OA16815A

OA16815A - RNAI agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases.

Info

Publication number: OA16815A
Application number: OA1201400209
Authority: OA
Inventors: Kallanthottathil G Rajeev; Tracy Zimmermann; Muthiah Manoharan; Martin Maier; Satyanarayana Kuchimanchi; Klaus CHARISSE
Original assignee: Alnylam Pharmaceuticals
Priority date: 2011-11-18
Filing date: 2012-11-16
Publication date: 2016-01-04

Abstract

The present invention provides RNAi agents, e.g., double stranded RNAi agents, that target the transthyretin (TTR) gene and methods of using such RNAi agents for treating or preventing TTRassociated diseases.

Description

This application claims priority to U.S. Provisional Application No. 61/561,710, filed on November 18, 2011, U.S. Provisional Application No. 61/615,618, filed on March 26,2012, and U.S. Provisional Application No. 61/680,098, filed on August 6, 2012, the entire contents of each of which are hereby incorporated herein by reference.

Sequence Listing

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 13, 2012, is named 121301WO.txt and is 541,508 bytes in size.

Background of the Invention

Transthyretin (TTR) (also known as prealbumin) is found in sérum and cerebrospinal fluid (CSF). TTR transports retînol-binding protein (RBP) and thyroxine (T4) and also acts as a carrier of retinol (vitamin A) through its association with RBP in the blood and the CSF. Transthyretin is named for its transport of thyroxine and retinol. TTR also fonctions as a protease and can cleave proteins including apoA-I (the major HDL apolipoprotein), amyloid β-peptide, and neuropeptide Y. See Liz, M.A. et al. (2010) IUBMB Life, 62(6):429-435.

TTR is a tetramer of four identical 127-amino acid subunits (monomers) that are rich in beta sheet structure. Each monomer has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internai channel.

The liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium) and pancréas.

Transthyretin is one of at least 27 distinct types of proteins that is a precursor protein in the formation of amyloid fibrils. See Guan, J. et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am JPhysiol Heart Cire Physiol, doi: 10.1152/ajpheart.OO815.2011. Extracellular déposition of amyloid fibrils in organs and tissues is the hallmark of amyloidosis. Amyloid fibrils are composed of misfolded protein aggregates, which may resuit from either excess production of or spécifie mutations in precursor proteins. The amyloidogenic potential of TTR may be related to its extensive beta sheet structure; X-ray crystallographic studies indicate that certain amyloidogenic mutations destabilize the tetrameric structure ofthe protein. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12); 1 -11.

Amyloidosis is a general term for the group of amyloid diseases that are characterized by amyloid deposits. Amyloid diseases are classified based on their precursor protein; for example, the name starts with “A” for amyloid and is followed by an abbreviation of the precursor protein, e.g., ATTR for amloidogenic transthyretin. Ibid.

There are numerous TTR-associated diseases, most of which are amyloid diseases. Normal-sequence TTR is associated with cardiac amyloidosis in people who are elderly and is termed sentie systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanîed by microscopie deposits in many other organs. TTR amyloidosis manîfests in various forms. When the peripheral nervous system is affected more prominently, the disease is termed familial amyloidotic polyneuropathy (FAP). When the heart is primarily involved but the nervous system is not, the disease is called familial amyloidotic cardiomyopathy (FAC). A third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form. Mutations in TTR may also cause amyloidotic vitreous opacities, carpal tunnel syndrome, and euthyroid hyperthyroxinemia, which is a non-amyloidotic disease thought to be secondary to an increased association of thyroxine with TTR due to a mutant TTR molécule with increased affinity for thyroxine. See, e.g., Moses et al. (1982) J. Clin. Invest., 86, 2025-2033.

Abnormal amyloidogenic proteins may be either inherited or acquired through somatic mutations. Guan, J. et al. (Nov. 4,2011) Current perspectives on cardiac amyloidosis, Am JPhysiol Heart Cire Physiol, doùlO.l152/ajpheart.00815.2011. Transthyretin associated ATTR is the most frequent form of hereditary systemic amyloidosis. Lobato, L. (2003) J. Nephrol., 16:438-442. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. TTR mutations usually give rise to systemic amyloid déposition, with particular involvement of the peripheral nervous System, although some mutations are associated with cardiomyopathy or vitreous opacities. Ibid.

The V30M mutation is the most prévalent TTR mutation. See, e.g., Lobato, L. (2003) JNephrol, 16:438-442. The V122I mutation is carried by 3.9% ofthe Afiican American population and is the most common cause of FAC. Jacobson, D.R. et al. (1997) N. Engl. J. Med. 336 (7): 466-73. It is estimated that SSA affects more than 25% of the population over âge 80. Westermark, P. et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87 (7): 2843-5.

Accordingly, there is a need in the art for effective treatments for TTR-associated diseases.

Summary of the Invention

The présent invention provides RNAi agents, e.g., double stranded RNAi agents, targeting the Transthyretin (TTR) gene. The présent invention also provides methods of inhibiting expression of TTR and methods of treating or preventing a TTR-associated disease in a subject using the RNAi agents, e.g. double stranded RNAi agents, of the invention. The présent invention is based, at least in part, on the discovery that RNAi agents that comprise particular chemical modifications show a superior ability to inhibit expression of TTR. Agents including a certain pattern of chemical modifications (e.g., an altemating pattern) and a ligand are shown herein to be effective in silencing the activity of the TTR gene. Furthermore, agents including one or more motifs of three identical modifications on three consecutive nucléotides, including one such motif at or near the cleavage site of the agents, show surprisingly enhanced TTR gene silencing activity. When a single such chemical motif is présent in the agent, it is preferred to be at or near the cleavage région for enhancing of the gene silencing activity. Cleavage région is the région surrounding the cleavage site, i.e., the site on the target mRNA at which cleavage occurs.

Accordingly, in one aspect, the présent invention features RNAi agents, e.g., double stranded RNAi agents, for inhibiting expression of a transthyretin (TTR). The double stranded RNAi agent includes a sense strand complementary to an antisense strand. The antisense strand includes a région complementary to a part of an mRNA encoding transthyretin. Each strand has 14 to 30 nucléotides, and the double stranded RNAi agent is represented by formula (III): sense: 5’ n_p -N_a -(X X X) _rN_b -Y Y Y -N_b -(Z Z Z)j -N_a - n_q 3’ antisense: 3’ n_p'-N_a'-(X'X'X')_k-N_b'-Y'Y'Y'-N_b'-(Z'Z'Z')i-N_a'- n_q' 5’ (III).

In Formula III, i, j, k, and l are each independently 0 or 1 ; p, p', q, and q' are each independently 0-6; each N_n and N_a' independently represents an oligonucleotide sequence including 0-25 nucléotides which are either modified or unmodified or combinations thereof, each sequence including at least two differently modified nucléotides; each N_b and N_b' independently represents an oligonucleotide sequence including 0-10 nucléotides which are either modified or unmodified or combinations thereof; each n_p, n_p', n_q, and n_q' independently represents an overhang nucléotide; XXX, YYY, ZZZ, X'X'X', ΥΎΎ', and Z'Z'Z' each independently represents one motif of three identical modifications on three consecutive nucléotides; modifications on N_b differ from the modification on Y and modifications on N_b' differ from the modification on Y'. In some embodiments, the sense strand is conjugated to at least one ligand, e.g., at least one ligand, e.g., at least one ligand attached to the 3’ end of the sense strand. In other embodiments, the ligand may be conjugated to the antisense strand.

In some embodiments, i is 1 ; j is 1 ; or both i and j are 1.

In some embodiments, k is 1 ; 1 is 1 ; or both k and 1 are 1.

In some embodiments, i is 0; j is l.

In some embodiments, i is 1, j is 0.

In some embodiments, k is 0; 1 is 1.

In some embodiments, k is 1; 1 is 0.

In some embodiments, XXX is complementary to X'X'X', YYY is complementary to ΥΎΎ', and ZZZ is complementary to Z'Z'Z'.

In some embodiments, the YYY motif occurs at or near the cleavage site of the sense strand.

In some embodiments, the ΥΎΎ' motif occurs at the 11,12 and 13 positions of the antisense strand from the 5’-end.

In some embodiments, the Y' is 2'-O-methyl.

In some embodiments, the Y’ is 2’-fluoro.

In some embodiments, formula (III) is represented as formula (Ilia):

sense: 5’ n_p -N_a -YYY -Nb -ZZZ -N_a-n_q 3’ antisense: 3’ n_p'-N_a'-Y'Y'Y'-N_b'-Z'Z'Z'-N_n'n_q' 5' (Ilia).

In formula Ilia, each Nb and Nb' independently represents an oligonucleotide sequence including 1-5 modified nucléotides.

In some embodiments, formula (III) is represented as formula (Illb):

sense: 5’ n_p-N_a-X X X -N_b-Y Y Y -N_a-n_q 3’ antisense: 3¹ n_p'-N_a'-X'X'X'-N_b'-Y'Y'Y'-N_a'-n_q' 5’ (Illb).

In formula Illb each Nb and Nb' independently represents an oligonucleotide sequence including 1-5 modified nucléotides.

In some embodiments, formula (III) is represented as formula (IIIc):

sense:	5’ n_p-N_a-X X X -N_b-Y Y Y -N_b-Z Z Z -N_d-n_lt 3'
antisense:	3' np'-N_a'-X'X'X'-Nb'-Y'Y'Y'-N_b'-Z'Z'Z'-N_a'-n_q' 5’ (IIIc).

In formula IIIc, each Nb and -Nb' independently represents an oligonucleotide sequence including 1-5 modifïed nucléotides and each N_a and N_a' independently represents an oligonucleotide sequence including 2-10 modifïed nucléotides.

In many embodiments, the duplex région is 15-30 nucléotide pairs in length. In some embodiments, the duplex région is 17-23 nucléotide pairs in length, 17-25 nucléotide pairs in length, 23-27 nucléotide pairs in length, 19-21 nucléotide pairs in length, or 21-23 nucléotide pairs in length.

In certain embodiments, each strand has 15-30 nucléotides.

In some embodiments, the modifications on the nucléotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C15 allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyl, and combinations thereof. In some preferred embodiments, the modifications on the nucléotides are 2'-O-methyl or 2'-fluoro.

In some embodiments, the ligand is one or more N-acetylgalactosamine (GalNAc) dérivatives attached through a bivalent or trivalent branched linker. In particular embodiments, the ligand is

In some embodiments, the ligand is attached to the 3' end of the sense strand.

In some embodiments, the RNAi agent is conjugated to the ligand as shown in the following schematic

wherein X is O or S.

In some embodiments, the RNAi agent further includes at least one phosphorothioate or methylphosphonate intemucleotide lînkage. In some embodiments, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3’-terminal of one strand. In some embodiments, the strand is the antisense strand. In other embodiments, the strand is the sense strand.

In certain embodiments, the base pair at the l position of the 5'-end of the duplex is an AU base pair.

In some embodiments, the Y nucléotides contain a 2'-fluoro modification.

In some embodiments, the Y' nucléotides contain a 2'-O-methyl modification.

In some embodiments, p'>0. In some such embodiments, each n is complementary to the target mRNA. In other such embodiments, each n is noncomplementary to the target mRNA. In some embodiments, p, p’, q and q’ are 1-6. In some preferred embodiments, p’ = 1 or 2. In some preferred embodiments, p-2. In some such embodiments, q’=0, p=0, q=0, and p’ overhang nucléotides are complementary to the target mRNA. In other such embodiments, q’=0, p=0, q=0, and p’ overhang nucléotides are non-complementary to the target mRNA.

In some embodiments, the sense strand has a total of 21 nucléotides and the antisense strand has a total of 23 nucléotides.

In certain embodiments, linkages between n_p' inciude phosphorothioate linkages. In some such embodiments, the linkages between n_p' are phosphorothioate linkages.

In some embodiments, the RNAi agent is selected from the group of agents listed in Table 1.

In preferred embodiments, the RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547.

In an even more preferred embodiment, the RNAi agent is AD-51547 having the following structure:

5’- UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3’ (SEQ ID

5’- uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3’ (SEQ ID sense:

NO:2) antisense:

NO:3) wherein lowercase nucléotides (a, u, g, c) indicate 2*-O-methyl nucléotides; Nf (e.g., Af) indicates a 2’-fluoro nucléotide; s indicates a phosphothiorate linkage; L96 indicates a GalNAcî ligand.

In another aspect, the présent invention features a cell containing the RNAi agent for inhibiting expression of TTR.

In a further aspect, the présent invention features a pharmaceutical composition comprising an RNAi agent for inhibiting expression of TTR. In some embodiments, the pharmaceutical composition is a solution comprising the RNAi agent. In some embodiments, the solution comprising the RNAi agent is an unbuffered solution, e.g., saline solution or water. In other embodiments, the solution is a buffered solution, e.g., a solution of phosphate buffered saline (PBS). In other embodiments, the pharmaceutical composition is a liposome or a lîpid formulation. In some embodiments, the lipid formulation comprises a XTC or MC3.

In yet another aspect, the présent invention features methods of inhibiting expression of transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell, thereby inhibiting expression of TTR in the cell.

In some embodiments, the expression of TTR is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.

In other embodiments, the cell is contacted in vitro with the RNAi agent. In other embodiments, the cell is présent within a subject. In preferred embodiments, the subject is a human.

In further embodiments, the subject is a subject suffering fforn a TTR-associated disease and the effective amount is a therapeutîcally effective amount. In other embodiments, the subject is a subject at risk for developing a TTR-associated disease and the effective amount is a prophylactically effective amount. In some embodiments, a subject at risk for develping a TTR-associated disease is a subject who carnes a TTR gene mutation that is associated with the development of a TTR-associated disease.

In certain embodiments, the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.

In some embodiments, the subject has a TTR-associated amyloidosis and the method reduces an amyloid TTR deposit in the subject.

In other embodiments, the RNAi agent is administered to the subject by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In certain embodiments, the RNAi agent is administered to the subject via subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject via subcutaneous administration. In some such embodiments, the subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot.

In certain embodiments, the RNAi agent is administered to the subject such that the RNAi agent is delivered to a spécifie site within the subject. In some embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and pancréas. In preferred embodiments, the site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by asialoglycoprotein receptor (ASGP-R) présent in hépatocytes.

In some embodiments, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about l mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg.

In some embodiments, the RNAi agent is administered in two or more doses. In particular embodiments, the RNAi agent is administered at intervals selected from the group consisting of once every about 2 hours, once every about 3 hours, once every about 4 hours, once every about 6 hours, once every about 8 hours, once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, once every about 96 hours, once every about 120 hours, once every about 144 hours, once every about 168 hours, once every about 240 hours, once every about 336 hours, once every about 504 hours, once every about 672 hours and once every about 720 hours.

In other embodiments, the method further includes assessing the level of TTR mRNA expression or TTR protein expression in a sample derived from the subject.

In preferred embodiments, admînistering the RNAi agent does not resuit in an inflammatory response in the subject as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL 1 β, IL-lra, IL-6, IL-8, IP-10, MCP-1, ΜΙΡ-Ια, MIP-Ιβ, TNFa, and any combinations thereof, in a sample from the subject.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition

In preferred embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered with a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

In another embodiment, the pharmaceutical composition is a liposome or a lipid formulation comprising SNALP or XTC. In one embodiment, the lipid formulation comprises an MC3.

In another aspect, the invention provides methods of treating or preventing a TTR-associated disease in a subject. The methods include administering to the subject a therapeutically effective amount or prophylactically effective amount of an RNAi agent, e.g., a double stranded RNAi agent, thereby treating or preventing the TTR-associated disease in the subject.

In some embodiments, TTR expression in a sample derived from the subject is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% or at least about 70% at least about 80%, or at least about 90%.

In some embodiments, the subject is a human.

In some embodiments, the subject is a subject suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTRassociated disease.

In some embodiments, the subject is a subject who cames s a TTR gene mutation that is associated with the development of a TTR-associated disease.

In certain embodiments, the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (F AP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.

In some embodiments, the RNAi agent is administered to the subject by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In certain embodiments, the RNAi agent is administered to the subject via subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject via subcutaneous administration. In some such embodiments, the subcutaneous administration includes administration via a subcutaneous pump or subcutaneous depot.

In certain embodiments, the RNAi agent is administered to the subject such that the RNAi agent is delivered to a spécifie site within the subject. In some such embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and pancréas. In preferred embodiments, the site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by asialoglycoprotein receptor (ASGP-R) présent in hépatocytes.

In some embodiments, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.

In preferred embodiments, administering the RNAi agent does not resuit in an inflammatory response in the subject as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1 β, IL-lra, IL-6, IL-8, IP-10, MCP-1, ΜΙΡ-Ια, MIP-Ιβ, TNFa, and any combinations thereof, in a sample from the subject.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition, e.g., a liposome.

In some embodiments, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in saline or water. In other embodiments, the siRNA is administred with a buffer solution, such as an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

In another aspect, the présent invention provides a method of inhibiting expression of transthyretin (TTR) in a cell, including contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell. In one aspect, the double stranded RNAi agent is selected from the group of agents listed in Table l, thereby inhibiting expression of transthyretin (TTR) in the cell.

In another aspect, the présent invention provides a method of inhibiting expression of transthyretin (TTR) in a cell, including contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell. In one aspect, the double stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby inhibiting expression of transthyretin (TTR) in the cell.

In a further aspect, the présent invention provides a method of treating or preventing a TTR-associated disease in a subject, including administering to the subject a therapeutlcally effective amount or a prophylactically effective amount of an RNAi agent, e.g., a double stranded RNAi agent. In one aspect, the double stranded RNAi agent is selected from the group of agents listed in Table 1, thereby treating or preventing a TTR-associated disease in the subject.

In yet another aspect, the présent invention provides a method of treating or preventing a TTR-associated disease in a subject, including administering to the subject a therapeutlcally effective amount or a prophylactically effective amount of an RNAi agent, e.g., a double stranded RNAi agent. In one aspect, the double stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby treating or preventing a TTR-associated disease in the subject.

In further aspects, the invention provides kits for performing the methods of the invention. In one aspect, the invention provides a kit for performing a method of inhibiting expression of transthyretin (TTR) in a cell comprising contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of said TTR in said cell, thereby inhibiting the expression of TTR in the cell. The kit comprises an RNAi agent and instructions for use and, optionally, means for administering the RNAi agent to the subject.

The présent invention is further illustrated by the following detailed description and drawins.

Brief Description of the Drawings

Figure 1 is a graph depicting that administering to mice a single subcutaneous dose of a GalNAc-conjugated RNAi agent targeting TTR resulted in dose-dependent suppression of TTR mRNA.

Figure 2 is a graph depicting that administering to mice a single subcutaneous dose of 7.5 mg/kg or 30 mg/kg of a GalNAc conjugated RNAi agent targeting TTR resulted in long lasting suppression of TTR mRNA.

Figure 3 depicts the human TTR mRNA sequence.

Figure 4 is a graph depicting improved silencing activity of RNAi agents modified relative to the parent AD-45163.

Figure 5 is a graph depicting improved silencing activity of RNAi agents modified relative to the parent AD-45165.

Figure 6 is a graph depicting improved free uptake silencing following 4 hour incubation with RNAi agents modified relative to the parent AD-45163.

Figure 7 is a graph depicting improved free uptake silencing following 24 hour incubation with RNAi agents modified relative to the parent AD-45163.

Figure 8 is a graph depicting improved free uptake silencing following 4 hour incubation with RNAi agents modified relative to the parent AD-45165.

Figure 9 is a graph depicting improved free uptake silencing following 24 hour incubation with RNAi agents modified relative to the parent AD-45165.

Figure 10 is a graph depicting silencing of TTR mRNA in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of RNAi agents AD-51544, AD-51545, AD-45163, AD-51546, AD-51547, or AD-45165.

Figure 11 is a graph depicting TTR protein suppression in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of 5 mg/kg or 1 mg/kg of RNAi agents AD-51544, AD-51545, or AD-45163.

Figure 12 is a graph depicting TTR protein suppression in transgenic mice that express hTTR V30M following administration of a single subcutaneous dose of 5 mg/kg or lmg/kgof RNAi agents AD-51546, AD-51547, or AD-45165.

Figure 13 depicts the protocol for post-dose blood draws in monkeys that received 5x5mg/kg RNAi agent (top line) or lx25mg/kg RNAi agent (bottom line).

Figure 14 is a graph depicting suppression of TTR protein in non-human primates following subcutaneous administration of ftve 5 mg/kg doses (top panel) or a single 25mg/kg dose (bottom panel) of AD-45163, AD-51544, AD-51545, AD-51546, or AD-51547.

Figure 15 is a graph depicting suppression of TTR protein in non-human primates following subcutaneous administration of AD-51547 at 2.5 mg/kg (white squares), 5 mg/kg (black squares) or 10 mg/kg (pattemed squares) per dose, or administration of PBS as a négative control (gray squares).

Detailed Description of the Invention

The présent invention provides RNAi agents, e.g., double stranded RNAi agents, and compositions targeting the Transthyretin (TTR) gene. The présent invention also provides methods of inhibiting expression of TTR and methods of treating or preventing a TTR-associated disease in a subject using the RNAi agents, e.g., double stranded RNAi agents, of the invention. The présent invention is based, at least in part, on the discovery that RNAi agents that comprise particular chemical modifications show a superior ability to inhibit expression of TTR. Agents including a certain pattern of chemical modifications (e.g., an altemating pattern) and a ligand are shown herein to be effective in silencing the activity of the TTR gene. Furthermore, agents including one or more motifs of three identical modifications on three consecutive nucléotides, including one such motif at or near the cleavage site of the agents, show surprisingly enhanced TTR gene silencing activity. When a single such chemical motif îs présent in the agent, it is preferred to be at or near the cleavage région for enhancing of the gene silencing activity. Cleavage région is the région surrounding the cleavage site, i.e., the site on the target mRNA at which cleavage occurs.

I. Définitions

As used herein, each of the following terms has the meaning associated with it in this section.

The term including is used herein to mean, and is used interchangeably with, the phrase including but not limited to.

The term or is used herein to mean, and is used interchangeably with, the term and/or, unless context clearly indicates otherwise.

As used herein, a “transthyretin” (“TTR”) refers to the well known gene and protein. TTR is also known as prealbumin, HsT265l, PALB, and TBPA. TTR functions as a transporter of retinol-binding protein (RBP), thyroxine (T4) and retinol, and it also acts as a protease. The liver sécrétés TTR into the blood, and the choroid plexus sécrétés TTR into the cerebrospinal fluid. TTR is also expressed in the pancréas and the retinal pigment epithelium. The greatest clinical relevance of TTR is that both normal and mutant TTR protein can form amyloid fibrils that aggregate into extracellular deposits, causing amyloidosis. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12):1-11 for a review. The molecular cloning and nucléotide sequence of rat transthyretin, as well as the distribution of mRNA expression, was described by Dickson, P.W. et al. (1985) J. Biol. Chem. 260(13)8214-8219. The Xray crystal structure of human TTR was described in Blake, C.C. et al. (1974) J Mol Biol 88,1-12. The sequence of a human TTR mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371. The sequence of mouse TTR mRNA can be found at RefSeq accession number NM_013697.2, and the sequence of rat TTR mRNA can be found at RefSeq accession number NM_012681.1

As used herein, “target sequence” refers to a contiguous portion of the nucléotide sequence of an mRNA molécule formed during the transcription of a TTR gene, including mRNA that is a product of RNA processing of a primary transcription product.

As used herein, the tenn “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucléotides that is described by the sequence referred to using the standard nucléotide nomenclature.

G, C, A and U each generally stand for a nucléotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. “T” and “dT” are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine, 2’-deoxythymidine or thymidine. However, it will be understood that the term “ribonucleotide” or “nucléotide” or “deoxyribonucleotide” can also refer to a modified nucléotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moîeties without substantially altering the base pairing properties of an oligonucleotide comprising a nucléotide bearing such replacement moiety. For example, without limitation, a nucléotide comprising inosine as its base may base pair with nucléotides containing adenine, cytosine, or uracil. Hence, nucléotides containing uracil, guanine, or adenine may be replaced in the nucléotide sequences of the invention by a nucléotide containing, for example, inosine. Sequences comprising such replacement moietîes are embodiments of the invention.

A “double stranded RNAi agent,” double-stranded RNA (dsRNA) molécule, also referred to as “dsRNA agent,” “dsRNA”, “siRNA”, “iRNA agent,” as used interchangeably herein, refers to a complex of ribonucleic acid molécules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined below, nucleic acid strands. In general, the majority of nucléotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucléotide. In addition, as used in this spécification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucléotides. Such modifications may include ail types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molécule, are encompassed by “RNAi agent” for the purposes of this spécification and claims.

In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucléotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucléotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150;:883-894.

The two strands forming the duplex structure may be different portions of one larger RNA molécule, or they may be separate RNA molécules. Where the two strands are part of one larger molécule, and therefore are connected by an uninterrupted chain of nucléotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” Where the two strands are connected covalently by means other than an uninterrupted chain of nucléotides between the 3’-end of one strand and the 5’-end of the respective other strand fonning the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may hâve the same or a different number of nucléotides. The maximum number of base pairs is the number of nucléotides in the shortest strand of the dsRNA minus any overhangs that are présent in the duplex. In addition to the duplex structure, an RNAÎ agent may comprise one or more nucléotide overhangs, The term “siRNA” is also used herein to refer to an RNAi agent as described above.

In another aspect, the agent is a single-stranded antisense RNA molécule. An antisense RNA molécule is complementary to a sequence within the target mRNA. Antisense RNA can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther l :347-355. The antisense RNA molécule may hâve about 15-30 nucléotides that are complementary to the target mRNA. For example, the antisense RNA molécule may hâve a sequence of at least 15,16, 17,18,19, 20 or more contiguous nucléotides from one of the antisense sequences of Table 1.

As used herein, a “nucléotide overhang” refers to the unpaired nucléotide or nucléotides that protrude from the duplex structure of an RNAi agent when a 3’-end of one strand of the RNAi agent extends beyond the 5’-end of the other strand, or vice versa. “Blunt” or “blunt end” means that there are no unpaired nucléotides at that end of the double stranded RNAi agent, i.e., no nucléotide overhang. A “blunt ended” RNAi agent is a dsRNA that is double-stranded over its entire length, i.e., no nucléotide overhang at either end of the molécule. The RNAi agents of the invention include RNAi agents with nucléotide overhangs at one end (i.e., agents with one overhang and one blunt end) or with nucléotide overhangs at both ends.

The term “antisense strand” refers to the strand of a double stranded RNAi agent which includes a région that is substantially complementary to a target sequence (e.g., a human TTR mRNA). As used herein, the term “région complementary to part of an mRNA encoding transthyretin” refers to a région on the antisense strand that is substantially complementary to part of a TTR mRNA sequence. Where the région of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal régions and, if présent, are generally in a terminal région or régions, e.g., within 6, 5, 4, 3, or 2 nucléotides of the 5’ and/or 3’ terminus.

The term “sense strand,” as used herein, refers to the strand of a dsRNA that includes a région that is substantially complementary to a région of the antisense strand.

As used herein, the term “cleavage région” refers to a région that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage région comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage région comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucléotides 10 and 11 of the antisense strand, and the cleavage région comprises nucléotides 11, 12 and 13.

As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucléotide sequence in relation to a second nucléotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucléotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucléotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may înclude: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours foilowed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to détermine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucléotides.

Sequences can be “fiilly complementary” with respect to each when there is base-pairing of the nucléotides of the first nucléotide sequence with the nucléotides of the second nucléotide sequence over the entîre length of the first and second nucléotide sequences. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fiilly complementary, or they may form one or more, but generally not more than 4,3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the détermination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucléotides in length and another oligonucleotide 23 nucléotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucléotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as “fully complementary” for the purposes described herein.

“Complementary” sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modifïed nucléotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.

The terms “complementary,” “fully complementary” and “substantially complementary” herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide that is “substantially complementary to at least part of ’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding TTR) including a 5’ UTR, an open reading frame (ORF), or a 3’ UTR. For example, a polynucleotide is complementary to at least a part of a TTR mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding TTR.

The tenu “inhibiting,” as used herein, is used ïnterchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.

The phrase “inhibiting expression of a TTR,” as used herein, includes inhibition of expression of any TTR gene (such as, e.g., a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene) as well as variants or mutants of a TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to systemic amyloid déposition), or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism.

“Inhibiting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

The expression of a TTR gene may be assessed based on the level of any variable associated with TTR gene expression, e.g., TTR mRNA level, TTR protein level, retinol binding protein level, vitamin A level, or the number or extent of amyloid deposits. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

The phrase “contacting a cell with an RNAi agent,” as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or altematively, the RNAi agent may be put into a situation that will permit or cause it to subsequently corne into contact with the cell.

Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., a GalNAcj ligand, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. In connection with the methods of the invention, a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

A patient or subject, as used herein, is intended to include either a human or non-human animal, preferably a mammal, e.g., a monkey. Most preferably, the subject or patient is a human.

A “TTR-associated disease,” as used herein, is intended to include any disease associated with the TTR gene or protein. Such a disease may be caused, for example, by excess production of the TTR protein, by TTR gene mutations, by abnormal cleavage of the TTR protein, by abnormal interactions between TTR and other proteins or other endogenous or exogenous substances. A “TTR-associated disease” includes any type of TTR amyloidosis (ATTR) wherein TTR plays a rôle in the formation of abnormal extracellular aggregates or amyloid deposits. TTR-associated diseases include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomie neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomie insufficiency, cardiomyopathy, vitreous opacities, rénal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and comeal lattice dystrophy.

Therapeutîcally effective amount, as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TTR associated disease, is sufficient to effect treatment of the disease (e.g., by dîminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The therapeutîcally effective amount may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, âge, weight, family history, genetic makeup, stage of pathological processes mediated by TTR expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

“Prophylactically effective amount,” as used herein, is întended to include the amount of an RNAi agent that, when administered to a subject who does not yet expérience or display symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Symptoms that may be ameliorated include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomie neuropathy (e.g., gastrointestinal dysfonction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomie insufficiency, cardiomyopathy, vitreous opacities, rénal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfonction, and comeal lattice dystrophy. Amelioratîng the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The prophylactically effective amount may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, âge, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

A therapeutically-effective amount or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi gents employed in the methods of the présent invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

The term “sample,” as used herein, includes a collection of sîmilar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tîssues présent within a subject. Examples of biological fluids include blood, sérum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized régions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hépatocytes), the retina or parts of the retina (e.g., retinal pigment epithelium), the central nervous system or parts of the central nervous system (e.g., ventricles or choroid plexus), or the pancréas or certain cells or parts of the pancréas. In some embodiments, a “sample derived from a subject” refers tocerebrospinal fluid obtained from the subject. In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a subject” refers to liver tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.

IL RNAi Agents

The présent invention provides RNAi agents with superior gene silencing activity. It is shown herein and in Provisional Application No. 61/561,710 (to which the présent application claims priority) that a superior resuit may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucléotides into a sense strand and/or antisense strand of a RNAi agent, particularly at or near the cleavage site. The sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if présent, of the sense and/or antisense strand. The RNAi agent also optionally conjugates with a GalNAc dérivative ligand, for instance on the sense strand. The resulting RNAi agents présent superior gene silencing activity.

The inventors surprisingly discovered that when the sense strand and antisense strand of the RNAi agent are completely modified, having one or more motifs of three identical modifications on three consecutive nucléotides at or near the cleavage site of at least one strand of a RNAi agent superiorly enhanced the gene silencing acitivity of the RNAi agent.

Accordingly, the invention provides RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of a target gene (i.e., a TTR gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the

RNAi agent can range from 12-30 nucléotides in length. For example, each strand can be between 14-30 nucléotides in length, 17-30 nucléotides in length, 25-30 nucléotides in length, 27-30 nucléotides in length, 17-23 nucléotides in length, 17-21 nucléotides in length, 17-19 nucléotides in length, 19-25 nucléotides in length, 19-23 nucléotides in length, 19-21 nucléotides in length, 21-25 nucléotides in length, or 21-23 nucléotides in length.

The sense strand and antîsense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex région of an RNAi agent may be 12-30 nucléotide pairs in length. For example, the duplex région can be between 14-30 nucléotide pairs in length, 17-30 nucléotide pairs in length, 27-30 nucléotide pairs in length, 17-23 nucléotide pairs in length, 17-21 nucléotide pairs in length, 17-19 nucléotide pairs in length, 19-25 nucléotide pairs in length, 19-23 nucléotide pairs in length, 19- 21 nucléotide pairs in length, 21-25 nucléotide pairs in length, or 21-23 nucléotide pairs in length. In another example, the duplex région is selected from 15,16, 17,18,19, 20, 21, 22,23, 24,25,26, and 27.

In one embodiment, the RNAi agent may contain one or more overhang régions and/or capping groups of RNAi agent at 3’-end, or 5’-end or both ends of a strand. The overhang can be 1-6 nucléotides in length, for instance 2-6 nucléotides in length, 1-5 nucléotides in length, 2-5 nucléotides in length, 1-4 nucléotides in length, 2-4 nucléotides in length, 1-3 nucléotides in length, 2-3 nucléotides in length, or 1-2 nucléotides in length. The overhangs can be the resuit of one strand being longer than the other, or the resuit of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence. The first and second strands can also be joined, e.g., by additional bases to form a haîrpin, or by other non-base linkers.

The RNAi agents provided by the présent invention include agents with chemical modifications as disclosed, for example, in U.S. Provisional Application No. 61/561,710, filed on November 18,2011, International Application No.

PCT/US2011/051597, filed on September 15, 2010, and PCT Publication WO 2009/073809, the entire contents of each of which are incorporated herein by reference.

In one embodiment, the nucléotides in the overhang région of the RNAi agent can each independently be a modified or unmodified nucléotide including, but no limited to 2’-sugar modified, such as, 2-F, 2’-O-methyl, thymidine (T), 2'-0-methoxyethyl-5methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.

The 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang région contains two nucléotides having a phosphorothioate between the two nucléotides, where the two nucléotides can be the same or different. In one embodiment, the overhang is présent at the 3’-end of the sense strand, antisense strand or both strands. In one embodiment, this 3’-overhang is présent in the antisense strand. In one embodiment, this 3’-overhang is présent in the sense strand.

The RNAi agent may contain only a single overhang, which can strengthen the interférence activity of the RNAi, without affecting its overall stabiiity. For example, the single-stranded overhang is located at the 3'-terminal end ofthe sense strand or, altematively, at the 3'-terminal end of the antisense strand. The RNAi may also hâve a blunt end, located at the 5’-end ofthe antisense strand (or the 3’-end ofthe sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucléotide overhang at the 3’-end, and the 5’-end is blunt. While the Applicants are not bound by theory, the theoretical mechanism is that the asymmetric blunt end at the 5’-end ofthe antisense strand and 3’-end overhang of the antisense strand favor the guide strand loading into RISC process.

In one embodiment, the RNAi agent is a double ended bluntmer of 19 nt in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucléotides at positions 7,8,9 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at positions 11, 12,13 from the 5’end.

In one embodiment, the RNAi agent is a double ended bluntmer of 20 nt in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucléotides at positions 8,9,10 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at positions 11, 12, 13 from the 5’end.

In one embodiment, the RNAi agent is a double ended bluntmer of 21 nt in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucléotides at positions 9,10,11 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at positions 11, 12, 13 from the 5’end.

In one embodiment, the RNAi agent comprises a 21 nucléotides (nt) sense strand and a 23 nucléotides (nt) antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucléotides at positions 9,10,11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nt overhang. Preferably, the 2 nt overhang is at the 3’-end of the antisense. Optionally, the RNAi agent further comprises a ligand (preferably GalNAcj).

In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucléotide residues in length, wherein starting from the 5' terminal nucléotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucléotide residues in length and, starting from the 3' terminal nucléotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucléotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucléotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucléotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucléotides which are unpaired with sense strand, thereby forming a 10-30 nucléotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucléotides are base paired with nucléotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexer! région between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucléotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at or near the cleavage site.

In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucléotides and a second strand having a length which is at most 30 nucléotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucléotides at position 11,12,13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucléotides longer at its 3’ end than the first strand, wherein the duplex région which is at least 25 nucléotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nt of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentîally results in an siRNA comprising the 3’ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucléotides, where one of the motifs occurs at the cleavage site in the sense strand.

In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucléotides, where one of the motifs occurs at or near the cleavage site in the antisense strand

For RNAi agent having a duplex région of 17-23 nt in length, the cleavage site of the antisense strand is typically around the 10,11 and 12 positions from the 5’-end. Thus, the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11,12 positions; 11, 12, 13 positions; 12, 13,14 positions; or 13,14, 15 positions of the antisense strand, the count starting from the l^st nucléotide from the 5’-end of the antisense strand, or, the count starting from the l^sl paired nucléotide within the duplex région from the 5*- end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex région of the RNAi from the 5’end.

The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucléotides at the cleavage site of the strand; and the antisense strand may hâve at least one motif of three identical modifications on three consecutive nucléotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucléotides on the sense strand and one motif of the three nucléotides on the antisense strand hâve at least one nucléotide overlap, i.e., at least one of the three nucléotides of the motif in the sense strand forms a base pair with at least one of the three nucléotides of the motif in the antisense strand. Altematively, at least two nucléotides may overlap, or ail three nucléotides may overlap.

In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucléotides. The first motif should occur at or near the cleavage site of the strand and the other motifs may be wing modifications. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucléotides. When the motifs are immediately adjacent to each other than the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucléotide than the chemistries can be the same or different. Two or more wing modifications may be présent. For instance, when two wing modifications are présent, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

Like the sense strand, the antisense strand of the RNAi agent may contain at least two motifs of three identical modifications on three consecutive nucléotides, with at least one ofthe motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that is présent on the sense strand.

In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucléotides at the 3’-end, 5’-end or both ends of the strand.

In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucléotides within the duplex région at the 3’-end, 5’-end or both ends of the strand.

When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex région, and hâve an overlap of one, two or three nucléotides.

When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex région, having an overlap of one, two or three nucléotides; two modifications each from one strand fall on the other end of the duplex région, having an overlap of one, two or three nucléotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucléotides in the duplex région.

In one embodiment, every nucléotide in the sense strand and antisense strand of the RNAi agent, including the nucléotides that are part of the motifs, may be modified. Each nucléotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases the modification will occur at ail of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal région, e.g., at a position on a terminal nucléotide or in the last 2,3,4, 5, or 10 nucléotides of a strand. A modification may occur in a double strand région, a single strand région, or in both. A modification may occur only in the double strand région of a RNA or may only occur in a single strand région of a RNA. For example, a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal région, e.g., at a position on a terminal nucléotide or in the last 2, 3, 4, 5, or 10 nucléotides of a strand, or may occur in double strand and single strand régions, particularly at termini. The 5’ end or ends can be phosphorylated.

It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucléotides or nucléotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. For example, it can be désirable to include purine nucléotides in overhangs. In some embodiments ail or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, , 2’-deoxy-2’-fluoro (2’-F) or 2’-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’- O-methyl, 2*-Oallyl, 2’-C- allyl, 2’-deoxy, 2’-hydroxyl, or 2’-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2*- O-methyl or 2’-fluoro.

At least two different modifications are typicaliy présent on the sense strand and antisense strand. Those two modifications may be the 2’- O-methyl or 2’-fluoro modifications, or others.

In one embodiment, the N_a and/or Nb comprise modifications of an altemating pattern. The term “altemating motif’ as used herein refers to a motif having one or more modifications, each modification occurring on altemating nucléotides of one strand. The altematîng nucléotide may refer to one per every other nucléotide or one per every three nucléotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucléotide, the altematîng motif can be “AB AB AB AB AB AB...,” “AABBAABBAABB...,” “AABAABAABAAB...,” “AAABAAABAAAB...,” “AAABBBAAABBB...,” or “ABC ABC ABC ABC...,” etc.

The type of modifications contained in the altematîng motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucléotide, the altematîng pattern, i.e., modifications on every other nucléotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the altematîng motif such as “AB AB AB.. “ACACAC..“BDBDBD...” or “CDCDCD..etc.

In one embodiment, the RNAi agent of the invention comprises the modification pattern for the altematîng motif on the sense strand relative to the modification pattern for the altematîng motif on the antisense strand is shifted. The shift may be such that the modified group of nucléotides of the sense strand corresponds to a differently modified group of nucléotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the altematîng motif in the sense strand may start with “ABABAB” from 5’-3’ of the strand and the altematîng motif in the antisense strand may start with “BABABA” from 5’-3’of the strand within the duplex région. As another example, the altematîng motif in the sense strand may start with “AABBAABB” from 5’-3* of the strand and the altematîng motif in the antisenese strand may start with “BBAABBAA” from 5’-3’ of the strand within the duplex région, so that there is a complété or partial shift of the modification patterns between the sense strand and the antisense strand.

In one embodiment, the RNAi agent comprises the pattern of the altematîng motif of 2'-O-methyl modification and 2’-F modification on the sense strand initially has a shift relative to the pattern of the altematîng motif of 2’-O-methyl modification and 2’F modification on the antisense strand initially, i.e., the 2'-O-methyl modified nucléotide on the sense strand base pairs with a 2’-F modified nucléotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2'-F modification, and the 1 position of the antisense strand may start with the 2'- O-methyl modification.

The introduction of one or more motifs of three identical modifications on three consecutive nucléotides to the sense strand and/or antisense strand interrupts the initial modification pattern présent in the sense strand and/or antisense strand. This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucléotides to the sense and/or antisense strand surprisingly enhances the gene silencing acitivty to the target gene.

In one embodiment, when the motif of three identical modifications on three consecutive nucléotides is introduced to any of the strands, the modification of the nucléotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “.. ,N_aYYYNb...,” where “Y” représente the modification of the motif of three identical modifications on three consecutive nucléotide, and “N_a” and “Nb” represent a modification to the nucléotide next to the motif “YYY” that is different than the modification of Y, and where N_a and Nb can be the same or different modifications. Altnematively, N_a and/or Nb may be présent or absent when there is a wing modification présent.

The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate intemucleotide linkage. The phosphorothioate or methylphosphonate intemucleotide linkage modification may occur on any nucléotide of the sense strand or antisense strand or both in any position of the strand. For instance, the intemucleotide linkage modification may occur on every nucléotide on the sense strand or antisense strand; each intemucleotide linkage modification may occur in an altemating pattern on the sense strand or antisense strand; or the sense strand or antisense strand may contain both intemucleotide linkage modifications in an altemating pattern. The altemating pattern of the intemucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the altemating pattern of the intemucleotide linkage modification on the sense strand may hâve a shift relative to the altemating pattern of the intemucleotide linkage modification on the antisense strand.

In one embodiment, the RNAi comprises the phosphorothioate or methylphosphonate intemucleotide linkage modification in the overhang région. For example, the overhang région may contain two nucléotides having a phosphorothioate or methylphosphonate intemucleotide linkage between the two nucléotides. Intemucleotide linkage modifications also may be made to lînk the overhang nucléotides with the terminal paired nucléotides within duplex région. For example, at least 2, 3,4, or ail the overhang nucléotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate intemucleotide linkages linking the overhang nucléotide with a paired nucléotide that is next to the overhang nucléotide. For instance, there may be at least two phosphorothioate intemucleotide linkages between the terminal three nucléotides, in which two of the three nucléotides are overhang nucléotides, and the third is a paried nucléotide next to the overhang nucléotide. Preferably, these terminal three nucléotides may be at the 3’-end of the antisense strand.

In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mistmatch can occur in the overhang région or the duplex région. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

In one embodiment, the RNAi agent comprises at least one of the first 1,2, 3,4, or 5 base pairs within the duplex régions from the 5’- end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.

In one embodiment, the nucléotide at the 1 position within the duplex région from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Altematively, at least one of the first 1,2 or 3 base pair within the duplex région from the 5’- end of the antisense strand is an AU base pair. For ex amp le, the first base pair within the duplex région from the 5’- end of the antisense strand is an AU base pair.

In one embodiment, the sense strand sequence may be represented by formula (I):

5' n_p-N_a-(X X X )i-N_b-Y Y Y -N_b-(Z Z Z )j-N_a-n_q 3' (I) wherein:

i and j are each independently 0 or 1;

p and q are each independently 0-6;

each N_o independently représente an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;

each N_b independently représente an oligonucleotide sequence comprising 0-10 modified nucléotides;

each n_p and n_q independently represent an overhang nucléotide;

wherein Nb and Y do not hâve the same modification; and

XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucléotides. Preferably YYY is ail 2’-F modified nucléotides.

In one embodiment, the N_a and/or N_b comprise modifications of altemating pattern.

In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex région of 17-23 nucléotides in length, the ΥΥΎ motif can occur at or the vîcinity of the cleavage site (e.g.; can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or 11, 12, 13) of - the sense strand, the count starting from the l^sl nucléotide, from the 5’-end; or optionally, the count starting at the l^st paired nucléotide within the duplex région, from the 5’- end.

In one embodiment, i is l and j is 0, or i is 0 and j is l, or both i and j are l. The sense strand can therefore be represented by the following formulas:

5' n_p-N_a-YYY-N_b-ZZZ-N_a-nq 3' (la);

5' n_p-N_a-XXX-N_b-YYY-N_a-n_q 3’ (Ib); or

5' n_p-N_a-XXX-N_b-YYY-N_b-ZZZ-N_a-n_q 3’ (le).

When the sense strand is represented by formula (la), N_b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each N_a independently can represent an oligonucleotide sequence comprising 2-20, ΣΙ 5, or 2-10 modified nucléotides.

When the sense strand is represented as formula (Ib), N_b represents an oligonucleotide sequence comprising 0-10,0-7,0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each N_a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.

When the sense strand is represented as formula (le), each N_b independently represents an oligonucleotide sequence comprising 0-10,0-7,0-5,0-4,0-2 or 0 modified nucléotides. Preferably, N_b is 0, 1, 2, 3,4, 5 or 6 Each N_a can independently represent an oligonucleotide sequence comprising 2-20,2-15, or 2-10 modified nucléotides.

Each of X, Y and Z may be the same or different from each other.

In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):

5' n_q’-N_a'-(Z’Z'Z')_k-N_b'-Y'Y'Y'-N_b'-(X'X^fX')j-N'_a-n_p' 3’ (II) wherein:

k and 1 are each independently 0 or 1 ;

p’ and q’ are each independently 0-6;

each N_a' independently represents an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;

each N_b' independently represents an oligonucleotide sequence comprising 0-10 modified nucléotides;

each n_p' and n_q' independently represent an overhang nucléotide;

wherein N_b’ and Y’ do not hâve the same modification;

and

X'X'X', ΥΎΎ' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucléotides.

In one embodiment, the N_a* and/or Nb’ comprise modifications of altemating pattern.

The ΥΎΎ' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex région of 17-23 nt in length, the ΥΎΎ' motif can occur at positions 9,10, 11 ; 10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the l^st nucléotide, from the 5’-end; or optionally, the count starting at the l^sl paired nucléotide within the duplex région, from the 5’- end. Preferably, the ΥΎΎ' motif occurs at positions 11, 12, 13.

In one embodiment, ΥΎΎ' motif is ail 2’-OMe modified nucléotides.

In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.

The antisense strand can therefore be represented by the following formulas:

5' n_q>-N_a'-Z'Z'Z'-N_b'-Y'Y'Y'-N_a'-n_p· 3’ (lia);

5’ n_q-N_a'-Y'Y'Y'-N_b'-X'X'X'-n_p· 3’ (Ilb); or

5’ n_q-N_a'- Z'Z'Z'-N_b'-Y'Y'Y'-N_b'- X'X'X'-N_a'-n_p· 3' (Ile).

When the antisense strand is represented by formula (Ha), N_b représente an oligonucleotide sequence comprising 0-10, 0-7,0-10,0-7,0-5,0-4, 0-2 or 0 modified nucléotides. Each N_a* independently représente an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.

When the antisense strand is represented as formula (Ilb), N_b’ représente an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each N_a’ independently represents an oligonucleotide sequence comprising 2-20,2-15, or 2-10 modified nucléotides.

When the antisense strand is represented as formula (Ile), each N_b’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5,0-4,0-2 or 0 modified nucléotides. Each N_a’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides. Preferably, N_b is 0,1,2, 3,4, 5 or 6.

Each of X', Y' and Z' may be the same or different from each other.

Each nucléotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-Callyl, 2’-hydroxyl, 2’-deoxy or 2’-fluoro. For example, each nucléotide of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may represent a 2’-O-methyl modification or a 2’-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex région is 21 nt, the count starting from the l^st nucléotide from the 5’-end, or optionaily, the count starting at the l^st paired nucléotide within the duplex région, from the 5’- end; and Y represents 2’F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex région; and XXX and ZZZ each independently represents a 2’-OMe modification or 2*-F modification.

In one embodiment the antisense strand may contain ΥΎΎ' motif occurring at positions 11, 12, 13 of the strand, the count starting from the l^st nucléotide from the 5’-end, or optionaily, the count starting at the l^sl paired nucléotide within the duplex région, from the 5’- end; and Y' represents 2’-O-methyl modification. The antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex région; and X'X'X' and each independently represents a 2’-OMe modification or 2’-F modification.

