. 118, 1996, pages 1581 - 1586
WANG, C. Y.; HUANG, L., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7851 - 7855
WEINER ET AL., JOURNAL OF DRUG TARGETING, vol. 2, 1992, pages 405 - 410
WESTERMARK, P. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 87, no. 7, 1990, pages 2843 - 5
XIA, J.; NORONHA, A.; TOUDJARSKA, 1.; LI, F.; AKINC, A.; BRAICH, R.; FRANK-KAMENETSKY, M.; RAJEEV, K.G.; EGLI, M.; MANOHARAN, M.: "Gene Silencing Activity of siRNAs with a Ribo-difluorotoluyl Nucleotide", ACS CHEM. BIOL., vol. 1, 2006, pages 176 - 183
ZHOU ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 19, 1992, pages 269 - 274
ZHOU, X. ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1065, 1991, pages 8
ZITZMANN ET AL., CANCER RES., vol. 62, 2002, pages 5139 - 43

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10745704B2 (en) 2010-04-06 2020-08-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of CD274/PD-L1 gene
US9982259B2 (en) 2014-03-25 2018-05-29 Arcturus Therapeutics, Inc. Transthyretin allele selective UNA oligomers for gene silencing
US20150307880A1 (en) * 2014-03-25 2015-10-29 Arcturus Therapeutics, Inc. Transthyretin allele selective una oligomers for gene silencing
US20150322435A1 (en) * 2014-03-25 2015-11-12 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
US20150307881A1 (en) * 2014-03-25 2015-10-29 Arcturus Therapeutics, Inc. Una oligomers having reduced off-target effects in gene silencing
US10683500B2 (en) 2014-03-25 2020-06-16 Arcturus Therapeutics, Inc. UNA oligomers having reduced off-target effects in gene silencing
EP3122889A4 (fr) * 2014-03-25 2017-11-01 Arcturus Therapeutics, Inc. Oligomères una à effets hors cible réduits pour le silençage génétique
EP3122365A4 (fr) * 2014-03-25 2017-11-29 Arcturus Therapeutics, Inc. Oligomères d'una sélectifs d'allèle de transthyrétine, pour inactivation génique
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
US10604758B2 (en) * 2014-03-25 2020-03-31 Arcturus Therapeutics, Inc. Therapeutic oligomers for treating amyloidosis
US20180135051A1 (en) * 2014-03-25 2018-05-17 Arcturus Therapeutics, Inc. Therapeutic oligomers for treating amyloidosis
US11427822B2 (en) 2014-08-20 2022-08-30 Alnylam Pharmaceuticals, Inc. Modified double-stranded RNA agents
US11401517B2 (en) 2014-08-20 2022-08-02 Alnylam Pharmaceuticals, Inc. Modified double-stranded RNA agents
US11549109B2 (en) 2014-08-20 2023-01-10 Alnylam Pharmaceuticals, Inc. Modified double-stranded RNA agents
US10519447B2 (en) * 2015-04-01 2019-12-31 Arcturus Therapeutics, Inc. Therapeutic UNA oligomers and uses thereof
JP2018512140A (ja) * 2015-04-01 2018-05-17 アークトゥラス・セラピューティクス・インコーポレイテッドＡｒｃｔｕｒｕｓ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． 治療上のｕｎａオリゴマーおよびその使用
US10421964B2 (en) * 2015-07-23 2019-09-24 Arcturus Therapeutics, Inc. UNA oligomers and compositions for treating amyloidosis
WO2017015671A1 (fr) * 2015-07-23 2017-01-26 Arcturus Therapeutics, Inc. Compositions permettant de traiter l'amylose
US11286486B2 (en) 2015-07-31 2022-03-29 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases
JP2018523655A (ja) * 2015-07-31 2018-08-23 アルナイラム ファーマシューティカルズ， インコーポレイテッドＡｌｎｙｌａｍ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ． ＴＴＲ関連疾患を治療または予防するためのトランスサイレチン（ＴＴＲ）ｉＲＮＡ組成物およびその使用方法
US10683501B2 (en) 2015-07-31 2020-06-16 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases
US12049628B2 (en) 2015-07-31 2024-07-30 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases
US11685918B2 (en) 2015-09-02 2023-06-27 Alnylam Pharmaceuticals, Inc. Programmed cell death 1 ligand 1 (PD-L1) iRNA compositions and methods of use thereof
WO2017040078A1 (fr) * 2015-09-02 2017-03-09 Alnylam Pharmaceuticals, Inc. Compositions d'arni ciblant le ligand de mort cellulaire programmée 1 (pd-l1) et leurs méthodes d'utilisation
US10889813B2 (en) 2015-09-02 2021-01-12 Alnylam Pharmaceuticals, Inc. Programmed cell death 1 ligand 1 (PD-L1) iRNA compositions and methods of use thereof
WO2017177326A1 (fr) * 2016-04-11 2017-10-19 Protiva Biotherapeutics, Inc. Compositions de conjugués d'acides nucléiques ciblés
JP2019513770A (ja) * 2016-04-11 2019-05-30 アルブータス・バイオファーマー・コーポレイション 標的核酸コンジュゲート組成物
CN109312342A (zh) * 2016-04-11 2019-02-05 阿布特斯生物制药公司 靶向核酸偶联物组合物
US11896672B2 (en) 2016-04-11 2024-02-13 Arbutus Biopharma Corporation Targeted nucleic acid conjugate compositions
EP4035659A1 (fr) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes destinés à l'administration d'agents thérapeutiques
US11427823B2 (en) 2017-04-11 2022-08-30 Arbutus Biopharma Corporation Targeted compositions
US12043833B2 (en) 2017-04-11 2024-07-23 Arbutus Biopharma Corporation Targeted compositions
US11806360B2 (en) 2017-09-19 2023-11-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating transthyretin (TTR) mediated amyloidosis
WO2020069055A1 (fr) * 2018-09-28 2020-04-02 Alnylam Pharmaceuticals, Inc. Compositions d'arni de la transthyrétine (ttr) et leurs procédés d'utilisation pour traiter ou prévenir des maladies oculaires associées à la ttr
JP7470107B2 (ja) 2018-09-28 2024-04-17 アルナイラム ファーマシューティカルズ， インコーポレイテッド トランスサイレチン（ＴＴＲ）ｉＲＮＡ組成物及びＴＴＲ関連眼疾患を治療又は予防するためのその使用方法
JP2022501057A (ja) * 2018-09-28 2022-01-06 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. トランスサイレチン（ＴＴＲ）ｉＲＮＡ組成物及びＴＴＲ関連眼疾患を治療又は予防するためのその使用方法
JP2022506517A (ja) * 2018-11-02 2022-01-17 アルブータス・バイオファーマー・コーポレイション 標的指向化二価結合体
WO2021092145A1 (fr) * 2019-11-06 2021-05-14 Alnylam Pharmaceuticals, Inc. Composition d'arni de la transthyrétine (ttr) et ses procédés d'utilisation pour le traitement ou la prévention de maladies oculaires associées à ttr
WO2022260939A2 (fr) 2021-06-08 2022-12-15 Alnylam Pharmaceuticals, Inc. Compositions et méthodes de traitement ou de prévention de la maladie de stargardt et/ou de troubles associés à la protéine 4 de liaison du rétinol (rbp4)
WO2023014677A1 (fr) * 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Compositions d'arni de la transthyrétine (ttr) et leurs procédés d'utilisation
US11959081B2 (en) 2021-08-03 2024-04-16 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof

Also Published As

Publication number Publication date
TW201610151A (zh) 2016-03-16
AR097738A1 (es) 2016-04-13
WO2015042564A8 (fr) 2015-05-28

Similar Documents

Publication Publication Date Title
AU2017225076B2 (en) Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
JP7062623B2 (ja) ケトヘキソキナーゼ（ＫＨＫ）ｉＲＮＡ組成物及びその使用方法
US11504391B1 (en) Modified RNA agents with reduced off-target effect
WO2015042564A1 (fr) Méthodes pour le traitement ou la prévention de maladies associées à la transthyrétine (ttr)
CN108064154B (zh) 用于抑制hao1(羟酸氧化酶1(乙醇酸盐氧化酶))基因表达的组合物及方法
KR102689177B1 (ko) 변형된 ＲＮＡｉ 제제
RU2804776C2 (ru) СРЕДСТВА ДЛЯ РНКи, КОМПОЗИЦИИ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ, АССОЦИИРОВАННЫХ С ТРАНСТИРЕТИНОМ (TTR)
OA16815A (en) RNAI agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14781784

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14781784

Country of ref document: EP

Kind code of ref document: A1