The sense strand represented by any one of the above formulas (la), (Ib) and (le) forms a duplex with a antisense strand being represented by any one of formulas (Ha), (Ilb) and (Ile), respectively.

Accordingly, the RNAi agents of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucléotides, the RNAi duplex represented by formula (III):

sense: antisense:

5’ n_p -N_a-(X X X)i -N_b- Y Y Y -N_b -(Z Z Z)_j-N_a-n_<1 3’

3’ np’-Na’-ÎX’X'X'Jk-Nb’-Y'Y'Y'-Nb’-CZ'Z'Z'Ji-Na'-nq’ 5' (ΠΙ) wherein:

i, j, k, and 1 are each independently 0 or 1 ;

p, p', q, and q' are each independently 0-6;

» each N_a and N_a independently represents an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;

f each N_b and Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucléotides;

wherein each n_p’, n_p, n^’, and n_q independently represents an overhang nucléotide; and

XXX, YYY, ZZZ, X'X'X', ΥΎΎ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucléotides.

In one embodiment, i is 1 and j is 0; or i is 0 and j is 1 ; or both i and j are 1. In another embodiment, k is 1 and 1 is 0; k is 0 and 1 is 1 ; or both k and 1 are 1.

Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:

5’ n_p -N_a -YYY -N_b -ZZZ -N_a-n_q 3’

3’ n_p’-N_a’-Y'Y'Y'-Nb’-Z'Z'Z'-N_a’n_q 5’ (Ilia)

5' n_p-N_a- X X X -N_b -Y Y Y - Ν,-η, 3’

3' n_p’-N_a’-X'X'X'-N_b'-Y'Y'Y'-Na Χ 5’ (Illb)

5’ n_p -N_a -XXX -N_b-Y Y Y -N_b- ZZZ -N_a-n_q 3'

3' np’-Na’-X'X'X'-Nb’-Y'Y'Y'-Nb’-Z'Z'Z'-Na-nq’ 5’ (IIIc)

When the RNAi agent is represented by formula (Ilia), each N_b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucléotides. Each N_a independently represents an oligonucleotide sequence comprising 2-20,2-15, or 2-10 modified nucléotides.

When the RNAi agent is represented as formula (Illb), each N_b, N_b’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucléotides. Each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.

When the RNAi agent is represented as formula (IIIc), each N_b, N_b’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucléotides. Each N_a, N_a independently represents an oligonucleotide sequence comprising 2-20,2-15, or 2-10 modified nucléotides. Each of »

N_a, N_a’, N_b and N_b independently comprises modifications of altemating pattem.

Each of X, Y and Z in formulas (III), (Ilia), (Illb) and (IIIc) may be the same or different from each other.

When the RNAi agent is represented by formula (III), (Ilia), (Illb) or (IIIc), at least one of the Y nucléotides may form a base pair with one of the Y' nucléotides. Alternativeiy, at least two of the Y nucléotides form base pairs with the corresponding Y' nucléotides; or ail three of the Y nucléotides ail form base pairs with the corresponding Y' nucléotides.

When the RNAi agent is represented by formula (Ilia) or (IIIc), at least one of the Z nucléotides may form a base pair with one of the Z' nucléotides. Alternativeiy, at least two of the Z nucléotides form base pairs with the corresponding Z' nucléotides; or ail three of the Z nucléotides ail form base pairs with the corresponding Z' nucléotides.

When the RNAi agent is represented as formula (Illb) or (IIIc), at least one of the X nucléotides may form a base pair with one of the X' nucléotides. Alternativeiy, at least two of the X nucléotides form base pairs with the corresponding X' nucléotides; or ail three of the X nucléotides ail form base pairs with the corresponding X' nucléotides.

In one embodiment, the modification on the Y nucléotide is different than the modification on the Y’ nucléotide, the modification on the Z nucléotide is different than the modification on the Z’ nucléotide, and/or the modification on the X nucléotide is different than the modification on the X’ nucléotide.

In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Illb) or (IIIc), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprise a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (Ilia), (Illb) or (IIIc), wherein the duplexes are connected by a lînker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IHa), (Illb) or (IIIc) are linked to each other at the 5’ end, and one or both of the 3’ ends of the are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

Various publications describe multimeric RNAi agents . Such publications include W02007/091269, US Patent No. 7858769, W02010/141511, W02007/117686, W02009/014887 and WO2011/031520 the entire contents of which are hereby incorporated herein by reference.

The RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand, A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring System, i.e,, ail ring atoms are carbon atoms, or a heterocyclîc ring System, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazînyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidînyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.

In certain spécifie embodiments, the RNAi agent of the invention is an agent selected from the group of agents listed in Table 1 and consisting of D1000, D1001, D1002, D1003, D1004, D1005, D1006, D1007, D1008, D1009, D1010, D1011, D1012, D1013, D1014, D1015, D1016, D1017, D1018, D1019, D1020, D1021, D1022, D1023, D1024, D1025, D1026, D1027, D1028, D1029, D1030, D1031, D1032, D1033, D1034, D1O35, D1036, D1037, D1038, D1039, D1040, D1041, D1042, D1043, D1044, D1045, D1046, D1047, D1048, D1049, D1050, D1051, D1052, D1O53, D1054, D1055, D1056, D1057, D1O58, D1059, D1060, D1061, D1062, D1063, D1064, D1065, D1066, D1067, D1068, D1069, D1070, D1071, D1072, D1073, D1074, D1075, D1076, D1077, D1078, D1079, D1080, D1081, D1082, D1O83, D1084, D1085, D1086, D1087, D1088, D1089, D1090, D1091, D1092, D1093, D1094, D1095, D1096, D1097, D1098, D1099, DI 100, DI 101, D1102, DI 103, DI 104, DI 105, DI 106, DI 107, D1108, DI 109, DI 110, DI 111, DI 112, DI 113, DI 114, DI 115, DI 116, Dll 17, DI 118, D1119, DI 120, DI 121, DI 122, DI 123, DI 124, DI 125, D1126, DI 127, D1128, D1129, D1130, DI 131, DI 132, DI 133,

DI 134, DI 135, DI 136, DI 137, DI 138, DI 139, DI 140, DI 141, DI 142, DI 143, DI 144,

DI 145, DI 146, DI 147, DI 148, DI 149, DI 150, DI 151, DI 152, DI 153, DI 154, DI 155,

DI 156, DI 157, DI 158, DI 159, DI 160, DI 161, DI 162, DI 163, DI 164, DI 165, D1166,

DI 167, DI 168, DI 169, DI 170, DI 171, DI 172, DI 173, DI 174, DI 175, DI 176, DI 177,

DI 178, DI 179, DI 180, DI 181, DI 182, DI 183, DI 184, DI 185, DI 186, DI 187, DI 188,

DI 189, DI 190, DI 191, D1192, DI 193, DI 194, DI 195, DI 196, DI 197, DI 198, DI 199,

D1200, D1201, D1202, D1203, D1204, D1205, D1206, D1207, D1208, D1209, D1210,

D1211, D1212, D1213, D1214, D1215, D1216, D1217, D1218, D1219, D1220, D1221,

D1222, D1223, D1224, D1225, D1226, D1227, D1228, D1229, D1230, D1231, D1232,

D1233, D1234, D1235, D1236, D1237, D1238, D1239, D1240, D1241, D1242, D1243,

D1244, D1245, D1246, D1247, D1248, D1249, D1250, D1251, D1252, D1253, D1254,

D1255, D1256, D1257, D1258, D1259, D1260, D1261, D1262, D1263, D1264, D1265,

D1266, D1267, D1268, D1269, D1270, D1271, D1272, D1273, D1274, D1275, D1276,

D1277, D1278, D1279, D1280, D1281, D1282, D1283, D1284, D1285, D1286, D1287,

D1288, D1289, D1290, D1291, D1292, D1293, D1294, D1295, D1296, D1297, D1298,

D1299, D1300, D1301, D1302, D1303, D1304, D1305, D1306, D1307, D13O8, D1309,

D1310, D1311, D1312, D1313, D1314, D1315, D1316, D1317, D1318, D1319, D1320,

D1321, D1322, D1323, D1324, D1325, D1326, D1327, D1328, D1329, D1330, D1331,

D1332, D1333, D1334, D1335, D1336, D1337, D1338, D1339, D1340, D1341, D1342,

D1343, D1344, D1345, D1346, D1347, D1348, D1349, D135O, D1351, D1352, D1353,

D1354, D1355, D1356, D1357, D1358, D1359, D1360, D1361, D1362, D1363, D1364,

D1365, D1366, D1367, D1368, D1369, D1370, D1371, D1372, D1373, D1374, D1375,

D1376, D1377, D1378, D1379, D1380, D1381, D1382, D1383, D1384, D1385, D1386,

D1387, D1388, D1389, D1390, D1391, D1392, D1393, D1394, D1395, D1396, D1397,

D1398, D1399, D1400, D1401, D1402, D1403, D1404, DMOS, D1406, D1407, D1408,

D1409, D1410, D1411, D1412, D1413, D1414, D1415, D1416, D1417, D1418, D1419,

D1420, D1421, D1422, D1423, D1424, D1425, D1426, D1427, D1428, D1429, D1430,

D1431, D1432, D1433, D1434, D1435, D1436, D1437, D1438, D1439, D1440, D1441,

D1442, D1443, D1444, D1445, D1446, D1447, D1448, D1449, D1450, D1451, D1452,

D1453, D1454, D1455, D1456, D1457, D1458, D1459, D1460, D1461, D1462, D1463,

D1464, D1465, D1466, D1467, D1468, D1469, D1470, D1471, D1472, D1473, D1474,

D1475, D1476, D1477, D1478, D1479, D1480, DI481, D1482, D1483, D1484, D1485,

D1486, D1487, D1488, D1489, D1490, D1491, D1492, D1493, D1494, D1495, D1496,

D1497, D1498, D1499,. D1500, D1501, D1502, D1503, D1504, D1505, D1506,

D1507, D1508, D1509, D1510, D1511, D1512, D1513, D1514, D1515, D1516, D1517,

D1518, D1519, D1520, D1521, D1522, D1523, D1524, D1525, D1526, D1527, D1528,

D1529, D153O, D1531, D1532, D1533, D1534, D1535, D1536, D1537, D1538, D1539,

D1540, D1541, D1542, D1543, D1544, D1545, D1546, D1547, D1548, D1549, D1550,

D1551, D1552, D1553, D1554, D1555, D1556, D1557, D1558, D1559, D1560, D1561,

D1562, D1563, D1564, D1565, D1566, D1567, D1568, D1569, D1570, D1571, D1572,

D1573, D1574, D1575, D1576, D1577, D1578, D1579, D1580, D1581, D1582, D1583,

D1584, D1585, D1586, D1587, D1588, D1589, D1590, D1591, D1592, D1593, D1594,

D1595, D1596, D1597, D1598, D1599, D1600, D1601, D1602, D1603, D1604, D1605,

D1606, D1607, D1608, D1609, D1610, D1611, D1612, D1613, D1614, D1615, D1616,

D1617, D1618, D1619, D1620, D1621, D1622, D1623, D1624, D1625, D1626, D1627,

D1628, D1629, D1630, D1631, D1632, D1633, D1634, D1635, D1636, D1637, D1638,

D1639, D1640, D1641, D1642, D1643, D1644, D1645, D1646, D1647, D1648, D1649,

D1650, D1651, D1652, D1653, D1654, D1655, D1656, D1657, D1658, D1659, D1660,

D1661, D1662, D1663, D1664, D1665, D1666, D1667, D1668, D1669, D1670, D1671,

D1672, D1673, D1674, D1675, D1676, D1677, D1678, D1679, D1680, D1681, D1682,

D1683, D1684, D1685, D1686, D1687, D1688, D1689, D1690, D1691, D1692, D1693,

D1694, D1695, D1696, D1697, D1698, D1699, D1700, D1701, D1702, D1703, D1704,

D1705, D1706, D1707, D1708, D1709, D1710, D1711, D1712, D1713, D1714, D1715,

D1716, D1717, D1718, D1719, D1720, D1721, D1722, D1723, D1724, D1725, D1726,

D1727, D1728, D1729, D1730, D1731, D1732, D1733, D1734, D1735, D1736, D1737,

D1738, D1739, D1740, D1741, D1742, D1743, D1744, D1745, D1746, D1747, D1748,

D1749, D1750, D1751, D1752, D1753, D1754, D1755, D1756, D1757, D1758, D1759,

D1760, D1761, D1762, D1763, D1764, D1765, D1766, D1767, D1768, D1769, D1770,

D1771, D1772, D1773, D1774, D1775, D1776, D1777, D1778, D1779, D1780, D1781,

D1782, D1783, D1784, D1785, D1786, D1787, D1788, D1789, D1790, D1791, D1792,

D1793, D1794, D1795, D1796, D1797, D1798, D1799, D1800, D1801, D1802, D1803,

D1804, D1805, D1806, D1807, D1808, D1809, D1810, D1811, D1812, D1813, D1814,

Dl 815, D1816, D1817, D1818, D1819, D1820, D1821, D1822, D1823, D1824, D1825, D1826, D1827, D1828, D1829, D1830, D1831, D1832, D1833, D1834, D1835, D1836, D1837, D1838, D1839, D1840, D1841, D1842, D1843, D1844, D1845, D1846, D1847, D1848, D1849, D1850, D1851, D1852, D1853, D1854, D1855, D1856, D1857, D1858, D1859, D1860, D1861, D1862, D1863, D1864, D1865, D1866, D1867, D1868, D1869, D1870, D1871, D1872, D1873, D1874, D1875, D1876, D1877, D1878, D1879, D1880, D1881, D1882, D1883, D1884, D1885, D1886, D1887, D1888, D1889, D1890, D1891, D1892, D1893, D1894, D1895, D1896, D1897, D1898, D1899, D1900, D1901, D1902, D1903, D1904, D1905, D1906, D1907, D1908, D1909, D1910, D1911, D1912, D1913, D19I4, D1915, D1916, D1917, D1918, D1919, D1920, D1921, D1922, D1923, D1924, D1925, D1926, D1927, D1928, D1929, D1930, D1931, D1932, D1933, D1934, D1935, D1936, D1937, D1938, D1939, D1940, D1941, D1942, D1943, D1944, D1945, D1946, D1947, D1948, D1949, D195O, D1951, D1952, D1953, D1954, D1955, D1956, D1957, D1958, D1959, D1960, D1961, D1962, D1963, D1964, D1965, D1966, D1967, D1968, D1969, D1970, D1971, D1972, D1973, D1974, D1975, D1976, D1977, D1978, D1979, D1980, D1981, D1982, D1983, D1984, D1985, D1986, D1987, D1988, D1989, D1990, D1991, D1992, D1993, D1994, D1995, D1996, D1997, D1998, D1999, D2000, D2001, D2002, D2003, D2004, D2005, D2006, D2007, D2008, D2009, D2010, D2011, D2012, D2013, D2014, D2015, D2016, D2017, D2018, D2019, D2020, D2021, D2022, D2023, D2024, D2025, D2026, D2027, D2028, D2029, D2030, D2031, D2032, D2033, D2034, D2035, D2036, D2037, D2038, D2039, D2040, D2041, D2042, D2043, D2044, D2045, D2046, D2047, D2048, D2049, D2050, D2051, D2052, D2O53, D2054, D2055, D2056, D2057, D2058, D2059, D2060, D2061, D2062, D2063, D2064, D2065, D2066, D2067, D2068, D2069, D2070, D2071, D2072, D2073, D2074, D2075, D2076, D2077, D2078, D2079, D2080, D2081, D2082, D2083, D2084, D2085, D2086, D2087, D2088, D2089, D2090 and D2091.

These agents may further comprise a ligand, such as a GalNAc ligand.

Ligands

The RNAi agents of the invention, e.g., double stranded RNAi agents, may optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, antisense strand or both strands, at the 3’-end, 5’-end or both ends. For instance, the ligand may be conjugated to the sense strand. In preferred embodiments, the ligand is conjgated to the 3’-end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc3:

A wide variety of entities can be coupled to the RNAi agents of the présent invention. Preferred moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether.

In preferred embodiments, a ligand alters the distribution, targeting or lifetime of the molécule into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molécule, cell or cell type, compartment, receptor e.g., a cellular or organ compartment, tissue, organ or région of the body, as, e.g., compared to a species absent such a ligand. Ligands providing enhanced affinity for a selected target are also termed targeting ligands.

Some ligands can hâve endosomolytic properties. The endosomolytic ligands promote the lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or peptidomimetic which shows pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at endosomal pH, The “active conformation is that conformation in which the endosomolytic ligand promûtes lysis of the endosome and/or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, 1987,26: 2964-2972), the EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586), and their dérivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic component may contain a chemical group (e.g., an amino acid) which will undergo a change in charge or protonation in response to a change in pH. The endosomolytic component may be linear or branched.

Ligands can improve transport, hybridization, and specificity properties and may also improve nuclease résistance of the résultant natural or modified oligoribonucleotide, or a polymeric molécule comprising any combination of monomers described herein and/or natural or modified ribonucleotides.

Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; and nuclease-resistance conferring moieties. General examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics.

Ligands can include a naturally occurring substance, such as a protein (e.g., human sérum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molécule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an oligonucleotide (e.g., an aptamer). Examples of polyamino acids include polyamino acid is a polylysine (P LL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyuréthane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example ofpolyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quatemary sait of a polyamine, or an alpha helical peptide.

Ligands can also include targeting groups, e.g,, a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholestérol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer.

Other examples of ligands inciude dyes, intercalating agents (e.g., acridînes), cross-linkers (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelator (e.g., EDTA), lipophilie molécules, e.g., cholestérol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-B is-O(hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, bomeol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03-(oleoyl)lîthocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]₂, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folie acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridineimidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molécules having a spécifie affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothélial cell, or bone cell. Ligands may also inciude hormones and hormone receptors. They can also inciude non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-kB,

The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by dîsrupting the cell’s microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, Vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinliolide A, indanocine, or myoservin.

The ligand can increase the uptake of the oligonucleotide into the cell by, for example, activating an inflammatory response. Exemplary ligands that would hâve such an effect include tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma interferon.

In one aspect, the ligand is a lipid or lipid-based molécule. Such a lipid or lipidbased molécule preferably binds a sérum protein, e.g., human sérum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molécules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase résistance to dégradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a sérum protein, e.g., HSA.

A lipid based ligand can be used to modulate, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

In another preferred embodiment, the lipid based ligand binds HSA weakly or not at ail, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.

In another aspect, the ligand is a moiety, e.g, a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell prolifération, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, e.g., folie acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low density lipoprotein (LDL) and high-density lipoprotein (HDL).

In another aspect, the ligand is a cell-permeation agent, preferably a helical cellpermeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilie and a lipophobic phase.

The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molécule capable of folding into a defined three-dimensional structure similar to a natural peptide. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15,20,25, 30, 35,40,45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell perméation peptide, cationic peptide, amphipathic peptide, or hydrophobie peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobie membrane translocation sequence (MTS). An exemplary hydrophobie MTS-containing peptide îs REGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:4). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP) (SEQ ID NO:5) containing a hydrophobie MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molécules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO:6) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWK.K) (SEQ ID NO:7) hâve been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably the peptide or peptidomimetic tethered to an iRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can hâve a structural modification, such as to increase stabiiity or direct conformational properties. Any of the structural modifications described below can be utilized.An RGD peptide moiety can be used to target a tumor cell, such as an endothélial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43,2002). An RGD peptide can facilitate targeting of an iRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Preferably, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to spécifie tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing avÜ3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides that target markers enriched in proliferating cells can be used. For example, RGD containing peptides and peptidomimetics can target cancer cells, in particular cells that exhibit an integrin. Thus, one could use RGD peptides, cyclic peptides containing RGD, RGD peptides that include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Generally, such ligands can be used to control proliferating cells and angiogeneis. Preferred conjugates of this type ofligand target PECAM-1, VEGF, or other cancer gene, e.g., a cancer gene described herein.

A “cell perméation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin Pl), a disulfide bond-containing peptide (e.g., a -defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell perméation peptide can also include a nuclear localization signal (NLS). For example, a cell perméation peptide can be a bipartite amphîpathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-l gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

In one embodiment, a targeting peptide can be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides înclude, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, hagfish intestinal antimicrobial peptides (HFIAPs), magainines, brevinins-2, dermaseptins, melittins, pleurocidin, H₂A peptides, Xenopus peptides, esculentinis-1, and caerins. A number of factors will preferably be considered to maintain the integrity of hélix stability. For example, a maximum number of hélix stabilization residues will be utilized (e.g., leu, ala, or lys), and a minimum number hélix destabilizatîon residues will be utilized (e.g., proline, or cyclic monomeric units. The capping residue will be considered (for example Gly is an exemplary N-capping residue and/or C-terminal amidation can be used to provide an extra H-bond to stabilize the hélix. Formation of sait bridges between residues with opposite charges, separated by i ± 3, or i ± 4 positions can provide stability. For example, cationic residues such as lysine, arginine, homo-arginine, omithine or histidine can form sait bridges with the anionic residues glutamate or aspartate.

Peptide and peptidomimetic ligands înclude those having naturally occurring or modified peptides, e.g., D or L peptides; α, β, or γ peptides; N-methyl peptides; azapeptides; peptides having one or more amide, i.e., peptide, linkages replaced with one or more urea, thiourea, carbamate, or sulfonyl urea linkages; or cyclic peptides.

The targeting ligand can be any ligand that is capable of targeting a spécifie receptor. Examples are: folate, GalNAc, galactose, mannose, mannose-6P, clusters of sugars such as GalNAc cluster, mannose cluster, galactose cluster, or an apatamer. A cluster is a combination of two or more sugar units. The targeting ligands also înclude integrin receptor ligands, Chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatîn, LDL and HDL ligands. The ligands can also be based on nucleic acid, e.g., an aptamer. The aptamer can be unmodified or hâve any combination of modifications disclosed herein.

Endosomal release agents include imidazoles, poly or oligoimidazoles, PEIs, peptides, fusogenic peptides, polycaboxylates, polyacations, masked oligo or poly cations or anions, acetals, polyacetals, ketals/polyketyals, orthoesters, polymers with masked or unmasked cationic or anîonic charges, dendrimers with masked or unmasked cationic or anionic charges.

PK modulator stands for pharmacokinetic modulator. PK modulators include lipophiles, bile acids, steroîds, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Examplary PK modulators include, but are not limited to, cholestérol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamîn E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to sérum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple phosphorothioate linkages in the backbaone are also amenable to the présent invention as ligands (e.g., as PK modulating ligands).

In addition, aptamers that bind sérum components (e.g., sérum proteins) are also amenable to the présent invention as PK modulating ligands.

Other ligand conjugates amenable to the invention are described in U.S. Patent Applications USSN: 10/916,185, filed August 10,2004; USSN: 10/946,873, filed September 21, 2004; USSN: 10/833,934, filed August 3, 2007; USSN: 11/115,989 filed April 27, 2005 and USSN: 11/944,227 filed November 21, 2007, which are incorporated by reference in their entireties for all purposes.

When two or more ligands are présent, the ligands can all hâve same properties, all hâve different properties or some ligands hâve the same properties while others hâve different properties. For example, a ligand can hâve targeting properties, hâve endosomolytic activity or hâve PK modulating properties. In a preferred embodiment, all the ligands hâve different properties.

Ligands can be coupled to the oligonucleotides at various places, for example, 3’-end, 5’-end, and/or at an internai position. In preferred embodiments, the ligand is attached to the oligonucleotides via an intervening tether, e.g., a carrier described herein. The ligand or tethered ligand may be présent on a monomer when the monomer is incorporated into the growing strand. In some embodiments, the ligand may be incorporated via coupling to a “precursor” monomer after the “precursor” monomer has been incorporated into the growing strand. For example, a monomer having, e.g., an amino-terminâted tether (i.e., having no associated ligand), e.g., TAP-(CH2)_nNH2 may be incorporated into a growing oligonucelotide strand. In a subséquent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having an electrophilic group, e.g., a pentafluorophenyl ester or aldéhyde group, can subsequently be attached to the precursor monomer by coupling the electrophilic group of the ligand with the terminal nucleophilïc group of the precursor monomer’s tether.

In another example, a monomer having a chemical group suitable for taking part in Click Chemistry reaction may be incorporated, e.g., an azide or alkyne terminated tether/linker. In a subséquent operation, i.e., after incorporation of the precursor monomer into the strand, a ligand having complementary chemical group, e.g. an alkyne or azide can be attached to the precursor monomer by coupling the alkyne and the azide together.

For double- stranded oligonucleotides, ligands can be attached to one or both strands. In some embodiments, a double-stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, a double-stranded iRNA agent contains a ligand conjugated to the antisense strand.

In some embodiments, ligand can be conjugated to nucleobases, sugar moieties, or intemucleosidic linkages of nucleic acid molécules. Conjugation to purine nucleobases or dérivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of a purine nucleobase are attached to a conjugate moiety. Conjugation to pyrimidine nucleobases or dérivatives thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be substituted with a conjugate moiety. Conjugation to sugar moieties of nucleosides can occur at any carbon atom. Example carbon atoms of a sugar moiety that can be attached to a conjugate moiety include die 2', 3', and 5' carbon atoms. The l'position can also be attached to a conjugate moiety, such as in an abasic residue. Intemucleosidic linkages can also bear conjugate moieties. For phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithiotate, phosphoroamidate, and the like), the conjugale moiety can be attached directly to the phosphores atom or to an O, N, or S atom bound to the phosphores atom. For amine- or amide-containing intemucleosidic linkages (e.g., PNA), the conjugate moiety can be attached to the nitrogen atom of the amine or amide or to an 5 adjacent carbon atom.

Any suitable ligand in the fïeld of RNA interférence may be used, although the ligand is typically a carbohydrate e.g. monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.

Linkers that conjugate the ligand to the nucleic acid include those discussed above. For example, the ligand can be one or more GalNAc (Ύ-acetylglucosamine) dérivatives attached through a bivalent or trivalent branched iinker.

In one embodiment, the dsRNA of the invention is conjugated to a bivalent and trivalent branched linkers include the structures shown in any of formula (IV) - (VII):

p2A_Q2A_p2A

γ2Α_|_2Α

γ2Β_|_2Β p3A_ç3A _p3A _p3B.q3B._r3B

Formula (IV)

Formula (V)

p4A_Q4A_p4A

p4B_Q4B_R4B

N

wherein:

q^2A, q^2B, q^3A, q^3B, q4^A, q^4B, q^5A, q^5B and q^5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;

p2A p2B p3A p3B p4A p4B p5A pSB pSC rp2A «p2B *p3A rp3B «p4A *p4A rp5B *p5C each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH2, CH₂NH or CH₂O;

Q^2a, Q^2B, Q^3a, Q^3B, Q^4a, Q^4B, Q^5a, Q^5B, Q^5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO2, N(Rⁿ), C(R’)=C(R”), C=C or C(O);

R^2A, R^2B, R^3A, R^3B, R^4A, R^4B, R^5A, R^5B, R^sc are each independently for each occurrence absent, NH, O, S, CH₂, C(O)O, C(O)NH, NHCH(R°)C(O), -C(O)-CH(R^a)-

NH-, CO, CH=N-O, ^S“^S\P^ s—S \r^ or heterocyclyl;

L^2a, L^2b, L^3a, L^3b, L^4a, L^4b, L^5a, L^5B and L^5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and

R^a is H or amino acid side chain.

Trivalent conjugating GalNAc dérivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (VII):

wherein L^5A, L^5B and L^5C represent a monosaccharide, such as GalNAc dérivative.

Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc dérivatives include, but are not limited to, the following compounds:

NHAc Ο , NHAc

In other embodiments, the RNAi agent of the invention is an agent selected from the group consisting of AD-45163, AD-45165, AD-51544, AD-51545, AD-51546, and AD-51547.

III. Pharmaceutical Compositions

The RNAi agents of the invention may be formulated for administration in any convenient way for use in human or veterinary medicine, by analogy with other pharmaceuticals. The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, émulsions, and gene therapy vectors.

In the methods of the invention, the RNAi agent may be administered in a solution. A free RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water. Altematively, the free siRNA may also be administred in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.

In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologie values of the human plasma. Solutés which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, métabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a sait. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

In other embodiments, the RNAi agent is formulated as a composition that includes one or more RNAi agents and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and ail solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonie and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

In one embodiment, the RNAi agent préparation includes at least a second therapeutic agent (e.g., an agent other than an RNA or a DNA). For example, an RNAi agent composition for the treatment of a TTR-associated disease, e.g., a transthyretinrelated hereditary amyloidosis (familial amyloid polyneuropathy, FAP), may include a known drug for the amelioration of FAP, e.g., Tafamidis (INN, or Fx-1006A or Vyndaqel).

A formulated RNAi agent composition can assume a variety of states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and/or anhydrous (e.g., it contaîns less than 80, 50, 30, 20, or 10% of water). In another example, the RNAi agent is in an aqueous phase, e.g., in a solution that includes water.

The aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase) or a particle (e.g., a microparticle as can be appropriate for a crystalline composition). Generally, the RNAi agent composition is formulated in a manner that is compatible with the intended method of administration, as described herein. For example, in particular embodiments the composition is prepared by at least one of the following methods: spray drying, lyophîlization, vacuum drying, évaporation, fluid bed drying, or a combination of these techniques; or sonication with a lipid, freeze-drying, condensation and other selfassembly.

An RNAi agent préparation can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes RNAi agent, e.g., a protein that complexes with the RNAi agent to form an ÎRNP. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg²*), salts, RNAse inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth.

In one embodiment, the RNAi agent préparation includes another siRNA compound, e.g., a second RNAi agent that can médiate RNAi with respect to a second gene, or with respect to the same gene. Still other préparation can include at least 3, 5, ten, twenty, fifty, or a hundred or more different RNAi agent species. Such RNAi agents can médiate RNAi with respect to a similar number of different genes.

The iRNA agents of the invention may be formulated for pharmaceutical use. Pharmaceutically acceptable compositions comprise a therapeutically-or prophylactically effective amount of one or more of the the dsRNA agents in any of the preceding embodiments, taken alone or formulated together with one or more pharmaceutically acceptable carriers (additives), excipient and/or diluents.

Methods of preparing pharmaceutical compositions of the invention include the step of bringing into association an RNAi agent of the présent invention with the carrier and, optionally, one or more accessory ingrédients. In general, the compositionsare prepared by uniformly and intimately bringing into association an RN Ai agent of the présent invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parentéral administration, for example, by subcutaneous, intramuscular, intravenous or épidural injection as, for example, a stérile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlledrelease patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally. Delivery using subcutaneous or intravenous methods can be particularly advantageous.

The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animais without excessive toxicity, irritation, allergie response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The phrase pharmaceutically-acceptable carrier as used herein means a pharmaceutîcally-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnésium, calcium or zinc stéarate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingrédients of the compositionand not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (l) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its dérivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnésium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnésium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonie saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) sérum component, such as sérum aibumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceuticalcompositions.

The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of RNAi agent which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and the particular mode of administration. The RNAi agent which can be combined with a carrier material to produce a single dosage form will generally be that amount of the RNAi agent which produces a desired effect, e.g., therapeutic or prophylactic effect. Generally, out of one hundred per cent, this amount will range from about 0.1 per cent to about ninety-nine percent of RNAi agent, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.

In certain embodiments, a composition of the présent invention comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides; and an RNAi agent of the présent invention. In certain embodiments, an aforementioned composition renders orally bioavailable an RNAi agent of the présent invention.

In some cases, in order to prolong the effect of an RNAi agent, it is désirable to slow the absorption of the agent from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the RNAi agent then dépends upon its rate of dissolution which, in tum, may dépend upon crystal size and crystalline form. Altematively, delayed absorption of a parenterally-administered RNAi agent may be accomplished by dissolving or suspending the agent in an oil vehicle.

Liposomes

An RNAi agent of the invention can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term “liposome” 20 refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that hâve a membrane formed from a lipophilie material and an aqueous interior. The aqueous portion contains the RNAi agent composition. The lipophilie material isolâtes the aqueous interior from an aqueous exterior, which typically does not 25 include the RNAi agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingrédients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internai aqueous 30 contents that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can médiate RNAi. In some cases the liposomes are also specificaliy targeted, e.g., to direct the RNAi agent to particular cell types.

A liposome containing an RNAi agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can hâve a high critical micelle concentration and may be nonionic. Exemplary détergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent préparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal préparation of RNAi agent.

If necessary a carrier compound that assiste in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleîc acid (e.g., spermine or spermidine). pH can also be adjusted to favor condensation.

Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham, et al. M. Mol. Biol. 23:238,1965; Oison, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194,1978; Mayhew, et al. Biochim. Biophys. Acta 775:169,1984; Kim, étal. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757,1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta

775:169,1984). These methods are readily adapted to packaging RNAi agent préparations into liposomes.

Liposomes that are pH-sensitive or negatively-charged entrap nucleic acid molécules rather than complex with them. Since both the nucleic acid molécules and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid molécules are entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes hâve been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 19, (1992) 269-274).

One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed fforn mixtures of phospholipid and/or phosphatidylcholine and/or cholestérol.

Examples of other methods to introduce liposomes into cells in vitro and in vivo inciude U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol. Chem. 269:2550,1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649,1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417,1992.

In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Further advantages of liposomes inciude: liposomes obtained from natural phospholipids are biocompatible and biodégradable; liposomes can incorporate a wîde range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internai compartments from metabolism and dégradation (Rosoff, in Pharmaceutical Dosage Forrns, Lîeberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considérations in the préparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

A posîtively charged synthetic cationic lipid, N-[l-(2,3-dioleyloxy)propyl]Ν,Ν,Ν-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fiising with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417,1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA),

A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise posîtively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough posîtively charged liposomes are used, the net charge on the resulting complexes is also positive. Posîtively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, l,2-bis(oleoyloxy)-3,3-(trimethy1ammonia)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

Other reported cationic lipid compounds include those that hâve been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).

Another cationic lipid conjugate includes derivatization of the lipid with cholestérol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280,1991). Lipopolylysine, made by conjugatîng polylysine to DOPE, has been reported to be effective for transfection in the presence of sérum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8,1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposomal formulations are particularly suited for topical administration, liposomes présent several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implémentations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the pénétration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405-410 and du Plessis et al.,Antivlral Research, 18, 1992, 259-265; Mannino, R. J. and FouldFogerite, S., Biotechniques 6:682-690,1988; Itani, T. et al. Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz. 149:157-176,1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. Enz. 101:512-527,1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855,1987).

Non-ionic liposomal Systems hâve also been examined to détermine their utility in the delivery of drugs to the skin, in particular Systems comprising non-ionic surfactant and cholestérol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.

Liposomes that include RNAi agent can be made highly déformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of déformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to kératinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a sériés of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without ffagmenting, and often self-loading.

Other formulations amenable to the présent invention are described in United States provîsional application serial Nos. 61/018,616, filed January 2, 2008; 61/018,611, filed January 2,2008; 61/039,748, filed March 26, 2008; 61/047,087, filed April 22, 2008 and 61/051,528, filed May 8,2008. PCT application no PCT/US2007/080331, filed October 3,2007 also describes formulations that are amenable to the présent invention.

Surfactants

Surfactants find wide application in formulations such as émulsions (including microemulsions) and liposomes (see above). RNAi agent (or a precursor, e.g., a larger dsîRNA which can be processed into a siRNA, or a DNA which encodes a siRNA or precursor) compositions can include a surfactant. In one embodiment, the siRNA is formulated as an émulsion that includes a surfactant. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p. 285).

If the surfactant molécule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants înclude nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

If the surfactant molécule carries a négative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

If the surfactant molécule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationïc surfactants include quatemary ammonium salts and ethoxylated amines. The quatemary ammonium salts are the most used members of this class.

If the surfactant molécule has the ability to carry either a positive or négative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid dérivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

The use of surfactants in drug products, formulations and in émulsions has been reviewed (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p. 285).

Micelles and other Membranous Formulations

The RNAi agents of the invention can also be provided as micellar formulations. “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molécules are arranged in a spherical structure such that ail the hydrophobie portions of the molécules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobie.

A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali métal Cg to C22 alkyl sulphate, and a micelle forming compound. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after addition of the alkali métal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingrédients but vîgorous mixing in order to provide smaller size micelles.

In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali métal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali métal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.

Phénol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Altematively, phénol and/or m-cresol may be added with the micelle forming ingrédients. An isotonie agent such as glycerin may also be added after formation of the mixed micellar composition.

For delivery of the micellar formulation as a spray, the formulation can be put into an aérosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingrédients are adjusted so that the aqueous and propellant phases become one, Le., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensîng a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.

Propellants may include hydrogen-containing chlorofluorocarbons, hydrogencontaining fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

The spécifie concentrations of the essential ingrédients can be determined by relatively straightforward expérimentation. For absorption through the oral cavities, it is often désirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.

Particles

In another embodiment, an RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle, Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, évaporation, fluîd bed drying, vacuum drying, or a combination of these techniques.

IV. Methods For Inhibiting TTR Expression

The présent invention also provides methods of inhibiting expression of a transthyretin (TTR) in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNAi agent, in an amount effective to inhibit expression of TTR in the cell, thereby inhibiting expression of TTR in the cell.

Contacting of a cell with an RNAi agent, e.g., a double stranded RNAi agent, may be done in vitro or in vivo. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc₃ ligand, or any other ligand that directs the RNAi agent to a site of interest, e.g., the liver of a subject.

The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.

The phrase “inhibiting expression of a TTR” is intended to refer to inhibition of expression of any TTR gene (such as, e.g., a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene) as well as variants or mutants of a TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to amyloid déposition), or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism.

“Inhibiting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene. The expression of the TTR gene may be assessed based on the level, or the change in the level, of any variable associated with TTR gene expression, e.g., TTR mRNA level, TTR protein level, or the number or extent of amyloid deposits. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject.

Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TTR expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a predose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

In some embodiments of the methods of the invention, expression of a TTR gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Inhibition of the expression of a TTR gene may be manifested by a réduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be présent, for example, in a sample derived fforn a subject) in which a TTR gene is transcribed and which has or hâve been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were présent) such that the expression of a TTR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or hâve not been so treated (control cell(s)). In preferred embodiments, the inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

(mRNA in control cells) - (mRNA in treated cells) * θθ₀^ (mRNA in control cells)

Altematively, inhibition of the expression of a TTR gene may be assessed in terms of a réduction of a parameter that is functionally linked to TTR gene expression, e.g., TTR protein expression, retinol binding protein level, vitamin A level, or presence of amyloid deposits comprising TTR. TTR gene silencing may be determined in any cell expressing TTR, either constitutively or by genomic engineering, and by any assay known in the art. The liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina and pancréas.

Inhibition of the expression of a TTR protein may be manifested by a réduction in the level of the TTR protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above for the assessment of mRNA suppression, the inhibiton of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

A control cell or group of cells that may be used to assess the inhibition of the expression of a TTR gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

The level of TTR mRNA that is expressed by a cell or group of cells, or the level of circulating TTR mRNA, may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of TTR in a sample is determined by detectîng a transcribed polynucleotide, or portion thereof, e.g., mRNA of the TTR gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA préparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nue. Acids Res. 12:7035), Northem blotting, in situ hybridization, and microarray analysis. Circulating TTR mRNA may be detected using methods the described in PCT/US2012/043584, the entire contents of which are hereby incorporated herein by reference.

In one embodiment, the level of expression of TTR is determined using a nucleic acid probe. The term probe, as used herein, refers to any molécule that is capable of selectively binding to a spécifie TTR. Probes can be synthesîzed by one of skill in the art, or derived from appropriate biological préparations. Probes may be specifically designed to be labeled. Examples of molécules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molécules.

Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southem or Northem analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the détermination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molécule (probe) that can hybridize to TTR mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA détection methods for use in determining the level of TTR mRNA.

An alternative method for determining the level of expression of TTR in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to préparé cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sri. USA 88:189-193), self sustained sequence réplication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification System (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lîzardi et al. (1988) Bio/Technology 6:1197), rolling circle réplication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the détection of the amplified molécules using techniques well known to those of skill in the art. These détection schemes are especially useful for the détection of nucleic acid molécules if such molécules are présent in very low numbers. In particular aspects of the invention, the level of expression of TTR is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan™ System).

The expression levels of TTR mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northem, Southem, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The détermination of TTR expression level may also comprise using nucleic acid probes in solution.

In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein.

The level of TTR protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precîpitin reactions, absorption spectroscopy, a colorimétrie assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.

In some embodiments, the efficacy of the methods of the invention can be monitored by detecting or monitoring a réduction in an amyloid TTR deposit. Reducing an amyloid TTR deposit, as used herein, includes any decrease in the size, number, or severity of TTR deposits, or to a prévention or réduction in the formation of TTR deposits, within an organ or area of a subject, as may be assessed in vitro or in vivo using any method known in the art. For example, some methods of assessîng amyloid deposits are described in Gertz, M.A. & Rajukumar, S.V. (Editors) (2010), Amyloidosis: Diagnosis and Treatment, New York: Humana Press. Methods of assessing amyloid deposits may include biochemical analyses, as well as visual or computerized assessment of amyloid deposits, as made visible, e.g., using immunohistochemical staining, fluorescent labeling, light microscopy, électron microscopy, fluorescence microscopy, or other types of microscopy. Invasive or noninvasive imaging modalities, including, e.g., CT, PET, or NMR/MRI imaging may be employed to assess amyloid deposits.

The methods of the invention may reduce TTR deposits in any number of tissues or régions of the body including but not limited to the heart, liver, spleen, esophagus, stomach, intestine (ileum, duodénum and colon), brain, sciatic nerve, dorsal root ganglion, kidney and retina.

The term “sample” as used herein refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues présent within a subject. Examples of biological fluids include blood, sérum and serosal fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the like. Tissue samples may include samples from tissues, organs or localized régions. For example, samples may be derived fforn particular organs, parts of organs, or fluids or cells within those organis. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hépatocytes), the retina or parts of the retina (e.g., retina! pigment epithelium), the central nervous System or parts of the central nervous System (e.g., ventricles or choroid plexus), or the pancréas or certain cells or parts of the pancréas. In preferred embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a subject” refers to liver tissue or retinal tissue derived from the subject.

In some embodiments of the methods of the invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a spécifie site within the subject. The inhibition of expression of TTR may be assessed using measurements of the level or change in the level of TTR mRNA or TTR protein in a sample derived from fluid or tissue from the spécifie site within the subject. In preferred embodiments, the site is selected from the group consisting of liver, choroid plexus, retina, and pancréas. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites (e.g., hépatocytes or retinal pigment epithelium). The site may also include cells that express a particular type of receptor (e.g., hépatocytes that express the asialogycloprotein receptor).

V. Methods for Treating or Preventing a TTR-Associated Discase

The présent invention also provides methods for treating or preventing a TTRassociated disease in a subject. The methods include administering to the subject a therapeutically effective amount or prophylactically effective amount of an RNAi agent of the invention.

As used herein, a subject includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal. A subject may include a transgenic organism. Most preferably, the subject is a human, such as a human suffering from or predisposed to developing a TTR-associated disease.

In some embodiments, the subject is suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTR-associated disease, e.g., a subject with a TTR gene mutation that is associated with the development of a TTR associated disease, a subject with a family history of TTR-associated disease, or a subject who has signs or symptoms suggesting the development of TTR amyloidosis.

A “TTR-associated disease,” as used herein, includes any disease caused by or associated with the formation of amyloid deposits in which the fibril precurosors consist of variant or wild-type TTR protein. Mutant and wild-type TTR give rise to various forms of amyloîd déposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, resulting in extracellular deposits that impair organ fonction. Climîcal syndromes associated with TTR aggregation include, for example, senile systemic amyloidosis (SSA); systemic familial amyloidosis; familial amyloidotic polyneuropathy (FAP); familial amyloidotic cardiomyopathy (FAC); and leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form.

In some embodiments of the methods of the invention, RNAi agents of the invention are administered to subjects suffering from familial amyloidotic cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). Normal-sequence TTR causes cardiac amyloidosis in people who are elderly and îs termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopie deposits in many other organs. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of clinically significant TTR amyloidosis (also called ATTR (amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis.

In some embodiments of the methods of the invention, RNAi agents of the invention are administered to subjects suffering from transthyretin (TTR)-related familial amyloidotic polyneuropathy (FAP). Such subjects may suffer from ocular manifestations, such as vitreous opacity and glaucoma. It is known to one of skill in the art that amyloidogenic transthyretin (ATTR) synthesized by retinal pigment epithelium (RPE) plays important rôles in the progression of ocular amyloidosis. Previous studies hâve shown that panretinal laser photocoagulation, which reduced the RPE cells, prevented the progression of amyloid déposition in the vitreous, indicating that the effective suppression of ATTR expression in RPE may become a novel therapy for ocular amyloidosis (see, e.g., Kawaji, T., et al., Ophthalmology. ¢2010) 117: 552-555). The methods of the invention are usefol for treatment of ocular manifestations of TTR related FAP, e.g., ocular amyloidosis. The RNAi agent can be delivered in a manner suitable for targeting a particular tissue, such as the eye. Modes of ocular delivery include retrobulbar, subcutaneous eyelîd, subconjunctival, subtenon, anterior chamber or intravitreous injection (or internai injection or infusion). Spécifie formulations for ocular delivery include eye drops or ointments.

Another TTR-associated disease is hyperthyroxinemia, also known as “dystransthyretinemic hyperthyroxinemia” or “dysprealbuminemic hyperthyroxinemia”. This type of hyperthyroxinemia may be secondary to an increased association of thyroxine with TTR due to a mutant TTR molécule with increased affinity for thyroxine. See, e.g., Moses et al. (1982) J. Clin. Invest., 86,2025-2033.

The RNAi agents of the invention may be administered to a subject using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatîc, cerebrospinal, and any combinations thereof. In preferred embodiments, the agents are administered subcutaneously.

In some embodiments, the administration is via a depot injection. A depot injection may release the RNAi agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of TTR, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent sérum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

In some embodiments, the administration is via a pump. The pump may be an extemal pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or épidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.

Other modes of administration include épidural, intracérébral, intracerebroventricular, nasal administration, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreai, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

In some embodiments, the RNAi agent is administered to a subject in an amount effective to inhibit TTR expression in a cell within the subject. The amount effective to inhibit TTR expression in a cell within a subject may be assessed using methods discussed above, including methods that involve assessment of the inhibition of TTR mRNA, TTR protein, or related variables, such as amyloid deposits.

In some embodiments, the RNAi agent is administered to a subject in a therapeutically or prophylactically effective amount.

Therapeutically effective amount, as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TTR assocîated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, amelîorating or maintaining the existing disease or one or more symptoms of disease). The therapeutically effective amount may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, âge, weight, family history, genetic makeup, stage of pathological processes mediated by TTR expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

“Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet expérience or display symptoms of a TTR-associated disease, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Symptoms that may be ameliorated include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomie neuropathy (e.g., gastrointestinal dysfonction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomie insufficiency, cardiomyopathy, vitreous opacities, rénal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfonction, and comeal lattice dystrophy. Amelîorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The prophylactically effective amount may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, âge, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

A therapeutically-effective amount or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi agents employed in the methods of the présent invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

As used herein, the phrases “therapeutically effective amount” and “prophylactically effective amount” also include an amount that provides a benefit in the treatment, prévention, or management of pathological processes or symptom(s) of pathological processes mediated by TTR expression. Symptoms ofTTR amyloidosis include sensory neuropathy (e.g. paresthesia, hypesthesia in distal limbs), autonomie neuropathy (e.g., gastrointestinal dysfonction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomie insufficiency, cardiomyopathy, vîtreous opacifies, rénal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfonction, and comeal lattice dystrophy.

The dose of an RNAi agent that is administered to a subject may be tailored to balance the risks and benefits of a particular dose, for example, to achieve a desired level of TTR gene suppression (as assessed, e.g., based on TTR mRNA suppression, TTR protein expression, or a réduction in an amyloid deposit, as defined above) or a desired therapeutic or prophylactic effect, while at the same time avoiding undesirable side effects.

In one embodiment, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., between about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about I mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about l mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 11 mg/kg, about 12 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 16 mg/kg, about 17 mg/kg, about 18 mg/kg, about 19 mg/kg, about 20 mg/kg, about 21 mg/kg, about 22 mg/kg, about 23 mg/kg, about 24 mg/kg, about 25 mg/kg, about 26 mg/kg, about 27 mg/kg, about 28 mg/kg, about 29 mg/kg, 30 mg/kg, about 31 mg/kg, about 32 mg/kg, about 33 mg/kg, about 34 mg/kg, about 35 mg/kg, about 36 mg/kg, about 37 mg/kg, about 38 mg/kg, about 39 mg/kg, about 40 mg/kg, about 41 mg/kg, about 42 mg/kg, about 43 mg/kg, about 44 mg/kg, about 45 mg/kg, about 46 mg/kg, about 47 mg/kg, about 48 mg/kg, about 49 mg/kg or about 50 mg/kg.

X.

In some embodiments, the RNAi agent is administered in two or more doses. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracistemal or intracapsular), or réservoir may be advisable. In some embodiments, the number or amount of subséquent doses is dépendent on the achievement of a desired effect, e.g., the suppression of a TTR gene, or the achievement of a therapeutic or prophylactic effect, e.g., reducing an amyloid deposit or reducing a symptom of a TTR-associated disease. ln some embodiments, the RNAi agent is administered according to a schedule. For example, the RNAi agent may be administered twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g., hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In other embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every hours) followed by a longer time period (e.g., about l week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered hourly and is later administered at a longer interval (e.g., daily, weekly, biweekly, or monthly). In another embodiment, the RNAi agent is initially administered daily and is later administered at a longer interval (e.g., weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a spécifie embodiment, the RNAi agent is administered once daily during a first week, followed by weekly dosing starting on the eighth day ofadministration. In another spécifie embodiment, the RNAi agent is administered every other day during a first week followed by weekly dosing starting on the eighth day of administration.

Any of these schedules may optionally be repeated for one or more itérations. Tlie number of itérations may dépend on the achievement of a desired effect, e.g., the suppression of a TTR gene, retinol binding protein level, vitamin A level, and/or the achievement of a therapeutic or prophylactic effect, e.g., reducing an amyloid deposit or reducing a symptom of a TTR-associated disease.

In some embodiments, the RNAi agent is administered with other therapeutic agents or other therapeutic regimens. For example, other agents or other therapeutic regimens suitable for treating a TTR-associated disease may include a liver transplant, which can reduce mutant TTR levels in the body; Tafamîdis (Vyndaqel), which kinetically stabilizes the TTR tetramer preventing tetramer dissociation required for TTR amyloidogenesis; and dîuretics, which may be employed, for example, to reduce edema in TTR amyloidosis with cardiac involvement.

In one embodiment, a subject is administered an initial dose and one or more maintenance doses of an RNAi agent. The maintenance dose or doses can be the same or lower than the initial dose, e.g., one-half of the initial dose. A maintenance regimen can include treating the subject with a dose or doses ranging from 0.01 pg to 15 mg/kg of body weight per day, e.g., 10 mg/kg, 1 mg/kg, 0.1 mg/kg, 0.01 mg/kg, 0.001 mg/kg, or 0.00001 mg/kg of bodyweight per day. The maintenance doses are, for example, administered no more than once every 2 days, once every 5 days, once every 7 days, once every 10 days, once every 14 days, once every 21 days, or once every 30 days. Further, the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient. In certain embodiments the dosage may be delivered no more than once per day, e.g., no more than once per 24, 36,48, or more hours, e.g., no more than once every 5 or 8 days. Following treatment, the patient can be monitored for changes in his/her condition. The dosage of the RNAi agent may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the disease state has been ablated, or if undesired side-effects are observed.

VI. Kits

The présent invention also provides kits for performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a TTR in a cell by contacting the cell with the RNAi agent(s) in an amount effective to inhibit expression of the TTR. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of TTR (e.g., means for measuring the inhibition of TTR mRNA or TTR protein). Such means for measuring the inhibition of TTR may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for admînistering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of ail references and published patents and patent applications cited throughout the application are hereby incorporated herein by reference.

EXAMPLES

Examplc 1: Inhibition of TTR with TTR-GalNAc conjugates

A single dose of the TTR RNAi agent AD-43527 was administered to mice subcutaneously and TTR mRNA levels were determined 72 hours post administration.

The mouse/rat cross-reactive GalNAc-conjugate, AD-43527, was chosen for in vivo évaluation in WT C57BL/6 mice for silencing of TTR mRNA in liver. The sequence of each strand of AD-43527 is shown below.

Strand: s= sense; as= antisense

Duplex #	Strand	Olîgo #	Sequence 5' to 3'
AD-43527	s	A89592	AfaCfaGfuGfuUfcüfuGfcUfcUfaüfaAfL96 (SEQ ID NO: 8)
	as	A- 83989	uüfaüfaGfaGfcAfaGfaAfcAfcUfgüfusüfsu (SEQ ID NO: 9
			L96 = GalNAc3; lowercase nts (a,u,g,c) are 2'-0-methyl nucléotides, Nf (i.e., Af) is a 2'-fluoro nucléotide

The ligand used was GalNAcj:

This GalNAc3 ligand was conjugated to the 3’-end of the sense strand using the linker and tether as shown below:

following schematic:

Additional RNAi agents that target TTR and hâve the following sequences and modifications were synthesized and assayed.

Mouse/rat cross reactive TTR RNAi agents

Duplex	Sense strand 5-3'	Antisense strand 5-3’
AD43528	AfaCfaGfuGfuUfcUfuGfcUfcüfaUfa AIQ11L96 (SEQ IDNO; 10)	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu (SEQ1DNO: 11)

Human/cyno cross reactive TTR RNAi agents; parent duplex is AD-18328 [having a sense strand 5’-3’ sequence of GuAAccAAGAGuAuuccAudTdT (SEQ ID NO: 12) and antisense strand 5’ to 3’ sequence of AUGGAAuACUCUUGGUuACdTdT (SEQ ID NO: 13) with the following modifications: altematîng 2'F/2’OMe w/2 PS on AS.

Duplex	Sense strand 5'-3'	Antisense strand 5'-3'
^DT 45163	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfaUfL96 (SEQ ID NO: 14)	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa (SEQ ID NO: 16)
AD45164	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfaUIQl 1L96 (SEQIDNO: 15)	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa (SEQ ID NO: 17)

L96 = GalNAc₃; lowercase nts (a,u,g,c) are 2’-O-methyl nucléotides, Nf (i.e., Af) is a 2’fluoro nucléotide; Q11 is cholestérol; s is phosphorothioate.

AD-43527 was administered to female C57BL/6 mice (6-10 weeks, 5 per group) via subcutaneous injection at a dose volume of ΙΟμΙ/g at a dose of 30,15, 7.5, 3.5, 1.75 or 0.5 mg/kg of AD-43527. Control animais received PBS by subcutaneous injection at the same dose volume.

After approximately seventy two hours, mice were anesthetized with 200 μΐ of ketamine, and then exsanguinated by severing the right caudal artery. Liver tissue was collected, flash-frozen and stored at -80°C until processing.

Efficacy of treatment was evaluated by measurement of TTR mRNA in the liver at 72 hours post-dose. TTR liver mRNA levels were assayed utilizing the Branched DNA assays- QuantiGene 1.0 (Panomics). Briefly, mouse liver samples were ground and tissue lysâtes were prepared. Liver lysis mixture (a mixture of 1 volume of lysis mixture, 2 volume of nuclease-free water and 10μ1 of Proteinase-K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes. 5μΙ of liver lysate and 95μ1 of working probe set (TTR probe for gene target and GAPDH for endogenous control) were added into the Capture Plate. Capture Plates were incubated at 53 °C ±1 °C (aprx. 16-20hrs). The next day, the Capture Plates were washed 3 times with IX Wash Buffer (nuclease-free water, Buffer Component 1 and Wash Buffer Component 2), then dried by centrifuging for 1 minute at 240g. 100μ1 of Amplifier Probe mix per well was added into the Capture Plate, which was sealed with aluminum foil and incubated for 1 hour at 46°C ±1°C. Following a 1 hour incubation, the wash step was repeated, then 100μ1 of Label Probe mix per well was added. Capture plates were incubated at 46 °C ±1 °C for 1 hour. The plates were then washed with IX Wash Buffer, dried and 100μ1 substrate per well was added into the Capture Plates. Capture Plates were incubated for 30 minutes at 46°C followed by incubation for 30 minutes at room température. Plates were read using the SpectraMax Luminometer following incubation. bDNA data were analyzed by subtracting the average background from each duplicate sample, averaging the résultant duplicate GAPDH (control probe) and TTR (experimental probe) values, and then computing the ratio: (experimental probebackground)/(control probe-background). The average TTR mRNA level was calculated for each group and normalized to the PBS group average to give relative TTR mRNA as a % of the PBS control group.

The results are shown in Figure 1. The GalNAc conjugated RNAi agent targeting TTR had an ED50 of approximately 5 mg/kg for TTR mRNA knockdown. These results demonstrate that GalNAc conjugated RNAi agents that target TTR are effective at inhibiting expression of TTR mRNA.

Example 2: Inhibition of TTR with TTR-GalNAc conjugatcs is durable

Mice were administered a subcutaneous dose (either 7.5 or 30.0 mg/kg) of AD43527, a GalNAc conjugated RNAi agent that targets TTR. The TTR mRNA levels in the liver were evaluated at 1, 3, 5, 7, 10, 13,15, 19,26, 33, and 41 days post treatment using the method described in Example 1.

The results are shown in Figure 2. At day 19, administration of 30.0 mg/kg GalNAc conjugated RNAi agents still showed about 50% silencing. Full recovery of expression occurred at day 41.

These results demonstrated that the inhibition provided by GalNAc conjugated siRNA targeting TTR is durable, lasting up to 3, 5, 7, 10, 13, 15, 19, 26 or 33 days post treatment.

Example 3. RNA Synthesis and Duplex Annealing

1. Oligonucleotide Synthesis

Oligonucleotides were synthesized on an AKTAoligopilot synthesizer or an ABI 394 synthsîzer. Commercially available controlled pore glass solid support (dT-CPG, 500Â, Prime Synthesis) and RNA phosphoramidites with standard protecting groups, 5’O-dimethoxytrityl N6-benzoyl-2’-/-butyldimethylsilyl-adenosine-3’-O-N,N’diisopropyl-2-cyanoethylphosphoramidite, 5*-O-dimethoxytrityl-N4-acetyl-2’-fbutyldimethylsilyl-cytidine-3’-O-N,N’-diisopropyl-2-cyanoethylphosphoramidite, 5'-Odimethoxytrityl-N2—isobutryl-2’-/-butyldimethylsilyl-guanosine-3’-O-N,N’-diisopropyl2-cyanoethylphosphoramidite, and 5’-<9-dimethoxytrityl-2’-/-butyldimethylsilyl-uridine3’-0-N,N’-diisopropyl-2-cyanoethylphosphoramidite (Pierce Nucleic Acids Technologies) were used for the oligonucleotide synthesis unless otherwise specified. The 2’-F phosphoramidites, 5’-O-dimethoxytrityl-N4-acetyl-2’-fluro-cytidine-3’-O

N,N*-diisopropyl-2-cyanoethyl-phosphoramidite and 5’-(9-dimethoxytrityl-2’-flurouridine-3’-0-N,N’-diisopropyl-2-cyanoethyl-phosphoramidite were purchased from (Promega). Ail phosphoramidites were used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which was used at 0.2M concentration in 10% THF/ANC (v/v). Coupling/recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M, American International Chemicals), for the PO-oxidation Iodine/Water/Pyridine was used and the PS-oxidation PADS (2 %) in 2,6-lutidine/ACN (1:1 v/v) was used.

Ligand conjugated strands were synthesized using a solid support containing the corresponding ligand. For example, the introduction of a carbohydrate moiety/ligand (for e.g., GalNAc) at the 3’-end of a sequence was achieved by starting the synthesis with the corresponding carbohydrate solid support. Similarly a cholestérol moiety at the 3’-end was introduced by starting the synthesis on the cholestérol support. In general, the ligand moiety was tethered to Zra»s-4-hydroxyprolinol via a tether of choice as described in the previous examples to obtain a hydroxyprolinol-ligand moiety. The hydroxyprolinol-ligand moiety was then coupled to a solid support via a succinate linker or was converted to phosphoramidite via standard phosphitylation conditions to obtain the desired carbohydrate conjugale building blocks. Fluorophore labeied siRNAs were synthesized from the corresponding phosphoramidite or solid support, purchased from Biosearch Technologies. The oleyl lithocholic (GalNAc)î polymer support made in house at a loadîng of 38.6 pmol/gram. The Mannose (Man)3 polymer support was also made in house at a loadîng of 42.0 pmol/gram.

Conjugation of the ligand of choice at the desired position, for example at the 5’end of the sequence, was achieved by coupling of the corresponding phosphoramidite to the growing chain under standard phosphoramidite coupling conditions unless otherwise specified. An extended 15 minute coupling of 0.1M solution of phosphoramidite in anhydrous CHjCN in the presence of 5-(ethylthio)-l//-tetrazole activator to a solid bound oligonucleotide. Oxidation of the intemucleotide phosphite to the phosphate was carried out using standard îodine-water as reported in Beaucage, S.L. (2008) Solidphase synthesis of siRNA oligonucleotides. Curr. Opin. Drug Discov. Devel., 11, 203216; Mueller, S., Wolf, J. and Ivanov, S.A. (2004) Current Strategies for the Synthesis of RNA. Curr, Org. Synth., 1,293-307; Xia, J., Noronha, A., Toudjarska, I., Li, F., Akinc, A., Braich, R., Frank-Kamenetsky, M., Rajeev, K.G., Egli, M. and Manoharan, M. (2006) Gene Silencing Activity of siRNAs with a Ribo-difluorotoluyl Nucléotide. ACS Chem. Biol., 1, 176-183 or by treatment with fôrAbutyl hydroperoxide/acetonitrile/water (10: 87: 3) with a 10 minute oxidation wait time conjugated oligonucleotide. Phosphorothioate was introduced by the oxidation of phosphite to phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and or Beaucage reagent The cholestérol phosphoramidite was synthesized in house, and used at a concentration of 0.1 M in dichloromethane. Coupling time for the cholestérol phosphoramidite was 16 minutes.

2. Deprotection- I (Nucleobase Deprotcction)

After completion of synthesis, the support was transferred to a 100 ml glass bottle (VWR). The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 80 mL of a mixture of ethanolic ammonia [ammonia: éthanol (3:1)] for 6.5h at 55°C. The bottle was cooled briefly on ice and then the ethanolic ammonia mixture was filtered into a new 250 ml bottle. The CPG was washed with 2 x 40 mL portions of ethanol/water (1:1 v/v). The volume of the mixture was then reduced to ~ 30 ml by roto-vap. The mixture was then frozen on dry ice and dried under vacuum on a speed vac.

3. Deprotection-II (Removal of 2’ TBDMS group)

The dried residue was resuspended in 26 ml of triethylamine, triethylamine trihydrofluoride (TEA.3HF) or pyridine-HF and DMSO (3:4:6) and heated at 60°C for 90 minutes to remove the teri-butyldimethylsilyl (TBDMS) groups at the 2’ position. The reaction was then quenched with 50 ml of 20mM sodium acetate and pH adjusted to 6.5, and stored in freezer until purification.

4. Analysis

The oligonucleotides were analyzed by high-performance liquid chromatography (HPLC) prior to purification and sélection of buffer and column dépends on nature of the sequence and or conjugated ligand.

5. HPLC Purification

The ligand conjugated oligonucleotides were purified by reverse phase préparative HPLC. The unconjugated oligonucleotides were purified by anion-exchange HPLC on a TSK. gel column packed in house. The buffers were 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN, IM NaBr (buffer B). Fractions containing iull-length oligonucleotides were pooled, desalted, and lyophilized. Approximately 0.15 OD ofdesalted oligonucleotidess were diluted in water to 150 μΐ and then pipetted in spécial vials for CGE and LC/MS analysis. Compounds were finally analyzed by LC-ESMS and CGE.

6. RNAi Agent préparation

For the préparation of an RNAi agent, equimolar amounts of sense and antisense strand were heated in lxPBS at 95°C for 5 minutes and slowly cooled to room température. The integrity of the duplex was confirmed by HPLC analysis. Table 1 below reflects the RNAi agents which target human or rodent TTR mRNA.

Table 1: RNAi Agents and Results of In Vitro Screening

Duplex ID	SID	SEQ ID NO:	Sense strand (S)	ASID	SEQ ID NO:	Antisense strand (AS)	% of mRNA remained conc. of siRNA	IC50 (nM)
lnM	0.1 nM	0.01 nM
D1000	S1OOO	18	AfuGfuAfaCfcAfAfGfaGfuAfuUfcCfasu	AS1000	1110	AfUfgGfaAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.03	0.1	0.47	0.006
D1001	S1001	19	AfsuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1001	1111	aUfsgGfAfAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.03	0.10	0.49	0.0065
D1002	S1002	20	AfuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1002	1112	aUfgGfAfAfuAfcUfcuuGfgsüfuAfcAfusGfsa	0.04	0.10	0.46	0.0068
D1003	S1003	21	AfuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1003	1113	aUfgGfAfAfuAfcUfcuuGfgUfsuAfcAfusGfsa	0.05	0.12	0.56	0.0073
D1004	S1004	22	a UGu a ACccAGagUAu uCCasu	AS1004	1114	AUggAAuaCUcuUGguUAcaUsGsa	0.07	0.13	0.44	0.008
D1005	S1OO5	23	AfuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1005	1115	aUfgGfAfAfuAfcUfcuuGfgsUfsuAfcAfusGfsa	0.06	0.11	0.53	0.0093
D1006	S1006	24	AfuGfuAfAfccAfAfGfaGfuAfuUfcCfasUf	AS1006	1116	a UfgGfaAfu AfcUfcuuGfGf uuAfcAf usGfsa	0.05	0.16	0.55	0.0095
D1007	S1OO7	25	AfuGfuAfAfCfcAfAfGfaGfuAfuUfcCfasUf	AS1007	1117	a UfgGfa AfuAfcUfcuuGfgu uAfcAf usGfsa	0.05	0.14	0.48	0.0098
D1008	S1008	26	auguaaccaadGadGudAudAcdGasu	AS 1008	1118	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.07	0.11	0.33	0.010
D1009	S1009	27	UfgGfGfAfuUfuCfAfUfgUfaAfcCfAfAfgsAf	AS1009	1119	uCfuugGfuUfaCfaugAfaAfuccCfasUfsc	0.03	0.14	0.56	0.0101
D1010	S1010	28	UfgGfgau Ufu CfAfUfgUfaAfcCfa AfgsAf	AS1010	1120	uCfuUfgGfuUfaCfaugAfaAfUfCfcCfasUfsc	0.03	0.14	0.65	0.0101
D1011	S1011	29	aUfGfu AfAfccAfAfGfa Gfu Af u UfcCfasUf	AS 1011	1121	aUfgGfa Afu AfcUfcuuGfGfu u Afca U fsgsa	0.06	0.10	0.55	0.011
D1012	S1012	30	UfgGfgAfuUfu CfAfUfgUfa acCfa AfgsAf	AS1012	1122	uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc	0.04	0.13	0.54	0.0114
D1013	S1013	31	auguaaccaadGadGudAudAcdGasu	AS1013	1123	aUfgGfaAfuAfcUfcUfugdGucfradCadTsgsa	0.11	0.19	0.49	0.011
D1014	S1014	32	AfuGfuaaCfcAfAfGfaGfuAfu UfcCfasUf	AS1014	1124	aUfgGfaAfuAfcUfcuuGfgUfUfAfcAfusGfsa	0.04	0.16	0.59	0.013
D1015	S1O1S	33	Afugu AfaccAfaGfd AGfdTAdT udCcdAsu	AS1015	1125	dAUdGgdAadTAfdCUfcUfuGfgUfuAfcAfusGfsa	0.07	0.15	0.51	0.013
D1O16	S1016	34	auGfu AfaCfcAfAfGfaGfu Afu UfcCfasUf	AS1016	1126	aUfgGfaAfuAfcUfcuuGfgUfuAfcAfUfsGfsa	0.05	0.14	0.64	0.013
D1017	S1017	35	UfGfggAfuUfuCfAfUfgUfAfAfcCfaAfgsAf	AS1017	1127	uCfu UfgGfuuaCfaugAfaAfu CfCfcasUfsc	0.09	0.41	0.74	0.0133
D1O18	S1018	36	AfuguAfaCfcAfAfGfaGfuAfuüfcCfasUf	AS1018	1128	aUfgGfaAfuAfcUfcuuGfgUfuAfCfAfusGfsa	0.03	0.14	0.61	0.014
D1019	51019	37	AfuGfuAfaccAfAfGfaGfuAfuUfcCfasUf	AS1019	1129	aUfgGfaAfuAfcUfcuuGfGfUfuAfcAfusGfsa	0.02	0.2	0.7	0.014
D1020	51020	38	AfsuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	A51020	1130	asUfsgGfAfAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.04	0.16	0.67	0.0156

01021	S1021	39	aUfguAfAfccAf AfgagUfa Ufu CfcasUf	AS1021	1131	aUfGfgAfaUfaCfUfCfuuGfGfuuAfCfaUfsgsa	0.11	0.24	0.64	0.016
01022	S1022	40	dTdGggdAdTuudCdAugdTdAacdCdAagsdA	AS1022	1132	udCdTugdGdTuadCdAugdAdAaudCdCcasdTsc	0.08	0.27	0.64	0.0161
D1023	S1023	41	AfsuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1023	1133	aUfgsGfAfAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.03	0.19	0.63	0.0163
01024	S1024	42	UfgGfgAfuUfuCfAfUfguaAfcCfaAfgsAf	AS1024	1134	uCfuUfgGfuUfAfCfaugAfaAfuCfcCfasUfsc	0.05	0.25	0.69	0.0164
D1025	S1025	43	UfgGfgAfuUfuCfAfUfgUfAfAfcCfa AfgsAf	AS1025	1135	uCfuUfgGfuuaCfaugAfaAfuCfcCfasUfsc	0.04	0.18	0.75	0.0166
01026	51026	44	UfgGfgAfuUfuCfAfUfgUfaAfcCfaAfgsAf	AS1026	1136	uCfuUfgGfuUfaCfaugAfaAfuCfcCfasUfsc	0.04	0.19	0.66	0.0178
D1027	S1O27	45	UfgGfgAfuUfuCfAfUfgüfaAfccaAfgsAf	AS1027	1137	uCfuUfGfGfuUfaCfaugAfaAfuCfcCfasUfsc	0.04	0.19	0.69	0.018
0102S	S1028	46	dAdTgudAdAccdAdAgadGdTaudTdCcasdT	AS1028	1138	adTdGgadAdTacdTdCuudGdGuudAdCausdGsa	0.15	0.29	0.72	0.018
D1029	51029	47	AdTGdTAdACdCAdAGdAGdTAdTUdCCdAsU	AS1029	1139	dAUdGGdAAdTAdCUdCUdTGdGUdTAdCAdTsGsdA	0.1	0.27	0.61	0.018
D1030	S1030	48	UfgGfGfAfuuuCfAfUfgUfaAfcCfaAfgsAf	AS1030	1140	uCfuUfgGfuUfaCfaugAfAfAfuccCfasUfsc	0.04	0.21	0.64	0.0187
D1031	S1031	49	AfuGfuAfAfccAfAfGfAfGfuAfuuccAfsu	AS1031	1141	AfUfGfGfAfAfuAfCfUfCfUfuGfGfuuAfcAfusGfsa	0.06	0.15	0.62	0.019
D1032	51032	50	AfsuGf uAfaCfcAfAfGfaGf uAfu ucCfasUf	AS1O32	1142	asUfgGfAfAfuAfcUfcuuGfgUfsuAfcAfusGfsa	0.09	0.34	0.78	0.021
01033	S1033	51	UfgGfgAf uUf uCfa UfGf Ufa acCfa AfgsAf	AS1033	1143	uCfuUfgGfUfUfacaUfgAfaAfuCfcCfasUfsc	0.06	0.26	0.57	0.0212
D1034	51034	52	Af uGf u AfAfccAfaGfaGfu Afu UfcCfasUf	AS1034	1144	aUfgGfa Afu Af cUfcUfu GfGfuu AfcAfusGfsa	0.11	0.39	0.82	0.0216
D1035	S1035	53	UfgGfgAfu uuCfAfUfgUfa AfcCfaAfgsAf	AS1035	1145	uCfuUfgGfuUfaCfaugAfAfAfuCfcCfasUfsc	0.04	0.16	056	0.0222
D1036	S1036	54	UfgGfGfAfuUfuCfaUfgUfaAfcCfAfAfgsAf	AS1036	1146	uCfuugGfuUfaCfaUfgAfaAfuccCfasUfsc	0.06	0.31	0.78	0.0234
D1037	S1037	55	UfgGfGfAfuUfuCfAfUfgUfaAfcCfaAfgsAf	AS1037	1147	u Cfu UfgGfu UfaCfa ugAfa AfuccCfasUfsc	0.03	0.14	0.62	0.0235
D1038	S1038	56	UfGfggAfUfuuCfAfugUfAfacCfAfagsAf	AS1038	1148	uCfUfugGfUfuaCfAfugAfAfauCfCfcasUfsc	0.09	0.39	0.78	0.0239
D1039	S1039	57	AfuGf uAfaCfcAfAfGfaGfu Afu ucCfasUf	AS1039	1149	aUfgGfAfAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.03	0.14	059	0.025
D1040	S1040	58	AfuGfuAfaCfcAfAfGfaGfu Afu UfccasUf	AS1040	1150	aUfGfGfaAfuAfcUfcuuGfgUfu AfcAfusGfsa	0.03	0.13	0.56	0.025
01041	S1041	59	AfsuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1041	1151	asUfgGfAfAfuAfcUfcuuGfgUfu AfcAfusGfsa	0.06	0.27	0.79	0.0252
D1042	S1042	60	UfgGfgAfuuuCfAfUfgUfAf AfcCfaAfgsAf	AS1042	1152	uCf u UfgGf uua CfaugAfAfAf uCfcCfasUfsc	0.05	0.27	0.67	0.0259
D1043	51043	61	Afu Gfu AfaCfcAfAfGfaGfuau UfcCfasUf	AS1043	1153	aUfgGfaAfUfAfcUfcuuGfgUfuAfcAfusGfsa	0.02	0.16	0,63	0.027
D1044	S1044	62	AfsuGfuAfaCfcAfAfGfaGfuAfuucCfasUf	AS1044	1154	asUfgGfAfAfuAfcUfcuuGfgsUfsuAfcAfusGfsa	0.06	0.30	0.81	0.0271
D1045	S1045	63	aUfguAfAfccAfAfgaGfGfauUfCfcasUf	AS 1045	1155	a UfGfgaAf UfacUfCfu uGfGfuu Af CfaUfsgsa	0.12	0.29	0.8	0.028
D1046	S1046	64	AfuGfu AfaCfcAfAfGfagu Afu UfcCfasUf	AS1046	1156	a U fgGfaAfuAfCf UfcuuGfgUfu AfcAfusGfsa	0.03	0.15	0.59	0.030
D1047	51047	65	UfgGfGfAfu UfuCfa UfgUfAfAfcCfaAfgsAf	AS1047	1157	uCfuUfgGfuuaCfaUfgAfaAfuccCfasUfsc	0.08	0.44	0.83	0.0324

D1048	S1048	66	AfuGfu AfaCfcAfAfGfaGfu Afu UfcCfasUf	AS1043 Ü58	aUfgGfaAfuAfcUfcuuGfgUfuAfcAfusGfsa	0.07	0.23	0.67	0.036
01049	51049	67	AfuGfuAfAfccAfAfGfAfGfuAf u uccAfsu	AS1049	1159	AfUfGfGfAfAfuAfCfUfCfUfUfGfGfUfuAfCfAfusGfsa	0.08	0.23	0.73	0.037
01050	S1050	68	UfgGfgAfuuuCfa UfgUfa AfcCfAfAfgsAf	AS1050	1160	uCfuugGfuUfaCfaUfgAfAfAfuCfcCfasUfsc	0.06	0.29	0.78	0.0372
D1051	S1051	69	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1051	1161	a UfgGfaAfud AcdTcdT udGgdT uAf cAfusgsa	0.12	0.41	0.86	0.040
D1O52	S1052	70	AfuguAfaccAfaGfdAGfdTAdTUdCcdAsu	AS1052	1162	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.22	0.72	0.042
D1053	S1053	71	AfuguAfaccAfaGfdAGfdTAdTUdCcdAsu	A51053	1163	dAUdGGdAAfuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.09	0.31	0.69	0.044
D1054	51054	72	AfuGfuAfaCfcAfaGfadGdTAfuUfcdCdAsUf	AS1054	1164	adTdGGfaAfudAdCUfcUfuGfgUfuAfcAfusGfsa	0.1	0.45	0.75	0.047
D1055	S1055	73	AfuguAfaccAfaGfaGfdTAdTUdCcdAsu	A51055	1165	dAUdGGdAadTAfcUfcUfuGfgUfuAfcAfusGfsa	0.12	0.26	0.7	0.049
D1056	51056	74	AuGuAaCcAaGaGuAuUcCasU	AS1056	1166	aUgGaAuAcUcUuGgUuAcAusGsa	0.08	0.24	0.65	0.050
D10S7	51057	75	AfuguAfaccAfagaGfuauUfccasUf	AS1057	1167	aUfGfGfaAfUfAfcUfCfUfuGfGfUfuAfCfAfusGfsa	0.14	0.42	0.62	0.051
01058	S1058	76	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1058	1168	a UfgGfaAfud AcdTcdTudGgdTuAfcAfusGfsa	0.12	0.36	0.86	0.053
D1059	S1059	77	AfuguAfaccAfaGfdAGfdTAdTUdCcdAsu	AS1059	1169	dAUdGGdAadTAfdCUfcUfuGfgUfuAfcAfusGfsa	0.09	0.27	0.7	0.054
01060	51060	78	adTgud Ad AccdAdAgagdT adTudCcasdT	AS1060	1170	adTdGgdAadTadCdTdCuudGdGuudAdCadTsgsa	0.11	0.37	0.66	0.056
01061	S1061	79	AfuGfuAfaCfcAfaGfdAdGuAfuUfcdCdAsUf	AS1061	1171	adT dGGfaAfu AfdCdT cUfuGfgUfu AfcAfusGfsa	0.1	0.31	0.77	0.059
01062	S1062	80	AfuguAfaccAfaGfdAGfdTAdTudCcdAsu	AS1O62	1172	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.27	0.65	0.059
01063	51063	81	a dTdG uadAdCccdAdGagdTd AuudCdCasu	AS1063	1173	dAdTggdAdAuadCdTcudTdGgudTdAcadTsdGsa	0.12	0.44	0.82	0.064
01064	51064	82	AfuGfuAfaCfcAfaGfaGfdTdAuUfcdCdAsUf	AS1064	1174	adTdGGfaAfdTdAcUfcUfuGfgUfuAfcAfusGfsa	0.12	0.32	0.83	0.064
01065	51065	83	AfuguAfaccAfaGfaGfdTAdTudCcdAsu	AS1065	1175	dAUdGgdAadTAfcUfcUfuGfgUfuAfcAfusGfsa	0.13	0.34	0.72	0.066
D1066	51066	84	AfuGfu Afa CfcAfaGfaGfu dAdTUfcdCdAsUf	AS1066	1176	adTdGGfadAdTAfcUfcUfuGfgUfuAfcAfusGfsa	0.11	0.33	0.72	0.067
D1067	S1067	85	AfuguAfaccAfaGfaGfdTAdTUdCcdAsu	AS1067	1177	aUfgGfaAfuAfcUfcUfiiGfgUfu AfcAfusGfsa	0.11	0.37	0.62	0.070
D1068	51068	86	AfuguAfaccAfaGfaGfdTAdTUdCcdAsu	AS1068	1178	dAUdGGdAAuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.16	0.33	0.64	0.072
D1069	S1069	87	a UfGfua AfCfccAfGfagUfAf uuCfCfasu	AS1069	1179	AfUfggAfAfuaCfUfcuUfGfguUfAfcaUfsGfsa	0.14	0.43	0.73	0.074
D1070	51070	88	AfuGfu Afa CfCfAfaGfagu Afu UfcCfasUf	AS1070	1180	aUfgGfaAfuAfCfUfcUfuggUfuAfcAfusGfsa	0.08	0.42	0.94	0.075
01071	S1071	89	UfgGfgAfuuuCfa UfgUfa AfcCfa AfgsAf	AS1071	1181	uCfuUfgGfuUfaCfaUfgAfAfAfuCfcCfasUfsc	0.14	0.28	0.83	0.0797
D1072	51072	90	AfuGfuAfaCfcAfaGfAfGfuauUfcCfasUf	AS1072	1182	a UfgGfaAf UfAfcucUfuGfgUfuAfcAfusGfsa	0.05	0.26	0.8	0.082
D1073	S1073	91	AfuGfuAfaCfcAfaGfadGdTdAdTUfcCfasUf	AS1073	1183	aUfgGfadAdTdAdCUfcUfuGfgUfuAfcAfusGfsa	0.12	0.41	0.73	0.083
01074	51074	92	AfUfguAfAfccAfAfgaGfUfauUfCfcasUf	AS1074	1184	aUfGfgaAfUfacUfCfuuGfGfuuAfCfausGfsa	0.14	0.44	0.75	0.086

D1075	S1075	93	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1075	1185	BÜfgGfdAdAdTdAcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.41	0.72	0.088
01076	S1076	94	AfuGfuAfaCfcAfaGfaGfudAdT dTdCCfasUf	AS1076	1186	aUfgdGdAdAdTAfcUfcUfuGfgUfuAfcAfusGfsa	0.15	0.45	0.86	0.088
D1077	S1077	95	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasu	AS1077	1187	AfUfgGfaAfuAfcUfcUfuGfgüfuAfcAfusGfsa	0.08	0.46	0.95	0.092
01078	51078	96	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1078	1188	dAUdGGdAadTAfcUfcüfuGfgUfuAfcAfusGfsa	0.09	0.32	0.76	0.093
01079	S1079	97	AfuguAfaccAfaGfaGfdTadTudCcdAsu	AS1079	1189	dAudGgdAadTAfcUfcUfuGfgUfuAfcAfusGfsa	0.14	0.38	0.76	0.095
D1080	51080	98	AfuGfuAfaCfcAfaGfAfGfuAfuucCfasUf	AS1080	1190	aUfgGfAfAfuAfcucUfuGfgüfuAfcAfusGfsa	0.05	0.42	0.86	0.099
D1081	S1081	99	AfuGfuAfaCfcAfaGfaGfuAfuUfdCdCdAstfT	AS 1031	1191	d AdTdG dGa Afu AfcUfcUf uGfgüf u AfcAf usGfsa	0.17	0.47	0.9	0.105
D1082	S1082	100	AfuGfu Afacca agagu Af u UfcCfasüf	AS1082	1192	aUfgGfaAfudACfudCUfudGGfudTAfcAfusgsa	0.12	0.44	0.83	0.106
D1083	51083	101	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfaslIf	AS1083	1193	BdTdGGfaAfdTdAcüfcUfuGfgUfuAfcAfusGfsa	0.11	0.34	0.74	0.109
D1084	S1084	102	AfuGfuAfAfCfcAfaGfaGfuauUfcCfasUf	A51084	1194	aUfgGfaAfUfAfcUfcUfuGfguuAfcAfusGfsa	0.1	0.45	0.93	0.117
D108S	S1085	103	AfuGfUfAfaCfcAfaGfaGfuauUfcCfasüf	AS1085	1195	BUfgGfaAfUfAfcUfcUfuGfgUfuacAfusGfsa	0.07	0.42	0.78	0.120
D1086	S1086	104	aUfguAfAfccAfAfgaGfuAfuUfcCfasUf	A51086	1196	aUfgGfaAfuAfcUfCfuuGfGfuuAfCfaUfsgsa	0.17	0.45	0.83	0.1197
D1087	S1087	105	AfuGfuAfaCfcAfaGfaGfUfAfuUfcCfasu	AS1087	1197	AfUfgGfaAfuacUfcUfuGfgüfuAfcAfusGfsa	0.05	0.3	0.7	0.120
D1088	51088	106	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1088	1198	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusgsa	0.11	0.46	0.8	0.120
01089	51089	107	AfuGfuAfaCfcAfaGfaGfUfAfuüfcCfasUf	AS1089	1199	aUfgGfaAfuacUfcUfuGfgUfuAfcAfusGfsa	0.14	0.49	0.85	0.122
01090	S1090	108	AfuGfuAfaCfcAfaGfaGfuauUfcCfasüf	AS1090	1200	aUfgGfaAfllfAfcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.41	0.85	0.125
01091	51091	109	AfuguAfaccAfaGfaGfdTAdTudCcdAsu	AS1091	1201	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.16	0.38	0.77	0.125
01092	S1092	110	AfuGfuAfaCfcAfaGfAfGfuAfuüfcCfasu	AS1092	1202	AfüfgGfaAfuAfcucUfuGfgUfuAfcAfusGfsa	0.05	0.31	0.93	0.126
01093	S1093	111	auGfuAfaCfcAfaGfAfGfuAfuUfcCfasUf	AS1093	1203	aUfgGfaAfuAfcucüfuGfgUfuAfcAfUfsGfsa	0.06	0.33	0.9	0.135
01094	S1094	112	AfuGf uAfaCfcAfaGfaGfüfAfu U fccasUf	AS1094	1204	BUfGfGfaAfuacUfcUfuGfgUfuAfcAfusGfsa	0.07	0.39	0.85	0.142
01095	S1095	113	AfuGfuAfaCfcAfaGfAfGfuAfuüfcCfasUf	A5109S	1205	aUfgGfaAfuAfcucüfuGfgUfuAfcAfusGfsa	0.09	0.39	0.76	0.146
□1096	S1096	114	AfuGf uAfaCfcAfaGfaGfUfAfu ucCfasUf	AS1096	1206	aUfgGfAfAfuacUfcUfuGfgUfuAfcAfusGfsa	0.06	0.38	0.85	0.147
D1097	S1097	115	AfuGfUfAfaCfcAfaGfaGfuAfuucCfasUf	AS1097	1207	aüfgGfAfAfuAfcUfcUfuGfgUfuacAfusGfsa	0.12	0.47	0.87	0.147
01098	51098	116	AfuGfu AfaCfcAfaGfaGfuAfUfüfccasUf	AS1098	1208	aUfGfGfaauAfcUfcUfuGfgUfuAfcAfusGfsa	0.06	0.42	0.85	0.151
D1099	51099	117	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1099	1209	dAUdGGdAadlAfdCUfcUfuGfgUfuAfcAfusGfsa	0.16	0.41	0.85	0.152
D1100	51100	118	AfuguAfaccAfaGfaGfuAfuUfcCfasüf	AS1100	1210	aUfgGfaAfuAfcUfcUfuGfgüfuAfcAfusGfsa	0.15	0.48	0.72	0.152
D1101	51101	119	AfuGf uAfa CfcAfaGfAfGfuAfuüfccasUf	AS1101	1211	aUfGfGfaAfuAfcucUfuGfgüfuAfcAfusGfsa	0.06	0.38	0.94	0.158

D1102	S1102	120	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1102	1212	aUfgGfaAfuAfdCuCftfTuGfdGuüfacAfusGfsa	0.21	0.45	0.89	0.162
D1103	S1103	121	AfuGfuaaCfCfAfaGfaGfuAfuUfcCfasUf	AS1103	1213	aUfgGfaAfuAfcUfcUfuggUfUfAfcAfusGfsa	0.14	0.49	0.95	0.163
DI 104	S1104	122	AfuGfuAfaccAfaGfaGfUfAfuUfcCfasUf	AS1104	1214	aUfgGfaAfuacUfcUfuGfGfUfuAfcAfusGfsa	0.06	0.36	0.92	0.163
D1105	S1105	123	AfuGfuAfaCfcAfaGfaGfuAfuucCfasUf	AS1105	1215	aUfgGfAfAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.45	0.84	0.167
D1106	51106	124	AfuGfuaaCfcAfaGfAfGfuAfuüfcCfasUf	AS 1106	1216	aUfgGfaAfuAfcucUfuGfgUfUfAfcAfusGfsa	0.09	0.43	0.91	0.170
D1107	S1107	125	AfuGfuAfaccAfaGfAfGfuAfuUfcCfasUf	AS1107	1217	aUfgGfaAfuAfcucUfuGfGfUfuAfcAfusGfsa	0.09	0.46	1	0.171
DI 108	51108	126	AfuguAfaccAfaGfaGfcfTadTudCcdAsu	AS1108	1218	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.11	0.39	0.71	0.176
D1109	SI 109	127	AfuGf UfAfaCfcAfaGfaGfu Afu U fccasUf	AS1109	1219	aUfGfGfaAfuAfcUfcUfuGfgUfuacAfusGfsa	0.1	0.43	0.9	0.180
D111O	S1110	128	AfuGfuAfaCfcAfaGfaguAfUfUfcCfasUf	AS1110	1220	aUfgGfaauAfCfUfcUfuGfgUfuAfcAfusGfsa	0.06	0.42	0.88	0.182
Dllll	Sllll	129	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1111	1221	dAUdGGdAAuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.18	0.49	0.79	0.183
D1112	S1112	130	AfuGfüfAfaccAfaGfaGfuAfuUfcCfasUf	AS1112	1222	aUfgGfaAfuAfcUfcUfuGfGfUfuacAfusGfsa	0.14	0.48	0.85	0.195
DI 113	S1113	131	AfuGfuAfaCfcAfaGfagu Afu UfcCfasUf	AS1113	1223	aUfgGfaAfuAfCfUfcUfuGfgUfuAfcAfusGfsa	0.09	0.41	0.85	0.201
D1114	SI 114	132	auGfuAfaCfcAfaGfaGfUfAfu UfcCfasUf	AS1114	1224	aUfgGfaAfuacUfcUfuGfgUfuAfcAfUfsGfsa	0.05	0.44	0.94	0.201
D1115	S1115	133	Afugu Afa CfcAfaGf aGf UfAfu UfcCfasUf	AS1115	1225	aUfgGfaAfuacUfcUfuGfgUfuAfCfAfusGfsa	0.08	0.41	0.96	0.204
D1116	S1116	134	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1116	1226	adTdGGfadAdTAfcUfcUfuGfgUfuAfcAfusGfsa	0.15	0.47	0.79	0.208
01117	S1117	135	AfuGfuaaCfcAfaGfaGfUfAfuUfcCfasUf	AS1117	1227	aUfgGfaAfuacüfcUfuGfgUfUfAfcAfusGfsa	0.08	0.42	0.92	0.224
D1118	51118	136	auguaaccaagaguauuccasu	AS1118	1228	AfUfGfGfAfAfUfAfCfUfCfUfUfGfGfUfUfAfCfAfUfsgsa	0.19	0.5	0.87	0.303
D1119	S1119	137	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1119	1229	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.14	0.55	0.89
D1120	S1120	138	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1120	1230	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.19	0.63	0.72
D1121	SI 121	139	AfuGfuAfaccAfaGfaGfu Af uUfcCfasU f	AS1121	1231	aUfgGfaAfuAfcUfcUfuGfGfUfuAfcAfusGfsa	0.14	0.61	0.91
D1122	S1122	140	AfUfGfu Afa CfcAfaGf aGf u Afu UfccasUf	AS1122	1232	aUfGfGfaAfuAfcUfcUfuGfgUfuAfcausGfsa	0.14	0.54	0.95
D1123	51123	141	auGfuAfAfCfcAfaGfaGfuAfuUfcCfasUf	AS1123	1233	aUfgGfaAfuAfcUfcUfuGfguuAfcAfUfsGfsa	0.13	0.61	0.97
01124	S1124	142	AfuGfuAfaCfcAfaGfaGfuAfUfUfcCfasUf	AS1124	1234	aUfgGfaauAfcUfcUfuGfgUfuAfcAfusGfsa	0.14	0.56	0.94
DI 125	S1125	143	AfuGfuAfaCfcaaGfaGfuAfuUfcCfasUf	AS1125	1235	aUfgGfaAfuAfcUfcUfUfGfgUfuAfcAfusGfsa	0.21	0.74	0.95
01126	S1126	144	AfUfGfu Afa CfcAfaGfaGf u Afu ucCfasUf	AS1126	1236	a UfgGfAfAfu AfcUfcUfuGfgUf uAfca usGfsa	0.2	0.69	0.91
01127	S1127	145	Afugu AfAf CfcAfaGfaGf u Afu UfcCfasUf	AS1127	1237	a UfgGfaAfuAfcUfcUfuGfgu u Af CfAfusGfsa	0.17	0.7	0.96
01128	S1128	146	AfUfGfu Afa CfcAfaGfaGf uAfu UfcCfasUf	AS 1128	1238	aUfgGfaAfuAfcUfcUfuGfgUfuAfcausGfsa	0.19	0.62	0.85

D1129	S1129	147	AfuGfuAfaCfcAfaGfaGfuAfuUfCfCfasUf	AS1129	1239	aUfgga Afu AfcUfcUfuGfgUfu AfcAfusGfsa	0.23	0.76	0.98
D1130	S1130	148	AfuGfuAfaCfcAfagaGfu Afu UfcCfasUf	AS 1130	1240	aUfgGfa AfuAfcUfCfUfu GfgUfu AfcAfusGfsa	0.21	0.64	0.9
D1131	S1131	149	AfuGfuAfAfCfcaaGfaGfuAfuUfcCfasUf	AS1131	1241	aUfgGfaAfuAfcUfcUfüfGfguuAfcAfusGfsa	0.17	0.7	1.01
D1132	S1132	150	AfuGfUfAfaCfcAfa GfaGfu Afu UfcCfasUf	AS1132	1242	aUfgGfaAfuAfcUfcUfuGfgUfuacAfusGfsa	0.17	0.58	0.87
01133	51133	151	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfAfsUf	AS1133	1243	augGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.33	0.89	1.05
01134	S1134	152	AfUfGfuAfaCfcAfaGfaguAfuUfcCfasUf	AS1134	1244	aUfgGfa AfuAfCfUfcUfuGfgUfuAfcausGfsa	0.16	0.64	0,96
01135	51135	153	AfuGfUfAfaCfcAfaGfaguAfuUfcCfasUf	AS1135	1245	aUfgGfa Afu AfCfUfcUfu GfgUfu acAfusGfsa	0.12	0.53	0.96
01136	SI 136	154	AfuGfu AfAfCfcAfagaGfu Afu UfcCfasUf	AS1136	1246	aUfgGfa AfuAfcUfCfUfu Gfgu u AfcAfusGfsa	0.16	0.58	0.98
D1137	S1137	155	AfuGf u AfAfCfcAfaGfaGfuAfu UfcCfasUf	AS1137	1247	aUfgGfaAfuAfcUfcUfuGfguuAfcAfusGfsa	0.16	0.6	0.91
D1138	S1138	156	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1138	1248	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsAf	0.1	0.54	0.91
01139	S1139	157	AfUfGfuAfaCfcAfagaGfuAfuUfcCfasUf	AS1139	1249	aUfgGfaAfuAfcUfCfUfuGfgUfuAfcausGfsa	0.24	0.68	0.98
01140	51140	158	AfuGfUfAfaCfcAfagaGfuAfuUfcCfasUf	AS1140	1250	aUfgGfaAfuAfcUfCf UfuGfgUfua cAfu sGfsa	0.13	0.75	0.9
DI 141	S1141	159	AfuGfuAfAfCfcAfaGfaguAfuUfcCfasUf	AS1141	1251	aUfgGfaAfuAfCfUfcUfuGfguuAfcAfusGfsa	0.15	0.52	1.05
DI 142	SI 142	160	AfuGfuAfaCfCfAfaGfaGfuAfuUfcCfasUf	AS1142	1252	aUfgGfaAfuAfcUfcUfuggUfuAfcAfusGfsa	0.16	0.66	0.89
D1143	S1143	161	auGfu AfaCfcAfaGfa Gf u Afu UfcCfasUf	AS1143	1253	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfUfsGfsa	0.12	0.51	0.89
D1144	SI 144	162	AfUfGfuAfaCfcaaGfaGfuAfuUfcCfasUf	AS1144	1254	aUfgGfaAfuAfcUfcUfUfGfgUfuAfcausGfsa	0.25	0.71	0.95
D1145	SI 145	163	AfuGfUfAfaCfcaaGfaGfuAfuUfcCfasUf	AS1145	1255	aUfgGfaAfuAfcUfcUfUfGfgUfuacAfusGfsa	0.17	0.74	0.98
DI 146	51146	164	AfuguAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1146	1256	aUfgGfaAfuAfcUfcUfuGfgUfuAfCfAfusGfsa	0.11	0.51	0.86
DI 147	S1147	165	AfuGfuAfaCfcAfaGfaGfuAfuUfccasUf	AS1147	1257	aUfGfGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.1	0.52	0.83
D1148	S1148	166	AfUfGfuAfaccAfaGfaGfuAfuUfcCfasUf	AS1148	1258	aUfgGfaAfuAfcUfcUfuGfGfUfuAfcausGfsa	0.14	0.63	0.98
D1149	S1149	167	AfuGfuAfAfCfcAfaGfaGfuAfuucCfasUf	AS1149	1259	aUfgGfAfAfuAfcUfcUfuGfguuAfcAfusGfsa	0.13	0.58	0.88
DI 150	S1150	168	Afu Gfua aCfcAfaGfaGf u Af uUfcCfa sUf	AS1150	1260	aUfgGfaAfuAfcUfcUfuGfgUfUfAfcAfusGfsa	0.15	0.62	0.94
D1151	S1151	169	AfUfGfuaaCfcAfaGfaGfuAfuUfcCfasUf	AS1151	1261	aUfgGfaAfuAfcUfcUfuGfgUfUfAfcausGfsa	0.18	0.73	0.94
D1152	S1152	170	auGfUfAfaCfcAfaGfaGfu Afu UfcCfasUf	AS1152	1262	aUfgGfaAfuAfcUfcUfuGfgUfuacAfUfsGfsa	0.13	0.53	0.97
D1153	S1153	171	AfuGfu AfAfCfcAfa GfaGfu Af uUfccasUf	AS1153	1263	aUfGfGfaAfuAfcUfcUfuGfguuAfcAfusGfsa	0.13	0.53	0.98
01154	S1154	172	UfgGfgAfuUfuCfaUfgUfaAfcCfaAfgsAf	AS1154	1264	uCfuU fgGfuUfa CfaUfgAfaAf uCfcCfa sUfsc	0.09	0.5	0.78
D1155	S1155	173	UfgGf GfAfuu uCfa UfgUfAfAfcCfaAf gsAf	AS1155	1265	uCfuüfgGfuuaCfaUfgAfAfAfuccCfasUfsc	0.13	0.62	0.89

ιοο

D1156	S1156	174	UfgGfgAfu uu CfaUfGf UfaAfcCfa AfgsAf	AS1156	1266	uCfuUfgGfuUfacaUfgAfAfAfuCfcCfasUfsc	0.12	0.65	0.85
D1157	S1157	175	UfgGfgAfu UfuCfa UfgUfAfAfcCfaAfgsAf	AS1157	1267	uCfuUfgGfuuaCfaUfgAfaAfuCfcCfasUfsc	0.11	0.54	0.85
D1158	51158	176	UfgGfgAfu uu CfaUfgUfAfAfcCfaAfgsAf	AS1158	1268	uCfuUfgGfuuaCfaUfgAfAfAfuCfcCfasUfsc	0.13	0.53	0.8
D1159	S1159	177	UfGfggAfUf u UfcAfuGf uAfAfccAfAfgsAf	A51159	1269	uCfuuGfGfuuAfcAfuGaAfauCfCfcasUfsc	0.59	0.89	0.81
D116O	S1160	178	UfGfggAfUfuuCfaUfgUfAf AfcCfaAfgsAf	A51160	1270	uCfu UfgGfu uaCfaUfgAfAfa uCfCfcasUfsc	0.16	0.72	0.9
01161	51161	179	UfgGfgAfu UfucaUfGfUfaAfcCfaAfgsAf	AS1161	1271	uCfu UfgGfu UfacaUfGfAfaAfuCfcCfasUfsc	0.27	0.69	0.86
D1162	51162	180	AfuGfuAfaCfcaaGfaGfUfAfuUfcCfasUf	AS1162	1272	aUfgGfaAfuacUfcUfUfGfgUfuAfcAfusGfsa	0.12	0.6	0.95
D1163	S1163	181	AfuGfuAfaccAfaGfaGfuAfufufcCfasUf	AS1163	1273	aUfgGfaauAfcUfcUfuGfGfUfuAfcAfusGfsa	0.05	0.56	1.02
DI 164	S1164	182	AfuGfuAfaCfcAfagaGfUfAfuUfcCfasUf	AS 1164	1274	aUfgGfaAfuacUfCfUfuGfgUfuAfcAfusGfsa	0.13	0.55	1
DI 165	SI 165	183	AfuGfuAfaCfcaaGfaGfuAfUfUfcCfasUf	AS1165	1275	aUfgGfaauAfcUfcUfUfGfgUfuAfcAfusGfsa	0.09	0.6	0.97
01166	51166	184	AfuguAfaCfCfAfaGfaGfuAfuUfcCfasUf	AS1166	1276	aUfgGfaAfuAfcUfcUfuggUfuAfCfAfusGfsa	0.15	0.59	0.91
D1167	51167	185	AfuGfuAfaCfcAfaga Gfu AfUf UfcCfasUf	AS1167	1277	a UfgGfaau AfcUf CfUfuGfgUfuAfcAfusGfsa	0.11	0.59	1
01168	51168	186	AfuGfuAfaCfCfAfagaGfuAfuUfcCfasUf	AS1168	1278	aUfgGfaAfuAfcUfCfUfuggUfuAfcAfusGfsa	0.13	0.57	0.94
01169	S1169	187	auGfuAfaCfcAfaGfaGfuAfUfUfcCfasüf	AS1169	1279	a UfgGfaa uAfcUfcUfuGfgUfu AfcAfUfsGfsa	0.08	0.5	0.9
D1170	51170	188	AfuguAfaCfcAfaGfaGfuAfUf UfcCfasUf	AS1170	1280	a UfgGfaa uAfcUfcUfuGfgUfu AfCfAfusGfsa	0.06	0.53	0.91
D1171	S1171	189	auGfuAfaCfcAfaGfaGfuAfuUfCfCfasUf	AS1171	1281	a UfggaAf uAfcUfcUfuGfgUfu AfcAfUfsGfsa	0.07	0.56	0.89
D1172	51172	190	AfuGfuAfaCfCfAfaGfaGfuAfuucCfasUf	AS1172	1282	aUfgGfAfAfuAfcUfcUfuggUfuAfcAfusGfsa	0.13	0.59	0.98
D1173	51173	191	AfuGfuAfaCfcaaGfAfGfuAfuUfcCfasUf	AS1173	1283	aUfgGfaAfuAfcucUfUfGfgUfuAfcAfusGfsa	0.2	0.65	1.03
D1174	S1174	192	AfuGfuaaCfcAfaGfaGfuAfUfUfcCfasUf	AS1174	1284	aUfgGfaauAfcUfcUfuGfgUfUfAfcAfusGfsa	0.07	0.51	0.95
01175	51175	193	Afugu Afa CfcAfaGfaGfu AfuUfCfCfasUf	AS1175	1285	aUfggaAfuAfcUfcUfuGfgUfuAfCfAfusGfsa	0.2	0.53	0.76
D1176	S1176	194	a uGfu AfaCfcAfaGfa Gfu Afu UfcCfAfsUf	AS1176	1286	augGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.74	0.98	0.81
D1177	S1177	195	AfuGfuAfaCfcAfaGfaGfuAfu ucCfAfsUf	AS1177	1287	augGfAfAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.43	0.64	0.88
DI 178	S1178	196	auguaaccAfaGfaGfuAfiiUfcCfasUf	A51178	1288	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.17	0.49	0.81
D1179	S1179	197	AfuGfuaaCfcAfaGfaGfuAfuUfCfCfasUf	AS1179	1289	aUfggaAfuAfcUfcUfuGfgUfUfAfcAfusGfsa	0.22	0.65	0.73
01180	51180	198	AfuguAfaCfcAfaGfaGfuAfuUfcCfAfsUf	AS1180	1290	augGfaAfuAfcUfcUfuGfgUfuAfcAfUfsGfsa	0.6	1.09	0.8
D1181	51181	199	auGfuAfaCfcAfaGfaGfuAfuUfccasu	AS1181	1291	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.3	0.78	0.78
01182	51182	200	auguaaccaaGfaGfuAfuUfcCfasUf	AS1182	1292	a UfgGfa AfuAfcUfcUfuGfgUfu AfcAfusGfsa	0.3S	0.73	0.84

ΙΟΙ

D1183	S1183	201	AfuGfuAfaccAfaGfaGfuAfuUfCfCfasUf	AS1183	1293	aUfggaAfuAfcUfcUfuGfGfUfuAfcAfusGfsa	0.19	0.6	0.94
D1184	S1184	202	AfuGfuaaCfcAfaGfaGfu Af u UfcCfAfsUf	AS1184	1294	augGfaAfuAfcUfcUfuGfgUfuAfCfAfusGfsa	0.61	1.08	0.8
D1185	S1185	203	auGfuAfaCfcAfaGfaGfuAfuuccasu	AS1185	1295	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.16	0.52	0.72
D1186	S1186	204	auguaaccaagaGfuAfuUfcCfasUf	AS1186	1296	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.2	0.53	0.74
D1187	S1187	205	AfuGfu Afa CfcaaGfaGfu Afu UfCfCfasUf	A51187	1297	aUfggaAfuAfcUfcUfUfGfgUfuAfcAfusGfsa	0.34	0.66	0.85
D1188	51188	206	AfuGfuAfaccAfaGfa Gfu Af u UfcCfAfsUf	AS1188	1298	augGfaAfuAfcUfcUfuGfgUfUfAfcAfusGfsa	0.61	0.98	1.02
D1189	S1189	207	AfuGfuAfaCfcAfaGfaGfuAfuuccasu	AS1189	1299	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.3	0.73	0.85
D1190	S1190	208	auguaaccaagaguauuccasu	AS1190	1300	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.28	0.69	0.78
DI 191	S1191	209	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1191	1301	aUfgGfaAfuAfcUfcUfugdGudTadCadTsgsa	0.33	0.88	0.64
D1192	SI 192	210	AfuGfuAfaCfcAfagaGfuAfuUfCfCfasUf	AS1192	1302	aUfggaAfuAfcUfCfUfuGfgUfuAfcAfusGfsa	0.31	0.64	0.83
DI 193	S1193	211	AfuGfuAfaCfcaaGfaGfuAfuUfcCfAfsUf	AS1193	1303	augGfaAfuAfcUfcUfuGfGfUfuAfcAfusGfsa	0.64	0.82	0.92
D1194	SI 194	212	AfuGfuAfaCfcAfaGfaGfuauuccasu	AS1194	1304	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.21	0.62	0.77
01195	S1195	213	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1195	1305	aUfgGfaAfuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.17	0.7	0.95
DI 196	51196	214	AfuGfuAfaCfcAfaGfaguAfuUfCfCfasUf	AS1196	1306	aUfggaAfuAfCfUfcUfuGfgUfuAfcAfusGfsa	0.19	0.71	0.65
D1197	SI 197	215	AfuGfuAfaCfcAfagaGfuAfuUfcCfAfsUf	AS1197	1307	augGfaAfuAfcUfcUfüfGfgUfuAfcAfusGfsa	0.64	0.82	0.93
DI 198	SI 198	216	auguAfaCfcAfaGfaGfuAfuUfccasu	AS1198	1308	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.19	0.65	0.72
D1199	SI 199	217	AfuGfuAfaCfcAfaGfaGfuauUfCfCfasUf	AS1199	1309	aUfggaAfUfAfcUfcUfuGfgUfuAfcAfusGfsa	0.15	0.52	0.64
D1200	S1200	218	AfuGfu AfaCfcAfaGfaguAfuUfcCfAfsUf	AS1200	1310	augGfaAfuAfcUfCfUfuGfgUfuAfcAfusGfsa	0.48	0.74	0.92
01201	$1201	219	auguAfaCfcAfaGfaGfuAfuUfcCfasu	AS1201	1311	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.17	0.71	0.77
01202	S1202	220	AfuGfuAfaCfcAfaGfaGfuauUfcCfAfsUf	AS1202	1312	augGfaAfuAfCfUfcUfuGfgUfuAfcAfusGfsa	0.43	0.69	0.85
D1203	S1203	221	auguaaCfcAfaGfaGfuAfuUfcCfasUf	AS1203	1313	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.14	0.61	0.76
D1204	S1204	222	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1204	1314	adTdGGfaAfudAdCUfcUfuGfgUfuAfcAfusGfsa	0.16	0.56	0.89
D1205	S120S	223	AfuGf uAfaCfcAfaGfaGfdTdAdT dTcCfasUf	AS 1205	1315	aUfgGfdAdAdTdAcUfcUfuGfgUfuAfcAfusGfsa	0.13	0.57	0.9
D1206	S1206	224	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1206	1316	adTdGdG dAAf uAfcUfcUf uGfgUfu AfcAfusGfsa	0.29	0.73	0.89
01207	S1207	225	AfuGfu AfaCfcAfaGfaGfuAfuUfcCfasUf	AS1207	1317	adTdGGfaAfuAfdCdTcUfuGfgUfuAfcAfusGfsa	0.16	0.56	0.78
D1208	S1208	226	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1208	1318	a UfdG dGd AdAu AfcUfcUfuGfgUfu AfcAfusGfsa	0.22	0.67	0.89
D1209	S1209	227	AfuguAfaccAfaGfaGfu Af u UfcCfasUf	AS1209	1319	aUfgGfaAfuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.14	0.55	0.78

102

D1210	S1210	228	AfuGfuAfaCfcAfaGfaGfuAfu UfcCfasUf	AS1210	1320	aUfgdGdAdAdTAfcUfcUfuGfgUfuAfcAfusGfsa	0.14	0.5	0.84
D1211	S1211	229	AfuGfu AfaCfcAfaGfaGfuAfu UfcCfasUf	AS1211	1321	aUfgGfadAdTdAdCUfcUfuGfgUfuAfcAfusGfsa	0.14	0.59	0.72
D1212	S1212	230	auguaaccaaGfaGfuAfuUfcCfasUf	AS1212	1322	aUfgGfaAfuAfcUfcUfugdGudTadCadTsgsa	0.21	0.74	0.77
D1213	S1213	231	AfuGfuAfaCfcAfaGfaGfuAfudTdCdCdAsUf	AS1213	1323	adTdGdGdAAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.15	0.53	0.91
D1214	S1214	232	aUfgUfaAfcCfaAfgAfgUfaUfuCfcAfsu	AS1214	1324	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.12	0.71	0.87
D1215	S1215	233	AfuGfuAfaCfcAfaGfaGfuAfdTdTdCdCasUf	AS1215	1325	aUfdGdGdAdAuAfcUfcUfuGfgUfuAfcAfusGfsa	0.18	0.67	0.97
D1216	S1216	234	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1216	1326	aUfgGfaAfuacucuuggUfuAfcAfusgsa	0.36	0.87	1.07
D1217	S1217	235	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1217	1327	aUfgGfaAfuAfCfUfCfUfuGfGfuuAfcAfusgsa	0.37	0.73	1.03
D1218	S1218	236	AfUfguAfAfccAfAfgaGfUfauUfCfcasUf	AS1218	1328	aUfGfgaAfUfacUfCfuuGfGfuuAfCfausGfsa	0.23	0.42	0.84
D1219	S1219	237	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1219	1329	aUfgGfaAfuaCfUfcUfUfgGfuuAfcAfusgsa	0.43	0.71	1.03
D1220	S1220	238	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1220	1330	aUfgGfaAfuAfcUfCfUfuGfGfuuAfcAfusgsa	0.37	0.63	0.99
01221	S1221	239	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1221	1331	aUfgGfaAfuAfcUfCfUfuGfGfuUfacAfusgsa	0.29	0.84	0.88
D1222	S1222	240	AfuGfuAfaccaagaguAfuUfcCfasUf	AS1222	1332	a UfgGfaAf ua Cfu CfuUfgGfuuAfcAf usgsa	0.31	0.8	0.99
D1223	S1223	241	auGfuAfAfccAfaGfagUfaUfUfcCfasUf	AS1223	1333	aUfgGfaaUfaCfUfcUfuGfGfuuAfcAfAfsgsa	0.09	0.52	0.82
D1224	S1224	242	AfuGfuAfaccaagaguAfuUfcCfasUf	AS 1224	1334	a UfgGfaAfuadCu dCudïgdGuu AfcAfusgsa	0.22	0.79	1
D1225	S1225	243	auGfuaAfccAfagAfguAfuuCfcasUf	AS1225	1335	aUfGfgAfAfuAfCfuCfUfuGfGfuUfAfcAfUfsGfsa	0.31	0.76	0.84
D1226	S1226	244	AfuGfu AfaccaagaguAfu UfcCfasUf	AS1226	1336	aUfgGfaAfuadCUfcdTUfgdGuuAfcAfusgsa	0.26	0.64	0.87
D1227	S1227	245	augUfaacCfaagAfguaUfuccAfsu	AS 1227	1337	aUfgGfAfaUfAfCfuCfUfUfgGfUfUfaCfAfUfsGfsa	0.33	0.79	0.81
D1228	S1228	246	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1228	1338	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.464	0.932	0.978
D1229	S1229	247	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS 1229	1339	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.453	1.047	1.178
D1230	S1230	248	AfuGfuAfaCfcAfaGfaGfuAfu UfcCfasUf	AS 1230	1340	aUfgGfaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.831	0.967	1.151
D1231	S1231	249	auGfu AfAf CfcAfaGfaGfu Afu UfcCfasu	AS 1231	1341	AfüfgGfaAfuAfcUfcUfuGfguuAfcAfUfsGfsa	0.09	0.5	1.07
D1232	S1232	250	AfuGfu AfaCfCfAfaGfaGfu Afu UfcCfasu	AS1232	1342	AfUfgGfaAfuAfcUfcUfuggUfuAfcAfusGfsa	0.11	0.54	1.1
D1233	S1233	251	AfuGfuAfaCfcAfaGfaGfuAfu UfCf Cfasu	AS 1233	1343	Af UfggaAfuAfcUfcUf uGfgU fuAfcAfusGfsa	0.19	0.61	0.74
D1234	S1234	252	aUfgUfaAfcCfaAfgAfgUfaUfuCfcAfsu	AS1234	1344	AfuGfgAfaUfaCfuCfuUfgGfuUfaCfaUfsgsAf	0.22	0.61	0.98
D1235	S1235	253	aUfgUfaAfcCfaAfgAfgUfaUfuCfcAfsu	AS 1235	1345	AfuGfgAfaUfaCfuCfuUfgGfuUfaCfaUfsgsAf	0.27	0.69	0.92
D1236	S1236	254	AfuGfuAfa CfcAfaGfaGfu AfuUfcCfasUf	AS1236	1346	AfuGfgAfaUfaCfuCfuUfgGfuUfaCfaUfsgsAf	0.54	1.08	0.8

103

D1237	S1237	255	augUfaAfccaAfgAfguaUfuCfcasu	AS 1237	1347	AfUfGfgAfaUfAfCfuCfuUfGfGfuUfaCfAfUfsgsa	0.29	0.61	0.79
D1233	S1238	256	AfugUfaAfccaAfgAfguaUfuCfcasu	AS1238	1348	AfUfGfgAfaUfAfCfuCfuUfGfGfuUfaCfAfusgsa	0.31	0.6	0.88
D1239	S1239	257	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1239	1349	dAUdGGdAauAfclIfcUfuGfgUfuAfcAfusGfsa	0.2	0.67	0.85
D1240	S1240	258	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1240	1350	dAUdGgdAauAfcUfcUfuGfgüfuAfcAfusGfsa	0.23	0.58	0.68
D1241	S1241	259	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS 1241	1351	dAudGgdAauAfcUfcüfuGfgUfuAfcAfusGfsa	0.25	0.65	0.78
01242	S1242	260	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1242	1352	d AU dGgdAa dTAfcUfcUf uGfgUf u AfcAfusGfsa	0.18	0.64	0.84
D1243	S1243	261	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS 1243	1353	dAUdGGdAAfuAfcUfcUfuGfGfUfuAfCfAfusGfsa	0.19	0.72	0.87
D1244	S1244	262	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS 1244	1354	dAUdGgdAadTAfdCUfcUfuGfgUfuAfcAfusGfsa	0.16	0.55	0.8
D1245	S1245	263	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1245	1355	dAUdGGdAAuAfcUfcUfuGfgUfuAfcAfusGfsa	0.22	0.51	0.9
D1246	S1246	264	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS 1246	1356	dAudGgdAadTAfcUfcUfuGfgUfuAfcAfusGfsa	0.27	0.78	0.66
D1247	S1247	265	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfasUf	AS1247	1357	dAdTdGdGaAfuAfcUfcUfuGfgUfuAfcAfusGfsa	0.16	0.57	0.97
D1248	S1248	266	AfacaAfuguUfcUfuGfdCUdCudAudAsa	AS 1248	1358	dTUdAudAgdAGfcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.09	0.36	0.0047
D1249	S1249	267	AfaCfaGfuGfuUfcUfuGfCfUfcUfaUfasa	AS1249	1359	UfUfaUfaGfagcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.10	0.47	0.005
D1250	S1250	268	AfaCfaGfuGfu UfcUfugcUfc UfAfUfasAf	AS1250	1360	uUfa uaGfaGfCfAfa G fa AfcAfcUfgUfus Ufsu	0.07	0.14	0.55	0.005
D1251	S1251	269	AfaCfaGfuGfuUfcUfuGfcucUfAfUfasAf	AS1251	1361	uUfauaGfAfGfcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.14	0.49	0.006
D12S2	S1252	270	CAGuGuucuuGcucuAuAAdTdT	AS1252	1362	UuAuAGAGcAAGAAcACUGdTdT				0.006
D1253	51253	271	AfaCfaGfuGfuUfcUfugcUfCfUfaUfasAf	AS1253	1363	uUfaUfagaGfCfAfaGfaAfcAfcUfgUfusUfsu	0.05	0.12	0.43	0.006
D1254	S1254	272	AfaCfaGfuGfuUfCfUfuGfcUfcUfaUfasa	AS1254	1364	UfUfaUfaGfaGfcAfagaAfcAfcUfgUfusUfsu	0.06	0.13	0.39	0.006
D1255	S1255	273	AfaCfaGfuGfu UfcUfuGfcUfCfUfaUfasa	AS1255	1365	UfUfaUfagaGfcAfaGfaAfcAfcUfgUfusUfsu	0.08	0.17	0.48	0.007
D1256	S1256	274	AfaCfaGfuGfuUfcUfUfGfcUfcUfaUfasa	AS1256	1366	UfUfaUfaGfaGfcaaGfaAfcAfcUfgUfusUfsu	0.08	0.14	0.40	0.007
D12S7	S12S7	275	AfaCfaGfuGfuUfcUfuGfcUfCfUfaUfasAf	AS1257	1367	uUfaUfagaGfcAfaGfaAfcAfcUfgUfusUfsUf	0.07	0.12	0.40	0.007
D1258	51258	276	AfaCfaguGfuUfCfUfuGfcUfcUfaUfasAf	AS1258	1368	uUfaUfaGfaGfcAfagaAfcAfCfUfgUfusUfsu	0.08	0.13	0.41	0.007
01259	S1259	277	AfaCfAfGfuGfuUfcUfuGfcucUfaUfasAf	AS1259	1369	uUfaUfaGfAfGfcAfaGfaAfcAfcugUfusUfsu	0.05	0.11	0.35	0.008
01260	S1260	278	AfacaGfuGfuUfCfUfuGfcUfcUfaUfasAf	AS1260	1370	uUfaUfaGfaGfcAfagaAfcAfcUfGfUfusUfsu	0.06	0.12	0.40	0.008
D1261	S1261	279	Afaca GfuGfuUfcUfuGfcUfCfUfa UfasAf	AS1261	1371	uUfaUfagaGfcAfaGfaAfcAfcUfGfüfusUfsu	0.06	0.13	0.42	0.008
D1262	S1262	280	AfaCfaGfuGfuUfcUfuGfcucUfaUfasAf	AS1262	1372	uUfaUfaGfAfGfcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.13	0.37	0.008
D1263	S1263	281	CAGuGuucuuGcucuAuAAdTdT	AS1263	1373	UuAuAGAGcAAGAAcACUGdTdT				0.008

104

D1264	S1264	282	AfaCfaGfuGfuUfcUfuGfCfUfcUfauasAf	AS1264	1374	uUfAfUfaGfagcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.12	050	0.008
D1265	S1265	283	AfaCfaGfuguUfCfUfuGfcUfcUfaUfasAf	AS1265	1375	uUfaUfaGfaGfcAfagaAfCfAfcUfgUfusUfsu	0.12	0.13	0.48	0.009
D1266	S1266	284	AfacaGfuGfuUfcUfuGfcUfcUfAfUfasAf	AS1266	1376	uUfauaGfaGfcAfaGfaAfcAfcUfGfUfiisUfsu	0.07	0.15	0.51	0.009
D1267	S1267	285	AfacaAfuguUfcUfuGfdCudCudAudAsa	AS1267	1377	dTudAudAgdAGfcAfaGfaAfcAfcAfgUfusUfsu	0.06	0.14	0.48	0.0088
D1268	S1268	286	AfaCfaGfuGfuUfCfUfuGfcucUfaUfasAf	AS1268	1378	uUfaUfaGfAfGfcAfagaAfcAfcUfgUfusUfsu	0.05	0.09	0.35	0.009
01269	S1269	287	CAGuGuucuuGcucuAuAAdTdT	AS1269	1379	UuAuAGAGcAAGAAcACUGdTdT				0.009
D1270	S1270	288	aaCfaGfuGfuUfcUfuGfcUfCfUfaUfasAf	AS1270	1380	uUfa UfagaGfcAfaGfaAfcAfcUfgUf UfsUfsu	0.07	0.14	0.49	0.009
D1271	S1271	289	AfaCfaGfUfGfuUfcUfuGfcucUfaUfasAf	AS1271	1381	uUfaUfaGfAfGfcAfaGfaAfcacUfgUfusUfsu	0.06	0.10	0.36	0.009
D1272	S1272	290	CAGuGuucuuGcucuAuAAdTdT	AS1272	1382	UuAuAGAGcAAGAAcACUGdTdT				0.009
D1273	S1273	291	AfaCfaGfUfGfuUfcUfuGfcUfcUfaUfasAf	AS1273	1383	uUfaUfaGfaGfcAfaGfaAfcacUfgUfusUfsUf	0.06	0.13	0.51	0.009
D1274	S1274	292	AfaCfaGfuGfuUfCfUfuGfcUfcuaUfasAf	AS1274	1384	uUfa UfAfGfaGf cAfaga AfcAfcUfgUfusUfsu	0.06	0.12	0.46	0.010
D1275	S1275	293	cAGuGuucuuGcucuAuAAdTdT	AS1275	1385	UuAuAGAGcAAGAAcACUGdTdT				0.010
D1276	S1276	294	AfaCfaGfuGfuUfCfUfuGfcUfcUfauasAf	AS1276	1386	uUfAfUfaGfaGfcAfagaAfcAfcUfgUfusUfsu	0.06	0.14	0.47	0.010
D1277	S1277	295	AfaCfaguGfuUfcUfuGfcUfCfUfaUfasAf	AS1277	1387	u Ufa UfagaGfcAfaGfa AfcAfCfUfgUfusUfsu	0.07	0.15	0.50	0.010
D1278	S1278	296	AfaCfaGfuGfuUfCfUfugcUfcUfaUfasAf	AS1278	1388	u Ufa UfaGfaGfCfAfaga AfcAfcUfgU f usUfsu	0.06	0.13	0.43	0.010
D1279	S1279	297	CAGuGuucuuGcucuAuAAdTdT	AS1279	1389	UuAuAGAGcAAGAAcACUGdTdT				0.010
D1280	S1280	298	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfasa	AS1280	1390	Uf Ufa UfaGfaGfcAfaGfa AfcAfcUfgUf usu su	0.06	0.14	0.45	0.010
D1281	S1281	299	AfaCfAfGfuGfuUfcUfuGfcUfcUfaUfasa	AS1281	1391	UfUfaUfaGfaGfcAfaGfaAfcAfcugUfusUfsu	0.07	0.18	0.46	0.011
D1282	S1282	300	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1282	1392	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.15	0.55	0.011
D1283	S1283	301	AfaCfaGfuGfu U fcUfuGfcucUfa UfasAf	AS1283	1393	uUfaUfaGfAfGfcAfaGfaAfcAfcUfgUfususu	0.07	0.12	0.45	0.011
D1284	S1284	302	AfacaGfuGfuUfcUfuGfcUfcUfa UfasAf	AS1284	1394	uUfaUfaGfaGfcAfaGfaAfcAfcUfGfUfusUfsu	0.06	0.13	0.48	0.011
D1285	S1285	303	AfAfCfaGfuGfuUfcUfuGfcucUfaUfasAf	AS1285	1395	uUfaUfaGfAfGfcAfaGfaAfcAfcUfguusUfsu	0.06	0.11	0.40	0.011
D1286	S1286	304	AfaCfAfGfuGfuUfcUfuGfcUfcUfauasAf	AS1286	1396	uUfAfUfaGfaGfcAfaGfaAfcAfcugUfusUfsu	0.06	0.16	0.47	0.011
D1287	S1287	305	AfaCfaGfuGfu UfcUfugcUfcUfaUfasAf	AS1287	1397	uUfaUfaGfaGfCfAfaGfaAfcAfcUfgUfususu	0.07	0.19	0.46	0.012
D1288	S1288	306	AfaCfaGfuGfuUfcUfugcUfcUfa UfasAf	AS1288	1398	uUfaUfaGfaGfCfAfaGfaAfcAfcUfgUfusUfsu	0.06	0.17	0.46	0.012
D1289	S1289	307	AfaCfaGfuGfuUfcUfUfGfcucUfa UfasAf	AS1289	1399	uUfaUfaGfAfGfcaaGfaAfcAfcUfgUfusUfsu	0.05	0.09	0.31	0.012
D1290	S1290	308	AfAfCfaGfuGfuUfcUfuGfcUfcUfaUfasa	AS 1290	1400	UfUfaUfaGfaGfcAfaGfaAfcAfcUfguusUfsu	0.06	0.16	0.49	0.013

105

D1291	S1291	309	AfaCfaGfuGfuUfCfUfuGfcUfcUfaUfasAf	AS1291	1401	uUfa UfaGfaGfcAfaga AfcAfcUfgUfusUfsUf	0.06	0.11	0.32	0.013
D1292	51292	310	AfaCfAfGfuGfuUfcUfugcUfcUfaUfasAf	AS 1292	1402	uUfa UfaGfaGfCfAfaGfa AfcAfcugUfusUfsu	0.06	0.14	0.44	0.013
D1293	S1293	311	AfaCfaGfUfGfuUfcUfuGfcUfcUfaUfasa	AS1293	1403	UfUfaUfaGfaGfcAfaGfaAfcacUfgUfusUfsu	0.07	0.16	0.39	0.013
D1294	51294	312	AfaCfAfGfuGfuUfcUfuGfcUfcuaUfasAf	AS1294	1404	u U fa UfAfGfaGfcAfaGfa AfcAfcugUfusUfsu	0.07	0.18	0.41	0.014
01295	51295	313	AfaCfaGfUfGfuüfcUfuGfcUfcuaUfasAf	AS1295	1405	uU fa UfAfGfaGfcAfaGfa AfcacUfgUfusUfsu	0.07	0.18	0.47	0.014
D1296	S1296	314	adAdCagdTdGuudCdTugdCdTcudAdTasa	AS 1296	1406	dTdTaudAdGagdCdAagdAdAcadCdTgucfTsdTsu	0.12	0.21	0.68	0.0146
D1297	S1297	315	AfacaGfUfGfuUfcUfuGfcUfcUfaUfasAf	AS1297	1407	uUfaUfaGfaGfcAfaGfaAfcacUfGfUfusUfsu	0.06	0.15	0.50	0.016
D1298	S1298	316	AfaCfaGfUfGfuUfcUfuGfcUfcUfauasAf	AS1298	1408	uUfAfUfaGfaGfcAfaGfaAfcacUfgUfusUfsu	0.08	0.17	0.50	0.016
D1299	S1299	317	AfaCfaguGfuüfcUfuGfcUfcUfaUfasAf	AS1299	1409	u Ufa UfaGfaGfcAfaGfaAfcAfCfUfgUfususu	0.07	0.16	0.50	0.018
01300	51300	318	AfaCfaGfuGfuUfcUfUfGfcUfcUfauasAf	AS 13 00	1410	uUfAfUfaGfaGfcaaGfaAfcAfcUfgUfusUfsu	0.06	0.12	0.43	0.020
D1301	S1301	319	AfaCfaGfUfGfuUfcUfugcUfcUfaUfasAf	AS1301	1411	uUfaUfaGfaGfCfAfaGfa AfcacUfgUfusUfsu	0.07	0.17	0.45	0.021
01302	51302	320	AfaCfaGfuguUfcUfUfGfcUfcUfa UfasAf	AS1302	1412	uUfaUfaGfaGfcaaGfaAfCfAfcUfgUfusUfsu	0.06	0.14	0.49	0.021
D1303	51303	321	AfAfCfaguGfuUfcUfuGfcUfcUfaUfasAf	AS1303	1413	uUfaUfaGfaGfcAfaGfaAfcAfCfUfguusUfsu	0.07	0.24	0.51	0.022
01304	51304	322	AfaCfaGfuGfuucUfuGfcUfcU fa UfasAf	A51304	1414	uUfaUfaGfaGfcAfaGfAfAfcAfcUfgUfususu	0.09	0.27	0.47	0.033
01305	S1305	323	aadCdAgudGdTucdTdTgcdTdCuadTdAsa	AS1305	1415	udïadTdAgadGdCaadGdAacdAdCugdTdTsusu	0.19	0.36	0.86	0.045
01306	S1306	324	AfacaGfuguUfcUfuGfdCUdCUdAudAsa	AS1306	1416	dTU dAUd AGfaGfcAfaGfa AfCfAfcUfGf UfusUf su	0.08	0.22	0.61
01307	S1307	325	AfacaGfuguUfcUfdTGfdCUdCUdAudAsa	AS1307	1417	dTUdAUdAGfaGfcAfaGfaAfCfAfcUfGfUfusUfsu	0.13	0.39	0.84
01308	S1308	326	AfacaGfuguUfcUfuGfdCUdCUdAudAsa	AS1308	1418	dTUdAUdAgdAGfcAfaGfaAfcAfcUfgUfusUfsu	0.09	0.13	0.48
01309	51309	327	AfacaGf ugu UfcUf dTGfdCUdCU dAudAsa	AS1309	1419	dTUdAUdAgdAGfdCAfaGfaAfcAfcUfgUfusUfsu	0.07	0.13	0.58
01310	S1310	328	AfacaAfuguUfcUfdTGfdCUdCudAudAsa	AS 1310	1420	dTU dAudAgdAGfdCAfaGfa AfcAfcAfgUfusUfsu	0.07	0.14	0.55
D1311	S1311	329	AfaCfaAfuGfuUfcUfuGfcUfcUfdAdTdAsdA	AS1311	1421	dTdTdAdTaGfaGfcAfaGfaAfcAfcAfgUfusUfsu	0.10	0.30	0.66
01312	S1312	330	AfacaGfuguUfcUfuGfdCUdCUdAudAsa	AS1312	1422	dTUdAUdAgdAGfcAfaGfaAfcAfcUfgUfusUfsu	0.09	0.13	0.48
D1313	51313	331	AfAfCfaGfuGfuucUfuGfcUfcUfaUfasAf	AS1313	1423	uUfaUfaGfaGfcAfaGfAfAfcAfcUfguusUfsu	0.14	0.38	0.74
D1314	S1314	332	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1314	1424	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.19	0.54
D1315	51315	333	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1315	1425	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.15	0.55
D1316	51316	334	AfaCfaGfuGfuUfcUfuGfcUfcUfauasAf	AS1316	1426	uUfAfUfaGfaGfcAfaGfaAfcAfcUfgUfususu	0.07	0.16	0.53
D1317	S1317	335	AfacaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1317	1427	uUfaUfaGfaGfcAfaGfaAfcAfcUfGfUfususu	0.07	0.16	0.55

106

D1318	51318	336	AfAfCfaGfuguUfcUfuGfcUfcUfaUfasAf	AS1318	1428	uUfaUfaGfaGfcAfaGfaAfCfAfcUfguusUfsu	0.10	0.32	0.61
D1319	S1319	337	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1319	1429	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfususu	0.08	0.16	0.53
01320	51320	338	AfaCfaGfuGfuUfcUfuGfcUfcUfa UfasAf	AS 1320	1430	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfususu	0.08	0.16	0.61
D1321	S1321	339	AfaCfaGfuGfuUfcUfuGfcUfCfUfaUfasAf	AS1321	1431	uUfaUfagaGfcAfaGfaAfcAfcUfgüfusUfsu	0.06	0.14	0.58
01322	S1322	340	AfaCfaGfuGfuUfcuuGfcUfcUfaUfasAf	AS1322	1432	uUfaUfaGfaGfcAfAfGfaAfcAfcUfgUfus Ufsu	0.15	0.49	0.84
D1323	S1323	341	AfaCfaGfuGfuUfcUfuGfcUfcuaUfasAf	AS1323	1433	uUfaUfAfGfaGfcAfaGfaAfcAfcUfgUfususu	0.07	0.20	0.62
D1324	S1324	342	AfAfCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS 1324	1434	uUfaUfaGfaGfcAfaGfaAfcAfcUfguusUfsu	0.08	0.25	0.78
D1325	S1325	343	AfAfCfaGfuGfuUfcUfuGfcUfcUfaUfasAf	AS 1325	1435	uUfaUfaGfaGfcAfaGfaAfcAfcUfguusUfsu	0.08	0.18	0.80
D1326	S1326	344	Afa CfaGfuGfuUfcUfuGfcUfcUfAf UfasAf	AS 1326	1436	uüfauaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.07	0.21	0.66
D1327	S1327	345	AfaCfaGfuGfuucUfuGfcUfcUfaUfasAf	AS 1327	1437	uUfaUfaGfaGfcAfaGfAfAfcAfcUfgUfusUfsu	0.10	0.31	0.70
D1328	51328	346	AfAf CfaGfuGfu UfcUfuGfcUfcUfau asAf	AS 1328	1438	uUfAfUfaGfaGfcAfaGfaAfcAfcUfguusUfsu	0.07	0.15	0.55
D1329	51329	347	AfaCfAfGfuGfuUfcUfuGfcUfcUfaUfasAf	AS 13 29	1439	uUfaUfaGfaGfcAfaGfaAfcAfcugUfusUfsu	0.08	0.19	0.71
D1330	S1330	348	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfAfsAf	AS1330	1440	uuaUfa GfaGfcAfaGfa AfcAf cU fgUfusUfsu	0.09	0.27	0.76
01331	S1331	349	AfaCfaGfuguUfcUfuGfcUfcUfaUfasAf	AS1331	1441	u Ufa UfaGfaGfcAfaGfaAf CfAfcUfgUfusUfsu	0.07	0.21	0.65
D1332	S1332	350	AfAfCfaGfuGfuUfcUfuGfcUfcuaUfasAf	AS1332	1442	uUfaUfAfGfaGfcAfaGfaAfcAfcUfgiiusUfsu	0.07	0.17	0.53
D1333	S1333	351	AfaCfaGfUfGfuUfcUfuGfcUfcUfaUfasAf	AS1333	1443	uUfaUfaGfaGfcAfaGfaAfcacUfgUfusUfsu	0.08	0.25	0.73
D1334	S1334	352	AfaCfaguGfuUfcUfuGfcUfcUfaUfasAf	AS1334	1444	uUfaUfaGfaGfcAfaGfaAfcAfCfUfgUfusUfsu	0.07	0.18	0.54
01335	S1335	353	AfaCfaGfuGfuUfcuuGfcUfcUfaUfasAf	AS1335	1445	uUfa UfaGfaGfcAfAfGfaAfcAfcUfgUf ususu	0.14	0.38	0.57
D1336	S1336	354	AfaCfaGfuGfUfUfcUfuGfcUfcUfa UfasAf	AS1336	1446	uUfaUfaGfaGfcAfaGfaacAfcUfgUfusUfsu	0.16	0.50	0.96
D1337	S1337	355	AfaCfaGfuGfuUfcUfuGfcUfcU fa uas Af	AS1337	1447	uUfAfUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.08	0.19	0.54
D1338	S1338	356	AfAfCfaGfuGfuUfcUfugcUfcUfaUfasAf	AS1338	1448	uUfaUfaGfaGfCfAfaGfaAfcAfcUfguusUfsu	0.08	0.20	0.69
D1339	S1339	357	AfaCfaGfuGfuUfCfUfuGfcUfcUfaUfasAf	AS1339	1449	uUfaUfaGfaGfcAfagaAfcAfcUfgUfusUfsu	0.07	0.16	0.55
D1340	S1340	358	AfaCfaGfuGfuUfcUfuGfcUfcuaUfasAf	AS 1340	1450	uUfaUfAfGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.08	0.17	0.57
D1341	S1341	359	AfaCfaGfuguUfcUfu GfcUfcUfa UfasAf	AS 1341	1451	uUfaUfaGfaGfcAfaGfaAfCfAfcUfgUfususu	0.08	0.22	0.63
D1342	S1342	360	AfAfCfaGfuGfuUfcuuGfcUfcUfaUfasAf	AS1342	1452	uUfaUfaGfaGfcAfAfGfaAfcAfcUfguusUfsu	0.21	0.56	0.86
D1343	S1343	361	AfacaGfuGfUfUfcUfuGfcUfcUfa UfasAf	AS1343	1453	uUfaUfaGfaGfcAfaGfaacAfcUfGfUfusUfsu	0.14	0.37	0.73
01344	S1344	362	AfaCfaGfuGfuucUfUfGfcUfcUfaUfasAf	AS1344	1454	uUfaUfaGfaGfcaaGfAfAfcAfcUfgUfusUfsu	0.08	0.20	0.66

107

D1345	S1345	363	AfaCfAfGfuGfuUfcuuGfcUfcUfaUfasAf	AS1345	1455	uUfa UfaGfaGfcAfAfGfaAfcAfcugUfusUfsu	0.12	0.34	0.73
01346	51346	364	AfaCfaGfuGfUfUfcUfuGfcUfcUfauasAf	AS1346	1456	uUfAfUfaGfaGfcAfaGfaacAfcUfgUfusUfsu	0.16	0.42	0.90
01347	S1347	365	AfaCfaGfuGfUfUfcUfuGfcUfcUfaUfasAf	AS1347	1457	uUfaUfaGfaGfcAfaGfaacAfcUfgUfusUfsUf	0.17	0.43	0.85
01348	S1348	366	AfaCfAfGfuGfuucUfuGfcUfcUfaUfasAf	AS1348	1458	uUfaUfaGfaGfcAfaGfAfAfcAfcugUfusUfsu	0.08	0.21	0.58
01349	S1349	367	AfaCfaGfuGfUfUfcUfuGfcUfcuaUfasAf	AS1349	1459	uUfaUfAfGfaGfcAfaGfaacAfcUfgUfusUfsu	0.21	0.39	0.88
D135O	S1350	368	AfaCfaguGfuUfcUfUfGfcUfcUfaUfasAf	AS1350	1460	uUfaUfaGfaGfcaaGfaAfcAfCfUfgUfusUfsu	0.06	0.13	0.52
01351	S1351	369	AfaCfAfGf ugu UfcUfuGfcUfcUfaUfasAf	AS1351	1461	uUfaUfaGfaGfcAfaGfaAfCfAfcugUfusUfsu	0.08	0.21	0.58
D1352	S1352	370	AfaCfaGf UfGfu Ufcuu GfcUfcUfaUfasAf	AS1352	1462	uUfaUfaGfaGfcAfAfGfaAfcacUfgUfusUfsu	0.18	0.49	0.84
D1353	51353	371	AfaCfaGf uGfUfUfcUfuGfcucUfaUfasAf	AS1353	1463	uUfaUfaGfAfGfcAfaGfaacAfcUfgUfusUfsu	0.11	0.25	0.68
D1354	S1354	372	AfacaGfuGfuUfcUfUfGfcUfcUfaUfasAf	AS1354	1464	uUfaUfaGfaGfcaaGfaAfcAfcUfGfüfusUfsu	0.07	0.15	0.52
D1355	S1355	373	AfaCfaGfUfGfuucUfu GfcUfcUfaUfasAf	AS1355	1465	uUfaUfaGfaGfcAfaGfAfAfcacUfgUfusUfsu	0.10	0.26	0.63
D1356	S1356	374	AfaCfaGfuGfUfUfcUfugcUfcUfaUfasAf	AS1356	1466	uUfa UfaGfaGfCfAfaGfaacAfcU fgUfusUfsu	0.16	0.33	0.79
D1357	S1357	375	Afa CfAfGfuGfu UfcUfuGfcUfcUfaUfasAf	AS1357	1467	uUfaUfaGfaGfcAfaGfaAfcAfcugUfusUfsUf	0.09	0.19	0.51
D1358	51358	376	Afa CfaGfuGfUf U fcuuGfcUfcUfaUfasAf	AS1358	1468	uUfaUfaGfaGfcAfAfGfaacAfcUfgUfusUfsu	0.22	0.48	0.71
D1359	S1359	377	AfaCfaGfuGfuUfcUfüfGfcUfcUfaUfasAf	AS1359	1469	uUfaUfaGfaGfcaaGfaAfcAfcUfgUfusUfsUf	0.10	0.17	0.61
D1360	S1360	378	AfaCfaguGfUfUfcUfuGfcUfcUfaUfasAf	AS1360	1470	uUfa UfaGfaGfcAfaGfaacAfCf UfgUfusU fsu	0.14	0.40	0.87
01361	S1361	379	Afa CfaGfuGfu UfcUf UfGfcUfcuaUf asAf	AS1361	1471	uUfaUfAfGfaGfcaaGfaAfcAfcUfgUfusUfsu	0.07	0.14	0.52
D1362	S1362	380	aa CfaGfuGfu UfcUfuGfCfUfcUfaUfasAf	AS1362	1472	uUfaUfaGfagcAfaGfaAfcAfcUfgUfUfsUfsu	0.10	0.28	0.81
01363	S1363	381	Afa CfaGfuGfu ucUfuGfcUfcUfAf U fasAf	AS 1363	1473	uUfauaGfaGfcAfaGfAfAfcAfcUfgUfusUfsu	0.06	0.16	0.68
01364	51364	382	AfaCfaGfuGfuUfcUfugcUfcUfaUfAfsAf	AS1364	1474	uua UfaGfaGfCfAfaGfaAfcAfcUfgUfusUfsu	0.09	0.26	0.67
01365	51365	383	aacaguguucuugcucuauasa	AS1365	1475	uUfaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.20	0.59	0.95
01366	S1366	384	Afa CfaGfuGfuUfcU fuGfCfUfcUfauasAf	AS1366	1476	uUfAfUfaGfagcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.13	0.53
01367	S1367	385	AfaCfaGfuGfuUfcUfuGfCfUfcUfaUfasAf	AS1367	1477	uUfaUfaGfagcAfaGfaAfcAfcUfgUfusUfsUf	0.08	0.16	0.53
D1368	S1368	386	AfaCfaGfuguUfcUfuGfcUfcUfAfU fasAf	AS1368	1478	uUfauaGfaGfcAfaGfaAfCfAfcUfgUfusUfsu	0.07	0.15	0.54
D1369	S1369	387	AfaCfaGfuGfuUfcuuGfcUfcUfaUfAfsAf	AS1369	1479	uuaUfaGfaGfcAfAfGfaAfcAfcUfgUfusUfsu	0.23	0.56	0.89
01370	S1370	388	AfaCfaGfuGfuUfcUfuGfCfUfcuaUfasAf	AS1370	1480	uUfa UfAfGfagcAfaGfa AfcAfcUfgUfusüfsu	0.06	0.12	0.55
D1371	S1371	389	Afa CfaGfuGfuUfcUfuGfCfUfcuaUf asAf	AS1371	1481	uUfa UfAfGfagcAfaGfa AfcAfcU fgUfusUfsu	0.07	0.18	0.58

I08

D1372	51372	390	AfaCfaguGfuUfcUfuGfcUfcUfAfUfasAf	AS1372	1482	uUfauaGfaGfcAfaGfaAfcAfCfUfgUfusUfsu	0.06	0.15	0.56
D1373	S1373	391	Afa CfaGfuGfu ucUfuGfcUfcUfaUfAfsAf	AS1373	1483	uuaUfaGfaGfcAfaGfAfAfcAfcUfgUfusUfsu	0.21	0.51	0.89
D1374	S1374	392	AfacaGfuguUfcUfuGfcUfcUfaUfasAf	AS1374	1484	uUfaUfaGfaGfcAfaGfaAfCfAfcUfGfUfusUfsu	0.08	0.21	0.64
D1375	S1375	393	AfaCfaGfuGfuUfcuuGfCfUfcUfaUfasAf	AS1375	1485	uUfaUfaGfagcAfAfGfaAfcAfcUfgUfusUfsu	0.15	0.40	0.94
D1376	S1376	394	AfaCfaGfuGfuUfcuuGfCfUfcUfaUfasAf	AS1376	1486	uUfaUfaGfagcAfAfGfaAfcAfcUfgUfusUfsu	0.13	0.40	0.96
D1377	S1377	395	AfaCfaGfuGfuUfcUfuGfcUfCfUfauasAf	AS1377	1487	uUfAfUfagaGfcAfaGfaAfcAfcUfgUfusUfsu	0.08	0.17	0.64
D1378	S1378	396	Afa CfaGf ugu UfcUf uGfcUfcUfaUfAfsAf	AS1378	1488	uuaUfaGfaGfcAfaGfaAfCfAfcUfgUfusUfsu	0.18	0.50	0.97
D1379	S1379	397	Afa CfaGfuGfu ucUfuGfCfUfcUfaUfasAf	AS1379	1489	uUfaUfaGfagcAfaGfAfAfcAfcUfgUfusUfsu	0.08	0.24	0.79
D1380	S1380	398	aa CfaGfuGfu UfcUfuGfcUfcUfAf UfasAf	AS1380	1490	uUfauaGfa GfcAfaGfa AfcAfcUfgUfUfsUfsu	0.07	0.14	0.58
D1381	S1381	399	Afa CfaguGfu UfcUf UGfcUfcUfaUfAfsAf	AS1381	1491	uuaUfaGfa GfcAfaGfa AfcAf Cf UfgUfusUfsu	0.11	0.34	0.96
D1382	S1382	400	AfaCfaGfugu UfcUf uGfCf UfcUfaUfasAf	AS1382	1492	uUfaUfaGfagcAfaGfaAfCfAfcUfgUfusUfsu	0.08	0.18	0.69
D1383	S1383	401	AfaCfaGfuGfiiUfcuuGfcUfCfUfaUfasAf	AS1383	1493	u Ufa UfagaGfcAfAfGfaAfcAfcUfgUf usUfsu	0.14	0.38	0.85
D1384	S1384	402	Afa CfaGfuGfu UfcUfuGfcUfcUfAfUfasAf	AS 13 84	1494	uUfauaGfaGfcAfaGfaAfcAfcUfgUfusUfsUf	0.07	0.16	0.54
D1385	S1385	403	AfacaGfuGfuUfcUfuGfcUfcUfaUfAfsAf	AS 1385	1495	uuaUfaGfaGfcAfaGfaAfcAfcUfGfUfusUfsu	0.08	0.20	0.75
D1386	S1386	404	aacagugu ucUfuGfcUcUau dAsa	AS 13 86	1496	u UfdAUdAGfa GfcAfaGfa adCad CudGdTdTsusu	0.25	0.56	0.90
D1387	S1387	405	Afa CfaguGfu UfcUf uGfCf UfcUfaUfasAf	AS 1387	1497	u Ufa UfaGf agcAfaGfa AfcAfCf UfgUfusUfsu	0.08	0.19	0.70
D1388	S1388	406	Afa CfaGfuGfu ucUfuGfcUf CfUfa Ufa sAf	AS1388	1498	u Ufa UfagaGfcAfaGfAfAfcAfcUfgUf usUfsu	0.08	0.14	0.60
D1389	S1389	407	Afa CfaGfuGfu UfcUf uGfcUfcuaUfAfsAf	AS1389	1499	uuaUfAfGfaGfcAfaGfeAfcAfcUfgUfusUfsu	0.08	0.19	0.62
D1390	S1390	408	aaCfaGf uGfu UfcUfuGfcUfcUfaUfAfsAf	AS 1390	1500	uuaUfaGfaGfcAfaGfaAfcAfcUfgUfUfsUfsu	0.08	0.27	0.76
D1391	S1391	409	aacaguguucdTudGcdTcdTadTasa	AS 1391	1501	u UfdAUdAGfaGfcAfaGfaadCa dCu dGudTsusu	0.18	0.36	0.81
D1392	S1392	410	AfacaGfuGfuUfcUfuGfCfUfcUfaUfasAf	AS 1392	1502	uUfaUfaGfagcAfaGfaAfcAfcUfGfUfusUfsu	0.07	0.17	0.55
D1393	S1393	411	AfaCfaGfuguUfcUfuGfcUfCfUfaUfasAf	AS 1393	1503	uUfaUfaga GfcAfa Gf a AfCfAfcUfgUfusUf su	0.07	0.15	0.57
D1394	S1394	412	AfaCfaGfuGfuUfcuuGfcUfcUfAfUfasAf	AS 1394	1504	uUfauaGfaGfcAfAfGfaAfcAfcUfgUfusUfsu	0.26	0.68	1.06
D1395	S1395	413	AfaCfaGfuGfuUfcUfuGfcucUfaUfAfsAf	AS1395	1505	uuaUfaGfAfGfcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.18	0.58
01396	S1396	414	AfaCfaGfuGfuUfcUfuGfcUfcUfaUfAfsAf	AS 1396	1506	uuaUfaGfaGfcAfaGfaAfcAfcUfgUfusUfsUf	0.09	0.27	0.73
D1397	S1397	415	AfaCfaAfuGfuUfcUfuGfcdAdCdTdAUfasAf	AS1397	1507	uUfadTdAdGdAGfcAfaGfaGfcAfcAfgUfusUfsu	0.20	0.51	0.73
01398	S1398	416	AfacaGfuguUfcuuGfcucUfauasAf	AS1398	1508	uUfAfUfaGfAfGfcAfAfGfaAfCfAfcUfGfUfusUfsu	0.13	0.34	0.86

109

D1399	S1399	417	dAacadGugucfTcuudGcucdTauasdA	AS 1399	1509	udTdAdTadGdAdGcdAdAdGadAdCdAcdTdGdTusdTsu	0.24	0.42	0.82
D1400	S1400	418	AfaCfaAfuGfuüfcUfuGfdCdAdCdTaUfasAf	AS1400	1510	uUfaUfdAdGdAdGcAfaGfaGfcAfcAfgUfusüfsu	0.49	0.85	0.78
D14O1	S1401	419	AfaCfaAfuGfuUfcUfudGdCdAdCUfaüfasAf	AS1401	1511	uUfaUfadGdAdGdCAfaGfaGfcAfcAfgüfusüfsu	0.67	0.83	0.85
D14O2	S1402	420	aaCfAfguGfUfucüfUfgcUfCfuaUfAfsa	AS 1402	1512	uUfaUfAfgaGfCfaaGfAfacAfCfugUfüfsusu	0.18	0.47	0.80
D1403	S1403	421	AfaCfaAfuGfuüfcUfuGfcdAdCUfadTdAsAf	AS1403	1513	udTdAUfadGdAGfcAfaGfaGfcAfcAfgUfusUfsu	0.73	0.89	0.77
D1404	S1404	422	aacAgugUucuUgcuCuauAsa	AS1404	1514	uUaUAgAGCaAGAaCACuGUUsusu	0.12	0.39	0.79
D1405	S1405	423	AacaGuguUcuuGcucUauasA	AS1405	1515	u UAUaGAGcAAGa ACAcU G U usUsu	0.12	0.37	0.77
D1406	S1406	424	AfaCfaAfuGfuUfcUfudGdCAfcüfadTdAsAf	AS1406	1516	udTd AUfaGfadG dCAfaGfa GfcAfcAfgU f usUfsu	0.59	0.93	0.89
D1407	51407	425	aACagUGuuCUugCUcuAUasa	AS1407	1517	UUauAGagCAagAAcaCUguUsUsu	0.09	0.16	0.55
D1408	51408	426	AfaCfaAf uGfu UfctlfuGfcAfcdT dAdTdAs Af	AS1408	1518	ucfTdAdTdAGfaGfcAfaGfaAfcAfcAfgUfusUfsu	0.22	0.64	0.86
D1409	S1409	427	aaCAguGUucU UgcU CuaU Asa	AS1409	1519	uUaUAgaGCaaGAacACugUUsusu	0.13	0.31	0.76
D1410	S1410	428	AfaCfaAfuGfuUfcUfuGfcAfdCdTdAdTdAsAf	AS1410	1520	udTdAdTdAdGaGfcAfaGfaGfcAfcAfgUfusüfsu	0.77	0.94	0.93
D1411	S1411	429	aacAfgugUfucuUfgcuCfuauAfsa	AS1411	1521	uUfaUfAfgAfGfCfaAfGfAfaCfAfCfuGfüfUfsusu	0.23	0.53	1.04
D1412	51412	430	aacdAgugdïucudTgcudCuaudAsa	AS1412	1522	udTadTdAgdAdGdCadAdGdAadCdAdCudGdTdTsusu	0.30	0.64	0.90
D1413	51413	431	Afa CfaGf uGfu UfcüfuGfcUfcüfaUf asa	AS1413	1523	UfUfaüfaGfaGfcAfaGfaAfcAfcUfgUfusUfsu	0.09	0.19	0.63
D1414	51414	432	Afa CfaGf uGfUfUfcüfuGfcUfcüfa Ufasa	AS1414	1524	UfUfaUfaGfaGfcAfaGfaacAfcüfgUfusUfsu	0.11	0.28	0.66
D1415	S1415	433	AfaCfaGfuGfuüfcUfuGfCfUfcUfaüfasa	AS1415	1525	UfUfaUfaGfagcAfaGfaAfcAfcUfgUfusUfsu	0.06	0.13	0.53
D1416	51416	434	a a cagugu ucuugcticuauasa	AS1416	1526	UfUfAfUfAfGfAfGfCfAfAfGfAfAfCfAfCfUfGfUfUfsusu	0.20	0.53	0.99
D1417	S1417	435	Afa CfaGfuGfuUfcUfuGfcUfcUfAfUfasa	AS1417	1527	UfUfauaGfaGfcAfaGfaAfcAfcüfgUfusUfsu	0.07	0.17	0.53
D1418	S1418	436	aAfCfagUfGfuuCfUfugCfUfcuAfUfasa	A51418	1528	UfUfa uAfGfagCfAfagAfAfcaCfUfguüfsUfsu	0.08	0.20	0.70
D1419	51419	437	AfaCfAfGfuGfuUfcUfuGfcUfcUfaUfasAf	AS1419	1529	u UfaUfaGfaGfcAf aGfaAfcAfcugUfus UfsUf	0.08	0.20	0.70
D1420	51420	438	GfaCfuUfcUfcCfUfCfcAfgugGfaCfcUfL96	AS1420	1530	aGfgUfcCfAfCfuGfgagGfaGfaAfgllfcsCfsc
D1421	51421	439	GfaCfuUfcUfcCfUfCfcAfgUfGfGfaCfcUfL96	AS1421	1531	aGfgüfccaCfuGfgagGfaGfaAfgUfcsCfsc
D1422	S1422	440	AfcUfuCfuCfcUfCfCfaGfuggAfcCfuGfL96	AS1422	1532	cAfgGfuCfCfAfcüfggaGfgAfgAfaGfusCfsc
D1423	S1423	441	AfcUfuCfuCfcUfCfCfaGfuGfGfAfcCfuGfl96	AS1423	1533	cAfgGfuccAfcUfggaGfgAfgAfaGfusCfsc
D1424	51424	442	CfuUfcUfcCfuCfCfAfgUfggaCfcUfgAfL96	AS1424	1534	uCfaGfgUfCfCfaCfuggAfgGfaGfaAfgsUfsc
01425	S1425	443	CfuUfcUfcCfuCfCfAfgUfgGfAfCfcUfgAfL96	AS1425	1535	uCfaGfgucCfaCfuggAfgGfaGfaAfgsUfsc

no

D1426	S1426	444	Ufu CfuCfcUfcCfAfGfu GfgacCfuGfaAfL96	AS1426	1536	uUfcAfgGfüfCfcAfcugGfaGfgAfgAfasGfsu
D1427	S1427	445	UfuCfuCfcUfcCfAfGfuGfgAfCfCfuGfaAfL96	AS1427	1537	UÜfcAfgguCfcAfcugGfaGfgAfgAfasGfsu
01428	S1428	446	UfcUfcCfuCfcAfGfUfgGfaccUfgAfaGfL96	AS1428	1538	cUfuCfaGfGfUfcCfacuGfgAfgGfaGfasAfsg
D1429	S1429	447	UfcUfcCfllCfcAfGfUfgGfaCfCfUfgAfaGfL96	AS1429	1539	cUfuCfaggUfcCfacuGfgAfgGfaGfasAfsg
D1430	S1430	448	CfijCfcUfcCfaGfUfGfgAfccuGfaAfgGfL96	AS1430	1540	cCfuUfcAfGfGfuCfcacUfgGfaGfgAfgsAfsa
D1431	S1431	449	CfuCfcUfcCfaGfUfGfgAfcCfüfGfaAfgGfL96	AS1431	1541	cCfuUfcagGfuCfcacUfgGfaGfgAfgsAfsa
01432	S1432	450	UfcCfuCfcAfgUfGfGfaCfcugAfaGfgAfL96	AS1432	1542	uCfcUfuCfAfGfgUfccaCfuGfgAfgGfasGfsa
D1433	S1433	451	UfcCfu CfcAfgUfGfGfaCfcUfGfAfa GfgAfL96	AS1433	1543	uCfcUfucaGfgUfccaCfuGfgAfgGfasGfsa
D1434	S1434	452	CfcUfcCfaGfuGfGfAfcCfugaAfgGfaCfL96	AS1434	1544	gUfcCfuUfCfAfgGfuccAfcUfgGfaGfgsAfsg
D1435	S1435	453	CfcUfcCfaGfuGfGfAfcCfuGfAfAfgGfaCfL96	AS1435	1545	gUfcCfuucAfgGfuccAfcUfgGfaGfgsAfsg
D1436	S1436	454	CfuCfcAfgUfgGfAfCfcUfgaaGfgAfcGfL96	AS1436	1546	cGfuCfcUfUfCfaGfgucCfaCfuGfgAfgsGfsa
D1437	S1437	455	CfuCfcAfgUfgGfAfCfcUfgAfAfGfgAfcGfL96	AS1437	1547	cGfuCfcuuCfaGfgucCfaCfuGfgAfgsGfsa
D1438	S1438	456	UfcCfaGfuGfgAf CfCfuGfaagGfa CfgAfL96	AS1438	1548	uCfgUfcCfUfUfcAfgguCfcAfcUfgGfasGfsg
D1439	S1439	457	UfcCfaGfuGfgAf CfCfuGfaAfGfGfa CfgAfL96	AS1439	1549	uCfgUfccuUfcAfgguCfcAfcUfgGfasGfsg
D1440	S1440	458	CfcAfgUfgGfaCfCfUfgAfaggAfcGfaGfL96	AS1440	1550	cUfcGfuCfCfUfuCfaggUfcCfaCfuGfgsAfsg
D1441	S1441	459	CfcAfgUfgGfaCfCfUfgAfaGfGfAfcGfaGfL96	AS1441	1551	cUfcGfuccUfuCfaggUfcCfaCfuGfgsAfsg
D1442	S1442	460	CfaGfuGfgAfcCfUfGfaAfggaCfgAfgGfL96	AS 1442	1552	cCfuCfgUfCfCfuUfcagGfuCfcAfcUfgsGfsa
D1443	S1443	461	CfaGfuGfgAfcCfUfGfaAfgGfAfCfgAfgGfL96	AS1443	1553	cCfuCfgucCfuUfcagGfuCfcAfcUfgsGfsa
D1444	S1444	462	AfgUfgGfaCfcUfGfAfaGfgacGfaGfgGfL96	AS1444	1554	cCfcUfcGfUfCfcUfucaGfgUfcCfaCfusGfsg
D1445	S1445	463	AfgUfgGfaCfcUfGfAfaGfgAfCfGfaGfgGfL96	AS1445	1555	cCfcUfcguCfcUfucaGfgUfcCfaCfusGfsg
D1446	S1446	464	GfuGfgAfcCfuGfAfAfgGfacgAfgGfgAfL96	AS1446	1556	uCfcCfuCfGfUfcCfuucAfgGfuCfcAfcsUfsg
D1447	S1447	465	GfuGfgAfcCfuGfAfAfgGfaCfGfAfgGfgAfL96	AS1447	1557	uCfcCfucgUfcCfuucAfgGfuCfcAfcsUfsg
D1448	S1448	466	UfgGfaCfcüfgAfAfGfgAfcgaGfgGfaUfL96	AS1448	1558	aUfcCfcUfCfGfuCfcuuCfaGfgUfcCfasCfsu
D1449	S1449	467	UfgGfaCf CüfgAfAfGfgAfcGfAfGfgGfa U f L96	AS1449	1559	aUfcCfcucGfuCfcuuCfaGfgUfcCfasCfsu
D1450	51450	468	GfgAfcCfuGfaAfGfGfaCfgagGfgAfuGfL96	AS1450	1560	cAfuCfcCfUfCfgUfccuUfcAfgGfuCfcsAfsc
D1451	S1451	469	GfgAfcCfuGfaAfGfGfaCfgAfGfGfgAfuGfL96	AS1451	1561	cAfu CfccuCfgUfccu UfcAfgGfuCfcsAfsc
D1452	S1452	470	GfaCfcUfgAfaGfGfAfcGfaggGfaUfgGfL96	AS1452	1562	cCfaUfcCfCfUfcGfuccUfuCfaGfgUfcsCfsa

D1453	S1453	471	GfaCfcUfgAfaGfGfAfcGfaGfGfGfaüfgGfLSG	AS1453	1563	cCfaUfcccüfcGfuccUfuCfaGfgUfcsCfsa
01454	S1454	472	AfcCfuGfaAfgGfAfCfgAfgggAfuGfgGfL96	AS1454	1564	cCfcAfuCfCf Cfu CfgucCfu UfcAfgGf usCf sc
D1455	S1455	473	AfcCfuGfaAfgGfAfCfgAfgGfGfAfuGfgGfL96	AS1455	1565	cCfcAfuccCfuCfgucCfuUfcAfgGfusCfsc
D14S6	S1456	474	CfcUfgAfaGfgAfCfGfaGfggaüfgGfgAf L9 6	AS1456	1566	uCfcCfaUfCfCfcUfcguCfcUfuCfaGfgsUfsc
D1457	S1457	475	CfcUfgAfaGfgAfCfGfaGfgGfAfUfgGfgAfL96	AS1457	1567	uCfcCfaucCfcüfcguCfcUfuCfaGfgsüfsc
D1458	S14S8	476	CfuGfaAfgGfaCfGfAfgGfgauGfgGfaUfL96	AS1458	1568	aüfcCfcAfUfCfcCfucgUfcCfuUfcAfgsGfsu
D1459	S1459	477	CfuGfaAfgGfaCfGfAfgGfgAfUfGfgGfaUfL96	AS1459	1569	aUfcCfcauCfcCfucgUfcCfuUfcAfgsGfsu
D1460	S1460	478	UfgAfaGfgAfcGfAfGfgGfaugGfgAfuUfL96	AS1460	1570	aAfuCfcCfAfUfcCfcucGfuCfcUfuCfasGfsg
D1461	S1461	479	UfgAfaGfgAfcGfA(GfgGfaUfGfGfgAfuUfL96	AS1461	1571	aAfuCfccaUfcCfcucGfuCfcUfuCfasGfsg
D1462	S1462	480	GfaAfgGfaCfgAfGfGfgAfuggGfaUfuüfL96	AS1462	1572	aAfaUfcCfCfAfuCfccuCfgüfcCfuUfcsAfsg
D1463	S1463	481	GfaAfgGfaCfgAfGfGfgAfuGfGfGfaUfuüfL96	AS1463	1573	a AfaUfcccAfuCf ccuCfgüfcCfu UfcsAf sg
D1464	51464	482	AfaGfgAfcGfaGfGfGfaUfgggAfuüfuCfL96	AS1464	1574	gAfaAfuCfCfCfaUfcccüfcGfuCfcUfusCfsa
D1465	51465	483	AfaGfgAfcGfaGfGfGf aU fgGfGfAfu UfuCf L96	AS1465	1575	gAfa AfuccCfa UfcccUfcGfu CfcüfusCfsa
D1466	S1466	484	AfgGfaCfgAfgGfGfAfuGfggaUfuUfcAfL96	AS1466	1576	uGfaAfaUfCfCfcAfuccCfuCfgUfcCfusUfsc
D1467	51467	485	AfgGfaCfgAfgGf GfAf uGfgGfAfUfu UfcAfL96	AS1467	1577	uGfaAfaucCfcAfuccCfuCfgUfcCfusUfsc
D1468	S1468	486	GfgAfcGfaGfgGfAfUfgGfgauUfuCfaUfL96	AS1468	1578	aUfgAfa AfUf CfcCfa ucCfcUfcGfuCfcsUfsu
D1469	S1469	487	GfgAfcGfaGfgGfAfUfgGfgAfUfUfuCfaUfL96	AS1469	1579	aUfgAfaauCfcCfaucCfcUfcGfuCfcslIfsu
D1470	S1470	488	GfaCfgAfgGfgAfUfGfgGfauuUfcAfuGfL96	AS1470	1580	cAfuGfaAfAfUfcCfcauCfcCfuCfgUfcsCfsu
D1471	S1471	489	GfaCfgAfgGfgAfUfGfgGfaUfüfüfcAfuGfLSS	AS1471	1581	cAfuGfaaaüfcCfcauCfcCfuCfgUfcsCfsu
D1472	51472	490	AfcGfaGfgGfaUfGfGfgAfuuuCfaüfgUfL96	AS1472	1582	aCfaüfgAiAfAfuCfccaUfcCfcUfcGfusCfsc
D1473	51473	491	AfcGfaGfgGfaUfGfGfgAfuUfUfCfaUfgUfL96	AS1473	1583	aCfaUfgaaAfuCfccaüfcCfcUfcGfusCfsc
D1474	S1474	492	CfgAfgGfgAfuGfGfGfaüfuucAfuGfuAfL96	AS1474	1584	uAf cAfu GfAfAfaUfcccAfuCfcCfuCfgsUfsc
D1475	S1475	493	CfgAfgGfgAfuGfGfGfaUfuUfCfAfuGfiiAfL96	AS1475	1585	uAf cAfuga Afa UfcccAfu CfcCfu CfgsUfsc
D1476	S1476	494	GfaGfgGfaUfgGfGfAfuUfucaUfgüfaAfL96	AS1476	1586	uUfaCfaUfGfAfaAfuccCfaUfcCfcUfcsGfsu
01477	S1477	495	GfaGfgGfaUfgGfGfAfuUfuCfAfUfgüfaAfL96	AS1477	1587	uUfaCfaugAfaAfuccCfaUfcCfcUfcsGfsu
01478	51478	496	AfgGfgAfuGfgGfAfUfuUfcauGfuAfaCfL96	AS1478	1588	gUfuAfcAfUfGfaAfaucCfcAfuCfcCfusCfsg
D1479	S1479	497	AfgGfgAfuGfgGfAfUfuüfcAfUfGfuAfaCfL96	AS1479	1589	gUfuAfcauGfaAfaucCfcAfuCfcCfusCfsg

112

D1480	S1480	498	GfgGfaUfgGfgAfUfUfuCfaugUfaAfcCfL96	AS1480	1590	gGfuUfaCfAfUfgAfaauCfcCfaUfcCfcsUfsc
01481	S1481	499	GfgGfa UfgGfgAf Uf UfuCfa UfGfUfa AfcCf L96	AS1481	1591	gGfuUfacaUfgAfaauCfcCfaUfcCfcsUfsc
D1482	S1482	500	GfgAfuGfgGfaUfUfUfcAfuguAfaCfcAfL96	AS1482	1592	uGfgUfuAfCfAfuGfaaaUfcCfcAfuCfcsCfsu
D1483	S1483	501	GfgAfuGfgGfaUf Uf UfcAfuGf UfAfa CfcAfl96	AS1483	1593	uGfgUfuacAfuGfaaaUfcCfcAfuCfcsCfsu
D1484	S1484	502	GfaUfgGfgAfuUfUfCfaUfguaAfcCfaAfL96	AS1484	1594	uUfgGfuUfAfCfaUfgaaAfuCfcCfaUfcsCfsc
D1485	S1485	503	GfaUfgGfgAfuUfUfCfaUfgUfAfAfcCfaAfL96	AS1485	1595	uUfgGfuuaCfa Ufgaa Afu CfcCfaUfcsCfsc
D1486	S1486	504	Af uGfgGfa U fuüfCfAfuGfu aa CfcAfaGf L96	AS1486	1596	cUfuGfgUfUfAfcAfugaAfaUfcCfcAfusCfsc
D1487	S1487	505	AfuGfgGfaUfuUfCfAfuGfuAfAfCfcAfaGfL96	AS1487	1597	cUfuGfguuAfcAfugaAfaUfcCfcAfusCfsc
D1488	S1488	506	UfgGfgAf u UfuCfAfUfgUfa acCfa AfgAf L96	AS1488	1598	uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc
D1489	S1489	507	UfgGfgAfuUfuCfAfUfgUfaAfCfCfaAfgAfL96	AS1489	1599	uCfuUfgguUfaCfaugAfaAfuCfcCfasUfsc
D1490	51490	508	GfgGfaUfuUfcAfUfGfuAfaccAfaGfaGfL96	AS1490	1600	cUfcUfuGfGfUfuAfcauGfaAfaUfcCfcsAfsu
D1491	S1491	509	GfgGfa UfuUfcAfUfGfuAfaCfCfAfaGfaGfL96	AS1491	1601	cUfcUf uggUfuAfcau Gfa Afa UfcCfcsAfsu
D1492	S1492	510	GfgAfuUfuCfaUfGfUfaAfccaAfgAfgUfL96	AS1492	1602	aCfuCfuüfGfGfu UfacaUfgAfa Afu CfcsCf sa
D1493	S1493	511	GfgAfuUfuCfa UfGfUfa AfcCfAfAfgAfgUfL96	AS1493	1603	aCfuCfuugGfuUfacaUfgAfaAfuCfcsCfsa
D1494	S1494	512	GfaUfuüfcAfuGfUfAfaCfcaaGfaGfuAfL96	AS1494	1604	u AfcUfcUfUfGfgUfuacAfuGfaAfa UfcsCfsc
01495	S1495	513	GfaUfuUfcAfuGfUfAfaCfcAfAfGfaGfuAfL96	AS1495	1605	uAfcUfcuuGfgUfuacAfuGfaAfaUfcsCfsc
D1496	S1496	514	AfuUfuCfaUfgUfAfAfcCfaagAfgUfaUfL96	AS1496	1606	aUfaCfuCfUfUfgGfuuaCfaUfgAfaAfusCfsc
D1497	S1497	515	AfuUfuCfaUfgUfAfAfcCfaAfGfAfgUfaUfL96	AS1497	1607	a UfaCfucuUfgGfu uaCfa U fgAfa Af usCfsc
D1498	51498	516	UfuUfcAfuGfuAfAfCfcAfagaGfuAfuUfL96	AS1498	1608	aAfuAfcUfCfUfuGfguuAfcAfuGfaAfasUfsc
D1499	S1499	517	UfuUfcAfuGfuAfAfCfcAfaGfAfGfuAfuUfL96	AS1499	1609	aAfuAfcucUfuGfguuAfcAfuGfaAfasUfsc
01500	S1500	518	UfuCfa UfgUfaAfCfCfaAfgagUfaUfuCfL96	AS1500	1610	gAfaUfaCfUfCfuUfgguUfaCfaUfgAfasAfsu
01501	S1501	519	UfuCfa UfgUfa AfCfCfaAfgAf GfUfa UfuCf L96	AS 1501	1611	gAfaUfacuCfu Ufggu UfaCfaUfgAfasAfsu
01502	S1502	520	UfcAfuGfu AfaCfCfAfa GfaguAf u UfcCfL96	AS 1502	1612	gGfaAfuAfCfUfcUfuggUfuAfcAfuGfasAfsa
D15O3	51503	521	UfcAfuGfuAfaCfCfAfaGfaGfUfAfuUfcCfL96	AS1503	1613	gGfaAfuacUfcUfuggUfuAfcAfuGfasAfsa
D1504	S1504	522	CfaUfgUfaAfcCfAfAfgAfguaUfuCfcAfL96	AS1504	1614	uGfgAfaUfAfCfuCfuugGfuUfa Cfa UfgsAfsa
DISOS	S1505	523	Cfa UfgUfa AfcCfAfAfgAfgUfAfUfu CfcAf L96	AS1505	1615	uGfgAfauaCfuCfuugGfuUfaCfaUfgsAfsa
01506	51506	524	AfuGfu AfaCfcAfAfGfaGfuauUfcCfaUfL96	AS1506	1616	aUfgGfaAfUfAfcUfcuuGfgUfuAfcAfusGfsa

ll3

D1507	51507	525	AfuGfuAfaCfcAfAfGfaGfuAfUfUfcCfaUflS6	AS1507	1617	aUfgGfaauAfcUfcuuGfgüfuAfcAfusGfsa
D1508	51508	526	UfgUfaAfcCfaAfGfAfgUfauuCfcAfuUfL96	AS 1508	1618	a Afu GfgAfAfUfaCfucuUfgGfuUfaCfasUfsg
D1509	S1509	527	UfgUfaAfcCfaAfGfAfgUfaUfUfCfcAfuUfL96	AS1509	1619	aAfuGfgaaUfaCfucuUfgGfuUfaCfasUfsg
D1510	S1510	528	GfuAfaCfcAfaGfAfGfuAfuucCfaUfuUfL96	AS1510	1620	aAfaUfgGfAfAfuAfcucUfuGfgUfuAfcsAfsu
D1511	S1511	529	GfuAfaCfcAfaGfAfGfuAfuUfCfCfaUfuUfL96	AS1511	1621	aAfaUfggaAfuAfcucUfuGfgUfuAfcsAfsu
D1512	51512	530	Ufa AfcCfa AfgAfGfUfa UfuccAfuUfu UfL96	AS1512	1622	aAfaAfuGfGfAfaUfacuCfuUfgGfuUfasCfsa
DIS 13	S1513	531	Ufa AfcCfaAfgAfGf Ufa UfuCfCfAfu U fuUf L96	AS1513	1623	aAfaAfuggAfaUfacuCfuUfgGfuUfasCfsa
DIS 14	$1514	532	Afa CfcAfaGfaGf UfAf uUfcca UfuUf uUfL96	AS1514	1624	aAfaAfaUfGfGfaAfuacUfcUfuGfgUfusAfsc
D1515	S1515	533	AfaCfcAfaGfaGfUfAfuUfcCfAfUfuUfuUfL96	AS1515	1625	aAfaAfaugGfaAfuacUfcUfuGfgUfusAfsc
D1S16	SIS 16	534	AfcCfaAfgAfgUfAfUfuCfcauUfuUfuAfL96	AS1516	1626	uAfaAfaAfUfGfgAfauaCfuCfuUfgGfusUfsa
D1517	S1517	535	AfcCfaAfgAfgUfAfUfuCfcAfUfUfuUfuAfL96	AS 1517	1627	u AfaAfaa uGf gAfa uaCf uCfu UfgGfu sUfsa
DIS 18	S1518	536	CfcAfaGfaGfuAfUfUfcCfauuUfuUfaCfL96	AS1518	1628	gUfaAfaAfAfUfgGfaauAfcUfcUfuGfgsUfsu
D1519	51519	537	CfcAfaGfaGfuAfUfUfcCfaUfUfUfuUfaCfL96	AS1519	1629	gUfaAfaa aU fgGfaau Af cUfcUfuGfgsüfsu
D1520	S1520	538	CfaAfgAfgUfaUfUfCfcAfuuuUfuAfcUfL96	AS1520	1630	aGfuAfaAfAfAfuGfgaa Ufa Cfu Cfu UfgsGfsu
D1521	S1521	539	CfaAfgAfgUfaüfUfCfcAfuUfUfUfuAfcüfL96	AS1521	1631	aGfuAfaaaAfu GfgaaUfaCfuCfu UfgsGfsu
D1522	S1522	540	AfaGfaGfu Afu UfCf CfaUfuuu UfaCfuAfL96	AS1522	1632	uAfgUfaAfAfAfaUfggaAfuAfcUfcUfusGfsg
D1523	S1523	541	AfaGfaGfuAfuUfCfCfaUfuUfUfUfaCfuAfL96	AS1S23	1633	uAfgUfaaaAfaUfggaAfuAfcUfcUfusGfsg
D1524	S1524	542	AfgAfgUfaUfuCfCfAfuUfuuuAfcUfaAfL96	AS1524	1634	uUfaGfuAfAfAfaAfuggAfaUfaCfuCfusUfsg
D1525	S1525	543	AfgAfgUfa Uf uCfCfAfuUfu Uf UfAfcUfaAf L96	AS1525	1635	uUfaGfuaaAfaAfuggAfaUfaCfuCfusUfsg
D1526	S1526	544	GfaGfuAf u UfcCfAfUfuUfu uaCf uAfa AfL96	AS1526	1636	uUfuAfgUfAfAfaAfaugGfaAfuAfcUfcsUfsu
D1527	S1S27	545	GfaGfuAfu UfcCfAfUfuUfu UfAfCfu Afa Af L96	AS1527	1637	uUfuAfguaAfaAfaugGfaAfuAfcUfcsUfsu
D1528	S1S28	546	AfgUfaUfuCfcAfUfUfuUfuacUfaAfaGfL96	AS1528	1638	cUfuUfaGfUfAfaAfaauGfgAfaUfaCfusCfsu
D1529	S1529	547	AfgUfa UfuCfcAfUf UfuUf uAfCf Ufa Afa GfL96	AS1529	1639	cUfuüfaguAfaAfaauGfgAfaUfaCfusCfsu
D1530	S1S30	548	Gfu Afu UfcCfa UfUfUfuUfacu Afa AfgCfL96	AS1530	1640	gCfuUfuAfGfUfaAfaaaUfgGfaAfuAfcsUfsc
D1531	S1531	549	GfuAfuUfcCfaUfUfUfuUfaCfUfAfaAfgCfL96	AS1531	1641	gCfuUfuagUfaAfaaaUfgGfaAfuAfcsUfsc
D1532	S1532	550	UfaUfuCfcAfuUfUfUfuAfcuaAfaGfcAfl96	AS1532	1642	uGfcUfuUfAfGfu Afaaa Afu GfgAfa UfasCfsu
D1533	S1533	551	UfaUf uCfcAfu Uf UfUfu AfcUfAfAfa GfcAf L96	AS1533	1643	uGfcUfuuaGfuAfaaaAfuGfgAfaUfasCfsu

114

01534	S1534	552	AfuUfcCfaUfuUfUfUfaCfuaaAfgCfaGfL96	AS 1534	1644	cUfgCfuUfUfAfgUfaaaAfaUfgGfaAfusAfsc
01535	S1535	553	AfuUfcCfaUfuUfUfUfaCfuAfAfAfgCfaGfL96	AS 1535	1645	cUfgCfu uu AfgUfaaaAfa UfgGfa AfusAfsc
D1536	S1536	554	UfuCfcAfuUfuUfUfAfcUfaaaGfcAfgUfL96	AS1536	1646	aCfuGfcUfUfUfaGfuaaAfaAfuGfgAfasUfsa
D1537	S1537	555	UfuCfcAfuUfuUfUfAfcUfaAfAfGfcAfgUfL96	AS1537	1647	aCfuGfcuuUfaGfuaaAfaAfuGfgAfasUfsa
D1538	S1538	556	UfcCfaUfuUfuUfAfCfuAfaagCfaGfuGfL96	AS1538	1648	cAfcUfgCfUfUfuAfguaAfaAfaUfgGfasAfsu
D1539	51539	557	UfcCfaUfuUfu UfAfCf uAfa AfGfCfa GfuGf L96	AS1539	1649	cAfcUfgcuUfuAfguaAfaAfaüfgGfasAfsu
D1540	S1540	558	CfcAfuUfuUfuAfCfUfaAfagcAfgUfgUfL96	AS1540	1650	aCfaCfuGfCfUfuUfaguAfaAfaAfuGfgsAfsa
D1541	51541	559	CfcAfuUfuUfuAfCfUfaAfaGfCfAfgUfgUfl96	AS1541	1651	aCfaCfugcUfuUfaguAfaAfaAfuGfgsAfsa
D1542	S1542	560	CfaUfuUfuUfaCfüfAfaAfgcaGfuGfuUfl96	AS1542	1652	aAfcAfcUfGfCfuUfuagUfaAfaAfaUfgsGfsa
D1543	51543	561	CfaUfuUfu UfaCfUfAfa AfgCfAfGfuGfu UfL96	AS1543	1653	aAfcAfcugCfuUfuagUfaAfaAfaUfgsGfsa
D1544	S1544	562	AfuUfuUfuAfcUfAfAfaGfcagUfgUfuUfL96	AS1544	1654	aAfaCfaCfUfGfcUfuuaGfuAfaAfaAfusGfsg
D1545	S1545	563	AfuUfuüfuAfcUfAfAfaGfcAfGfUfgUfuUfL96	AS1545	1655	aAfaCfacuGfcUfuuaGfuAfaAfaAfusGfsg
01546	S1546	564	UfuüfuUfaCfuAfAfAfgCfaguGfuUfuUfL96	AS1546	1656	aAfaAfcAfCfUfgCfuuuAfgUfaAfaAfasUfsg
01547	51547	565	UfuUfuUfaCfuAfAfAfgCfaGfUfGfuUfuUfL96	AS1547	1657	aAfaAfcacUfgCfuuuAfgUfaAfaAfasUfsg
01548	S1548	566	Ufu UfuAfcUfa AfAfGfcAfgugUfuUfu CfL96	AS1548	1658	gAfaAfaCfAfCfuGfcuuUfaGfuAfaAfasAfsu
D1549	S1549	567	Ufu UfuAfcUfa AfAfGfcAfgUfGfUfu UfuCfL96	AS1549	1659	gAfaAfacaCfuGfcuuUfaGfuAfaAfasAfsu
DIS 50	S1550	568	UfuUfaCfuAfaAfGfCfaGfuguUfuUfcAfL96	AS1550	1660	uGfaAfaAfCfAfcUfgcuUfuAfgUfaAfasAfsa
D1551	S1551	569	Ufu UfaCfu Afa AfGfCfaGfuGfUfUfu UfcAf L96	AS1551	1661	uGfaAfaacAfcUfgcuUfuAfgüfaAfasAfsa
D15S2	51552	570	UfuAfcUfaAfaGfCfAfgUfguuUfuCfaCfL96	AS1552	1662	gUfgAfaAfAfCfaCfugcUfuUfaGfuAfasAfsa
D1553	S1553	571	UfuAfcUfaAfaGfCfAfgUfgUfUfUfuCfaCfL96	AS1553	1663	gUfgAfa a a CfaCf ugcUfuUfa Gfu AfasAfsa
D1554	S1554	572	UfaCfuAfa AfgCfAfGfuGfu uu UfcAfcCf L96	AS 1554	1664	gGfuGfaAfAfAfcAfcugCfuUfuAfgUfasAfsa
D1555	51555	573	UfaCfuAf a AfgCfAfGfuGfu U f UfUfcAfcCfL96	AS 1555	1665	gGfuGfaaaAfcAfcugCfuUfuAfgUfasAfsa
D1556	S1556	574	AfcUfa AfaGfcAfGfUfgUfuu uCfaCfcUfL96	AS 1556	1666	aGfgUfgAfAfAfaCfacuGfcUfuUfaGfusAfsa
D1557	51557	575	AfcUfaAfaGfcAfGfUfgUfuUfUfCfaCfcUfL96	AS 1557	1667	aGfgUfgaaAfaCfacuGfcUfuUfaGfusAfsa
D1558	51558	576	CfuAfa AfgCfaGf UfGfu Ufu ucAfcCfuCfL96	AS 1558	1668	gAfgGf uGfAfAfa AfcacUfgCfu U f uAfgsUfsa
D1559	S1559	577	CfuAfa AfgCfaGf UfGfu Ufu UfCfAfcCfuCf L96	AS 1559	1669	gAfgGfugaAfaAfcacUfgCfuUfuAfgsUfsa
D1560	S1560	578	UfaAfaGfcAfgUfGfUfuUfucaCfcUfcAfL96	AS1560	1670	uGfaGfgUfGfAfaAfacaCfuGfcUfuUfasGfsu

us

D1561	S1561	579	UfaAfaGfcAfgUfGfUfuUfuCfAfCfcüfcAfL96	AS1561	1671	uGfaGfgugAfaAfacaCfuGfcUfuUfasGfsu
D1562	S1562	580	AfaAfgCfaGfuGfUfUfuUfcacCfuCfaüfL96	A51562	1672	aUfgAfgGfUfGfaAfaacAfcUfgCfuUfusAfsg
D1563	51563	581	AfaAfgCfaGfuGfUfUfuUfcAfCfCfuCfaUfL96	AS1563	1673	aUfgAfgguGfaAfaacAfcUfgCfuUfusAfsg
D1564	S1S64	582	AfaGfcAfgUfgUfUfUfuCfaccUfcAfuAfL96	AS1564	1674	uAfuGfaGfGfUfgAfaaaCfaCfuGfcUfusUfsa
01565	S1565	583	AfaGfcAfgUfgUfUfUfuCfaCfCfUfcAfuAfL96	AS1565	1675	uAfuGfaggUfgAfaaaCfaCfuGfcUfusUfsa
D1566	S1566	584	AfgCfaGf uGfu Uf Uf UfcAfccu CfaUfaU f L96	AS1566	1676	aUfaUfgAfGfGfuGfaaaAfcAfcUfgCfusUfsu
D1567	S1567	S85	AfgCfaGfuGfuUfUfUfcAfcCfUfCfaUfaUfL96	AS1567	1677	aUfaUfgagGfuGfaaaAfcAfcUfgCfusUfsu
D1568	S1568	586	GfcAfgUfgUfuUfUfCfaCfcucAfuAfuGfL96	AS1568	1678	cAfuAfuGfAfGfgUfgaaAfaCfaCfuGfcsUfsu
D1569	S1569	587	GfcAfgUfgUfuUfUfCfaCfcUfCfAfuAfuGfL96	AS1569	1679	cAfuAfugaGfgUfgaaAfaCfaCfuGfcsUfsu
D1570	S1570	588	CfaGfuGfuUfuUfCfAfcCfucaUfaUfgCfL96	AS1570	1680	gCfaUfaUfGfAfgGfugaAfaAfcAfcUfgsCfsu
D1571	S1571	589	CfaGfu GfuUfu UfCfAfcCfuCfAf UfaUfgCf L96	AS 1571	1681	gCfaUfaugAfgGfugaAfaAfcAfcUfgsCfsu
D1572	S1572	590	AfgUfgUfuUfuCfAfCfcUfcauAfuGfcUfL96	AS1572	1682	aGfcAfuAfUfGfaGfgugAfaAfaCfaCfusGfsc
D1573	S1573	591	AfgUfgUfuUfuCfAfCfcUfcAfUfAfuGfcUfL96	AS1573	1683	aGfcAfua uGfaGfgugAfa AfaCfa CfusGfsc
D1574	S1574	592	GfuGfu Uf uUfcAfCfCfuCfaua UfgCf uAfLS 6	AS 1574	1684	uAfgCfaUfAfUfgAfgguGfaAfaAfcAfcsUfsg
D1575	S1575	593	GfuGfuUfuUfcAfCfCfuCfaUfAfUfgCfuAfL96	AS1575	1685	uAfgCfaua UfgAfggu Gfa Afa AfcAfcsUfsg
01576	51576	594	UfgUfuUfuCfaCfCfUfcAfuauGfcUfaUfL96	AS1576	1686	aUfaGfcAfUfAfuGfaggUfgAfaAfaCfasCfsu
01577	S1577	595	UfgUfu UfuCfaCfCf UfcAfu AfUfGfcUfa UfL96	AS 1577	1687	aUfaGfcauAfuGfaggUfgAfaAfaCfasCfsu
01578	S1578	596	GfuUfuUfcAfcCfUfCfaUfaugCfuAfuGfL96	AS 1578	1688	cAfuAfgCfAfUfaUfgagGfuGfaAfaAfcsAfsc
01579	51579	597	GfuUfuUfcAfcCfUfCfaUfaUfGfCfuAfuGfL96	AS 1579	1689	cAfu Afgca UfaUfgagGfuGfa Afa AfcsAfsc
D1580	S1580	598	UfuUfuCfaCfcUfCfAfuAfugcUfaUfgUfL96	AS1580	1690	aCfaUfaGfCfAfuAfugaGfgUfgAfaAfasCfsa
01581	S1581	599	Ufu Uf uCfaCfcUf CfAfu Af uGfCfUfaUfgU fL96	AS1581	1691	aCfaUfagcAfuAfugaGfgUfgAfaAfasCfsa
D1582	51582	600	UfuUfcAfcCfuCfAfUfaUfgcuAfuGfuUfL96	A51582	1692	aAfcAf uAfGfCfa Ufau gAfgGfuGfaAfasAfsc
D1583	S1583	601	Ufu UfcAfcCfuCfAfUfaUfgCfUfAfuGfu UfL9 6	AS1583	1693	aAfcAfuagCfaUfaugAfgGfuGfaAfasAfsc
D1584	S1584	602	Ufu Cfa CfcUfcAf UfAfuGfcua UfgUfu AfL9 6	AS1584	1694	uAfaCfaUfAfGfcAfuauGfaGfgUfgAfasAfsa
D1585	51585	603	Ufu Cfa CfcUfcAfUfAfuGfcUfAfUfgUfuAfL96	AS1585	1695	uAfaCfauaGfcAfuauGfaGfgUfgAfasAfsa
D1586	S1586	604	UfcAfcCfuCfaUfAfUfgCfuauGfuUfaGfL96	AS1586	1696	cUfa AfcAfUfAfgCfaua UfgAfgGfu GfasAfsa
D1587	51587	605	UfcAfcCfuCfaUfAfUfgCfuAfUfGfuUfaGfL96	AS1587	1697	cUfaAfcauAfgCfauaUfgAfgGfuGfasAfsa

116

D1588	S1588	606	CfaCfcUfcAfuAfUfGfcUfaugUfuAfgAfL96	AS1588	1698	uCfuAfaCfAfUfaGfcauAfuGfaGfgUfgsAfsa
D1S89	S1589	607	CfaCfcUfcAfuAfüfGfcUfaUfGfUfuAfgAfL96	AS 1589	1699	uCfuAfacaUfaGfcauAfuGfaGfgUfgsAfsa
D1590	S1590	608	AfcCfuCfaUfaUfGfCfuAfuguUfaGfaAfL96	AS1590	1700	uUfcUfaAfCfAfuAfgcaUfaUfgAfgGfusGfsa
D1591	S1591	609	AfcCfuCfaUfaUfGfCfuAfuGfUfUfaGfaAfL96	AS1591	1701	uUfcUfaacAfuAfgcaUfaUfgAfgGfusGfsa
D1592	S1592	610	CfcUfcAfuAfuGfCfUfaUfguuAfgAfaGfL96	AS 1592	1702	cUfuCfuAfAfCfaUfagcAfuAfuGfaGfgsUfsg
D1593	S1593	611	CfcüfcAfuAfuGfCfUfaUfgUfUfAfgAfaGfL96	AS1593	1703	cüfuCfuaaCfaUfagcAfuAfuGfaGfgsUfsg
D1594	S1594	612	CfuCfaUfaUfgCfUfAfuGfuuaGfaAfgUfL96	AS1594	1704	aCfu UfcUfAfAfcAfuagCfaUfa UfgAfgsGfsu
D1595	S1S95	613	CfuCfaUfaUfgCfUfAfuGfuUfAfGfaAfgUfL96	AS1595	1705	aCfu Ufcua AfcAfuagCfaUfaUfgAfgsGf su
D1596	S1596	614	UfcAfuAfuGfcllfAfUfgUfuagAfaGfuCfL96	AS1596	1706	gAfcUfuCfUfAfaCfauaGfcAfuAfuGfasGfsg
D1597	51597	615	UfcAfuAfuGfcUfAfUfgUfuAfGfAfaGfuCfL96	AS1597	1707	gAfcUfucuAfaCfauaGfcAfuAfuGfasGfsg
D1598	S1598	616	CfaUfaUfgCfuAfUfGfuUfagaAfgUfcCfL96	AS1598	1708	gGfaCfuUfCfUfaAfcauAfgCfaUfaUfgsAfsg
D1599	S1599	617	Cfa UfaUfgCf uAfUf GfuUfa GfAfAfgUfcCf L96	AS1599	1709	gGfaCfuucUfaAfcauAfgCfaüfaUfgsAfsg
D1600	51600	618	AfuAfuGfcUfaUfGfUfuAfgaaGfuCfcAfL96	AS1600	1710	uGfgAfcUfUfCfuAfacaUfaGfcAfuAfusGfsa
D1601	51601	619	AfuAfuGfcUfaUfGfUfuAfgAfAfGfuCfcAfL96	AS1601	1711	uGfgAfcuuCfuAfacaUfaGfcAfuAfusGfsa
D1602	51602	620	UfaUfgCfuAfuGfUfUfaGfaagUfcCfaGfL96	AS1602	1712	cUfgGfaCfUfUfcUfaacAfuAfgCfaUfasUfsg
01603	S1603	621	UfaüfgCfuAfuGfUfUfaGfaAfGfUfcCfaGfL96	AS1603	1713	cUfgGfacuüfcUfaacAfuAfgCfaUfasUfsg
01604	S1604	622	AfuGfcUfaUfgUfUfAfgAfaguCfcAfgGfL96	AS 1604	1714	cCfuGfgAfCfUfuCfuaaCfaUfaGfcAfusAfsu
D1605	S1605	623	AfuGfcUfaUfgUfUfAfgAfaGfUfCfcAfgGfL96	AS1605	1715	cCfuGfgacUfu Cfu aa CfallfaGfcAfusAfsu
D1606	S1606	624	UfgCfuAfuGfuUfAfGfaAfgucCfaGfgCfL96	A51606	1716	gCfcUfgGfAfCfuUfcuaAfcAfuAfgCfasUfsa
D1607	S1607	625	UfgCfuAfuGfuUfAfGfaAfgUfCfCfaGfgCfL96	AS1607	1717	gCfcUfggaCfuUfcuaAfcAfuAfgCfasUfsa
D1608	51608	626	GfcUfaUfgUfuAfGfAfaGfuccAfgGfcAfL96	AS1608	1718	uGfcCfuGfGfAfcUfucuAfaCfaUfaGfcsAfsu
D1609	51609	627	GfcUfa UfgUfuAfGfAfaGfu CfCfAfgGfcAfL9 6	AS1609	1719	uGfcCfaggAfcUfucuAfaCfaUfaGfcsAfsu
D1610	S1610	628	CfuAfuGfuUfaGfAfAfgUfccaGfgCfaGfL96	AS1610	1720	cUfgCfcUfGfGfaCfuucUfaAfcAfuAfgsCfsa
01611	S1611	629	CfuAfuGfuUfaGfAfAfgUfcCfAfGfgCfaGfL96	AS1611	1721	cüfgCfcugGfa Cfu ucUfa AfcAfuAfgsCfsa
01612	S1612	630	Ufa UfgUfuAfgAfAfGfuCfcagGfcAfgAfL9 6	AS1612	1722	uCfuGfcCf UfGfgAfcuu Cfu AfaCfa UfasGfsc
D1613	S1613	631	UfaUfgUfuAfgAfAfGfuCfcAfGfGfcAfgAfL96	AS1613	1723	uCfuGfccuGfgAfcuuCfuAfaCfaUfasGfsc
01614	S1614	632	AfuGfuUfaGfaAfGfUfcCfaggCfaGfaGfL96	AS1614	1724	cUfcUfgCfCfUfgGfacuUfcUfaAfcAfusAfsg

1I7

01615	S1615	633	AfuGfuUfaGfaAfGfUfcCfaGfGfCfaGfaGfL96	AS1615	1725	cUfcUfgccUfgGfacuUfcUfaAfcAfusAfsg
D1616	S1616	634	UfgUfuAfgAfaGfUfCfcAfggcAfgAfgAfL96	AS1616	1726	uCfuCfuGfCfCfuGfgacUfuCfuAfaCfasUfsa
D1617	S1617	635	UfgUfuAfgAfaGfUfCfcAfgGfCfAfgAfgAfL96	AS1617	1727	uCfuCfugcCfuGfgacUfuCfuAfaCfasUfsa
D1618	51618	636	GfuUfaGfaAfgUfCfCfaGfgcaGfaGfaCfL96	A51618	1728	gUfcUfcUf GfCfcUfggaCfu U fcUfa AfcsAfsu
D1619	S1619	637	GfuUfaGfaAfgUfCfCfaGfgCfAfGfa GfaCfL96	AS1619	1729	gUfcUfcugCfcUfgga Cfu UfcUfa AfcsAfsu
D1620	S1620	638	UfuAfgAfaGfuCfCfAfgGfcagAfgAfcAfL96	AS1620	1730	uGfuCfuCfUfGfcCfuggAfcUfuCfuAfasCfsa
D1621	S1621	639	UfuAfgAfaGfuCfCfAfgGfcAfGfAfgAfcAfL96	AS1621	1731	uGfuCfucuGfcCfuggAfcUfuCfuAfasCfsa
D1622	S1622	640	UfaGfaAfgUfcCfAfGfgCfagaGfaCfaAfL96	AS1622	1732	uUfgUfcUfCfUfgCfcugGfaCfuUfcUfasAfsc
D1623	S1623	641	UfaGfaAfgUfcCfAfGfgCfaGfAfGfaCfaAfL96	AS1623	1733	uUfgUfcucUfgCfcugGfa Cfu UfcUfasAfsc
01624	S1624	642	AfgAfaGf uCfcAfGfGfcAfgagAfcAfa UfL96	AS1624	1734	aUfuGfuCfUfCfuGfccuGfgAfcUfuCfusAfsa
D1625	S1625	643	AfgAfaGfuCfcAfGfGfcAfgAfGfAfcAfaUfL96	AS1625	1735	aUfuGfucuCfiiGfccuGfgAfcUfuCfusAfsa
D1626	S1626	644	GfaAfgUfcCfaGfGfCfaGfagaCfaAfuAfL96	AS1626	1736	uAfuUfgUfCfUfcUfgccUfgGfaCfuUfcsUfsa
D1627	S1627	645	GfaAfgUfcCfaGfGfCfaGfaGfAfCfaAfuAfL96	AS1627	1737	uAfuUfgucUfcUfgccUfgGfaCfuUfcsUfsa
D1628	S1628	646	AfaGfuCfcAfgGfCfAfgAfgacAfaUfaAfL96	AS1628	1738	uUfaUfuGfUfCfuCfugcCfuGfgAfcUfusCfsu
D1629	S1629	647	AfaGfuCfcAfgGfCfAfgAfgAfCfAfaüfaAfL96	AS1629	1739	uUfaUfuguCfuCfugcCfuGfgAfcUfusCfsu
D1630	S1630	648	AfgUfcCfaGfgCfAfGfaGfa ca Afu Afa Af L96	AS1630	1740	uüfuAfuUfGfUfcUfcugCfcUfgGfaCfusUfsc
01631	S1631	649	AfgUfcCfaGfgCfAfGfaGfaCfAfAfuAfaAfL96	AS1631	1741	uUfuAfuugUfcUfcugCfcUfgGfaCfusUfsc
D1632	S1632	650	GfuCfcAfgGfcAfGfAfgAfca a UfaAfaAf L96	AS1632	1742	uUfuUfaUfUfGfuCfucuGfcCfuGfgAfcsUfsu
D1633	S1633	651	Gfu CfcAfgGfcAfGfAfgAfcAfAf UfaAfaAf L96	AS1633	1743	uUfuUfauuGfuCfucuGfcCfuGfgAfcsüfsu
D1634	S1634	652	UfcCfaGfgCfaGfAfGfaCfaa uAfa AfaCfL96	AS1634	1744	gUfuUfuAfUfUfgUfcucUfgCfcUfgGfasCfsu
D1635	S1635	653	UfcCfaGfgCfaGfAfGfaCfaAfüfAfaAfaCfL96	AS1635	1745	gUfuUfuauUfgUfcucUfgCfcUfgGfasCfsu
D1636	S1636	654	CfcAfgGfcAfgAfGfAfcAfa ua AfaAfcAfL96	AS1636	1746	uGfuUfuUfAfUfuGfucuCfuGfcCfuGfgsAfsc
D1637	S1637	655	CfcAfgGfcAfgAfGfAfcAfa Uf AfAfaAfcAf L96	AS1637	1747	uGfu Ufuua UfuGf ucuCfuGfcCfuGfgsAfsc
D1638	S1638	656	CfaGfgCfaGfaGfAfCfaAfuaa AfaCfaUfL96	AS1638	1748	aUfgUfuUfUfAfuUfgucUfcUfgCfcUfgsGfsa
D1639	S1639	657	CfaGfgCfaGfaGfAfCfaAfuAfAfAfaCfaUfL96	AS1639	1749	a UfgUfu uuAfu UfgucUfcüfgCfcUfgsGfsa
D1640	S1640	658	AfgGfcAfgAfgAfCfAfaUfaaaAfcAfuUfL96	AS1640	1750	aAfuGfuUfUfUfaUfuguCfuCfuGfcCfusGfsg
D1641	S1641	659	AfgGfcAfgAfgAfCfAfaUfaAfAfAfcAfuUfL96	AS1641	1751	aAfuGfuuuUfaUfuguCfuCfuGfcCfusGfsg

118

D1642	S1642	660	GfgCfaGfaGfaCfAfAfu AfaaaCfa Ufu CfL96	AS1642	1752	gAfaUfgUfUfUfuAfuugUfcUfcUfgCfcsUfsg
D1643	S1643	661	GfgCfaGfaGfaCfAfAfuAfaAfAfCfaUfuCfL96	AS1643	1753	gAfa Ufguu Ufu Afu ugUfcUfcUfgCfcsUfsg
D1644	S1644	662	GfcAfgAfgAfcAfAfUfaAfaacAfuUfcCfL96	AS1644	1754	gGfaAfuGfUfUfuUfauuGfuCfuCfuGfcsCfsu
D1645	S1645	663	GfcAfgAfgAfcAfAfUfaAfaAfCfAfuUfcCfL96	AS1645	1755	gGfaAfuguUfuUfauuGfuCfuCfuGfcsCfsu
D1646	51646	664	CfaGfaGfaCfaAfUfAfaAfacaUfuCfcUfL96	AS1646	1756	aGfgAfaUfGfUfuUfuauUfgUfcUfcUfgsCfsc
D1647	S1647	665	CfaGfaGfaCfaAfUfAfaAfaCfAfUfuCfcUfL96	AS1647	1757	aGfgAfaugUfuUfuauUfgüfcUfcUfgsCfsc
D1648	S1648	666	AfgAfgAfcAfa UfAfAfa Afcau UfcCfuGfL96	AS1648	1758	cAfgGfa Af UfGfuUf uua U f uGfuCfuCfusGf se
D1649	S1649	667	AfgAfgAfcAfaUfAfAfaAfcAfUfUfcCfuGfL96	A51649	1759	cAfgGfa a uGfu Ufuua UfuGfuCfuCf usGfsc
D1650	S1650	668	GfaGfaCfa Afu AfAfAf aCfa uu CfcUfgUfL96	AS1650	1760	aCfaGfgAfAfUfgUf uu u Afu UfgUfcUfcsUfsg
D1651	S1651	669	GfaGfaCfaAfuAfAfAfaCfaUfUfCfcUfgUfL96	AS1651	1761	aCfaGfgaaUfgUfuuuAfuUfgUfcUfcsUfsg
D1652	S1652	670	AfgAfcAfa U fa AfAfAfcAfuucCfuGfuGf L96	AS1652	1762	cAfcAfgGfAfAfuGfuuuUfaüfuGfuCfusCfsu
D1653	S1653	671	AfgAfcAfaUfaAfAfAfcAfuUfCfCfuGfuGfL96	AS1653	1763	cAfcAfggaAfuGfuuuUfaUfuGfuCfusCfsu
D1654	S1654	672	GfaCfaAfuAfaAfAfCfaUfuccUfgUfgAfL96	AS1654	1764	uCfaCfaGfGfAfaUfguu UfuAfu UfgüfcsUf sc
D1655	S1655	673	GfaCfaAfuAfaAfAfCfaUfuCfCfUfgUfgAfL96	AS1655	1765	uCfaCfaggAfaUfguuUfuAfuUfgUfcsUfsc
D1656	S1656	674	AfcAfa Ufa AfaAfCfAfuUfccuGf uGf aAf 19 6	AS1656	1766	uUfcAfcAfGfGfa AfuguUfu Ufa UfuGfusCfsu
D1657	51657	675	AfcAfaUfaAfaAfCfAfuUfcCfUfGfuGfaAfL96	AS16S7	1767	u UfcAfcagGfaAfugu Ufu Ufa UfuGfusCfsu
D1658	S1658	676	CfaAfuAfaAfaCfAfUfuCfcugUfgAfaAfL96	AS1658	1768	uUfuCfaCfAfGfgAfaugUfuUfuAfuUfgsUfsc
D1659	S1659	677	CfaAfuAfaAfaCfAfUfuCfcUfGfUfgAfaAfL96	AS1659	1769	uUfuCfacaGfgAfaugUfuUfuAfuUfgsUfsc
D1660	S1660	678	Afa UfaAfa AfcAfUf UfcCfuguGfa AfaGfL96	AS1660	1770	cUfu UfcAfCfAfgGfaauGfu UfuUfaUfusGfsu
D1661	S1661	679	Afa Ufa Afa AfcAfUf UfcCfuGf UfGfa AfaGfl9 6	AS1661	1771	cUfu UfcacAfgGfa a uGfuUfu Ufa Uf usGfsu
D1562	51662	680	AfuAfaAfaCfaUfUfCfcUfgugAfaAfgGfL96	AS1662	1772	cCfuUfuCfAfCfaGfgaaUfgUfuUfuAfusUfsg
D1653	S1663	681	AfuAfaAfaCfaUfUfCfcUfgUfGfAfaAfgGfL96	AS1663	1773	cCfuUfucaCfaGfgaaUfgUfuUfuAfusüfsg
D1664	S1664	682	Ufa Afa AfcAfu UfCfCfuGfuga AfaGfgCfL96	AS1664	1774	gCfcUfuUfCfAfcAfggaAfuGfuUfuUfasUfsu
D1665	S1665	683	UfaAfaAfcAfuUfCfCfuGfuGfAfAfaGfgCfL96	AS1665	1775	gCfcUfuucAfcAfggaAfuGfuUfuUfasUfsu
D1666	S1666	684	Afa Afa CfaUfu CfCf UfgUfgaaAfgGfcAfL96	AS1666	1776	uGfcCfuUfUfCfa CfaggAfa UfgUfuUfusAfsu
D1667	S1667	685	AfaAfaCfaUfuCfCfUfgUfgAfAfAfgGfcAfL96	AS1667	1777	uGfcCfuuuCfaCfaggAfaUfgUfuUfusAfsu
D1668	S1668	686	Afa AfcAfu UfcCfUfGfuGfaaaGfgCfaCfL96	AS1668	1778	gUfgCfcUfUfUfcAfcagGfaAfuGfu U f usUfsa

119

D1669	51669	687	AfaAfcAfuUfcCfUfGfuGfaAfAfGfgCfaCfL96	AS1669	1779	gUfgCfcuuUfcAfcagGfaAfuGfuUfusUfsa
D1670	51670	688	AfaCfaUfuCfcUfGfUfgAfaagGfcAfcUfL96	AS1670	1780	aGfuGfcCfUfUfuCfacaGfgAfaUfgUfusUfsu
D1671	S1671	689	AfaCfaUfuCfcUfGfUfgAfaAfGfGfcAfcUfL96	AS1671	1781	aGfuGfccuUfuCfacaGfgAfaUfgUfusUfsu
D1672	S1672	690	AfcAfuUfcCfuGfUfGfaAfaggCfaCfuUfL96	AS1672	1782	aAfgUfgCfCfUfuUfcacAfgGfaAfuGfusUfsu
D1673	S1673	691	AfcAfuUfcCfuGfUfGfaAfaGfGfCfaCfuUfL96	AS1673	1783	aAfgUfgccUfuUfcacAfgGfaAfuGfusUfsu
D1674	S1674	692	CfaUfuCfcUfgUfGfAfaAfggcAfcUfuUfL96	AS1674	1784	aAfaGfuGfCfCfuUfucaCfaGfgAfaUfgsUfsu
D1675	51675	693	CfaUfuCfcUfgUfGfAfaAfgGfCfAfcUfuUfL96	AS1675	1785	aAfaGfugcCfuUfucaCfaGfgAfaUfgsUfsu
D1676	S1676	694	AfuUfcCfuGfuGfAfAfaGfgcaCfuUfuUfL96	AS1676	1786	aAfaAfgUfGfCfcUfuucAfcAfgGfaAfusGfsu
D1677	S1677	695	AfuUfcCf uGfuGfAfAfaGfgCfAfCfu UfuUf L9 6	AS1677	1787	aAfaAfgugCfcUfuucAfcAfgGfaAfusGfsu
D1678	51678	696	UfuCfcUfgUfgAfAfAfgGfcacUfuUfuCfL96	AS1678	1788	gAfaAfaGfUfGfcCfuuuCfaCfaGfgAfasUfsg
D1679	S1679	697	UfuCfcUfgUfgAfAfAfgGfcAfCfUfuUfuCfL96	AS1679	1789	gAfaAfaguGfcCfuuuCfaCfaGfgAfasUfsg
D1680	51680	698	UfcCfuGfuGfaAfAfGfgCfacuUfuUfcAfL96	AS1680	1790	uGfaAfaAfGfUfgCfcuuUfcAfcAfgGfasAfsu
D1681	S1681	699	UfcCfuGfuGfaAfAfGfgCfaCfUfUfuUfcAfL96	AS1681	1791	uGfa Af aagUfgCfcuu UfcAfcAfgGfasAfsu
D1682	S1682	700	CfcUfgUfgAfaAfGfGfcAfcuuUfuCfaUfL96	AS1682	1792	a UfgAfaAfAfGfuGfccu UfuCfaCfaGfgsAfsa
01683	S1683	701	CfcUfgUfgAfaAfGfGfcAfcUfUfUfuCfaUfL96	AS1683	1793	a UfgAfaaaGfu Gfccu UfuCfaCfa GfgsAfsa
01684	S1684	702	CfuGfuGfaAfaGfGfCfaCfuuuUfcAfuUfL96	AS1684	1794	aAfuGfaAfAfAfgUfgccUfuUfcAfcAfgsGfsa
01685	S1685	703	CfuGfuGfaAfaGfGfCfaCfuUfUfUfcAfuUfL96	AS1685	1795	aAfuGfaaaAfgUfgccUfuUfcAfcAfgsGfsa
D1686	51686	704	UfgUfgAfaAfgGfCfAfcUfuuuCfaUfuCfL96	AS1686	1796	gAfa UfgAfAfAfaGfu gcCfuUfuCfa CfasGfsg
01687	S1687	705	UfgUfgAfaAfgGfCfAfcUfuUfUfCfaUfuCfL96	AS1687	1797	gAfaUfgaaAfaGfugcCfuUfuCfaCfasGfsg
D1688	S1688	706	GfuGfaAfaGfgCfAfCfuUfuucAfuUfcCfL96	AS1688	1798	gGfaAfuGfAfAfaAfgugCfcUfuUfcAfcsAfsg
D1689	51689	707	GfuGfaAfaGfgCfAfCfuUfuUfCfAfuUfcCfL96	AS1689	1799	gGfa Afuga Afa AfgugCfcUfu UfcAfcsAfsg
D1690	S169O	708	UfgAfaAfgGfcAfCfUfuUfucaUfuCfcAfL96	AS 1690	1800	uGfgAfaUfGfAfaAfaguGfcCfuUfuCfasCfsa
D1691	51691	709	UfgAfaAfgGfcAfCfUfuUfuCfAfUfuCfcAfL96	A51691	1801	uGfgAfaugAfaAfaguGfcCfuUfuCfasCfsa
D1692	S1692	710	GfaAfaGfgCfaCfUfUfuUfcauUfcCfaCfL96	AS1692	1802	gUfgGfaAfUfGfaAfaagUfgCfcUfuUfcsAfsc
D1693	S1693	711	G fa AfaGfgCfaCfUf Ufu UfcAf UfUfcCf a CfL96	AS1693	1803	gUfgGfaauGfaAfaagUfgCfcUfuUfcsAfsc
D1694	S1694	712	Afa AfgGfcAfcUfUf UfuCfa uuCfcAfcUf L96	AS1694	1804	aGfuGfgAfAfUfgAfaa a GfuGfcCfuUfusCfsa
D1695	S1695	713	AfaAfgGfcAfcUfUfUfuCfaUfUfCfcAfcUfL96	AS1695	1805	aGfuGfga aUfgAfa aa GfuGfcCfuUfusCfsa

120

01696	S1696	714	AfaGfgCfaCfuUfUfUfcAfuucCfaCfuUfL96	AS1696	1806	a AfgUfgGfAfAfuGfa aaAfgUfgCfcU fusUfsc
D1697	S1697	715	AfaGfgCfaCfuUfUfUf cAfu UfCfCfa Cfu Uf L96	AS1697	1807	aAfgUfggaAfuGfaaaAfgUfgCfcUfusUfsc
D1698	S1698	716	AfgGfcAfcUfuUfUfCfaUfuccAfcüfuUfL96	AS1698	1808	aAfaGfuGfGfAfaUfgaaAfaGfuGfcCfusUfsu
D1699	S1699	717	AfgGfcAfcUfuUfUfCfaUfuCfCfAfcUfuUfL96	AS1699	1809	aAfaGfuggAfaUfgaaAfaGfuGfcCfusUfsu
D1700	S1700	718	GfgCfaCfuUfuUfCfAfuUfccaCfuUfuAfL96	AS1700	1810	uAfaAfgUfGfGfaAfugaAfaAfgUfgCfcsUfsu
D1701	S1701	719	GfgCfaCfuUfuUfCfAfuUfcCfAfCfuUfuAfL96	AS1701	1811	uAfaAfgugGfaAfugaAfaAfgUfgCfcsUfsu
D1702	51702	720	GfcAfcUfuUfuCfAfUfuCfcacUfuUfaAfL96	AS1702	1812	uUfaAfaGfUfGfgAfaugAfaAfaGfuGfcsCfsu
01703	S1703	721	GfcAfcUfuUfuCfAfUfu CfcAfCfUfu Ufa AfL96	A51703	1813	uUfaAfaguGfgAfaugAfaAfaGfuGfcsCfsu
D1704	51704	722	CfaCfuUfuUfcAfUfUfcCfacuUfuAfaCfL96	AS1704	1814	gUfuAfaAfGfUfgGfaauGfaAfaAfgUfgsCfsc
D1705	S1705	723	CfaCfuUfuUfcAfUfUfcCfaCfUfUfuAfaCfL96	AS1705	1815	gUfuAfaagUfgGfaauGfaAfaAfgUfgsCfsc
D1706	S1706	724	AfcUfuUfuCfaUfUfCfcAfcuuUfaAfcUfL96	AS1706	1816	aGfu Ufa AfAfGfuGfgaa UfgAfaAf aGf usGfsc
D1707	51707	725	AfcUfuUfuCfaUfUfCfcAfcUfUfUfaAfcUfL96	AS1707	1817	aGfuUfaaaGfuGfgaaUfgAfaAfaGfusGfsc
D1708	51708	726	CfuUfuUfcAfuUfCfCfaCfuuuAfaCfuUfL96	AS1708	1818	aAfgUfuAfAfAfgUfggaAfuGfaAfaAfgsUfsg
01709	S1709	727	CfuUfuUfcAfuUfCfCfaCfuUfUfAfaCfuUfL96	AS1709	1819	aAfgUfuaaAfgUfggaAfuGfaAfaAfgsUfsg
D1710	51710	728	UfuUfuCfaUfuCfCfAfcUfuuaAfcUfuGfL96	AS1710	1820	cAfaGfuUfAfAfaGfuggAfaUfgAfaAfasGfsu
D1711	51711	729	UfuUfu CfaUfuCfCfAf cUfu UfAfAfcUf uGf L96	AS1711	1821	cAfaGfuuaAfaGfuggAfaUfgAfaAfasGfsu
01712	51712	730	UfuUfcAfuUfcCfAfCfuUfuaaCfuUfgAfL96	AS1712	1822	uCfaAfgUfUfAfaAfgugGfaAfuGfaAfasAfsg
D1713	S1713	731	UfuUfcAfuUfcCfAfCfuUfuAfAfCfuUfgAfL96	AS1713	1823	uCfaAfguuAfaAfgugGfaAfuGfaAfasAfsg
01714	S1714	732	UfuCfaUfuCfcAfCfUfuUfaacUfuGfaUfL96	AS1714	1824	aUfcAfaGfUfUfaAfaguGfgAfaUfgAfasAfsa
01715	S1715	733	UfuCfaUfuCfcAfCftJfuUfaAfCfUfuGfaUfL96	AS1715	1825	aUfcAfaguUfaAfaguGfgAfaUfgAfasAfsa
01716	51716	734	UfcAfuUfcCfaCf Uf UfuAfa eu UfgAfu Uf L96	AS1716	1826	aAfuCfaAfGfUfuAfaagUfgGfaAfuGfasAfsa
D1717	S1717	735	UfcAfuUfcCfaCfUfUfuAfaCfUfUfgAfuUfL96	AS1717	1827	aAfuCfaagUfuAfaagUfgGfaAfuGfasAfsa
D1718	51718	736	CfaUfuCfcAfcUfUfUfaAfcuuGfaUfuUfL96	AS1718	1828	aAfaUfcAfAfGfuUfaaaGfuGfgAfaUfgsAfsa
D1719	51719	737	CfaUfuCfcAfcUfUfUfaAfcUfUfGfaUfuUfL96	AS1719	1829	a AfaUfcaaGf u UfaaaGfuGfgAfa UfgsAfsa
D1720	S1720	738	AfuUfcCfaCfuUfUfAfaCfuugAfuüfuUfL96	AS1720	1830	aAfaAfuCfAfAfgUfuaaAfgUfgGfaAfusGfsa
D1721	S1721	739	AfuUfcCfaCfuUfUfAfaCfuUfGfAfuUfuUfL96	AS 1721	1831	aAfaAfucaAfgUfuaaAfgUfgGfaAfusGfsa
D1722	S1722	740	UfuCfcAfcUfu UfAfAfcUfugaUfu UfuUfL96	AS1722	1832	aAfaAfaUfCfAfaGfuuaAfaGfuGfgAfasUfsg

121

D1723	S1723	741	U fuCfcAfcUfu UfAfAfcUfuGfAf Ufu UfuUf 196	AS1723	1833	aAfaAfaucAfaGfuuaAfaGfuGfgAfasUfsg
D1724	51724	742	UfcCfaCfuUfuAfAfCfuUfgauUfuUfuUfL96	AS1724	1834	aAfaAfaAfUfCfaAfguuAfaAfgUfgGfasAfsu
D1725	S1725	743	UfcCfaCfuUfuAfAfCfuUfgAfUfUfuUfuUfL96	AS1725	1835	a Afa Afaa uCfaAfguuAfa AfgUfgGfa sAfsu
D1726	S1726	744	CfcAfcUfuUfaAfCfUfuGfauuUfuUfuAfL96	AS1726	1836	uAfaAfaAfAfUfcAfaguUfaAfaGfuGfgsAfsa
D1727	S1727	745	CfcAfcUfuUfaAfCfUfuGfaUfUfUfuUfuAfL96	AS1727	1837	uAfaAfaaaUfcAfaguüfaAfaGfuGfgsAfsa
D1728	S1728	746	CfaCfuUfuAfaCfUfUfgAfuuuUfuUfaAfL96	AS1728	1838	uUfaAfaAfAfAfuCfaagUfuAfaAfgUfgsGfsa
D1729	S1729	747	CfaCfuUfuAfaCfUfUfgAfuUfUfUfuUfaAfL96	AS1729	1839	uUfaAfaaaAfuCfaagUfuAfaAfgUfgsGfsa
D1730	S1730	748	AfcUfuUfaAfcUfUfGfaUfuuuUfuAfaAfL96	AS1730	1840	uUfuAfaAfAfAfaUfcaaGfuUfaAfaGfusGfsg
D1731	S1731	749	AfcUfu UfaAfcUf UfGfaUf u UfUf Ufu AfaAf L9 6	AS1731	1841	uUfuAfaaaAfaUfcaaGfuUfaAfaGfusGfsg
D1732	S1732	750	CfuUfuAfaCfuUfGfAfuUfuuuUfaAfaUfL96	AS1732	1842	aüfuUfaAfAfAfaAfucaAfgUfuAfaAfgsUfsg
D1733	S1733	751	CfuUfuAfaCfuUfGfAfuUfuUfUfUfaAfaUfL96	AS1733	1843	a U f uUfaaa Afa AfucaAfgUf u Afa AfgsUfsg
D1734	S1734	752	UfuUfaAfcUfuGfAfUfuUfuuuAfaAfuUfL96	AS1734	1844	aAfuUfuAfAfAfaAfaucAfaGfuUfaAfasGfsu
D1735	S1735	753	UfuUfaAfcUfuGfAfUfuUfuUfUfAfaAfuUfL96	AS1735	1845	aAfuUfuaaAfaAfaucAfaGfuUfaAfasGfsu
D1736	S1736	754	Uf uAfaCfu UfgAfUfUfuUfu ua AfaUf uCf L96	AS1736	1846	gAfaUfuUfAfAfaAfaauCfaAfgUfuAfasAfsg
D1737	S1737	755	Uf UAfaCfu UfgAfUfUfuUfu UfAfAfaUf uCf L9 6	AS1737	1847	gAfa Uf uua AfaAf aa uCfaAfgUfu AfasAfsg
D1738	S1738	756	UfaAfcUfuGfaUfUfUfuUfuaaAfuUfcCfL96	AS1738	1848	gGfaAfuUfUfAfa Afa aa UfcAf aGfu UfasAfsa
D1739	S1739	757	UfaAfcUfuGfaUfUfUf uUfu AfAfAfu U fcCfL96	AS1739	1849	gGfaAfuuuAfaAfaaaUfcAfaGfuUfasAfsa
D1740	S1740	758	AfaCfuUfgAfuUfUfUftiüfaaaUfuCfcCfL96	AS1740	1850	gGfgAfaUfUfUfaAfaaaAfuCfaAfgUfusAfsa
D1741	S1741	759	AfaCfuUfgAfuUfUfUfuUfaAfAfUfuCfcCfL96	AS1741	1851	gGfgAfauuUfaAfaaaAfuCfaAfgUfusAfsa
D1742	S1742	760	AfcUfuGfaUfuUfUfUfuAfaauUfcCfcUfL96	AS1742	1852	aGfgGfaAfUfUfuAfaaaAfaUfcAfaGfusUfsa
D1743	S1743	761	AfcUfuGfaUfuUfUfUfuAfaAfUfUfcCfcUfL96	AS1743	1853	aGfgGfaauUfuAfaaaAfaUfcAfaGfusUfsa
D1744	S1744	762	CfuUfgAfuUfuUfUfUfaAfauuCfcCfuUfl96	AS1744	1854	aAfgGfgAfAfUfuUfaaaAfaAfuCfaAfgsUfsu
D1745	S1745	763	CfuUfgAfuUfuUfUfUfaAfaUfUfCfcCfuUfL96	AS1745	1855	aAfgGfgaaUfuUfaaaAfaAfuCfaAfgsUfsu
D1746	S1746	764	UfuGfaUfuUfuUfUfAfaAfuucCfcUfuAfL96	AS1746	1856	uAfaGfgGfAfAfuUfuaaAfaAfaUfcAfasGfsu
D1747	S1747	765	UfuGfaUfuUfuUfUfAfaAfuUfCfCfcUfuAfL96	AS1747	1857	uAfaGfggaAfuUfuaaAfaAfaUfcAfasGfsu
D1748	51748	766	UfgAfuUfuUfuUfAfAfaUfuccCfuUfaUfL96	AS1748	1858	a U fa AfgGfGf Afa Uf uu a Afa Afa AfuCfasAfsg
D1749	51749	767	UfgAfuUfuUfuUfAfAfaUfuCfCfCfuUfaUft96	AS1749	1859	aUfaAfgggAfaUfuuaAfaAfaAfuCfasAfsg

122

D1750	51750	768	GfaUfuUfuUfuAfAfAfuUfcccUfuAfuUfL96	AS1750	1860	aAfuAfaGfGfGfaAfuuuAfaAfaAfaUfcsAfsa
01751	S1751	769	GfaUfuUfuUfuAfAfAfu UfcCfCf Ufu Afu Uf L96	AS1751	1861	aAfuAfaggGfaAfuu uAfa Afa Afa UfcsAfsa
D1752	S1752	770	AfuUfuUfuUfaAfAfUfuCfccuüfaUfuGfL96	AS1752	1862	cAfaUfaAfGfGfgAfauuUfaAfaAfaAfusCfsa
D1753	S1753	771	AfuUf uUfuUfaAfAf Ufu CfcCfUfUfa UfuGfL96	AS1753	1863	cAfa UfaagGfgAfau uUfa AfaAfaAf usCfsa
D1754	S1754	772	UfuUfuUfuAfaAfUfUfcCfcuuAfuUfgUfL96	AS1754	1864	aCfaAfuAfAfGfgGfaauUfuAfaAfaAfasUfsc
D1755	S1755	773	UfuUf uUfii Afa AfUfUfcCfcUfUfAfu UfgUfL9 6	AS1755	1865	aCfaAfuaaGfgGfaauUfuAfaAfaAfasUfsc
D1756	S1756	774	UfuUfuUfaAfaüfUfCfcCfuuaUfuGfuCfL96	AS1756	1866	gAfcAfa UfAfAfgGfgaa UfuUfa Afa AfasAf su
D1757	S1757	775	UfuUfuUfaAfaUfUfCfcCfuüfAfUfuGfuCfL96	AS1757	1867	gAfcAfaua AfgGfgaaUfu Ufa AfaAfasAfsu
D1758	S1758	776	UfuUfuAfaAfuüfCfCfcUfuauUfgUfcCfL96	AS1758	1868	gGfaCfaAfUfAfaGfggaAfuUfuAfaAfasAfsa
D1759	S1759	777	UfuUfuAfaAfuUfCfCfcUfuAfUfUfgUfcCfL96	AS1759	1869	gGfaCfaau AfaGfgga Afu Ufu AfaAfasAfsa
D1760	S1760	778	UfuUfaAfaUfuCfCfCfuUfauuGfuCfcCfL96	AS1760	1870	gGfgAfcAfAfUfaAfgggAfaUfu UfaAfasAf sa
D1761	S1761	779	UfuUfaAfaUfuCfCfCfuUfaUfUfGfuCfcCfL96	AS1761	1871	gGfgAfcaaUfaAfgggAfaUfuUfaAfasAfsa
D1762	S1762	780	Ufu Afa Afu UfcCfCf Ufu Afu ugUfcCfcUf L96	AS1762	1872	aGfgGfaCfAfAfuAfaggGfaAfuUfuAfasAfsa
D1763	S1763	781	Ufu Afa Afu UfcCfCf Ufu Afu UfGfUfcCfcUfLSG	AS1763	1873	aGfgGfacaAfuAfaggGfaAfuUfuAfasAfsa
D1764	S1764	782	Ufa Afa UfuCfcCfUfUfaUf ugu CfcCfuUfL96	AS1764	1874	aAfgGfgAfCfAfaUfaagGfgAfaUfuUfasAfsa
D1765	S1765	783	UfaAfa UfuCfcCfUfUfaUf uGf Uf CfcCfu UfL96	AS1765	1875	aAfgGfgacAfaUfaagGfgAfaUfuUfasAfsa
DI 766	S1766	784	AfaAfuUfcCfcUfUfAfuUfgucCfcUfuCfL96	AS1766	1876	gAfaGfgGfAfCfaAfuaaGfgGfaAfuUfusAfsa
D1767	S1767	785	Afa AfuUfcCfcUfUfAfu UfgUfCfCf c Ufu CfL96	AS1767	1877	gAfaGfggaCfa Af u aa GfgGfa Af u U fusAfsa
D1768	S1768	786	AfaUfuCfcCfuUfAfUfuGfuccCfuUfcCfL96	AS1768	1878	gGfaAfgGfGfAfcAfauaAfgGfgAfaUfusUfsa
D1769	S1769	787	AfaUfuCfcCfuUfAfUfuGfuCfCfCfuUfcCfL96	AS1769	1879	gGfa AfgggAfcAfaua AfgGfgAfa UfusUfsa
D1770	S1770	788	Afu UfcCfcUfuAf Uf UfgUfcccUf uCf cAfL96	AS1770	1880	uGfgAfaGfGfGfaCfaauAfaGfgGfaAfusUfsu
D1771	S1771	789	Afu UfcCfcUfuAfUf UfgUfcCfCfUfu CfcAfL96	AS1771	1881	uGfgAfaggGfaCfa auAfa GfgGfaAfusUfsu
D1772	S1772	790	UfuCfcCfuUfaUfUfGfuCfccuUfcCfaAfL96	AS1772	1882	uUfgGfaAfGfGfgAfcaaUfaAfgGfgAfasUfsu
D1773	S1773	791	UfuCfcCfuUfaUfUfGfuCfcCfUfUfcCfaAfL96	AS1773	1883	uUfgGfaagGfgAfcaaUfaAfgGfgAfasUfsu
D1774	S1774	792	UfcCfcUfuAfuUfGfUfcCfcuuCfcAfaAfL96	AS1774	1884	uUfuGfgAfAfGfgGfacaAfuAfaGfgGfasAfsu
D177S	S1775	793	UfcCfcUfuAfuUfGfUfcCfcUfUfCfcAfaAfL96	AS1775	1885	uUfuGfgaaGfgGfacaAfuAfaGfgGfasAfsu
D1776	S1776	794	CfcCfuUfaUfuGfUfCfcCfuucCfaAfaAfL96	AS1776	1886	uUfuUfgGfAfAfgGfgacAfaUfaAfgGfgsAfsa

123

D1777	S1777	795	CfcCfuUfaUfuGfUfCfcCfuUfCfCfaAfaAfL96	AS1777	1887	uUfuUfggaAfgGfgacAfaUfaAfgGfgsAfsa
D1778	S1778	796	CfcUfuAfuUfgUfCfCfcUfuccAfaAfaAfl96	AS1778	1888	uUfu Ufu GfGfAfaGfgga Cfa AfuAfaGfgsGfsa
D1779	S1779	797	CfcUfuAfuUfgUfCfCfcUfuCfCfAfaAfaAfL96	AS1779	1889	uUfuUfuggAfaGfggaCfaAfuAfaGfgsGfsa
D1780	S1780	798	CfuUfaUfuGfuCfCfCfuUfccaAfaAfaAfL96	AS1780	1890	uUfuUfuUfGfGfaAfgggAfcAfaUfaAfgsGfsg
D1781	S1781	799	CfuUfaUfuGfuCfCfCfuUfcCfAfAfaAfaAfL96	AS1781	1891	uUfuüfuugGfaAfgggAfcAfaUfaAfgsGfsg
D1782	S1782	800	UfuAfuUfgUfcCfCfUfuCfcaaAfaAfaAfL96	AS1782	1892	uUfuUfuUfUfGfgAfaggGfaCfaAfuAfasGfsg
D1783	S1783	801	UfuAfuUfgUfcCfCfUfuCfcAfAfAfaAfaAfL96	AS1783	1893	uUfu Ufu uuGfgAfaggGfaCfaAfu AfasGfsg
D1784	S1784	802	UfaUfuGfuCfcCfUfUfcCfaaaAfaAfaAfL96	AS1784	1894	uUfuUfu Uf Uf UfgGfaagGfgAfcAfa UfasAfsg
D1785	S1785	803	UfaUfuGfuCfcCfUfUfcCfaAfAfAfaAfaAfL96	AS1785	1895	uUfuUfuuuUfgGfaagGfgAfcAfaUfasAfsg
D1786	S1786	804	AfuUfgUfcCfcUfUfCfcAfaaaAfaAfaGfL96	AS1786	1896	cUfuüfuUfUfUfuGfgaaGfgGfaCfaAfusAfsa
D1787	S1787	805	AfuUfgUfcCfcUfUfCfcAfaAfAfAfaAfaGfL96	AS1787	1897	cUf uUfu uu Uf uGfga aGfgGfaCfa Afus Afsa
D1788	S1788	806	UfuGfuCfcCfuUfCfCfaAfaaaAfaAfgAfL96	AS1788	1898	uCfuUfuUfUfUfuUfggaAfgGfgAfcAfasUfsa
D1789	S1789	807	UfuGfu CfcCfu UfCf Cfa Afa AfAfAfaAfgAf L96	AS1789	1899	uCfuUfuuuUfuUfggaAfgGfgAfcAfasUfsa
D1790	S1790	808	UfgUfcCfcUfuCfCfAfaAfaaaAfaGfaGfL96	AS1790	1900	cUfcUfu Uf UfUfu UfuggAfaGfgGfa CfasAfsu
D1791	S1791	809	UfgUfcCfcUfuCfCfAfaAfaAfAfAfaGfaGfL96	AS1791	1901	cUfcUfuuuUfuUfuggAfaGfgGfaCfasAfsu
01792	S1792	810	GfuCfcCfuUfcCfAfAfaAfaaaAfgAfgAfL96	AS1792	1902	uCfuCfuUfUfUfuUfuugGfaAfgGfgAfcsAfsa
D1793	S1793	811	GfuCfcCfuUfcCfAfAfaAfaAfAfAfgAfgAfL96	AS1793	1903	uCfuCfuuuUfuUfuugGfaAfgGfgAfcsAfsa
D1794	S1794	812	UfcCfcUfuCfcAfAfAfaAfaaaGfaGfaAfL96	AS1794	1904	uUfcUfcUfUfUfuUfuuuGfgAfaGfgGfasCfsa
D1795	S1795	813	UfcCfcUfu CfcAfAfAfa Afa AfAfGfaGfa AfL96	AS1795	1905	uUfcUfcuuUfuUfuuuGfgAfaGfgGfasCfsa
D1796	S1796	814	CfcCfuUfcCfaAfAfAfaAfaagAfgAfaUfL96	AS1796	1906	aUfuCfuCfUfUfuUfuuuUfgGfaAfgGfgsAfsc
D1797	S1797	815	CfcCfuUfcCfaAfAfAfaAfaAfGfAfgAfaUfL96	AS1797	1907	aUfuCfucuUfuUfuuuUfgGfaAfgGfgsAfsc
D1798	S1798	816	CfcüfuCfcAfaAfAfAfaAfagaGfaAfuCfL96	AS1798	1908	gAfuUfcUfCfUfuUfuuuUfuGfgAfaGfgsGfsa
D1799	S1799	817	CfcUfu CfcAfaAfAfAfaAfaGfAfGfa Afu CfL96	AS1799	1909	gAfuUfcucUfuUfuuuUfuGfgAfaGfgsGfsa
D1800	51800	818	CfuUfcCfaAfaAfAfAfaAfgagAfaUfcAfL96	AS 1800	1910	uGfaUfuCfUfCfuUfuuuUfuUfgGfaAfgsGfsg
D1801	51801	819	CfuUfcCfaAfaAfAfAfaAfgAfGfAfaUfcAfL96	AS1801	1911	uGfaUfucuCfuUfuuuUfuUfgGfaAfgsGfsg
D1802	51802	820	UfuCfcAfaAfaAfAfAfaGfagaAfuCfaAfL96	AS1802	1912	uUfgAfuUfCfUfcUfuuuUfuUfuGfgAfasGfsg
D1803	51803	821	UfuCfcAfaAfaAfAfAfaGfaGfAfAfuCfaAfL96	AS1803	1913	uUfgAfuucUfcUfuuuUfuUfuGfgAfasGfsg

124

D1804	51804	822	UfcCfaAfaAfaAfAfAfgAfgaaUfcAfaAfL96	AS1804	1914	uUfuGfaUfUfCfuCfuu uUfu UfuUfgGfa sAfsg
D1805	S1805	823	UfcCfaAfaAfaAfAfAfgAfgAfAfUfcAfaAfL96	AS1805	1915	uUfuGfauuCfuCfu uu Uf uUfu UfgGfasAfsg
D1806	$1806	824	CfcAfaAfaAfaAfAfGfaGfaauCfaAfaAfL96	AS1806	1916	u Ufu UfgAf UfUfcUfcuu UfuUfu UfuGfgsAfsa
D1807	S1807	825	CfcAfaAfaAfaAfAfGfaGfaAfUfCfaAfaAfL96	AS 1807	1917	uUfuUfgauüfcUfcuuUfuUfuUfuGfgsAfsa
01808	S1808	826	CfaAfaAfaAfaAfGfAfgAfaucAfaAfaUfL96	AS1808	1918	aUfuUfuGfAfUfu Cfucu UfuUfu UfuUfgsGfsa
01809	$1809	827	CfaAfaAfaAfaAfGfAfgAfaUfCfAfaAfaUfL96	AS1809	1919	aUfuUfugaüfuCfucuüfuUfu UfuUfgsGfsa
01810	S1810	828	AfaAfaAfaAfaGfAfGfaAfucaAfaAfuüfL96	AS1810	1920	aAfuUfuUfGfAfuüfcucUfuUfuUfuUfusGfsg
01811	$1811	829	AfaAfaAfaAfaGfAfGfaAfuCfAfAfaAfuüfL96	AS1811	1921	aAfuUfuugAfuUfcucüfuUfuUfuUfusGfsg
D1812	S1812	830	AfaAfaAfaAfgAfGfAfaüfcaaAfaUfuUfL96	AS1812	1922	aAfaUfuUfUfGfaUfucuCfuUfuUfuUfusUfsg
D1813	$1813	831	AfaAfa AfaAfgAfGfAfaUfcAfAfAfaUfuUfL96	AS1813	1923	aAfaUfuuuGfaUfucuCfuUfuUfuUfusüfsg
D1814	S1814	832	Afa AfaAfaGfaGfAfAfuCfaaa Afu Ufu Uf L96	AS1814	1924	aAfaAfuUfUfUfgAfuucUfcUfuUfuüfusUfsu
01815	$1815	833	AfaAfa AfaGfaGfAfAfu Cfa AfAfAfu UfuUf L96	AS1815	1925	aAfaAfuuuUfgAfuucUfcüfuUfu UfusUfsu
D1816	S1816	834	AfaAfaAfgAfgAfAfUfcAfaaaUfuUfuAfL96	AS1816	1926	uAfaAfaUfUfüfuGfauuCfuCfu Ufu UfusUfsu
D1817	S1817	835	AfaAfaAfgAfgAfAfUfcAfaAfAfUfuUfuAfL96	AS1817	1927	uAfaAfauuUfuGfauuCfuCfuUfuUfusUfsu
01818	51818	836	Afa AfaGfaGfaAfüfCfa Afaauüfu UfaCf L96	AS1818	1928	gUfaAfa AfUf UfuUfgau UfcUfcUfu UfusUfsu
01819	S1819	837	AfaAfaGfaGfaAfUfCfaAfaAfUfUfuUfaCfL96	AS1819	1929	güfaAfaauUfuUfgauUfcUfcUfuUfusUfsu
D1820	S1820	838	AfaAfgAfgAfaUfCfAfaAfauuUfuAfcAfL96	AS1820	1930	uGfu AfaAfAfUfu UfugaUfuCf u Cfu UfusUfsu
01821	S1821	839	AfaAfgAfgAfaUfCfAfaAfaUfUfUfuAfcAfL96	AS1821	1931	uGfuAfaaaUfuUfugaUfuCfuCfuUfusUfsu
D1822	S1822	840	AfaGfaGfaAfuCfAfAfaAfuuuUfaCfaAfL96	AS1822	1932	uUfgUfaAfAfAfuüfuugAfuUfcUfcUfusUfsu
D1823	S1823	841	AfaGfaGfaAfuCfAfAfaAfuUfUfUfaCfaAfL96	AS 1823	1933	uUfgUfaaaAfuüfuugAfuUfcUfcUfusUfsu
D1824	S1824	842	AfgAfgAfa UfcAfAfAfaUfu uuAf cAfaAf L96	AS1824	1934	uUfuGfuAfAfAfaüfuuuGfaUfuCfuCfusUfsu
D1825	$1825	843	AfgAfgAfa UfcAfAfAfaüfu Uf UfAfcAfaAfL96	AS1825	1935	uüfuGfuaaAfaUfuuuGfaUfuCfuCfusUfsu
D1826	S1826	844	GfaGfaAfuCfaAfAfAfuUfuuaCfaAfaGfL96	AS1826	1936	cUf U UfgUfAfAfaAf u uu UfgAf uUfcüfcsüfsu
D1827	$1827	845	GfaGfaAfuCfaAfAfAfuUfuUfAfCfaAfaGfL96	AS1827	1937	cUfuUfguaAfaAfuuuUfgAfuüfcUfcsUfsu
D1828	S1828	846	AfgAfaUfcAfaAfAfUfuUfuacAfaAfgAfL96	AS1828	1938	uCfuüfuGfUfAfaAfauuUfuGfaUfuCfusCfsu
D1829	$1829	847	AfgAfaUfcAfaAfAfUfuUfuAfCfAfaAfgAfL96	AS1829	1939	uCfuüfugu AfaAfa u uUfuGfa UfuCfusCfsu
D1830	S1830	848	GfaAfuCfaAfaAfUfUfuUfacaAfaGfaAfL96	AS1830	1940	uUfcUfuUfGfUfaAfaauUf uUfgAfu U fcsUfsc

125

D1831	S1831	849	GfaAfuCfaAfaAfUfüfuUfaCfAfAfaGfaAfL96	AS1831	1941	uUfcUfuugUfaAfaauUfuUfgAfuUfcsUfsc
D1832	S1832	850	AfaUfcAfaAfaUfUfUfuAfcaaAfgAfaUfL96	AS1832	1942	aUfu CfuUfUfGfu Afaaa Ufu UfuGfa UfusCfsu
D1833	S1833	851	AfaUfcAfa Afa UfUfUfuAfcAfAfAfgAfaUf L96	AS1833	1943	aUfuCfuuuGfuAfaaaUfuUfuGfaUfusCfsu
D1834	S1834	852	AfuCfaAfaAfuUfUfUfaCfaaaGfaAfuCfL96	AS1834	1944	gAfu UfcUfUf UfgUfaaa AfuUfu UfgAfusUfsc
D1835	S1835	853	AfuCfaAfaAfuUfUfUfaCfaAfAfGfaAfuCfLSÔ	AS1835	1945	gAfuUfcuuUfgUfaaaAfuUfuUfgAfusUfsc
D1836	S1836	854	UfcAfaAfaUfuUfUfAfcAfaagAfaUfcAfL96	AS1836	1946	uGfaUfuCfUfUfuGfuaaAfaUfuUfuGfasUfsu
D1837	51837	855	UfcAfa Afa UfuUfUfAfcAfa AfGfAfa UfcAfL96	AS1837	1947	uGfaUfucuUfuGfuaaAfaUfuUfuGfasUfsu
D1838	S1838	856	CfaAfaAfuUfuUfAfCfaAfagaAfuCfaAfL96	AS1838	1948	uUfgAfuUfCfUfuUfguaAfaAfuUfuUfgsAfsu
D1839	S1839	857	Cfa Afa Afu UfuUfAfCfa AfaGfAfAfu Cfa AfL96	AS 1839	1949	uUfgAfuucUfu Ufgua AfaAf uUfu UfgsAfsu
D1840	51840	858	Afa Afa UfuUfuAfCfAfa Afgaa UfcAfa AfL96	AS1840	1950	uUfuGfaUfUfCfuUfuguAfaAfaUfuUfusGfsa
01841	51841	859	AfaAfaUfuUfuAfCfAfaAfgAfAfUfcAfaAfL96	AS1841	1951	uUfuGfauuCfuUfuguAfaAfaUfuUfusGfsa
01842	51842	860	AfaAfuUfuUfaCfAfAfaGfaauCfaAfaGfL96	AS1842	1952	cUfuUfgAfUfUfcUfuugUfaAfaAfuUfusUfsg
D1843	S1843	861	AfaAfuUfuUfaCfAfAfaGfaAfUfCfaAfaGfL96	AS1843	1953	cUfuUfgauUfcUfuugUfaAfaAfuUfusUfsg
D1844	51844	862	AfaUfuUfuAfcAfAfAfgAfaucAfaAfgGfL96	AS1844	1954	cCfuUfuGfAfUfuCfuuuGfuAfaAfaUfusUfsu
D1845	S1845	863	AfaUfuUfuAfcAfAfAfgAfaUfCfAfaAfgGfL96	AS1845	1955	cCfuUfugaUfu Cfu uuGfu AfaAfa UfusUfsu
D1846	S1846	864	AfuUfuUfa Cfa AfAfGfa Afuca Afa GfgAfL96	AS1846	1956	uCfcUfu UfGfAfu UfcuuUfgUfaAfaAfusUfsu
D1847	51847	865	Afu Ufu Ufa CfaAfAfGfa AfuCfAfAfaGfgAf L96	AS1847	1957	uCfcUfuugAfuUfcuuUfgUfaAfaAfusUfsu
D1848	51848	866	UfuUfuAfcAfaAfGfAfaUfcaaAfgGfaAfL96	AS1848	1958	uUfcCfu UfUfGfaUfucu UfuGf uAfa AfasUfsu
D1849	S1849	867	UfuUfuAfcAfaAfGfAfaUfcAfAfAfgGfaAfL96	AS1849	1959	uUfcCfu uu Gfa Ufucu UfuGfu Afa AfasUfsu
D1850	S1850	868	UfuUfaCfaAfaGfAfAfuCfaaaGfgAfaUfL96	AS1850	1960	aUfuCfcUfUfUfgAfuucUfuUfgUfaAfasAfsu
D1851	51851	869	Ufu UfaCfa AfaGfAfAf uCfa AfAfGfgAfaUfL9 6	AS1851	1961	aUfuCfcuuUfgAfuucUfuUfgUfaAfasAfsu
D18S2	51852	870	UfuAfcAfaAfgAfAfUfcAfaagGfaAfuUfL96	AS1852	1962	aAfuUfcCfUfUfuGfauuCfuUfuGfuAfasAfsa
D1853	51853	871	UfuAfcAfaAfgAfAfUfcAfaAfGfGfaAfuüfL96	AS1853	1963	aAfu Ufccu UfuGfa uuCfuUfuGfu AfasAfsa
D1854	S1854	872	UfaCfaAfaGfaAfUfCfaAfaggAfaUfuCfL96	AS1854	1964	gAfa UfuCf CfUfu UfgauUfcUfuUfgUfasAfsa
D1855	S1855	873	UfaCfaAfaGfaAfUfCfaAfaGfGfAfaUfuCfL96	AS1855	1965	gAfa Ufuccüf uUfgau UfcUfuUfgUfasAfsa
D1856	51856	874	AfcAfaAfgAfaUfCfAfaAfggaAfuUfcUfL96	AS1856	1966	aGfa Af uUfCfCfu Ufuga UfuCfu U f uGfusAfsa
01857	S1857	875	AfcAfaAfgAfaUfCfAfaAfgGfAfAfuUfcUfL96	AS1857	1967	aGfaAfuucCfuUfugaUfuCfuUfuGfusAfsa

126

D1858	S1858	876	CfaAfaGfaAfuCfAfAfaGfgaaUfuCfuAfL96	AS1858	1968	uAfgAfaUfUfCfcUfuugAfuUfcUfuUfgsUfsa
D18S9	S1859	877	CfaAfaGfaAfuCfAfAfaGfgAfAfUfuCfuAfL96	AS1859	1969	uAfgAfauuCfcUf uugAfu UfcUfu U fgsUfsa
D1860	S1860	878	Afa AfgAfa UfcAfAfAfgGfaau UfcUfaGf L96	AS1860	1970	cUfaGfaAfUfUfcCfuuuGfaUfuCfuUfusGfsu
D1861	S1861	879	Afa AfgAfa UfcAfAfAfgGfaAfüf UfcUfa GfL96	AS1861	1971	cUfaGfaauUfcCfuuuGfaUfuCfuUfusGfsu
D1862	S1862	880	AfaGfaAfuCfaAfAfGfgAfauuCfuAfgAfL96	AS1862	1972	uCfuAfgAfAfUfuCfcuu UfgAfu UfcUf usUfsg
D1863	S1863	881	AfaGfaAfuCfaAfAfGfgAfaUfUfCfuAfgAfL96	AS1863	1973	uCfuAfgaaUfuCfcuuUfgAfuUfcUfusUfsg
D1864	S1864	882	AfgAfa UfcAfaAfGfGfaAfuucUfaGfaAfL96	AS1864	1974	u UfcUfaGfAfAfuUfccu UfuGfaUfuCfusUfsu
D1865	S1865	883	AfgAfa UfcAfaAfGfGfaAfuUfCfUfaGfaAfL96	AS1865	1975	u UfcUfaga Afu Ufccu UfuGfa UfuCf usUfsu
01866	S1866	884	GfaAfuCfaAfaGfGfAfaUfucuAfgAfaAfL96	AS1866	1976	u UfuCfuAfGfAfaUfuccUfu UfgAfuUfcsUfsu
D1867	S1867	885	GfaAfuCfaAfaGfGfAfaUfuCfUfAfgAfaAfL96	AS1867	1977	uUfuCfuagAfaUfuccUfuUfgAfuUfcsUfsu
01868	S1868	886	AfaUfcAfaAfgGfAfAfuUfcuaGfaAfaGfL96	AS1868	1978	cUfu UfcUfAfGfa Afu ucCfu UfuGfa UfusCfsu
D1869	S1869	887	AfaUfcAfaAfgGfAfAfuUfcUfAfGfaAfaGfL96	AS1869	1979	cUfuüfcuaGfaAfuucCfuUfuGfaUfusCfsu
D1870	S1870	888	AfuCfaAfaGfgAfAfUfuCfuagAfaAfgUfL96	AS1870	1980	aCfuUfuCfUfAfgAfauuCfcUfuUfgAfusUfsc
D1871	S1871	889	AfuCfaAfaGfgAfAfUfuCfuAfGfAfaAfgUfL96	AS1871	1981	aCfuUfucuAfgAfauuCfcUfuUfgAfusUfsc
D1872	S1872	890	UfcAfaAfgGfaAfUfUfcUfagaAfaGfuAfL96	AS1872	1982	uAfcUfuUfCfUfaGfaauUfcCfuUfuGfasUfsu
D1873	S1873	891	UfcAfaAfgGfaAfUfUfcUfaGfAfAfaGfuAfL96	AS1873	1983	uAfcUfuucUfaGfaauUfcCfuUfuGfasUfsu
D1874	S1874	892	Cfa AfaGfgAfa Uf UfCf u AfgaaAfgUfaUfL96	AS1874	1984	aUfaCfuUfUfCfuAfgaaUfuCfcUfuUfgsAfsu
D1875	S1875	893	Cfa AfaGfgAfaUf UfCf u AfgAfAfAfgU fa UfL96	AS1875	1985	aUfaCfuuuCfuAfgaaUfuCfcUfuUfgsAfsu
01876	S1876	894	AfaAfgGfaAfuUfCfUfaGfaaaGfuAfuCfL96	AS1876	1986	gAfuAfcUfUfUfcUfagaAfuUfcCfuUfusGfsa
D1877	S1877	895	AfaAfgGfaAfuUfCfUfaGfaAfAfGfuAfuCfL96	AS1877	1987	gAfuAfcu uUfcUfagaAfu UfcCfu UfusGfsa
D1878	S1878	896	AfaGfgAfa UfuCfUfAfgAfaagUfaUfcUfL96	AS1878	1988	aGfaUfaCfUfUfuCfuagAfaUfuCfcUfusUfsg
D1879	S1879	897	AfaGfgAfaUfuCfUfAfgAfaAfGfUfaUfcUfL96	AS1879	1989	aGfaUfacuUfuCfuagAfaUfuCfcUfusUfsg
D1880	S1880	898	AfgGfaAfuUfcUfAfGfaAfaguAfuCfuGfL96	AS1880	1990	cAfgAfuAfCfUfuUfcuaGfaAfuUfcCfusUfsu
D1881	S1881	899	AfgGfaAfuUfcUfAfGfaAfaGfUfAfuCfuGfL96	AS1881	1991	cAfgAfuacUfu UfcuaGfa Afu UfcCfusUfsu
D1882	S1882	900	GfgAfa UfuCfu AfGfAfa AfguaUfcUfgGfLS 6	AS1882	1992	cCfaGfaUfAf Cfu Ufucu AfgAfa Uf uCfcsUfsu
D1883	S1883	901	GfgAfaUfuCfuAfGfAfaAfgUfAfUfcUfgGfL96	AS1883	1993	cCfaGfaua CfuUfucu AfgAfaUfu CfcsUfsu
D1884	S1884	902	Gf a Af uUfcUfaGfAfAfa Gf uau Cf uGfgGf L96	AS1884	1994	cCfcAfgAfUfAfcUfuucUfaGfaAfuUfcsCfsu

127

D1885	S1885	903	GfaAfuUfcUfaGfAfAfaGfuAfUfCfuGfgGfL96	AS1885	1995	cCfcAfgauAfcUfuucUfaGfaAfuUfcsCfsu
D1886	51886	904	AfaUfuCfuAfgAfAfAfgUfaucUfgGfgCfL96	AS1886	1996	gCfcCfaGfAfUfaCfuuuCfuAfgAfaUfusCfsc
D1887	51887	905	AfaUfuCfuAfgAfAfAfgUfaUfCfUfgGfgCfL96	AS1887	1997	gCfcCfagaUfaCfuuuCfuAfgAfaUfusCfsc
D1888	S1888	906	Afu UfcUfaGfaAfAfGfu AfucuGfgGfcAfL96	AS 1888	1998	uGfcCfcAfGfAfu Afcu uUfcUfaGfa AfusUfsc
D1889	51889	907	Afu UfcüfaGfaAfAfGf uAfu CfUfGfgGfcAf 196	AS1889	1999	uGfcCfcagAfuAfcuuUfcUfaGfa AfusUfsc
D1890	51890	908	Ufu Cfu AfgAfaAfGfUfa UfcugGfgCfaGfL9 6	AS 1890	2000	cUfgCfcCfAfGfaUfacuUfuCfuAfgAfasUfsu
D1891	S1891	909	Ufu CfuAfgAfaAfGf Ufa UfcUfGfGfgCfaGfL96	AS 1891	2001	cUfgCfccaGfaUfacuUfuCfuAfgAfasUfsu
D1892	S1892	910	UfcUfaGfaAfaGfüfAfuCfuggGfcAfgAfL96	AS1892	2002	uCfuGfcCfCfAfgAfuacUfuUfcUfaGfasAfsu
D1893	S1893	911	UfcUfaGfaAfaGf UfAfu CfuGfGfGfcAfgAf L96	AS1893	2003	uCfuGfcccAfgAfuacUfu UfcUfaGfasAfsu
D1894	S1894	912	CfuAfgAfaAfgUfAfUfcUfgggCfaGfaAfL96	AS1894	2004	uUfcUfgCfCfCfaGfauaCfuUfuCfuAfgsAfsa
D1895	S1895	913	CfuAfgAfaAfgUfAfUfcUfgGfGfCfaGfaAfL96	AS 1895	2005	uUfcUfgccCfaGfauaCfuUfuCfuAfgsAfsa
D1896	S1896	914	UfaGfaAfaGfuAfUfCfuGfggcAfgAfaCfL96	AS1896	2006	gUfu CfuGfCf CfcAfga u AfcUfuUfcU fa sGfsa
D1897	S1897	915	UfaGfaAfaGfuAfUfCfuGfgGfCfAfgAfaCfL96	AS1897	2007	gUfu CfugcCfcAfga u AfcUfuUfcUfa sGfsa
D1898	S1898	916	AfgAfaAfgUfaUfCfUfgGfgcaGfaAfcGfL96	AS1898	2008	cGf uUfcUfGf CfcCfaga Ufa CfuUfu CfusAfsg
D1899	S1899	917	AfgAfaAfgUfaUfCfUfgGfgCfAfGfaAfcGfL96	AS1899	2009	cGf uUfcugCfcCfaga UfaCfu Ufu CfusAfsg
D1900	S1900	918	GfaAfaGfuAfuCfUfGfgGfcagAfaCfgCfL96	AS1900	2010	gCfgUfuCfUfGfcCfcagAfuAfcUfuUfcsUfsa
D1901	S1901	919	GfaAfaGfuAfuCfUfGfgGfcAfGfAfaCfgCfL96	AS1901	2011	gCfgUfucuGfcCfcagAfuAfcUfuUfcsUfsa
D1902	S1902	920	AfaAfgUfa UfcUfGfGfgCfaga AfcGfcUf L96	A51902	2012	aGfcGfuUfCfUfgCfccaGfaUfaCfuUfusCfsu
D1903	51903	921	AfaAfgUfaUfcUfGfGfgCfaGfAfAfcGfcUfLS6	AS1903	2013	aGfcGfuucUfgCfccaGfaUfaCfuUfusCfsu
D1904	S1904	922	AfaGfuAfuCfuGfGfGfcAfga aCfgCfuAfL9 6	AS1904	2014	uAfgCfgUfUfCfuGfcccAfgAfuAfcUfusUfsc
D1905	S1905	923	AfaGfuAfuCfuGfGfGfcAfgAfAfCfgCfuAfL96	AS1905	2015	uAfgCfguu Cfu GfcccAfgAfuAfcUfusUfsc
D1906	51906	924	AfgUfaUfcUfgGfGfCfaGfaacGfcUfaGfL96	AS1906	2016	cUfaGfcGfUfUfcUfgccCfaGfaUfaCfusUfsu
D1907	S1907	925	AfgUfaUfcUfgGfGfCfaGfaAfCfGfcUfaGfL96	AS1907	2017	cUfaGfcguUfcUfgccCfaGfaUfaCfusUfsu
D1908	S1908	926	GfuAfuCfuGfgGfCfAfgAfacgCfuAfgGfL96	AS1908	2018	cCfuAfgCfGfUfuCfugcCfcAfgAfuAfcsUfsu
D1909	S1909	927	GfuAfuCfuGfgGfCfAfgAfaCfGfCfuAfgGfL96	AS 1909	2019	cCfuAfgcgUfuCfugcCfcAfgAfuAfcsUfsu
D1910	S1910	928	UfaUfcUfgGfgCfAfGfaAfcgcUfaGfgAfL96	AS1910	2020	uCfcUfaGfCfGfuUfcugCfcCfaGfaUfasCfsu
D1911	51911	929	UfaUfcUfgGfgCfAfGfaAfcGfCfUfaGfgAfL96	AS1911	2021	u CfcUfagcGfuUfcugCfcCfaGfaUfasCf su

128

D1912	S1912	930	AfuCfu GfgGfcAfGfAfa CfgcuAfgGfaGfL96	AS1912	2022	cUfcCfuAfGfCfgUfucuGfcCfcAfgAfusAfsc
D1913	S1913	931	AfuCfuGfgGfcAfGfAfaCfgCfUfAfgGfaGfL96	AS1913	2023	cUfcCfuagCfgUfucuGfcCfcAfgAfusAfsc
D1914	S1914	932	UfcUfgGfgCfaGfAfAfcGfcuaGfgAfgAfL96	AS1914	2024	uCfuCfcUfAfGfcGfuucUfgCfcCfaGfasUfsa
D1915	51915	933	UfcUfgGfgCfaGfAfAfcGfcüfAfGfgAfgAfL96	AS1915	2025	uCfuCfcuaGfcGfuucUfgCfcCfaGfasUfsa
D1916	51916	934	CfuGfgGfcAfgAfAfCfgCfuagGfaGfaGfL96	AS 1916	2026	cUfcUfcCfUfAfgCfguuCfuGfcCfcAfgsAfsu
D1917	S1917	935	CfuGfgGfcAfgAfAfCfgCfuAfGfGfaGfaGfL96	AS 1917	2027	cUfcUfccuAfgCfguuCfuGfcCfcAfgsAfsu
D1918	51918	936	UfgGfgCfaGfaAfCfGfcUfaggAfgAfgAfL96	AS 1918	2028	uCfuCfuCfCfUfaGfcguUfcUfgCfcCfasGfsa
D1919	S1919	937	UfgGfgCfaGfaAfCfGfcUfaGfGfAfgAfgAfL96	AS 1919	2029	uCfuCfuccUfaGfcguUfcUfgCfcCfasGfsa
D1920	S1920	938	GfgGfcAfgAfaCfGfCfuAfggaGfaGfaUfL96	AS 1920	2030	aUfcUfcUfCfCfuAfgcgUfuCfuGfcCfcsAfsg
D1921	S1921	939	GfgGfcAfgAfaCfGfCfuAfgGfAfGfaGfaUfL96	AS 1921	2031	aUfcUfcucCfuAfgcgUfuCfuGfcCfcsAfsg
01922	S1922	940	GfgCfaGfaAfcGfCfUfaGfgagAfgAfuCfL96	AS 1922	2032	gAfuCfuCfUfCfcUfagcGfuUfcUfgCfcsCfsa
01923	S1923	941	GfgCfaGfaAfcGfCfUfaGfgAfGfAfgAfuCfL96	AS 1923	2033	gAfuCfucuCfcUfagcGfuUfcUfgCfcsCfsa
01924	51924	942	GfcAfgAfaCfgCfUfAfgGfagaGfaUfcCfL96	AS1924	2034	gGfaUfcUfCfUfcCfuagCfgUfuCfuGfcsCfsc
D1925	S1925	943	GfcAfgAfaCfgCfUfAfgGfaGfAfGfaUfcCfL96	AS1925	2035	gGfaUfcucUfcCfuagCfgUfu Cfu GfcsCfsc
D1926	51926	944	CfaGfaAfcGfcUfAfGfgAfgagAfuCfcAfL96	AS1926	2036	uGfgAfuCfUfCfuCfcuaGfcGfuUfcUfgsCfsc
D1927	S1927	945	CfaGfaAfcGfcUfAfGfgAfgAfGfAfuCfcAfL96	AS1927	2037	uGfgAfucuCfuCfcuaGfcGfuUfcUfgsCfsc
D1928	S1928	946	AfgAfaCfgCfuAfGfGfaGfagaUfcCfaAfL96	AS1928	2038	u UfgGfaUf CfUfcUfccuAfgCfgUfu CfusGfsc
D1929	S1929	947	AfgAfaCfgCfuAfGfGfaGfaGfAfUfcCfaAfL96	AS1929	2039	u UfgGfa ucUfcUfccuAfgCfgUf uCfusGfsc
D1930	S1930	948	GfaAfcGfcU faGfGfAfgAfga uCfcAf a AfL96	AS1930	2040	u UfuGfgAf UfCfuCfuccUfaGfcGfu UfcsUfsg
D1931	S1931	949	GfaAfcGfcUfa GfGfAfgAfgAf UfCfcAfaAfL96	AS1931	2041	u UfuGfgauCfu CfuccUfaGfcGf uUfcsUfsg
D1932	S1932	950	AfaCfgCfuAfgGfAfGfaGfaucCfaAfaUfL96	AS1932	2042	aUfuUfgGfAfUfcUfcucCfuAfgCfgUfusCfsu
D1933	S1933	951	AfaCfgCfuAfgGfAfGfaGfaUfCfCfaAfaUfL96	AS1933	2043	aUfuUfggaUfcUfcucCfuAfgCfgUfusCfsu
D1934	51934	952	AfcGfcUfaGfgAfGfAfgAfuccAfaAfuUfL96	AS 19 34	2044	aAfuUfuGfGfAfuCfucuCfcUfaGfcGfusUfsc
D1935	S1935	953	AfcGfcUfaGfgAfGfAfgAfuCfCfAfaAfuUfL96	AS1935	2045	a Afu UfuggAf uCfucuCfcUfaGfcGfu sUfsc
D1936	51936	954	CfgCfuAfgGfaGfAfGfaUfccaAfaUfuUfL96	AS1936	2046	aAfaUfuUfGfGfaUfcucUfcCfuAfgCfgsUfsu
D1937	S1937	955	CfgCfuAfgGfaGfAfGfaUfcCfAfAfaUfuUfL96	AS1937	2047	aAfaUfuugGfaUfcucUfcCfuAfgCfgsUfsu
D1938	S1938	956	GfcUfaGfgAfgAfGfAfu Cfcaa Afu Uf uCf L96	AS1938	2048	gAfaAfu UfUfGfgAfu cuCfuCfcUfaGfcsGfsu

129

D1939	S1939	957	GfcUfaGfgAfgAfGfAfuCfcAfAfAfuUfuCfl-96	AS 1939	2049	gAfaAfu uuGfgAfu cuCf uCfcUfaGfcsGfsu
D1940	S1940	958	CfuAfgGfaGfaGfAfUfcCfaaaUfuUfcCfL96	AS 19 40	2050	gGfaAfaUfUfUfgGfaucUfcUfcCfuAfgsCfsg
D1941	51941	959	CfuAfgGfaGfaGfAfUfcCfaAfAfUfuUfcCfL96	AS 1941	2051	gGfaAfauuUfgGfaucUfcUfcCfuAfgsCfsg
D1942	S1942	960	UfaGfgAfgAfgAfUfCfcAfaauUfuCfcAfL96	AS 1942	2052	uGfgAfaAfUfUfuGfgauCfuCfuCfcUfasGfsc
D1943	S1943	961	UfaGfgAfgAf gAf UfCfcAfa AfUfUfu CfcAf L96	AS1943	2053	uGfgAfaauUfuGfgauCfuCfuCfcUfasGfsc
D1944	S1944	962	AfgGfaGfaGfa UfCf Cfa Afau uUfcCfaUfL96	AS1944	2054	aUfgGfaAfAfUfuUfggaUfcUfcUfcCfusAfsg
D1945	51945	963	AfgGfaGfaGfaUfCfCfaAfaUfUfUfcCfaUfL96	AS1945	2055	aUfgGfaaaUfuUfggaUfcUfcUfcCfusAfsg
D1946	S1946	964	GfgAfgAfgAfuCfCfAfaAfuuuCfcAfuUfL96	AS 1946	2056	aAfuGfgAfAfAfuUfuggAfuCfuCfuCfcsUfsa
D1947	S1947	965	GfgAfgAfgAfuCfCfAfaAfuUfUfCfcAfuUfL96	AS1947	2057	aAfuGfgaaAfuUfuggAfuCfuCfuCfcsUfsa
D1948	S1948	966	GfaGfaGfaUfcCfAfAfaUfuucCfaUfuGfL96	AS1948	2058	cAfaUfgGfAfAfaUfuugGfaUfcUfcUfcsCfsu
01949	S1949	967	GfaGfaGfaUfcCfAfAfa UfuUfCfCfa UfuGfL96	AS1949	2059	cAfaUfggaAfaUfuugGfaUfcUfcUfcsCfsu
01950	S1950	968	AfgAfgAfuCfcAfAfAfuUfuccAfuUfgUfL96	AS1950	2060	aCfaAfuGfGfAfaAfuuuGfgAfuCfuCfusCfsc
D1951	S1951	969	AfgAfgAfuCfcAfAfAfuUfuCfCfAfuUfgUfL96	AS1951	2061	aCfaAfuggAfaAfuuuGfgAfuCfuCfusCfsc
D1952	51952	970	GfaGfa UfcCfaAfAfUfuUfccaU f uGfuCf L96	AS1952	2062	gAfcAfaUfGfGfaAfauuUfgGfaUfcUfcsUfsc
D1953	S1953	971	GfaGfaUfcCfaAfAfUfuUfcCfAfUfuGfuCfL96	AS1953	2063	gAfcAfaugGfaAfauuUfgGfaUfcUfcsUfsc
D1954	S1954	972	AfgAf u CfcAfa Af UfUfuCfcauUfgUfcUfL96	AS1954	2064	aGfaCfaAfUfGfgAfaauUfuGfgAfuCfusCfsu
D1955	51955	973	AfgAfuCfcAfaAfUfUfuCfcAfUfUfgUfcUfL96	AS1955	2065	a GfaCf aa uGfgAfa a uUf uGfgAfu CfusCfsu
D1956	S1956	974	GfaUfcCfaAfaUfUfUfcCfauuGfuCfuUfL96	AS1956	2066	aAfgAfcAfAfUfgGfaaaUfuUfgGfaUfcsUfsc
D1957	S1957	975	GfaUfcCfaAfaUfUfUfcCfaUfUfGfuCfuUfL96	AS1957	2067	a AfgAfca a UfgGfaaa UfuUfgGfa UfcsUfsc
D1958	S1958	976	AfuCfcAfaAfu UfUfCfcAf uugUfcUf uGfL96	AS1958	2068	cAfaGfaCfAfAfuGfgaaAfuUfuGfgAfusCfsu
D1959	S1959	977	AfuCfcAfaAfuUfUfCfcAfuUfGfUfcUfuGfL96	AS 1959	2069	cAfaGfacaAfuGfgaaAfuUfuGfgAfusCfsu
D1960	S1960	978	UfcCfaAfaUfuUfCfCfaUfuguCfuUfgCfL96	AS 1960	2070	gCfaAfgAfCfAfaUfggaAfaUfuUfgGfasUfsc
D1961	S1961	979	UfcCfaAfa UfuUfCfCfa Ufu GfUfCfuUfgCfL96	AS 1961	2071	gCfaAfgacAfaUfggaAfaUfuUfgGfasUfsc
D1962	51962	980	CfcAfaAfuUfuCfCfAfuUfgucUfuGfcAfL96	AS 1962	2072	uGfcAfaGfAfCfaAfuggAfaAfuUfuGfgsAfsu
D1963	51963	981	CfcAfaAfuUfuCfCfAfuUfgUfCfUfuGfcAfL96	AS1963	2073	uGfcAfagaCfaAfuggAfaAfuUfuGfgsAfsu
D1964	S1964	982	CfaAfaUfuUfcCfAfUfuGfucuUfgCfaAfL96	AS1964	2074	uUfgCfaAfGfAfcAfaugGfaAfaUfuUfgsGfsa
D1965	51965	983	CfaAfaUfuUfcCfAfUfuGfuCfUfUfgCfaAfL96	A51965	2075	u UfgCfaagAfcAfa ugGfa Afa UfuUfgsGfsa

130

01966	S1966	984	AfaAfuUfuCfcAfUfUfgUfcuuGfcAfaGfL96	AS1966	2076	cUfuGfcAfAfGfaCfaauGfgAfaAfuUfusGfsg
D1967	51967	985	AfaAfuUfuCfcAfUfUfgUfcUfUfGfcAfaGfL96	AS1967	2077	cUfuGfcaaGfaCfaauGfgAfaAfuUfusGfsg
D1968	51968	986	AfaUfuUfcCfaUfUfGfuCfuugCfaAfgCfL96	AS 1968	2078	gCfuUfgCfAfAfgAfcaaUfgGfaAfaUfusUfsg
D1969	S1969	987	Afa UfuUfcCfaUfUfGfuCfuUfGf Cfa AfgCfL96	AS1969	2079	gCfuUfgcaAfgAfcaaUfgGfaAfaUfusUfsg
D1970	S1970	988	AfuUfuCfcAfuUfGfUfcUfugcAfaGfcAfL96	AS 1970	2080	uGfcUfuGfCfAfaGfacaAfuGfgAfaAfusUfsu
D1971	S1971	989	AfuUfuCfcAfuUfGfUfcUfuGfCfAfaGfcAfL96	AS1971	2081	uGfcUfugcAfaGfacaAfuGfgAfaAfusUfsu
01972	51972	990	UfuUfcCfaUfuGfUfCfuUfgcaAfgCfaAfL96	AS1972	2082	uUfgCfuUfGfCfaAfgacAfaUfgGfaAfasUfsu
D1973	S1973	991	UfuUfcCfa Uf uGf UfCfu UfgCfAfAfgCfa AfL96	AS1973	2083	uUfgCfuugCfaAfgacAfaUfgGfaAfasUfsu
D1974	51974	992	UfuCfcAfuüfgUfCfUfuGfcaaGfcAfaAfL96	AS1974	2084	uUfuGfcUfUfGfcAfagaCfaAfuGfgAfasAfsu
01975	S1975	993	UfuCfcAfuUfgUfCfUfuGfcAfAfGfcAfaAfL96	AS1975	2085	uUfuGfcuuGfcAfagaCfaAfuGfgAfasAfsu
D1976	S1976	994	UfcCfaUfuGfuCfUfUfgCfaagCfaAfaGfL96	AS1976	2086	cUfuUfgCfUfUfgCfaagAfcAfaUfgGfasAfsa
D1977	S1977	995	UfcCfa UfuGfuCf Uf UfgCfa AfGfCfa Af a GfL96	AS1977	2087	cUfuUfgcuUfgCfaagAfcAfaUfgGfasAfsa
D1978	S1978	996	CfcAfuUfgUfcUfUfGfcAfagcAfaAfgCfL96	AS 1978	2088	gCfu Uf uGf CfUfuGfca a GfaCfa AfuGfgsAfsa
D1979	51979	997	CfcAfuUfgUfcUfUfGfcAfaGfCfAfaAfgCfL96	AS 1979	2089	gCfu Uf ugcUfu Gfcaa GfaCfaAfüGfgsAfsa
D1980	51980	998	CfaUfuGfuCfuUfGfCfaAfgcaAfaGfcAfL96	AS1980	2090	uGfcUfuUfGfCfu UfgcaAfgAfcAfa UfgsGfsa
01981	S1981	999	CfaUfuGfuCfuUfGfCfaAfgCfAfAfaGfcAfL96	AS1981	2091	uGfcUfuugCf u UfgcaAfgAfcAfa UfgsGfsa
D1982	S1982	1000	AfuUfgUfcUfuGfCfAfaGfcaaAfgCfaCfL96	AS1982	2092	gUfgCfu UfUfGfcUfugcAfaGfa Cfa AfusGfsg
01983	S1983	1001	AfuUfgUfcUfuGfCfAfaGfcAfAfAfgCfaCfL96	AS1983	2093	gUfgCfuuuGfcUfugcAfaGfaCfaAfusGfsg
01984	S1984	1002	UfuGfuCfuUfgCfAfAfgCfaaaGfcAfcGfL96	AS1984	2094	cGfuGfcUfUfUfgCfuugCfaAfgAfcAfasUfsg
01985	S1985	1003	UfuGfuCfuUfgCfAfAfgCfaAfAfGfcAfcGfL96	AS1985	2095	cGfuGfcuuUfgCfu ugCfa AfgAfcAfasUfsg
D1986	S1986	1004	UfgUfcUfuGfcAfAfGfcAfaagCfaCfgUfL96	AS 1986	2096	aCfgUfgCfUfUfuGfcuuGfcAfaGfaCfasAfsu
01987	51987	1005	UfgUfcUfuGfcAfAfGfcAfaAfGfCfaCfgUfL96	AS 1987	2097	aCfgUfgcuUfuGfcuuGfcAfaGfaCfasAfsu
01988	S1988	1006	GfuCfuUfgCfaAfGfCfaAfagcAfcGfuAfL96	AS 1988	2098	uAfcGfuGfCfUfuUfgcuUfgCfaAfgAfcsAfsa
01989	S1989	1007	GfuCfuUfgCfaAfGfCfaAfaGfCfAfcGfuAfL96	AS1989	2099	uAfcGfugcUfuUfgcuUfgCfaAfgAfcsAfsa
D1990	S1990	1008	UfcUf uGfcAfaGfCfAfa Afgca CfgUfa Uf L96	AS1990	2100	aUfaCfgUfGfCfuUfugcUfuGfcAfaGfasCfsa
D1991	51991	1009	UfcUfuGfcAfaGfCfAfaAfgCfAfCfgUfaUfL96	AS1991	2101	aUfaCfgugCfuUfugcUfuGfcAfaGfasCfsa
01992	51992	1010	CfuUfgCfaAfgCfAfAfaGfcacGfuAfuUfL96	AS1992	2102	aAfuAfcGfUfGfcUfuugCfuUfgCfaAfgsAfsc

131

D1993	S1993	1011	CfuUfgCfaAfgCfAfAfaGfcAfCfGfuAfuUfL96	AS1993	2103	aAfuAfcguGfcUfuugCfuUfgCfaAfgsAfsc
D1994	S1994	1012	UfuGfcAfaGfcAfAfAfgCfacgUfaUfuAfL96	AS1994	2104	uAfaUfaCfGfUfgCfuuuGfcUfuGfcAfasGfsa
D1995	S1995	1013	UfuGfcAfaGfcAfAfAfgCfaCfGfUfaUfuAfLS6	AS1995	2105	uAfaUfacgUfgCfuuuGfcUfuGfcAfasGfsa
D1996	S1996	1014	UfgCfaAfgCfaAfAfGfcAfcguAfuUfaAfL96	AS1996	2106	uUfaAfuAfCfGfuGfcuuUfgCfuUfgCfasAfsg
D1997	S1997	1015	UfgCfaAfgCfaAfAfGfcAfcGfUfAfuUfaAfL96	AS1997	2107	uUfaAfuacGfuGfcuuUfgCfuUfgCfasAfsg
D1998	S1998	1016	GfcAfaGfcAfaAfGfCfaCfgua Ufu Afa AfL96	AS1998	2108	u UfuAfaUfAfCfgUfgcu UfuGfcUfuGfcsAfsa
01999	51999	1017	GfcAfaGfcAfaAfGfCfaCfgUfAfUfuAfaAfL96	A51999	2109	uUfuAfauaCfgUfgcuUfuGfcUfuGfcsAfsa
D2000	S2000	1018	CfaAfgCfaAfaGfCfAfcGfuauUfaAfaUfL96	AS2000	2110	aUfuUfaAfUfAfcGfugcUfuUfgCfuUfgsCfsa
D2001	52001	1019	CfaAfgCfaAfaGfCfAfcGfuAfUfUfaAfaUfL96	AS2001	2111	aUfuUfaauAfcGfugcUfuUfgCfuUfgsCfsa
D2002	S2002	1020	AfaGfcAfaAfgCfAfCfgUfauuAfaAfuAfL96	AS2002	2112	uAfuUfuAfAfUfaCfgugCfuUfuGfcUfusGfsc
D2003	S2003	1021	AfaGfcAfaAfgCfAfCfgUfaUfUfAfaAfuAfL96	AS2003	2113	uAfuüfuaaUfaCfgugCfuUfuGfcUfusGfsc
D2004	S2004	1022	AfgCfaAfaGfcAfCfGfuAfuuaAfaUfaUfL96	AS2004	2114	aUfaUfuUfAfAfuAfcguGfcUfuUfgCfusUfsg
D2005	S2005	1023	AfgCfa AfaGfcAfCfGf uAfuUfAfAfa Ufa UfL96	AS200S	2115	aUfaUfuuaAfuAfcguGfcUfuUfgCfusUfsg
D2006	S2006	1024	GfcAfaAfgCfa CfGfUfa UfuaaAf uAfuGf L96	AS2006	2116	cAfuAfuUfUfAfaUfacgUfgCfuUfuGfcsUfsu
02007	S2007	1025	GfcAfaAfgCfaCfGf Ufa Ufu AfAfAfu AfuGf L96	AS2007	2117	cAfuAfuuuAfaUfacgUfgCfuUfuGfcsUfsu
D2008	S2008	1026	CfaAfaGfcAfcGfUfAfuUfaaaUfaUfgAfL96	AS2008	2118	uCfaUfaUfUfUfaAfuacGfuGfcUfuUfgsCfsu
D2009	S2009	1027	CfaAfaGfcAfcGfUfAfuUfaAfAfUfaUfgAfL96	AS2009	2119	uCfaUfauuUfaAfuacGfuGfcUfuUfgsCfsu
02010	S2010	1028	AfaAfgCfaCfgUfAfUfuAfaauAfuGfaUfL96	AS2010	2120	aUfcAfuAfUfUfuAfauaCfgUfgCfuUfusGfsc
02011	S2011	1029	AfaAfgCfaCfgUfAfUfuAfaAfUfAfuGfaUfL96	AS2011	2121	aUfcAfuauUfuAfauaCfgUfgCfuUfusGfsc
D2012	S2012	1030	AfaGfcAfcGfuAfUfUfaAfauaUfgAfuCfL96	AS2012	2122	gAfuCfaUfAfUfuUfaauAfcGfuGfcUfusUfsg
D2013	52013	1031	AfaGfcAfcGfuAfUfUfaAfaUfAfUfgAfuCfL96	AS2013	2123	gAfuCfauaUfuUfaauAfcGfuGfcUfusUfsg
D2014	52014	1032	AfgCfa CfgUfaUfUfAfa Afua uGfa UfcUf L96	AS2014	2124	aGfa Uf cAfUfAfu UfuaaUfa CfgUfgCfusUfsu
D2015	S2015	1033	AfgCfaCfgUfaUfUfAfaAfuAfUfGfaUfcUfL96	AS2015	2125	aGfaUfcauAfuUfuaaUfaCfgUfgCfusüfsu
D2016	52016	1034	GfcAfcGfuAfuUfAfAfaUfaugAfuCfuGfL96	AS2016	2126	cAfgAfuCfAfUfaUfuuaAfuAfcGfuGfcsUfsu
D2017	52017	1035	GfcAfcGfuAfuUfAfAfaUfaUfGfAfuCfuGfL96	AS2017	2127	cAfgAfucaUfaUfuuaAfuAfcGfuGfcsUfsu
D2018	52018	1036	CfaCfgUfaUfuAfAfAfuAfugaUfcUfgCfL96	AS2018	2128	gCfaGfaUfCfAfuAfuuuAfaUfaCfgUfgsCfsu
D2019	S2019	1037	CfaCfgUfaUfuAfAfAfuAfuGfAfUfcUfgCfL96	AS2019	2129	gCfaGfaucAfuAfuuuAfaUfaCfgUfgsCfsu

132

D2020	S2020	1038	AfcGfuAfuUfaAfAfUfaUfgauCfuGfcAfL96	AS2020	2130	uGfcAfgAfUfCfa Ufauu Ufa AfuAfcGfusGfsc
D2021	S2021	1039	AfcGfuAfuUfaAfAfüfaUfgAfUfCfuGfcAfL96	AS2021	2131	uGfcAfga uCfaUfau uUfa Afu Af cGf usGfsc
D2022	S2022	1040	CfgUfaUfuAfaAfUfAfuGfaucUfgCfaGfL96	AS2022	2132	cUfgCfaGfAfUfcAfuauUfuAfaUfaCfgsUfsg
D2023	S2023	1041	CfgUfaUfuAfaAfUfAfuGfaUfCfUfgCfaGfL96	AS2023	2133	cUfgCfagaUfcAfuauUfuAfaUfaCfgsUfsg
D2024	S2024	1042	GfuAfuUfaAfaUfAfUfgAfucuGfcAfgCfL96	AS2024	2134	gCfuGfcAfGfAfuCfauaUfuUfaAfuAfcsGfsu
D2025	S2025	1043	GfuAfuUfaAfaUfAfUfgAfuCfUfGfcAfgCfL96	AS2025	2135	gCfuGfcagAfuCf aua Ufu Ufa Af u AfcsGfsu
D2026	S2026	1044	Ufa Ufu AfaAfuAf UfGfaUfcugCfaGfcCfL96	AS2026	2136	gGfcUfgCfAfGfaUfcauAfuUfuAfaUfasCfsg
D2027	S2027	1045	UfaUfuAfaAfuAfUfGfaUfcUfGfCfaGfcCfL96	AS2027	2137	gGfcUfgcaGfaUfcauAfuUfuAfaUfasCfsg
02028	S2028	1046	AfuUfaAfaUfaUfGfAfuCfugcAfgCfcAfL96	AS2028	2138	uGfgCfuGfCfAfgAfucaUfaUfuUfaAfusAfsc
D2029	S2029	1047	AfuUfaAfaUfaUfGfAfuCfuGfCfAfgCfcAfL96	AS2029	2139	uGfgCf ugcAfgAf uca UfaUfuUfaAfu sAfsc
D2030	S2030	1048	UfuAfaAfuAfuGfAfUfcUfgcaGfcCfaUfL96	AS2030	2140	aUfgGfcUfGfCfaGfaucAfuAfuUfuAfasUfsa
D2031	S2031	1049	UfuAfaAfuAfuGfAfUfcUfgCfAfGfcCfaUfL96	AS2031	2141	aUfgGfcugCfaGfaucAfuAfuUfuAfasUfsa
02032	S2032	1050	UfaAfaUfaUfgAfUfCfuGfcagCfcAfuUfL96	AS2032	2142	aAfuGfgCf UfGfcAfga uCfa UfaUfu UfasAfsu
02033	S2033	1051	UfaAfaUfaUfgAfUfCfuGfcAfGfCfcAfuUfL96	AS2033	2143	aAfuGfgcuGfcAfgauCfaUfaUfuUfasAfsu
D2034	S2034	1052	AfaAfuAfuGfaUfCfUfgCfagcCfaUfuAfL96	AS2034	2144	uAfaUfgGfCfüfgCfagaUfcAfuAfuUfusAfsa
D2035	S2035	1053	AfaAfuAfuGfaUfCfUfgCfaGfCfCfaUfuAfL96	AS2035	2145	uAfaUfggcUfgCfagaUfcAfuAfuUfusAfsa
02036	S2036	1054	AfaUfaUfgAfuCfUfGfcAfgccAfuUfaAfL96	AS2036	2146	uUfaAfuGfGfCfuGfcagAfuCfaUfaUfusUfsa
D2037	S2037	1055	AfaUfaUfgAfuCfUfGfcAfgCfCfAfuUfaAfL96	AS2037	2147	uUfaAfuggCfuGfcagAfuCfaUfaUfusUfsa
D2038	S2038	1056	Af uAf uGfaUfcUfGfCfaGfcca UfuAfaAf L96	AS2038	2148	uUfuAfaUfGfGfcUfgcaGfaUfcAfuAfusUfsu
D2039	S2039	1057	AfuAfuGfaUfcUfGfCfaGfcCfAfUfuAfaAfL96	AS2039	2149	uUfuAfaugGfcUfgcaGfaUfcAfuAfusUfsu
D2040	S2040	1058	UfaUfgAfuCfuGfCfAfgCfcauUfaAfaAfL96	AS2040	2150	uUfuUfaAfUfGfgCfugcAfgAfuCfaUfasUfsu
D2041	S2041	1059	UfaUfgAfuCfu GfCfAfgCfcAfUfUfa AfaAf L9 6	AS2041	2151	uUfuUfaauGfgCfugcAfgAfuCfaUfasUfsu
D2042	S2042	1060	AfuGfaUfcUfgCfAfGfcCfauuAfaAfaAfL96	AS2042	2152	uUfuUfuAfAfUfgGfcugCfaGfaUfcAfusAfsu
D2043	S2043	1061	AfuGfaUfcUfgCfAfGfcCfaUfUfAfaAfaAfL96	AS2043	2153	uUfuUfuaaUfgGfcugCfaGfaUfcAfusAfsu
D2044	S2044	1062	UfgAfuCfuGfcAfGfCfcAfuuaAfaAfaGfL96	AS2044	2154	cUfuUfuUfAfAfuGfgcuGfcAfgAfuCfasUfsa
D2045	S2045	1063	UfgAfuCfuGfcAfGfCfcAfuUfAfAfaAfaGfL96	AS2045	2155	cUfuUfuuaAfuGfgcuGfcAfgAfuCfasUfsa
D2046	S2046	1064	GfaUfcUfgCfaGfCfCfaUfuaaAfaAfgAfL96	AS2046	2156	uCfuUfu Uf UfAfa UfggcUfgCfaGfa UfcsAfsu

133

D2047	S2047	1055	GfaUfcUfgCfaGfCfCfaUfuAfAfAfaAfgAfL96	AS2047	2157	uCfuUfuuuAfaUfggcUfgCfaGfaUfcsAfsu
D2048	S2048	1066	AfuCfuGfcAfgCfCfAfuUfaaaAfaGfaCfL96	AS2048	2158	gUfcUfuUfUfUfaAfuggCfuGfcAfgAfusCfsa
D2049	S2049	1067	AfuCfuGfcAf gCfCfAf uUfa AfAfAfa GfaCfL96	AS2049	2159	gUfcUfuuuUfaAfuggCfuGfcAfgAfusCfsa
D2050	S2050	1068	UfcUfgCfaGfcCfAfUfuAfaaaAfgAfcAfL96	A52050	2160	uGfuCfuUfUfUfuAfaugGfcUfgCfaGfasUfsc
D2051	S2051	1069	UfcUfgCfaGfcCfAfllftiAfaAfAfAfgAfcAfL96	AS2051	2161	uGfuCfuuuUfuAfaugGfcUfgCfaGfasUfsc
D2052	S2052	1070	CfuGfcAfgCfcAfUfUfaAfaaaGfaCfaCfL96	AS2052	2162	gUfgUfcUfUfUfuUfaauGfgCfuGfcAfgsAfsu
D20S3	S2053	1071	CfuGfcAfgCfcAfUfUfaAfaAfAfGfaCfaCfL96	AS2053	2163	gUfgUfcu uUfuUfaa uGfgCfuGfcAf gsAfsu
D20S4	S2054	1072	UfgCfaGfcCfaUfUfAfaAfaagAfcAfcAfL96	AS2054	2164	uGfuGfuCfUfUfuUfuaaUfgGfcUfgCfasGfsa
D2055	S205S	1073	UfgCfaGfcCfaUfUfAfaAfaAfGfAfcAfcAfL96	AS2055	2165	uGfuGfucuUfuUfuaaUfgGfcüfgCfasGfsa
D2056	S2056	1074	GfcAfgCfcAfuUfAfAfaAfagaCfaCfaUfL96	AS2056	2166	aUfgUfgUfCfUfuUfuuaAfuGfgCfuGfcsAfsg
D2057	S2057	1075	GfcAfgCfcAfuUfAfAfaAfaGfAfCfaCfaUfL96	AS2057	2167	a UfgUfgucUfuUfu ua AfuGfgCf uGfcsAfsg
D20S8	S2058	1076	CfaGf cCfa Uf u AfAfAfaAfgacAfcAf u Uf L96	AS2058	2168	aAfuGfuGfUfCfuUfuuuAfaUfgGfcüfgsCfsa
D2059	S2059	1077	CfaGfcCfa UfuAfAfAfa AfgAfCfAf cAfu Uf L96	AS2059	2169	aAfuGfuguCfuUfuuuAfaUfgGfcUfgsCfsa
D2060	S2060	1078	AfgCfcAfuUfaAfAfAfaGfacaCfaUfuCfL96	AS2060	2170	gAfaUfgUfGfUfcUfuuuUfaAfuGfgCfusGfsc
D2061	S2061	1079	AfgCfcAfu UfaAfAfAfaGfaCfAfCfaUf uCfL9 6	AS2061	2171	gAfaUfjgugUfcUfuuuUfaAfuGfgCfusGfsc
D2062	S2062	1080	GfcCfaUfuAfaAfAfAfgAfcacAfuUfcUfL96	AS2062	2172	aGfaAfuGfUfGfuCfuuuUfuAfaUfgGfcsUfsg
D2063	S2063	1081	GfcCfaUfuAfaAfAfAfgAfcAfCfAfuüfcUfL96	AS2063	2173	aGfaAfuguGfuCfuuuUfuAfaUfgGfcsUfsg
D2064	S2064	1082	CfcAfuUfaAfaAfAfGfaCfacaUfuCfuGfL96	AS2064	2174	cAfgAfaüfGfUfgUfcuuUfuUfaAfuGfgsCfsu
D2065	S2065	1083	CfcAf uUfaAfa AfAfGfa CfaCfAfUf u CfuGfL96	AS2065	2175	cAfgAfaugUfgUfcuuUfuUfaAfuGfgsCfsu
D2066	S2066	1084	CfaUfuAfaAfaAfGfAfcAfcauUfcUfgUfL96	AS2066	2176	aCfaGfaAfUfGfuGfucuUfuUfuAfaUfgsGfsc
D2067	S2067	1085	CfaUfuAfaAfaAfGfAfcAfcAfUfUfcUfgUfL96	AS2067	2177	a CfaGfaauGfuGfu eu UfuUfu AfaUfgsGfsc
D2068	S2068	1086	AfuUfa Afa AfaGfAfCfa CfauuCfuGfuAf L96	AS2068	2178	uAfcAfgAfAfUfgUfgucUfuUfuUfaAfusGfsg
D2069	S2069	1087	AfuUfa AfaAfaGfAfCfa Cfa UfUfCfuGfuAfL96	AS2069	2179	uAfcAfgaaUfgUfgucUfuUfuUfaAfusGfsg
D2070	S2070	1088	UfuAfaAfaAfgAfCfAfcAfuucUfgUfaAfL96	AS2070	2180	uUfaCfaGfAfAfuGfuguCfuUfuUfuAfasUfsg
D2071	S2071	1089	UfuAfaAfaAfgAfCfAfcAfuUfCfUfgUfaAfL96	AS2071	2181	uUfaCfagaAfuGfuguCfuUfuUfuAfasUfsg
D2072	S2072	1090	U fa Afa Afa GfaCfAfCfaUf ucuGfu Afa AfL96	AS2072	2182	uUfuAfcAfGfAfaUfgugUfcUfuUfuUfasAfsu
02073	S2073	1091	UfaAfaAfaGfaCfAfCfaüfuCfUfGfuAfaAfL96	AS2073	2183	uUfuAfcagAfaUfgugUfcUfuUfuUfasAfsu

134

D2074	S2074	1092	AfaAfaAfgAfcAfCfAfu UfcugüfaAfa AfL96	AS2074	2184	uUfu UfaCfAfGfa Af ugu GfuCfu UfuUfusAfsa
D2075	52075	1093	AfaAfaAfgAfcAfCfAfuUfcUfGfUfaAfaAfL96	AS2075	2185	uUfuUfacaGfaAfuguGfuCfuUfuUfusAfsa
D2076	52076	1094	AfaAfaGfaCfaCfAfUfuCfuguAfaAfaAfL96	AS2076	2186	uUfuUfuAfCfAfgAfaugUfgUfcUfuUfusUfsa
D2077	S2077	1095	AfaAfaGfaCfaCfAfUfuCfuGfUfAfaAfaAfL96	AS2077	2187	u Ufu UfuacAfgAfaugUfgUfcUfu Uf usUfsa
D2078	S2078	1096	AfaAfgAfcAfcAfUfüfcUfguaAfaAfaAfL96	AS2078	2188	uUfuUfuUfAfCfaGfaauGfuGfuCfuUfusUfsu
D2079	52079	1097	AfaAfgAfcAfcAfUfUfcUfgUfAfAfaAfaAfL96	AS2079	2189	u Ufu UfuuaCfaGfaauGfu GfuCfu UfusUfsu
D2080	S2080	1098	Afa GfaCf a CfaUfUfCfuGf uaa Afa Afa AfL9 6	AS2080	2190	uUfuüfuUfUfAfcAfgaaUfgUfgUfcUfusUfsu
02081	S2081	1099	AfaGfaCfaCfaUfUfCfuGfuAfAfAfaAfaAfL96	AS2081	2191	uUfuUfuuuAfcAfgaaUfgUfgUfcUfusUfsu
02082	52082	1100	AfgAfcAfcAfulIfCfUfgUfa a a Afa Af a Af L96	AS2082	2192	uUfuUfuUfUfUfaCfagaAfuGfuGfuCfusUfsu
02083	S2083	1101	AfgAfcAfcAfuüfCfUfgUfaAfAfAfaAfaAfL96	AS2083	2193	uUfuUfuuuUfaCfagaAfuGfuGfuCfusüfsu
02084	S2084	1102	GfaCfaCfaUfuCfUfGfuAfaaaAfaAfaAfL96	AS2084	2194	uUfuUfuUfUfUfuAfcagAfaUfgUfgUfcsUfsu
02085	52085	1103	GfaCfaCfaUfuCfUfGfuAfaAfAfAfaAfaAfL96	AS2085	2195	uUfuUfuuuUfuAfcagAfaUfgUfgUfcsUfsu
D2086	S2086	1104	AfcAfcAfuUfcUfGfUfaAfaaaAfaAfaAfL96	AS2086	2196	uUfuUfuUfUfUfuUfacaGfaAfuGfuGfusCfsu
D2087	S2087	1105	AfcAfcAfuUfcUfGfUfaAfaAfAfAfaAfeAfL96	AS2087	2197	uUfuUfuuuUfuUfacaGfaAfuGfuGfusCfsu
D2088	S2088	1106	CfaCfaUfuCfuGfUfAfaAfaaaAfaAfaAfL96	AS2088	2198	uUfuUfuUfUfUfuUfuacAfgAfaUfgUfgsUfsc
D2089	S2089	1107	CfaCfaUfuCfuGfUfAfaAfaAfAfAfaAfaAfL96	AS2089	2199	uUfuUfuuuUfuUfuacAfgAfaUfgUfgsUfsc
D2090	S2090	1108	AfcAfuUfcUfgUfAfAfaAfaaaAfaAfaAfL96	AS2090	2200	uUfuUfuUfUfUfuUfuuaCfaGfaAfuGfusGfsu
D2091	52091	1109	AfcAfuUfcUfgUfAfAfaAfaAfAfAfaAfaAfL96	AS2091	2201	uUfuUfuuuUfuUfuuaCfaGfaAfuGfusGfsu

Lowercase nucléotides (a, u, g, c) are 2’-O-methyl nucléotides; Nf (e.g., Af) is a 2’-fluoro nucléotide; s îs a phosphothiorate linkage;

L96 indicates a GalNAca ligand.

135

Example 4: In vitro screening of RNAi Agents

Cell culture and transfections

Human Hep3B cells or rat H.I1.4.E cells (ATCC, Manassas, VA) were grown to near confluence at 37 °C in an atmosphère of 5% CO2 in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 14.8 μΐ of Opti-MEM plus 0.2 μΐ of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778150) to 5 μΐ of siRNA duplexes per well into a 96-well plate and incubated at room température for 15 minutes. 80 μΐ of complété growth media without antibiotic containing ~2 xl04 Hep3B cells were then added to the siRNA mixture. Cells were incubated for either 24 or 120 hours prior to RNA purification. Single dose experiments were performed at lOnM and 0.1 nM final duplex concentration and dose response experiments were done using 8,4 fold serial dilutions with a maximum dose of lOnM final duplex concentration.

Total RNA isolation using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 61012)

Cells were harvested and lysed in 150 μΐ of Lysis/Binding Buffer then mixed for 5 minutes at 850rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μΐ Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supematant was removed without disturbing the beads. After removing the supematant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supematant, magnetic beads were washed 2 times with 150 μΐ Wash Buffer A and mixed for 1 minute. Beads were capture again and supematant removed. Beads were then washed with 150 μΐ Wash Buffer B, captured and supematant was removed. Beads were next washed with 150 μΐ Elution Buffer, captured and supematant removed. Beads were allowed to dry for 2 minutes. After drying, 50 μΐ of Elution Buffer was added and mixed for 5 minutes at 70°C. Beads were captured on magnet for 5 minutes. 40 μΐ of supematant was removed and added to another 96 well plate.

136 cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster Citv, CA, Cat #4368813)

A master mix of 1 μΐ 10X Buffer, 0.4μ1 25X dNTPs, 1 μΐ Random primers, 0.5 μΐ Reverse Transcriptase, 0.5 μΐ RNase inhibitor and 1.6μ1 of H₂O per reaction were added into 5 μΐ total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25 °C 10 min, 37 °C 120 min, 85 °C 5 sec, 4 °C hold.

Real time PCR

2μ1 of cDNA were added to a master mix containing 0.5μ1 GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E (human) Cat # 4308313 (rodent)), 0.5μ1 TTR TaqMan probe (Applied Biosystems cat # HS00174914 jnl (human) cat # Rn00562124_ml (rat)) and 5μ1 Lightcycier 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plate (Roche cat # 04887301001). Real time PCR was done in a Roche LC 480 Real Time PCR machine (Roche). Each duplex was tested in at least two independent transfections and each transfection was assayed in duplicate, unless otherwise noted.

To calculate relative fold change, real time data were analyzed using the AACt method and normalized to assays performed with cells transfected with lOnM AD-1955, or mock transfected cells. IC50S were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 (sense sequence: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 2202); antisense sequence: UCGAAGuCUcAGCGuAAGdTsdT (SEQ ID NO: 2203)) or naïve cells over the same dose range, or to its own lowest dose. IC50S were calculated for each individual transfection as well as in combination, where a single IC50 was fit to the data from both transfections.

The results of gene silencing of the exemplary siRNA duplex with various motif modifications of the invention are shown in Table 1 above.

137

Example 5: In vitro Silencing Activity of Chemically Modified RNAi Agents that Target TTR

The following experiments demonstrated the bénéficiai effects of chemical modifications, including the introduction of triplet repeat motifs, together with a GalNAc3 ligand, on the silencing activity of RNAi agents that target TTR. The sequences of the agents investigated are provided in Table 2 below. The régions of complementarity to the TTR mRNA are as follows: the région of complementarity of RNAi agents AD-45165, AD-51546 and AD-51547 is GGATGGGATTTCATGTAACCAAGA (SEQ ID NO: 2204) and the région or complemetarity of RNAi agents AD-45163, AD-51544, and AD-51545 is TTCATGTAACCAAGAGTATTCCAT (SEQ ID NO: 2205).

Protocol for assessment of ICsn in Hep3B cells

The IC₅₀ for each modified siRNA was determined in Hep3B cells (a human hepatoma cell line) by standard reverse transfection using Lipofectamine RNAiMAX. In brief, reverse transfection was carried out by adding 5 pL of Opti-MEM to 5 pL of siRNA duplex per well into a 96-well plate along with 10 pL of Opti-MEM plus 0.5 pL of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) and incubating at room température for 15-20 minutes. Following incubation, 100 pL of complété growth media without antibiotic containing 12,000-15,000 Hep3B cells was then added to each well. Cells were incubated for 24 hours at 37°C in an atmosphère of 5% CO₂ prior to lysis and analysis of TTR and GAPDH mRNA by bDNA (Quantigene). Seven different siRNA concentrations ranging from lOnM to 0.6pM were assessed for IC50 détermination and TTR/GAPDH for siRNA transfected cells was normalized to cells transfected with 1 OnM Luc siRNA. The results are shown in Table 2.

Protocol for assessment of free-uptake IC50

Free uptake silencing in primary cynomolgus hépatocytes was assessed following incubation with TTR siRNA for either 4 hours or 24 hours. Silencing was measured at 24 hours from the initial exposure. In brief, 96-well culture plates were coated with 0.05%-0.1% collagen (Sigma C3867-1 VL) at room température, 24 hours

138 prior to the start of the experiment. On the day of assay, siRNAs were diluted in prewarmed Plating Media consisting of DMEM supplemented with GIBCO’s Maintenance Media Kit (Serum-Free, Life Technologies CM4000), and added to the collagen-coated 96-well culture plates. Cryopreserved primary cynomolgus hépatocytes were rapidly thawed in a 37°C water bath, and immediately diluted in Plating Media to a concentration of 360,000 cells/mL, A volume of cell suspension was gently pipetted on top of the pre-plated siRNAs such that the final cell count was 18,000 cells/well, The plate was lightly swirled to mix and spread cells evenly across the wells and placed in a 37°C, 5% CO₂ incubator for 24 hours prior to lysis and analysis of TTR and GAPDH mRNA by bDNA (Quantigene, Affymetrix). In the case of the 4h incubation with siRNA, the media was decanted after 4 hours of exposure to the cells, and replaced with fresh Plating Media for the remaining 20 hours of incubation. Downstream analysis for TTR and GAPDH mRNA was the same as described above. For a typical dose réponse curve, siRNAs were titrated from luM to 0.24nM by 4 fold serial dilution.

139

Table 2: In vitro Activity Summary for Altemating TTR-GalNAc and Variants with Triplet Motifs

Duplex ID	S (5’-3’)	AS (5’-3”)	Free-Uptake IC50 (μΜ)	Hep3B IC50 (nM)
4h	2411
AD-45I63	AfuGfuAfaCfcAfaGfaGfuAfuUfcCfaUfL96 (SEQ ID NO: 2206)	aUfgGfaAfuAfcUfcUfuGfgUfûAfcAfusGfsa (SEQIDNO: 2212)	0.04101	0.00820	0.0115
AD-51544	AfuGfuAfaCfcA£AfGfaGfuAfuucCfaUfL96 (SEQ ID NO: 2207)	aUfgGfAfAfuAfcUfcuuGfgUfuAfcAfusGfsa (SEQIDNO: 2213)	0.00346	0.00374	0.0014
AD-51545	AfuGfuAfAfCfcAfAfGfaGfuAfuUfcCfaUfL96 (SEQIDNO: 2208)	aUfgGfaAfiiAfcUfcuuGfguuAfcAfusGfsa (SEQIDNO: 2214)	0.00395	0.00389	0.0018
AD-45165	U fgGfgAfiiUfuCfaU fgUfaAfcCfaAfgAfL96 (SEQIDNO: 2209)	uCfuUfgGfuUfaCfaUfgAfaAfuCfcCfasUfsc (SEQ ID NO: 2215)	0.02407	0.00869	0.0112
AD-51546	UfgGfGfAfuUfuCfAfUfgUfaAfcCfAfAfgAfL96 (SEQ ID NO: 2210)	uCfuugGfuUfaCfaugAfaAfuccCfasUfsc (SEQIDNO: 2216)	0.00317	0.00263	0.0017
AD-51547	UfgGfgAfuUfiiCfAfUfgUfaacCfaAfgAfL96 (SEQIDNO: 2211)	uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc (SEQ ID NO: 2217)	0.00460	0.00374	0.0028

Lowercase nucléotides (a, u, g, c) indicate 2’-O-methyl nucléotides; Nf (e.g,, Af) indicates a 2’-fluoro nucléotide; s indicates a phosphothiorate linkage;

L96 indicates a GalNAcj ligand; bold nucléotides indicate changes relative to the corresponding parent agent. Each bold nucléotide is at the center of a triplet motif.

140

The results are provided in Table 2 and demonstrate that modified RNAi agents that target TTR provide enhanced silencing activity.

Results: Improved Activity of Modified RNAi Agents

Parent RNAi agents with altemating chemical modifications and a GalNAcj ligand provided an ICjo in Hep3B cells of about 0.01 nM. As shown in Figures 4-5 and in Table 2, agents modified relative to the parent agents, for example, by the addition of one or more repeating triplets of 2’-fluoro and 2’-O-methyl modifications, showed unexpectedly enhanced silencing activity, achieving IC50 values in Hep3B cells that were 5-8 fold better than the corresponding parent agent.

Results: Free Uptake ICgnS in Hep3B cells

As shown in Table 2 and Figures 6-7, RNAi agents modified relative to the parent AD-45163 also showed enhanced free uptake silencing. The modified agents showed more than double the silencing activity of the parent after a 24 hour incubation period and nearly 10 times the silencing activity of the parent after a 4 hour incubation period.

As shown in Table 2 and Figures 8-9, RNAi agents modified relative to the parent AD-45165 also showed enhanced free uptake silencing. The modified agents showed 2-3 times the silencing activity of the parent after a 24 hour incubation period and 5-8 times the silencing activity of the parent after a 4 hour incubation period.

Taken collectively, these results demonstrate that the modified RNAi agents presented herein, e.g., AD-51544, AD-51545, AD-51546, and AD-51547, ail showed unexpectedly good inhibition of TTR mRNA in in vitro silencing experiments.

141

Example 6: TTR mRNA silencing and TTR Protein Suppression in Transgenic Mice

To assess the efficacy of the RNAi agents AD-45163, AD-51544, AD-51545, AD45165, AD-51546, and AD-51547, these agents were administered to transgenic mice that express human transthyretin with the V30M mutation (see Santos, SD., Femaandes, R., and Saraiva, MJ. (2010) Neurobiology ofÀging, 31, 280-289). The V30M mutation is known to cause familial amyloid polyneuropathy type I in humans. See, e.g., Lobato, L. (2003) JNephrol., 16(3):438-42.

The RNAi agents (in PBS buffer) or PBS control were administered to mice (2 male and 2 female) of 18-24 months of âge in a single subcutaneous dose of 5 mg/kg or 1 mg/kg. After approximately 48 hours, mice were anesthetized with 200 μΙ of ketamine, and then exsanguinated by severing the right caudal artery. Whole blood was isolated and plasma was isolated and stored at -80°C until assaying. Liver tissue was collected, flash-frozen and stored at -80°C until processing.

Efficacy of treatment was evaluated by (i) measurement of TTR mRNA in liver at 48 hours post-dose, and (ii) measurement of TTR protein in plasma at pre-bleed and at 48 hours post-dose. TTR liver mRNA levels were assayed utilizing the Branched DNA assays- QuantiGene 2.0 (Panomîcs cat #: QS0011). Briefly, mouse liver samples were ground and tissue lysâtes were prepared. Liver lysis mixture (a mixture of 1 volume of lysîs mixture, 2 volume of nuclease-free water and lOul of Proteinase-K/ml for a final concentration of 20mg/ml) was incubated at 65 °C for 35 minutes. 20μ1 of Working Probe Set (TTR probe for gene target and GAPDH for endogenous control) and 80ul of tissue-lysate were then added into the Capture Plate. Capture Plates were incubated at 55 °C ±1 °C (aprx. 16-20hrs). The next day, the Capture Plates were washed 3 times with IX Wash Buffer (nuclease-free water, Buffer Component 1 and Wash Buffer Component 2), then dried by centrifuging for 1 minute at 240g. 100μ1 of pre-Amplifier Working Reagent was added into the Capture Plate, which was sealed with aluminum foil and incubated for 1 hour at 55°C ±1°C. Following 1 hour incubation, the wash step was repeated, then 100μ1 of Amplifier Working Reagent was added. After 1 hour, the wash and dry steps were repeated, and 100μ1 of Label Probe was added. Capture plates

142 were incubated 50 °C ±1 °C for 1 hour. The plate was then washed with IX Wash Buffer, dried and ΙΟΟμΙ Substrate was added into the Capture Plate. Capture Plates were read using the SpectraMax Luminometer following a 5 to 15 minute incubation. bDNA data were analyzed by subtracting the average background from each triplicate sample, averaging the résultant triplicate GAPDH (control probe) and TTR (experimental probe) values, and then computing the ratio: (experimental probe-background)/(control probebackground).

Plasma TTR levels were assayed utilizing the commercially available kit “AssayMax Human Prealbumin ELISA Kit” (AssayPro, St. Charles, MO, Catalog # EP3010-1) according to manufacturer’s guidelines. Briefly, mouse plasma was diluted 1:10,000 in IX mix diluents and added to pre-coated plates along with kit standards, and incubated for 2 hours at room température foilowed by 5X washes with kit wash buffer. Fifty microliters of biotinylated prealbumin antibody was added to each well and incubated for 1 hr at room température, foilowed by 5X washes with wash buffer, Fifty microliters of streptavidin-peroxidase conjugate was added to each well and plates were incubated for 30 minutes at room température foilowed by washing as previously described. The reaction was developed by the addition of 50 μΐ/well of chromogen substrate and incubation for 10 minutes at room température with stopping of reaction by the addition of 50 μΐ/well of stop solution. Absorbance at 450 nm was read on a Versamax microplate reader (Molecular Devices, Sunnyvale, CA) and data were analyzed utilizing the Softmax 4.6 software package (Molecular Devices).

The results are shown in Figures 10-12. Figure 10 shows that the RNAi agents modified relative to the parent agents AD-45163 and AD-45165 showed RNA silencing activity that was similar or more potent compared with that of the parent agents. Figure 11 shows that the agents AD-51544 and AD-51545 showed dose dépendent silencing activity and that the silencing activity of these agents at a dose of 5mg(kg was similar to that of the corresponding parent AD-45163. Figure 12 shows that the agents AD-51546 and AD-51547 also showed dose-dependent silencing activity. Furthermore, the silencing activity of AD-51546 and AD-51547 at a dose of 5mg/kg was superior to that of the corresponding parent AD-45165.

143

Example 7: Sérum and Liver Pharmacokinetic Profiles of RNAi Agents that Target TTR in Mîce

To assess the pharmacokinetic profiles of the RNAi agents AD-45163, AD51544, AD-51545, AD-51546, and AD-51547, these agents, in PBS buffer, were administered to C57BL/6 mice using a single IV bolus or subcutaneous (SC) administration. The plasma concentrations and liver concentrations of the agents were assessed at various timepoints after the administration.

The plasma pharmacokinetic parameters are presented in Tables 3 and 4 below.

The mean résident time (MRT) in plasma was about 0.2 hours after IV dosing and about 1 hour after SC dosing. At a dose of 25 mg/kg, the agents AD-51544, AD-51545, AD51546, and AD-51547 showed similar plasma pharmacokinetic properties. Each of these agents had more than 75% bioavailability from the subcutaneous space. Their bioavailability was superior to that of the parent agent AD-45163 that was administered at a higher dose of 30 mg/kg. The subcutaneous bioavailability of AD-51544 and AD51547 was about 100%, whereas that of AD-51545 was 90% and that of and AD-51546 was 76%.

144

Table 3: Summary of Plasma PK Parameter Estimâtes After SC Administration of TTR-GalNAc siRNAs in Mice

Parameter	30 mpk AD45163 (h/c TTRGalNAc)	25 mpk AD51544 (h/c TTRGalNAc)	25 mpk AD51545 (h/c TTRGalNAc)	25 mpk AD51546 (h/c TTRGalNAc)	25 mpk AD51547 (h/c TTRGalNAc)
Plasma Tmax (h)	0.25	1	0.5	1	0.5
Plasma Cmax (pg/mL)	9.6	11.7	10.9	11.7	12.1
Plasma AUC (h*pg/mL)	12.4	21.9	19.9	20.9	25.3
F_sc(%)	79	100	90.1	76.0	99.2

145

Table 4: Plasma siRNA PK Parameters in Mice after an IV Bolus or

SC Dose of AD-51544, 51545, 51546 or 51547 at 25 mg/kg

Test Article	AD-51544	AD-51545	AD-51546	AD-51547
siRNA Dose (mg/kg)	25	25	25	25
Route of Administration	IV	SC	IV	SC	IV	SC	IV	SC
tmax (h)	0.083	1	0.083	0.5	0.083	1	0.083	0.5
C_max (pg/mL)	96.5=	11.7	108=	10.9	128=	10.9	123=	12.1
AUCo _last (h-pg/mL)	21.6	21.9	22.1	19.9	27.5	20.9	25.5	25.3
MRTo-w(h)	0.17	1.2	0.16	1.1	0.22	1.4	0.19	1.3
Apparent t_1/23 (h)^b	ND	ND	ND	0.49	ND	1.2	ND	0.56
F_sc (%>	-	102	-	90.1	-	76.0	-	99.2
a: Concentration at the 1« sampling time (5 min) after IV dosing b: Apparent élimination half-life (t_1/2^) could not be determined (ND) for ail 4 test articles after IV dosing as the terminal phase of the concentration-time profiles was not well defined, as a resuit, the t^#-associât ed PK parameters (eg, AUCo__œ, CL and Vss) were not reported. c: SC bioavailability, calculated as percentage ratio of AUCo-tæa after SC and IV dosing at 25 mg/kg

146

The results also indicated that the RNAi agents AD-45163, AD-51544, AD51545, AD-51546, and AD-51547 achieved similar or higher concentrations in the liver when administered subcutaneously than when administered by IV bolus. The liver pharmacokinetic parameters are presented in Tables 5 and 6 below. The peak concentration (C_max) and area under the curve (AUCo-iast) in the liver were two to three times higher after subcutaneous administration as compared with IV administration of the same agent at the same dose. Liver exposures were highest for AD-51547 and lowest for AD-51545. The mean résident time (MRT) and élimination half-life were longer for AD-51546 and AD-51547 compared with AD-51544 and AD-51545. Following subcutaneous administration, the approximate MRTs were 40 hours for AD51546 and 25 hours for AD-51547, whereas the MRTs for AD-51544 and AD-51545 were lower (about 6-9 hours). The élimination half life of AD-51546 and AD-51547 was also higher (41-53 hours) than was the élimination half life of AD-51544 and AD15 51545 (6-10 hours).

147

Table 5: Summary of Liver PK Parameter Estimâtes After SC Administration of TTR-GalNAc siRNAs in Mice

Parameter	30 mpk AD45163 (h/c TTRGalNAc)	25 mpk AD51544 (h/c TTRGalNAc)	25 mpk AD51545 (h/c TTRGalNAc)	25 mpk AD51546 (h/c TTRGalNAc)	25 mpk AD51547 (h/c TTRGalNAc)
Liver Tmax (h)	8	4	4	2	8
Liver Cmax (pg/g)	313	126	80	117	174
Liver AUC (hWg)	4519	1092	763	2131	4583

148

Table 6: Liver siRNA PK Parameters in Mice after an IV Bolus or SC Dose of AD-51544, 51545,51546 or 51547 at 25 mg/kg

Test Article	AD-51544	AD-51545	AD-51546	AD-51547
siRNA Dose (mg/kg)	25	25	25	25
Route of Administration	IV	SC	IV	SC	IV	SC	IV	SC
Fnax (h)	1	4	1	4	4	2	2	8
c_max (gg/g)	67.9	126	37.0	80.5	35.3	117	73.8	174
AUC_0]ast (h-pg/g)	632	1092	324	763	984	2131	1429	4583
MRT₀._last(h)	8.7	6.5	5.9	8.5	45.7	40.2	29.4	25.3
Apparent t_1/2B (h)	8.1	8.2	5.7	10.0	51.1	45.3	41.1	52.7

149

Examplc 8: In vitro Stabilïty of RNAi Agents in Monkey Sérum

The sérum stability of RNAi agents AD-51544, AD-51545, AD-51546, and AD51547 was also assessed in monkeys. The results demonstrated that the antisense and sense strands of AD-51544, AD-51545, and AD-51547 showed sérum stability over a period of about 24 hours (data not shown).

Example 9: RNAi Agents Produce Lasting Suppression of TTR Protein in NonHuman Primates

The RNA silencing activity of RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547 was assessed by measuring suppression of TTR protein in sérum of cynomologous monkeys following subcutaneous administration of five 5 mg/kg doses (one dose each day for 5 days) or a single 25mg/kg dose. Pre-dose TTR protein levels in sérum were assessed by averaging the levels at 11 days prior to the first dose, 7 days prior to the first dose, and 1 day prior to the first dose. Post-dose sérum levels of TTR protein were assessed by determining the level in sérum beginning at 1 day after the final dose (i.e., study day 5 in the 5x5 mg/kg group and study day 1 in the 1x25 mg/kg group) until 49 days after the last dose (i.e., study day 53 in the 5x5 mg/kg group and study day 49 in the 1x25 mg/kg group). See Figure 13.

TTR protein levels were assessed as described in Example 6. The results are shown in Figure 14 and in Tables 7 and 8.

A maximal suppression of TTR protein of up to about 50% was achieved in the groups that received 25 mg/kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 8). A greater maximal suppression of TTR protein of about 70% was achieved in the groups that received 5x5 mg/kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 7). The agent AD-51545 produced a lesser degree of suppression in both administration protocols. Significant suppression of about 20% or more persisted for up to 49 days after the last dose of AD-51546 and AD-51547 in both the 1x25 mg/kg and 5x5 mg/kg protocols. Generally, better suppression was achieved in the 5x5 mg/kg protocol than in the 1x25 mg/kg protocol.

150

Table 7 Fraction Sérum Transthyretin Relative to Pre-dose in Cynomolgus Monkeys ( 5 mg/kg daily for 5 days)

	D-ll	D-7	D-l	D5	D7	D9	Dll	D14	D18	D22	D26	D32	D39	D46	D53
AD45163	0.98	0.99	1.03	0.71	0.52	0.40	0.34	0.27	0.31	0.39	0.48	0.64	0.68	0.81	0.88
AD51544	1.02	0.99	0.99	0.60	0.47	0.37	0.35	0.39	0.48	0.58	0.66	0.74	0.83	0.91	0.92
AD51545	1.03	0.97	1.00	0.73	0.65	0.63	0.69	0.68	0.78	0.87	0.97	1.00	1.03	1.06	1.09
AD51546	1.01	0.97	1.02	0.59	0.42	0.35	0.30	0.32	0.43	0.58	0.66	0.77	0.92	0.93	0.97
AD51547	0.99	0.99	1.02	0.74	0.54	0.41	0.34	0.34	0.39	0.49	0.51	0.53	0.65	0.70	0.77
Table i	: Fraction Sérum Transthyretin Relative to Pre-dose in Cynomo	gus Monkeys (25 mg/kg
	D-ll	D-7	D-l	DI	D3	D5	D7	D10	D14	D18	D22	D28	D35	D42	D49
AD45163	1.04	1.01	0.95	0.99	0.84	0.67	0.57	0.44	0.45	0.51	0.58	0.66	0.72	0.78	0.85
AD51544	1.01	1.04	0.95	0.92	0.69	0.57	0.49	0.48	0.56	0.65	0.69	0.77	0.83	0.87	0.94
AD51545	0.98	1.02	0.99	0.87	0.77	0.69	0.71	0.72	0.84	0.90	0.92	0.99	1.00	1.00	1.00
AD51546	1.04	1.03	0.93	0.89	0.71	0.62	0.53	0.50	0.55	0.70	0.70	0.69	0.72	0.79	0.84
AD51547	0.96	1.03	1.01	1.19	0.90	0.70	0.54	0.48	0.50	0.50	0.52	0.58	0.62	0.70	0.72

151

Example 10: Tolerability of RNAi Agents that Target TTR

In Cytokine Evaluation in Whole Blood Assay

To assess the tolerability of RNAi agents that target TTR (including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547), each agent was tested in a whole blood assay using blood from three human donors. The agents were either 300 nM DOTAP transfected or 1 μΜ without transfection reagent (ffee siRNA). There was less than a two fold change for the following cytokines/chemokines: G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1 β, IL-Ira, IL-6, IL-8, IP-10, MCP-1, ΜΙΡ-Ια, MIP-Ιβ, TNFa. (Results not shown).

In Vivo Evaluation

To assess in vivo tolerability, RNAi agents were injected subcutaneously in CD1 mice at a dose of 125 mg/kg. No cytokine induction was observed at 2,4, 6,24, or 48 hours after subcutaneous injection of AD-45163. No significant cytokine induction was observed at 6 or 24 hours after subcucutaneous injection of AD-51544, AD-51545, AD51546, or AD-51547.

To further assess in vivo tolerability, multiple RNAi agents (including AD45163, AD-51544, AD-51545, AD-51546, and AD-51547) were tested by subcutaneous injection of 5 and 25 mg in non-human primates (cynomologous monkeys) with dose volumes between 1-2 ml per site. No erythema or edema was observed at injection sites.

Single SC Dose Rat Tolerability Study

To assess toxicity, rats were injected with a single subcutaneous dose of 100, 250,500, or 750 mg/kg of AD-45163 (see Table 9). The following assessments were made: clinical signs of toxicity, body weight, hematology, clinical chemistry and coagulation, organ weights (liver & spleen); gross and microscopie évaluation (kidney, liver, lung, lymph node, spleen, testes, thymus, aorta, heart, intestine (small and large).

152

Table 9: Single SC Dose Rat Tolerability Study: 100, 250, 500 & 750 mg/kg of AD45163 in Sprague Dawley Rats

Group	Dose Level (mg/kg) i	Dose Volume (iml/kg)	Route & Regimen	No. Male Sprague Dawley Rats	Day of Necropsy
PBS	0	10	SC Injection Day 1 (2 sites)	7/group (5 Tox animais, 2TK animais)	Day 4
AD-45163 Parent	100
250
500
750

The results showed no test article-related clinical signs of toxicity, effects on body weight, organ weights, or clinical chemistry. No histopathology was observed in heart, kidneys, testes, spleen, liver, and thymus. There was a non-adverse, slight test article-related increase in WBC (|68%, primarily attributed to increase in NEUT and MONO) at 750 mg/kg. These results indicate that a single-dose of up to 750 mg/kg is well tolerated in rats.

Tolerability of Repeated Subcutaneous Administrations in Rats

To assess the tolerability of repeated subcutaneous administrations of AD-45163, daily subcutaneous injections of 300 mg/kg were given for 5 days, and a necropsy was performed on day 6. The study design is shown in Table 10,

153

Table 10: Five Day Repeat Dose Tolerability Study in Rat

Group	Dose Level (kmg/kg	Conc (mg/mL)	No of Tox Animais	Nx Day 6
PBS	0	0	2M, 2F	2M, 2F
AD-45163	300	150	2M, 2F	2M, 2F

The following outcome variables were assessed: clinical signs, body weîghts, hematology, clinical chemistry and coagulation, organ weights, gross and microscopie évaluation (liver, spleen, kidney, heart, GI tract and first and last injection site). The results showed no test article-related clinical signs, body weight or organ weight effects, and also no test article-related findings in clinical hematology or chemistry. There was a possible slight prolongation of activated partial thromboplastin time (APTT) on day 6 (20.4 vs. 17.4 sec). Histopathology reveaied no test article-related findings in the liver, spleen, heart, and GI tract. In the kidney, minimal to slight hypertrophy of the tubular epithelium (not adverse) was observed. At the last injection site, there was minimal multifocal mononuclear infiltration, not adverse. These results indicate that five daily 300 mg/kg doses of the parent RNAi agent AD-45163 are well tolerated in rats.

Example 11: RNAi Agents Produce Lasting Suppression of TTR Protein in NonHuman Primates

The RNA silencing activity of RNAi agent AD-51547 was assessed by measuring suppression of TTR protein in the sérum of cynomologous monkeys following subcutaneous administration of a “loading phase” of the RNAi agent: five daily doses of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg (one dose each day for 5 days) followed by a “maintenance phase” of the RNAi agent: weekly dosing of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg for 4 weeks. Pre-dose TTR protein levels in sérum were assessed by averaging the levels at 11 days prior to the first dose, 7 days prior to the first dose, and 1 day prior to the first dose. Post-dose sérum levels of TTR protein were assessed by determining the Ievel in sérum relative to pre-dose beginning at 1 day after

154 the loading phase was completed until 40 days after the last dose of the maintenance phase (i.e., study day 70),

TTR protein levels were assessed as described in Example 6, The results are shown in Figure 15.

A maximal suppression of TTR protein of up to about 80% was achieved in ail of the groups that received either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD-51547. Nadir knockdown was achieved in ail of the groups by about day 14, the suppression sustained at nadir knockdown levels with a weekly maintenance dose of either 2.5 mg/kg, 5 mg/kg or 10 mg/kg of AD-51547. The levels of TTR had not retumed to baseline more than 40 days after the day of administration of the last maintenance dose for the 5 and 2.5 mg/kg dose levels.

155

Equivalents:

Those skilled in the art will recognize, or be able to ascertain using no more than routine expérimentation, many équivalents to the spécifie embodiments and methods described herein. Such équivalents are intended to be encompassed by the scope of the 5 following claims.

Claims

We claim:

1. A double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a région complementary to part of an mRNA encoding transthyretin (TTR), wherein each strand has about 14 to about 30 nucléotides, wherein said double stranded RNAi agent is represented by formula (III):

sense: 5’ n_p -N_a -(X X X)j-N_b -Y Y Y -N_b -(Z Z Z)j -N_a - n_q 3' antisense: 3' n_p'-N_a'-(X'X'X')_k-N_b'-Y'Y'Y'-Nb'-(Z'Z'Z')j-N_a'- n_q' 5’ (HI) wherein:

i, j, k, and 1 are each independently 0 or 1 ;

p, p’, q, and q' are each independently 0-6;

each N_a and N_a' independently represents an oligonucleotide sequence comprising 0-25 nucléotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucléotides;

each N_b and N_b' independently represents an oligonucleotide sequence comprising 0-10 nucléotides which are either modified or unmodified or combinations thereof;

each n_p, n_p', n_q, and n_q' independently represents an overhang nucléotide;

XXX, ΥΎΥ, ZZZ, X'X'X', ΥΎΎ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucléotides;

modifications on N_b differ from the modification on Y and modifications on N_b' differ from the modification on Y'; and wherein the sense strand is conjugated to at least one ligand.

157
2. The RNAi agent of claim 1, wherein i is 1 ; j is 1 ; or both i and j are 1.
3. The RNAi agent of claim 1, wherein k is 1 ; 1 is 1 ; or both k and 1 are 1.
4. The RNAi agent of claim 1, wherein XXX is complementary to X'X'X', YYY is complementary to ΥΎΎ', and ZZZ is complementary to Z'Z'Z'.
5. The RNAi agent of claim 1, wherein the YYY motif occurs at or near the cleavage site of the sense strand.
6. The RNAi agent of claim 1, wherein the ΥΎΎ* motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.
7. The RNAi agent of claim 6, wherein the Y' is 2'-O-methyl.
8. The RNAi agent of claim 1, wherein formula (III) is represented as formula (Ilia):

sense: 5' n_p -N_a -YYY -N_b -ZZZ -N_a-n_q 3’ antisense: 3' n_p'-N_a'-Y'Y'Y'-N_b'-Z'Z'Z'-N_a'n_q' 5' (Ilia) wherein each N_b and N_b' independently represents an oligonucleotide sequence comprising 1-5 modified nucléotides.
9. The RNAi agent of claim 1, wherein formula (III) is represented as formula (Illb):

sense: 5’ n_p-N_a-X X X -N_b-Y Y Y -Na-nq 3' antisense: 3' n_p'-N_a'-X'X'X'-N_b'-Y'Y'Y'-N₀'-n_q' 5’ (Illb) wherein each N_b and N_b' independently represents an oligonucleotide sequence comprising 1-5 modified nucléotides.
10. The RNAi agent claim 1, wherein formula (III) is represented as formula (IIIc):

sense: 5’ n_p-N_a-X X X -N_b-Y Y Y -N_b-Z Z Z -N_a-n_q 3’

158 antisense: 3' n_p'-N_a'-X'X'X'-N_b'-Y'Y'Y'-N_b'-Z'Z'Z'-N₀'-n_q' 5’ (IIIc) wherein each N_b and N_b' independently represents an oligonucleotide sequence comprising l-5 modified nucléotides and each N_a and N_a' independently represents an oligonucleotide sequence comprising 2-10 modified nucléotides.
11. The RNAi agent of claim 1, wherein the duplex région is 15-30 nucléotide pairs in length,
12. The RNAi agent of claim 11, wherein the duplex région is 17-23 nucléotide pairs in length.
13. The RNAi agent of claim 11, wherein the duplex région is 17-25 nucléotide pairs in length.
14. The RNAi agent of claim 11, wherein the duplex région is 23-27 nucléotide pairs in length.
15. The RNAi agent of claim 11, wherein the duplex région is 19-21 nucléotide pairs in length.
16. The RNAi agent of claim 13, wherein the duplex région is 21-23 nucléotide pairs in length.
17. The RNAi agent of claim 1, wherein each strand has 15-30 nucléotides.
18. The RNAi agent of claim 1, wherein the modifications on the nucléotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyI, and combinations thereof.
19. The RNAi agent of claim 18, wherein the modifications on the nucléotides are 2'-O-methyl,2'-fluoro or both.
20. The RNAi agent of claim 1, wherein the ligand is one or more GalNAc dérivatives attached through a bivalent or trivalent branched linker.

159
22. The RNAi agent of claim 1, wherein the ligand is attached to the 3’ end of the sense strand.

5
23. The RNAi agent of claim 22, wherein the RNAi agent is conjugated to the ligand as shown in the following schematic wherein X is O or S.

10 23a. The RNAi agent of claim 23, wherein the RNAi agent is conjugated to the ligand as shown in the following schematic

160
24. The RNAi agent of claim l further comprising at least one phosphorothioate or methylphosphonate intemucleotide linkage.
25. The RNAi agent of claim 24, wherein the phosphorothioate or

5 methylphosphonate intemucleotide linkage is at the 3’-terminal of one strand.
26. The RNAi agent of claim 25, wherein said strand is the antisense strand.
27. The RNAi agent of claim 25, wherein said strand is the sense strand.
28. The RNAi agent of claim l, wherein the base pair at the l position of the 5’-end of the antisense strand of the duplex is an AU base pair.

10
29. The RNAi agent of claim l, wherein the Y nucléotides contain a 2’-fluoro modification.
30. The RNAi agent of claim l, wherein the Y’ nucléotides contain a 2’-O-methyl modification.
31. The RNAi agent of claim 1, wherein p'>0.

15
32. The RNAi agent of claim 1, wherein p'=2.
33. The RNAi agent of claim 32, wherein q’=0, p=0, q=0, and p’ overhang nucléotides are complementary to the target mRNA.
34. The RNAi agent of claim 32, wherein q’=0, p=0, q=0, and p’ overhang nucléotides are non-complementary to the target mRNA.

161
35. The RNAi agent of claim 32, wherein the sense strand has a total of 21 nucléotides and the antisense strand has a total of 23 nucléotides.
36. The RNAi agent of any one of claims 31-35, wherein at least one np' is linked to a neighboring nucléotide via a phosphorothioate linkage.
37. The RNAi agent of claim 36, wherein ail np' are linked to neighboring nucléotides via phosphorothioate linkages.
38. The RNAi agent of claim 1 selected from the group of RNAi agents listed in Table 1.
39. The RNAi agent of claim 1 selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547.
40. The RNAi agent of claim 39, wherein the RNAi agent is AD-51547.
41. A cell containing the double stranded RNAi agent of any one of claims 1 to 40.
42. A pharmaceutical composition comprising an RNAi agent of any one of claims 1 to 40.
43. The pharmaceutical composition of claim 42, wherein RNAi agent is administered in an unbuffered solution.
44. The pharmaceutical composition of claim 43, wherein said unbuffered solution is saline or water.
45. The pharmaceutical composition of claim 42, wherein said siRNA is administered with a buffer solution.
46. The pharmaceutical composition of claim 45, wherein said buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

162
47. The pharmaceutical composition of claim 46, wherein said buffer solution is phosphate buffered saline (PBS).
48. The pharmaceutical composition of claim 42, wherein said pharmaceutical composition is a liposome.
49. The pharmaceutical composition of claim 42, wherein said pharmaceutical composition is a lipid formulation.
50. A method of inhibiting expression of a transthyretîn (TTR) in a cell comprising contacting said cell with an RNAi agent of any one of daims 1 to 40 or with a pharmaceutical composition of any one of daims 42 to 49 in an amount effective to inhibit expression of said TTR in said cell, thereby inhibiting expression of said transthyretîn (TTR) in said cell.
51. The method of claim 50, wherein expression of said TTR is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.
52. The method of claim 50, wherein said cell is contacted in vitro with said RNAi agent.
53. The method of claim 50, wherein said cell is présent within a subject.
54. The method of claim 53, wherein said subject is a human.
55. The method of claim 53, wherein said subject is suffering from a TTR-associated disease and said effective amount is a therapeutically effective amount.
56. The method of claim 53, wherein said subject is a subject at risk for developing a

TTR-associated disease and said effective amount is a prophylactically effective amount.
57. The method of claim 56, wherein said subject carries a TTR gene mutation that is associated with the development of a TTR-associated disease.

163
58. The method of claim 55 or 56, wherein said TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.
59. The method of claim 53, wherein said subject has a TTR-associated amyloidosis and said method reduces an amyloid TTR deposit in said subject.
60. The method of claim 53, wherein said RNAi agent is administered to said subject by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof.
61. The method of claim 53, wherein said RNAi agent is administered to said subject via subcutaneous, intramuscular or intravenous administration.
62. The method of claim 61, wherein said subcutaneous administration comprises administration via a subcutaneous pump or subcutaneous depot.
63. The method of claim 53, wherein said RNAi agent is administered to said subject, such that said RNAi agent is delivered to a spécifie site within said subject.
64. The method of claim 63, wherein said site is selected from the group consisting of liver, choroîd plexus, retina, and pancréas.
65. The method of claim 63, wherein said site is the liver,
66. The method of claim 63, wherein delivery of said RNAi agent is mediated by an asialoglycoprotein receptor (ASGP-R) présent in hépatocytes.
67. The method of claim 53, wherein said RNAi agent is administered at a dose of 0.05-50 mg/kg.
68. The method of claim 53, wherein said RNAi agent is administered in two or more doses.

164
69. The method of claim 68, wherein said RNAi agent is administered at intervals selected from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, and once every about 96 hours.
70. The method of claim 53, further comprising assessing the level of TTR mRNA expression or TTR protein expression in a sample derived from the subject.
71. The method of claim 53, wherein administering said RNAi agent does not resuit in an inflammatory response in said subject as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL 1 β, IL-lra, IL-6, IL-8, IP-10, MCP-1, ΜΙΡ-Ια, MIP-Ιβ, TNFa, and any combinations thereof, in a sample from said subject.
72. The method of claim 53, wherein said RNAi agent is administered using a pharmaceutical composition.
73. The method of claim 72, wherein said siRNA is administered in an unbuffered solution.
74. The method of claim 73, wherein said unbuffered solution is saline or water.
75. The method of claim 72, wherein said siRNA is administered with a buffer solution.
76. The method of claim 75, wherein said buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
77. The method of claim 76, wherein said buffer solution is phosphate buffered saline (PBS).
78. The method of claim 72, wherein said pharmaceutical composition is a liposome.

165
79. A method of treating or preventing a TTR-associated disease in a subject, comprising administering to said subject a therapeutically effective amount or a prophylactically effective amount of an RNAi agent of any one of daims 1 to 40 or a pharmaceutical composition of any one of daims 42 to 49, thereby treating or preventing said TTR-associated disease in said subject.
80. The method of claim 79, wherein TTR expression in a sample derived from said subject is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.
81. The method of claim 79, wherein said subject is a human.
82. The method of claim 79, wherein said subject is a subject suffering from a TTRassociated disease.
83. The method of daim 79, wherein said subject is a subject at risk for developing a TTR-associated disease.
84. The method of claim 79, wherein said subject carries a TTR gene mutation that is associated with the development of a TTR-associated disease.
85. The method of claim 79, wherein said TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.
86. The method of claim 79, wherein said subject has a TTR-associated amyloidosis and said method reduces an amyloid TTR deposit in said subject.
87. The method of claim 79, wherein said RNAi agent is administered to said subject by an administration means selected from the group consisting of subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof.

166
88. The method of claim 79, wherein said RNAi agent is administered to said subject via subcutaneous, intramuscular or intravenous administration.
89. The method of claim 88, wherein said subcutaneous administration comprises administration via a subcutaneous pump or subcutaneous depot.
90. The method of claim 79, wherein said RNAi agent is administered to said subject, such that said RNAi agent is delivered to a spécifie site within said subject.
91. The method of claim 90, wherein said site is selected from the group consisting of liver, choroid plexus, retina, and pancréas.
92. The method of claim 90 wherein said site is the liver.
93. The method of claim 90, wherein delivery of said RNAi agent is mediated by an asialoglycoprotein receptor (ASGP-R) présent in hépatocytes.
94. The method of claim 79, wherein said RNAi agent is administered at a dose of 0.05-50 mg/kg.
95. The method of claim 79, wherein said RNAi agent is administered in two or more doses.
96. The method of claim 95, wherein said RNAi agent is administered at intervals selected from the group consisting of once every about 12 hours, once every about 24 hours, once every about 48 hours, once every about 72 hours, and once every about 96 hours.
97. The method of claim 79, further comprising assessing the level of TTR mRNA expression or TTR protein expression in a sample derived from the subject.
98. The method of claim 79, wherein administering said RNAi agent does not resuit in an inflammatory response in said subject as assessed based on the level of a cytokine or chemokine selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12 (p70), IL1 β, IL-Ira, IL-6, IL-8, IP-10, MCP-1, ΜΙΡ-Ια, MIP-Ιβ, TNFa, and any combinations thereof, in a sample from said subject.

167
99. The method of claim 79, wherein said RNAi agent is administered using a pharmaceutical composition.
100. The method of claim 99, wherein said siRNA is administered in an unbuffered solution.
101. The method of claim 100, wherein said unbuffered solution is saline or water.
102. The method of claim 99, wherein said siRNA is administered with a buffer solution.
103. The method of claim 102, wherein said buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
104. The method of claim 103, wherein said buffer solution is phosphate buffered saline (PBS).
105. The method of claim 99, wherein said pharmaceutical composition is a liposome.
106. A method of inhibiting expression of transthyretin (TTR) in a cell, comprising contactîng said cell with a double stranded RNAi agent in an amount effective to inhibit expression of TTR in said cell, wherein said double stranded RNAi agent is selected from the group of RNAi agents listed in Table 1, thereby inhibiting expression of transthyretin (TTR) in said cell.
107. A method of inhibiting expression of transthyretin (TTR) in a cell, comprising contactîng said cell with a double stranded RNAi agent in an amount effective to inhibit expression of TTR in said cell, wherein said double stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby inhibiting expression of transthyretin (TTR) in said cell.
108. A method of inhibiting expression of transthyretin (TTR) in a cell, comprising contactîng said cell with a double stranded RNAi agent in an amount effective to inhibit expression of TTR in said cell, wherein said double stranded RNAi agent is AD-51547, thereby inhibiting expression of transthyretin (TTR) in said cell.

168
109. A method of treating or preventing a TTR-assocîated disease in a subject, comprising administering to said subject a therapeuticaliy effective amount or a prophylactically effective amount of a double stranded RNAi agent, wherein said double stranded RNAi agent is selected from the group of agents listed in Table 1, thereby treating or preventing a TTR-associated disease in said subject.
110. A method of treating or preventing a TTR-associated disease in a subject, comprising administering to said subject a therapeuticaliy effective amount or a prophylactically effective amount of a double stranded RNAi agent, wherein said double stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby treating or preventing a TTR-associated disease in said subject.
111. A method of treating or preventing a TTR-associated disease in a subject, comprising administering to said subject a therapeuticaliy effective amount or a prophylactically effective amount of a double stranded RNAi agent, wherein said double stranded RNAi agent is AD-51547, thereby treating or preventing a TTR-associated disease in said subject.
112. A kit for performing the method of claim 45, comprising

a) said RNAi agent, and

b) instructions for use.
113. A kit for performing the method of claim 73, comprising

a) said RNAi agent,

b) instructions for use, and

c) optionally, means for administering said RNAi agent to said subject.